NATURA
Qualifikationsphase
bearbeitet von
Horst Bickel
Anna Büntge
Inka Montero
Carsten Schmidt
Petra Stock
Lösungen
Ernst Klett Verlag
Stuttgart · Leipzig
DO01045455_Loesung_00.indd 1
14.04.2015 13:42:33
5 4 3 2 1
1. Auflage 1 | 19 18 17 16 15
Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden.
Die letzte Zahl bezeichnet das Jahr des Druckes.
Das Werk und seine Teile sind urheberrechtlich geschützt. Jede Nutzung in anderen als den gesetzlich
zugelassenen Fällen bedarf der vorherigen schriftlichen Einwilligung des Verlages.
Hinweis § 52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung eingescannt und in
ein Netzwerk eingestellt werden. Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen.
Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages.
© Ernst Klett Verlag GmbH, Stuttgart 2015. Alle Rechte vorbehalten. www.klett.de
Redaktion: Rolf Strecker
Mediengestaltung: Ingrid Walter
A15150-04545501
DO01045455_Loesung_00.indd 2
14.04.2015 13:42:33
Methoden
Modelle unterstützen die Forschung (Seite 15)
A1 Erläutern Sie anhand Abb. 6 den Vorgang der Modellierung am Beispiel der DNA-Strukturaufklärung.
– Die Daten der DNA wurden ausgewertet und führten zu Modellvorstellungen. An diesem Beispiel zeigt sich, dass auch Fehlinterpretationen zu Modellen führen die korrigiert und verändert werden (Pauling) oder sich bestätigen. Diese führte zu neuen Untersuchungen (Rosalind
Franklin), deren Daten zu veränderten Modellen führen. Die Planung neuer Experimente und
weiterer Ergebnisse müssen das Modell bestätigen.
A2 Beschreiben Sie den Kurvenverlauf in Abb. 7 und erläutern Sie die einzelnen Abschnitte 1 bis
4 unter dem Aspekt der Populationsgröße von Räubern und Beute an einem Beispiel.
– Bei diesen Modelldaten sind die Individuenzahlen gegen die Zeit aufgetragen. Die Kurvenverläufe der Beute- und Räuberindividuen verändert sich zeitlich verzögert. Der Anstieg der
Beutetiere führt mit einer zeitlichen Verzögerung zu einem Anstieg der Räuber (Phase 1 und 2).
Der Kurvenverlauf der Beutetiere sinkt mit zunehmender Räuberanzahl (Phase 3). In Phase 4
sinkt dann die Anzahl der Räuber ebenfalls. Dieser idealisierte Kurvenverlauf kann durch Simulationen entstehen. In natürlichen Systemen sind zusätzlich andere Faktoren vorhanden, welche
die Kurvenverläufe zusätzlich beeinflussen, sodass die Sinuskurve in ihrem Verlauf beeinträch­
tigt wäre.
A3 Beschreiben Sie die Daten in Abb. 8 und erläutern Sie, welche Bedeutung solche Modellrechnungen für das Verständnis der Evolution haben.
– In Abb. 8 sind Modelldaten zur Fitness unter verschiedenen Modellvorgaben dargestellt. Die
Verteilung und Veränderung von Allelen innerhalb von Populationen spielt eine entscheidende
Rolle bei der Fitness im Evolutionsprozess. Die Simulationen zeigen jedoch, dass im Idealfall
die Fitness bei beiden Voraussetzungen immer erreicht wird. Hier können Grundüberlegungen
Mechanismen erklären. Diese müssen jedoch in der Realität genauer angepasst werden, das
Modell muss überprüft werden.
3 Methoden
DO01045455_Loesung_00.indd 3
14.04.2015 13:42:33
1
Genetik
1. 1 Nucleinsäuren
DNA — ein geniales Speichermedium (Seite 21)
. A1 Die DNA im Vergleich mit modernen Speichermedien: Ein Nucleotid auf einem DNA-Strang
hat einen Informationsgehalt von 2 bit (= 0,25 byte), da es 22 = 4 Zustände (A, T, G bzw. C)
annehmen kann. Berechnen Sie den Informationsgehalt der DNA einer menschlichen Zelle.
Vergleichen Sie mit modernen Speichermedien (DVD oder USB-Stick). Berücksichtigen Sie
auch den Platzbedarf.
– Ein Basenpaar der DNA hat einen Informationsgehalt von 2 bit = 0,25 Byte. Die menschliche
DNA enthält rund 6 Milliarden Basenpaare. Damit ergeben sich 0,25 x 6 x 109 Byte = 1,5 Giga‑
byte. Auf eine DVD passt mit 4,7 Gigabyte mehr als die dreifache Datenmenge, allerdings bei
enormem Platzbedarf. Auch wenn z. B. Speichermedien immer kleiner bei größerem Speicher‑
volumen werden, ist der Platzbedarf eines Zellkerns noch nicht erreicht.
DNA-Replikation (Seite 22)
$ A1 Erläutern Sie den Vorteil der hohen Anzahl an AT-Basenpaaren im Bereich eines Origins.
– Zwischen aufeinander folgenden AT-Basenpaaren sind die Stapelkräfte der DNA verringert.
Zudem besteht eine AT-Basenpaarung jeweils aus nur zwei Wasserstoffbrückenbindungen.
Aufgrund der geringeren Anzahl an Wasserstoffbrücken und schwächeren Basenstapelkräften
kann der DNA-Doppelstrang von der Helicase hier leichter geöffnet werden.
PCR — DNA-Replikation im Reagenzglas (Seite 23)
$ A1 Vergleichen Sie die Polymerasekettenreaktion mit der DNA-Replikation in einer eukaryotischen Zelle.
– Die Auftrennung der DNA-Stränge erfolgt bei der PCR durch Temperaturerhöhung. Bei der
DNA-Replikation werden hierzu Enzyme verwendet (Helicase). Bei der PCR werden sowohl der
Leit- als auch der Folgestrang kontinuierlich synthetisiert. Bei der DNA-Replikation wird nur
der Leitstrang kontinuierlich synthetisiert. Die Synthese des Folgestrangs erfolgt in OkazakiFragmenten, die am Ende der Replikation zusammengefügt werden müssen.
Genau wie bei der DNA-Replikation sind zum Start der Synthese Primer erforderlich. Im
Gegensatz zur DNA-Replikation handelt es sich jedoch bei der PCR um DNA-Primer und nicht
um RNA-Primer. Folglich müssen diese auch am Ende nicht wieder herausgeschnitten werden.
Startpunkt und Endpunkt der Replikation werden durch spezifische Sequenzen auf der DNA
festgelegt. Bei der PCR wird der Beginn durch die Primer festgelegt und das Ende durch die
Temperaturerhöhung herbeigeführt.
Für beide Prozesse wird eine DNA-Polymerase verwendet, die nur in 3‘ — 5‘-Richtung arbeiten
kann. Im Gegensatz zu den DNA-Polymerasen aus Eukaryoten ist die bei der PCR verwendete
DNA-Polymerase hitzestabil.
Bei der DNA-Replikation steht am Ende eine Verdopplung des gesamten Genoms einer Zelle
eines Organismus. Das Endprodukt der PCR sind viele Kopien einer relativ kurzen spezifischen
DNA-Sequenz.
RNA — mehr als nur eine weitere Nucleinsäure (Seite 24)
0 A1 Recherchieren Sie ein Beispiel eines Ribozyms und beschreiben Sie seine Funktion.
– Eines der ersten Ribozyme, die entdeckt wurden, ist die RNase P – eine Ribonuclease. Sie ist an
der Bildung von t-RNA-Molekülen durch die Spaltung größerer t-RNA-Vorstufen beteiligt.
$ A2 Vergleichen Sie Ribozyme und Enzyme in ihrem Aufbau und ihrer Funktion.
– Ribozyme sind aus RNA-Nucleotiden aufgebaut. Durch Wechselwirkungen zwischen den
Nucleotiden (z. B. komplementäre Basenpaarung durch H-Brücken) können sie eine komplexe
dreidimensionale Struktur bilden (Sekundär-/ Tertiärstruktur).
Enzyme sind aus Aminosäuren aufgebaut. Auch sie können durch Wechselwirkungen zwischen
den Seitenketten der Aminosäuren eine komplexe dreidimensionale Struktur bilden (Sekun‑
där-/ Tertiärstruktur).
Ribozyme und Enzyme haben dieselbe Grundfunktion: Sie binden spezifisch Substrate, kataly‑
sieren eine spezifische Reaktion mit diesem Substrat und entlassen ein Produkt (verändertes
Substrat). Sie gehen aus dieser Reaktion unverbraucht hervor und können sie oft wiederholen.
4 Genetik
DO01045455_Loesung_01.indd 4
14.04.2015 13:51:38
Material: Nucleinsäuren (Seite 25)
. A1 Erläutern Sie die Schwierigkeiten bei der Entwicklung antiviraler Medikamente ohne Nebenwirkungen. Nehmen Sie Stellung zu der Aussage „Viren sind perfekte Tramper“.
– Viren bestehen meist nur aus Nucleinsäure und Proteinhülle. Sie nutzen den Zellstoffwechsel
und die enzymatische Maschinerie des Wirts. Medikamente, die ihre Vermehrung stoppen oder
verhindern sollen, können nur schlecht in den Stoffwechsel oder die Replikation eingreifen, da
sie auch unbefallene Zellen des Wirtes schädigen würden. Viruserkrankungen lassen sich derzeit am besten durch Impfungen potentieller Wirte bekämp‑
fen. Möglich könnte auch ein Angriff auf die spezifischen RNA-Polymerasen sein.
Tramper reisen mit leichtem Gepäck und unter Ausnutzung fremder Ressourcen über große Ent‑
fernungen. Die Aussage trifft zu, da Viren fast nur die Information ihrer Nucleinsäure mit sich
tragen und sich über die Ressourcen ihrer Wirte effektiv vermehren können.
. A2 Nennen Sie die drei möglichen Hypothesen von Hershey und Chase. Erläutern Sie die Schritte
des Experiments. Ergänzen Sie begründet die Schlussfolgerung.
– 1. Die Viren-Proteine sind entscheidend für die Vermehrung, enthalten also die nötigen Informationen.
2. Die Viren-DNA ist entscheidend für die Vermehrung, enthält also die nötigen Informationen.
3. Sowohl DNA als auch Proteine sind entscheidend für die Vermehrung. Beide enthalten also die nötigen Informationen.
Zunächst züchteten sie Bakteriophagen, die entweder eine radioaktiv markierte Proteinhülle
(durch den Einbau von radioaktiven Schwefelatomen) oder eine radioaktiv markierte DNA
(durch den Einbau von radioaktiven Phosphoratomen) besaßen. Diese ließen sie Bakterien
befallen. Durch Mixen und anschließendes Zentrifugieren gelang es ihnen, Proteine und DNA
voneinander zu trennen, ohne dass dabei die Bakterien beschädigt wurden. Bei den Phagen
mit markierter DNA fand sich die Radioaktivität am Boden des Probenröhrchens, bei denen mit
markierten Proteinen im Überstand.
Abschließend entnahmen sie Proben aus dem jeweiligen Bodensatz und beobachteten, ob die
Phagen sich vermehren konnten.
Da sich die Phagen in beiden Ansätzen erfolgreich vermehren konnten, obwohl die Proteine im
Überstand abgetrennt wurden, zeigt, dass allein die DNA für die Vermehrung nötig ist. Hershey
und Chase lieferten damit eine unabhängige Bestätigung der Ergebnisse 1944 von Avery, dass
die DNA die genetische Information enthält.
5 Genetik
DO01045455_Loesung_01.indd 5
14.04.2015 13:51:38
1. 2 Proteinbiosynthese
Die Entwicklung des Genbegriffs (Seite 26)
$ A1 Geben Sie an, welches Gen bei den in Abb. 1 dargestellten Neurospora-Mutanten jeweils
defekt ist und erläutern Sie die Entwicklung des Genbegriffs.
– Bei jeder Mangelmutante von Neurospora ist das Gen für ein bestimmtes Enzym defekt. Stellt
man der Mutante aber im Nährmedium den Stoff zur Verfügung, hat ihr Stoffwechsel wieder
alle benötigten Substanzen, vor allem das lebenswichtige Tryptophan zur Verfügung: Die Zellen
wachsen und vermehren sich wieder. Im ersten Fall kann Neurospora nur wachsen, wenn ihr
direkt Tryptophan zur Verfügung gestellt wird. Die Vorstufen dafür nützen nichts. Es kann also
hier der letzte Aufbauschritt zum Tryptophan nicht vollzogen werden, Das Enzym für die Kataly‑
se der Reaktion von Indol zu Tryptophan ist aufgrund der Veränderung in seinem Gen defekt. Im
zweiten Fall funktioniert dieser Schritt. Diese Mutante wächst auch, wenn Indol (oder direkt das
daraus gebildete Tryptophan) zur Verfügung steht. Indol selbst aber kann hier nicht syntheti‑
siert werden, das Enzym für die Reaktion von Anthranilsäure zu Indol ist defekt. Entsprechend
kann man von den anderen beiden Mutanten sagen, dass die dritte keine Antranilsäure, die
vierte keine Chorrisminsäure synthetisieren kann.
Die Entwicklung des Genbegriffs hängt mit dem Erkenntnisgewinn über Proteinfunktion und
Genexpression zusammen. Garrod stellte zunächst die Hypothese auf, dass ein Gen die gene‑
tische Information für den Bau eines Enzyms trägt. Dies bestätigten Beadle und Tatum in ihrem
Experiment über Mangelmutanten. Mit der Kenntnis darüber, dass nicht jedes Polypeptid ein
Enzym darstellt, entwickelte man die Ein-Gen-ein-Polypeptid-Hypothese. Mit den Erkenntnissen
über die Genexpression (z. B. alternatives Spleißen; r-RNA, si-RNA etc.) entwickelte man den
heutigen Genbegriff: Ein Gen ist ein DNA-Abschnitt, der für eine RNA codiert.
Material: Genwirkketten (Seite 27)
$ A1 Erläutern Sie das in der Abbildung dargestellte Versuchsergebnis.
– Alle 6 Bakterienstämme wachsen auf dem Vollmedium und auf dem Minimalmedium, dem
Arginin zugesetzt wurde. Auf dem Minimalmedium mit Ornithinzusatz wachsen 2 Stämme und
auf dem mit Citrullin 4 Bakterienstämme. Das Versuchsergebnis lässt darauf schließen, dass
Arginin von allen Bakterien benötigt wird. Zwei Stämme wachsen weder auf Ornithin noch
auf Arginin. Für diese Stämme ist Arginin ein lebenswichtiger Zusatz, da sie diesen Stoff nicht
selbst herstellen können. Die beiden Stämme, die auf Ornithin wachsen, wachsen ebenfalls auf
Citrullin, was darauf hinweist, dass sie Enzyme zur Weiterverarbeitung beider Stoffe besitzen. 2 Stämme wachsen nur auf Citrullin, nicht aber auf Ornithin. Ihnen fehlen die Enzyme zur Verar‑
beitung dieses Stoffes. So lässt sich schließen, dass Ornithin und Citrullin Zwischenprodukte auf
dem Syntheseweg des Arginin sind.
0 A2 Erklären Sie den Begriff „Mangelmutante“.
– Unter „Mangelmutanten“ versteht man Bakterien, die die Fähigkeit verloren haben, bestimmte
biochemische Synthesen durchzuführen. Dadurch können sie nur auf Nährmedien wachsen,
denen die Stoffe zugesetzt wurden, die sie nicht mehr selbst herstellen können.
0 A3 Nennen Sie Möglichkeiten, im Labor Mangelmutanten eines Bakteriums zu erkennen.
– Mangelmutanten lassen sich dadurch erkennen, dass sie auf Minimalnährmedien nicht wach‑
sen können. Durch Zugabe verschiedener Substanzen lässt sich erkennen, welcher Stoff von der
Mangelmutante nicht mehr selbst hergestellt werden kann. Gibt man Zwischenprodukte des
Syntheseweges hinzu, kann man genau erkennen, welches Enzym auf dem Stoffwechselweg des
Bakteriums durch die Mutation einen Defekt aufweist.
$ A4 Stellen Sie den Syntheseweg der Aminosäure Arginin in Form einer Genwirkkette dar.
– Vorstufe ® Ornithin ® Citrullin ® Arginin
Enzym 1
Enzym 2 Enzym 3
Gen 1
Gen 2
Gen 3
$ A5 Ordnen Sie die beschriebenen Krankheitsbilder Mutationen der Gene der Enzyme A, B, C
bzw. D zu. Begründen Sie.
– Mutation am Gen für Enzym A: Phenylketonurie; Anreicherung von Phenylalanin, Entstehung
von Phenylketon, da kein Abbau zu Tyrosin möglich;
Mutation am Gen für Enzym B: Albinismus; keine Bildung von Melanin möglich;
Mutation am Gen für Enzym C: Alkaptonurie; Anreicherung von Homogentinsinsäure und Oxida‑
tion zum Alkapton, da kein Abbau zu CO2 und H2O möglich;
Mutation am Gen für Enzym D: Kretinismus; keine Bildung von Thyroxin möglich.
6 Genetik
DO01045455_Loesung_01.indd 6
14.04.2015 13:51:38
0 A6 Bei den oben beschriebenen Stoffwechselerkrankungen handelt es sich um genetisch bedingte Krankheiten, die durch eine rezessive Anlage verursacht werden. Die Erkrankung tritt
nur auf, wenn beide homologen Chromosomen den Defekt aufweisen. Geben Sie dafür eine
Erklärung.
– Liegt eine rezessive Erkrankung vor, tragen beide homologen Chromosomen den Defekt, d. h.
der Organismus kann das Enzym nicht mehr herstellen. In diesem Fall tritt die Erkrankung auf.
Beim heterozygoten Genotyp kann das Enzym immer noch hergestellt werden.
$ A7 Neugeborene werden heute routinemäßig auf PKU untersucht. Beschreiben Sie eine mögliche Therapie im Falle eines positiven Tests.
– Bei positivem Ergebnis wird eine phenylalaninarme und thyrosinreiche Diät verabreicht, das
Gehirn entwickelt sich dann normal.
$ A8 PKU-Kranke fallen häufig durch eine besonders helle Haut, helle Haarfarbe und helle Augen
auf. Begründen Sie diese Symptome anhand des Phenylalaninstoffwechsels.
– PKU-Kranken fehlt das Enzym zur Synthese von Thyrosin aus Phenylalanin. Dadurch entsteht
bei PKU-Kranken ein Mangel an Thyrosin und allen daraus gebildeten Stoffen. Zu ihnen gehört
auch der Farbstoff Melanin, der für die Färbung der Haut, der Haare und der Iris des Auges
verantwortlich ist.
Transkription — der erste Schritt der Proteinbiosynthese (Seite 29)
0 A1 Geben Sie die m-RNA-Sequenz an, in die der folgende DNA-Abschnitt transkribiert wird.
3‘ TTGAGGCTAGATACCGAACCTTCT 5‘
– Die m-RNA lautet: 5‘ AACUCCGAUCUAUGGCUUGGAAGA 3‘
$ A2 Stellen Sie tabellarisch DNA-Replikation und Transkription gegenüber, indem Sie die biologische Bedeutung, den Zeitpunkt im Zellzyklus, die zugehörigen Vorlagen, die beteiligten
Enzyme sowie die verwendeten Nucleotide auflisten.
– biologische Bedeutung der DNA-Replikation: Kopieren von DNA vor der Zellteilung
biologische Bedeutung der Transkription: Transport der genetischen Information vom Zellkern
zu den Ribosomen
Zeitpunkt im Zellzyklus bei der DNA-Replikation: vor der Zellteilung (Synthese-Phase)
Zeitpunkt im Zellzyklus bei der Transkription: G1-Phase (Wachstumsphase) und G0-Phase (Dauerphase)
zugehörige Vorlagen bei der DNA-Replikation: beide DNA-Einzelstränge
zugehörige Vorlagen bei der Transkription: codogener DNA-Strang
verwendete Nucleotide bei der DNA-Replikation: A-, T-, C-, G-Nucleotide
verwendete Nucleotide bei der Transkription: A-, U-, C-, G-Nucleotide
Material: Die Erforschung der RNA (Seite 31)
0 A1 Beschreiben Sie kurz das Experiment in Abb. 1 und erläutern Sie die Bedeutung der kurzfris­
tigen Gabe von radioaktiv markiertem Uracil.
– Eukaryotischen Zellen wurde für einen kurzen Zeitraum radioaktiv markiertes Uracil angeboten
(Tracerexperiment). Anschließend wurde untersucht, wo die Markierungen in der Zelle zu finden
waren. Die Bedeutung der kurzfristigen Gabe von markiertem Uracil liegt darin, dass eine Ver‑
änderung innerhalb der Zelle gemessen werden kann, ansonsten käme es zu einer Anhäufung,
wodurch die räumliche Veränderung nicht mehr nachvollziehbar wäre.
$ A2 Erklären Sie anhand der in Abb. 1 dargestellten Versuchsergebnisse die unterschiedliche Verteilung des Tracers in der Zelle und übertragen Sie diese Aussagen auf das Schema in Abb. 3.
– Uracil ist ein Baustein der nur in der RNA vorkommt. Hierdurch konnte man nachweisen, dass
zuerst im Zellkern (Nucleus) viel Uracil zu finden ist, danach im Cytoplasma. Dies bedeutet, dass
RNA im Nucleus gebildet wird und anschließend ins Cytoplasma gelangt. Das wäre ein Hinweis,
dass die RNA die Informationen aus dem Nucleus ins Cytoplasma „transportiert“.
$ A3 Erläutern Sie mithilfe dieser Aussagen und der Informationen zur Entdeckungsgeschichte
der RNA, welche Fragestellungen mit diesen Experimenten beantwortet werden konnten.
– Die Vermutung, dass die Ribosomen immer spezifische Aufbauten der Proteine vorbestimmt
haben, konnte widerlegt werden, da die Zusammensetzung der RNA ständig wechselte und
relativ schnell „Informationen“ aus dem Nucleus ins Cytoplasma gelangten. Daher musste eine
zusätzliche RNA vorhanden sein, welche die Verbindung zwischen DNA und Ribosomen darstell‑
te. Diese wurde messenger-RNA genannt.
7 Genetik
DO01045455_Loesung_01.indd 7
14.04.2015 13:51:38
$ A4 Beschreiben Sie die Versuchsergebnisse in Abb. 2.
– In Abb. 2 sind die verschiedenen RNAs und deren Verteilung nach der Zentrifugation darge‑
stellt. Es wird sowohl die Gesamtmenge der RNA angegeben als auch die radioaktiv markierte
Menge. Man findet größere Mengen an Polysomen und einzelnen Ribosomen sowie t-RNA. Freie
m-RNA findet man nicht in großen Mengen. Bei der Markierung liegt der Schwerpunkt bei den
Polysomen und Ribosomen und der m-RNA, nicht bei der t-RNA.
$ A5 Erklären Sie die Messergebnisse in Verbindung mit der Versuchsdurchführung.
– Aus diesem Messergebnis wird deutlich, dass die Information kurzfristig über die m-RNA
umgesetzt wird, da diese kurzfristig für die Steuerung der Proteinbiosynthese neu aufgebaut
wird. Die m-RNA tritt mit den Ribosomen in Verbindung. Durch das Pulsexperiment konnte der
kurzfristige Vorgang deutlich werden, besonders von der freien zu gebundenen m-RNA.
$ A6 Erläutern Sie anhand des Textes zur Entdeckungsgeschichte der m-RNA, welcher Zusammenhang mit den Versuchen geklärt werden konnte.
– Es wurde die Vermittlung der Information von der DNA zum Ort der Proteinbiosynthese, den
Ribosomen, hierdurch erklärbar.
$ A7 Beschreiben Sie die Experimente mit Acetabulariazellen in Abb. 6. Nehmen Sie hierzu auch
die Informationen aus dem Text zur Hilfe.
– In Abb. 6 sind die Auftrennungsergebnisse von Proteinen verschiedener Acetabularia-Arten
mithilfe der Gelelektrophorese dargestellt. Es zeigen sich zwischen A. mediterranea und A. crenulata deutliche Unterschiede. Nach dem Tausch der Rhizoide mit dem jeweiligen Nucleus
zeigten sich die dementsprechenden Bandenmuster des dazugehörenden Nucleus.
$ A8 Erläutern Sie, welche Bedeutung diese Ergebnisse für die Hypothese zu den morphogenetischen Substanzen und der m-RNA haben.
– Da die Proteine dem jeweiligen Kern zugeordnet werden konnten, jedoch kurzfristig noch die
alte Hutform gebildet wurde, mussten neben den Proteinen noch andere Substanzen vorhanden
sein, die morphogenetischen Substanzen. Es waren also nicht nur der Nucleus und die neuen
Proteine entscheidend, sondern noch Substanzen des alten Nucleus. Da die m-RNA jedoch auch
nicht bei den Proteinen nachzuweisen ist, könnte sie diese Funktion beinhalten.
Der genetische Code (Seite 32)
0 A1 Übersetzen Sie die folgende m-RNA in eine Aminosäuresequenz.
5’ UUAGAUGAGCGACGAACCCCUAAAAUUUACCUAGUAGUAGCCAU 3‘
– Met-Ser-Asp-Glu-Pro-Leu-Lys-Phe-Thr-Stopp-Stopp-Stopp
0 A2 Übertragen Sie diesen Abschnitt eines codogenen DNA-Strangs in die entsprechende Aminosäuresequenz.
3’ CTGGCTACTGACCCGCTTCTTCTATC 5‘
– Die m-RNA lautet: 5‘GACCGAUGACUGGGCGAAGAAGAUAG3‘
Die Aminosäuresequenz lautet: Met-Thr-Gly-Arg-Arg-Arg-Stopp
$ A3 Lassen Sie den ersten Buchstaben im Beispielsatz „VORDERRNAISTDIEDNA“ weg und behalten den „Triplettcode“ bei, wird der Sinn des Satzes entstellt. Lassen Sie in der DNA-Sequenz
aus Aufgabe 2 ebenfalls die erste Base weg. Beschreiben Sie die Konsequenzen.
– Die m-RNA lautet: 5‘ACCGAUGACUGGGCGAAGAAGAUAG3‘
Durch die Verschiebung des Leserasters entfällt das Start-Codon AUG, es gibt kein Genprodukt.
8 Genetik
DO01045455_Loesung_01.indd 8
14.04.2015 13:51:39
Material: Die Entdeckung des genetischen Codes (Seite 33)
$ A1 Skizzieren Sie den Versuchsaufbau von Nirenberg und Lederer, mit dem der genetische Code
entschlüsselt wurde.
– s. Skizze
radioaktiv markiertes Phenylalanin
unmarkierte Aminosäuren
(alle außer Phenylalanin)
t-RNAMoleküle
m-RNA-Tripletts
der Sequenz UUU
Ribosomen
Nur die mit Phenylalanin beladene t-RNA bindet an die m-RNA und das
Ribosom.
Filtrieren
Ribosomen und die gebundene Phenylalanin-t-RNA bleiben auf
dem Filter zurück. Die übrigen t-RNAs gelangen ins Filtrat
Untersuchen auf
Radioaktivität
Ist der Filter radioaktiv, codiert das Triplett UCU für Phenylalanin.
0 A2 Aus den Versuchsergebnissen lässt sich den Tripletts UUU und UCU eine Bedeutung zuordnen. Nennen Sie diese.
– UUU codiert für die Aminosäure Phenylalanin (Phe), UCU für die Aminosäure Serin (Ser).
$ A3 Vor den Triplettbindungstests wurden alle m-RNA-Moleküle der Herkunftszellen entfernt.
Begründen Sie dieses Vorgehen.
– Die radioaktiv markierten Aminosäuren wären ansonsten bei der Translation der m-RNA-Mole‑
küle der Herkunftszelle in die Proteine eingebaut worden, die Radioaktivität hätte sich auf dem
Filter wiedergefunden, die Bedeutung der m-RNA-Moleküle bekannter Sequenz hätte sich nicht
aufklären lassen.
0 A4 Durch die Verwendung von Poly-U-, Poly-A-, Poly-C- und Poly-G-m-RNA-Sequenzen konnte
weiteren Tripletts eine Bedeutung zugeordnet werden. Nennen Sie die entsprechenden
Tripletts und ihre Bedeutung.
– Jede der vier eingesetzten m-RNAs wird in Proteine aus immer gleichen Aminosäuren übersetzt.
Die vier auftretenden Tripletts codieren die folgenden Aminosäuren: UUU = Phenylalanin; AAA = Lysin; CCC = Prolin; GGG = Glycin
$ A5 Verwendet man RNA, in der zwei Nucleotide abwechselnd vorkommen, erhält man Peptide,
in denen sich zwei Aminosäuren abwechseln. Erklären Sie dies. Kann man durch diese Versuche die Bedeutung weiterer Tripletts eindeutig klären?
– Wechseln sich in einer m-RNA zwei Nucleotide regelmäßig ab, ergeben sich je nach Translati‑
onsstart zwei verschiedene, sich abwechselnde Tripletts. Bei Poly-AC sind folgende Triplettmus­
ter möglich: ACA-CAC-ACA-CAC-… oder CAC-ACA-CAC-ACA-… Da sich mit Poly-AC ein Peptid
ergibt, in dem sich Threonin und Histidin abwechseln, kann man folgern, dass eines der beiden
Tripletts ACA oder CAC die Aminosäure Histidin codiert, das andere Threonin. Eindeutig klären
lässt sich die Bedeutung der Tripletts nicht.
$ A6 Verwendet man andere, regelmäßige Polynucleotide aus längeren Untereinheiten, erhält
man im Gemisch verschiedene Peptide (s. unten). Erläutern Sie, weshalb verschiedene Pep‑
tide gebildet werden. Ordnen Sie weiteren Tripletts eine Bedeutung zu.
– Je nach Start ergeben sich bei Poly-AAC drei verschiedene Triplettmuster: AAC-AAC-AAC-AAC-…,
ACA-ACA-ACA-ACA-… oder CAA-CAA-CAA-CAA-… Zunächst lässt sich nicht eindeutig folgern,
welches der drei Tripletts AAC, ACA und CAA die Aminosäuren Asparagin, Threonin bzw. Gluta‑
min codiert. Aus den Angaben zu Aufgabe 5 ist aber bekannt, dass das Triplett ACA die Ami‑
nosäuren Histidin oder Threonin codiert. Da hier nur Threonin auftritt, muss ACA für Threonin
stehen. Daraus ergibt sich, dass CAC der Aminosäure Histidin entspricht (s. Aufgabe 5). Welches
der beiden Tripletts AAC und CAA die Aminosäuren Asparagin bzw. Glutamin codiert, bleibt
zunächst unklar. Mit Poly-ACC ergeben sich die drei Triplettmuster: ACC-ACC-ACC-ACC-…, CCACCA-CCA-CCA-… oder CAC-CAC-CAC-CAC-… Da CAC der Aminosäure Histidin entspricht, müssen
die Tripletts ACC und CCA jeweils für eine der beiden Aminosäuren Threonin oder Prolin stehen.
9 Genetik
DO01045455_Loesung_01.indd 9
14.04.2015 13:51:39
$ A7 Es wurden ebenfalls Experimente mit vier regelmäßig wechselnden Nucleotiden durchgeführt (s. unten). Analysieren Sie das Versuchsergebnis.
– Mit Poly-ACCC ergeben sich folgende vier Triplettmuster: ACC-CAC-CCA-CCC-ACC-…, CCC-ACC-CAC-CCA-CCC-…, CCA-CCC-ACC-CAC-CCA-… oder CAC-CCA-CCC-ACC-CAC-…
Die vier möglichen Tripletts treten stets in derselben Reihenfolge auf. Daher wird ein Peptid
gebildet, in dem sich eine Sequenz aus vier Aminosäuren wiederholt. Da bekannt ist, dass das
Triplett CCC für Prolin und das Triplett CAC für Histidin steht, müssen die Tripletts ACC und CCA
jeweils eine der beiden Aminosäuren Threonin oder Prolin codieren. Das Triplett CCA liegt zwi‑
schen den Tripletts CAC und CCC. Zwischen Histidin und Prolin liegt im Peptid die Aminosäure
Prolin. Also steht das Triplett CCA ebenfalls für Prolin und ACC folglich für Threonin.
Translation — ein Protein entsteht (Seite 36)
$ A1 Das Codon AUG hat zwei verschiedene Bedeutungen, je nachdem ob es sich am Anfang einer
m-RNA befindet oder nicht. Begründen Sie.
– Als Startcodon markiert AUG auf einer m-RNA den Beginn der Translation, fungiert also als
„Satzzeichen“. Methionin ist demgemäß die erste Aminosäure eines Proteins, die aber meist bei
der Reifung von Proteinen wieder abgespalten wird. Innerhalb eines Proteins codiert das Codon
AUG lediglich für die Aminosäure Methionin.
0 A2 Ein Ausschnitt eines Peptids lautet: … Ser — Val — Lys — Met — Ala …
Geben Sie eine mögliche Sequenz der m-RNA und der codogenen DNA an.
– Eine mögliche Lösung wäre: m-RNA: 5’ UCU GUG AAA AUG GCU 3’
codogene DNA: 3’ AGA CAC TTT TAC CGA 5’
Vergleich der Proteinbiosynthese bei Pro- und Eukaryoten (Seite 39)
0 A1 Erläutern Sie, weshalb die Proteinsynthese bei Eukaryoten mehr Zeit erfordert.
– Bei eukaryotischen Zellen erfolgt die Transkription im Zellkern, die Translation im Zellplasma.
Der Ort der Transkription ist also, anders als bei den Prokaryoten, durch die Kernmembran vom
Ort der Translation getrennt. Die Translation kann demnach bei Eukaryoten erst beginnen,
wenn die Transkription mit dem Spleißen beendet und die fertige m-RNA durch die Kernporen in
das Cytoplasma gelangt ist.
Modellvorstellungen zur Genregulation bei Prokaryoten (Seite 40)
$ A1 Vergleichen Sie Substrat-Induktion und Endprodukt-Repression.
– Bei gleichem Grundaufbau (Repressor, Effektor, Operon aus Promotor, Operator und Struktur‑
genen) zeigen Substrat-Induktion und Endprodukt-Repression genau gegenteilige Zustände:
Während bei der Substrat-Induktion das Regulatorgen für einen aktiven Repressor codiert, der
durch Bindung des Effektors inaktiviert wird, codiert bei der Endprodukt-Repression das Regu‑
latorgen für einen inaktiven Repressor, der durch Bindung des Effektors erst aktiv wird. Beide
Male verhindert ein aktiver Repressor die Transkription der Strukturgene, ein inaktiver gibt sie
frei. Bei der Substrat-Induktion entstehen abbauende Enzyme, während bei der EndproduktRepression aufbauende Enzyme gebildet werden.
$ A2 Erläutern Sie die Aussage: Ein Effektor kann als Induktor oder als Co-Repressor wirken.
– Je nachdem, ob der Effektor den Repressor inaktiviert oder aktiviert, sorgt er als Induktor für
den Substratabbau (Substrat-Induktion) oder als Co-Repressor für den Baustopp des Endpro‑
dukts (Endprodukt-Repression).
Material: Genregulation bei Prokaryoten (Seite 41)
0 A1 Beschreiben Sie die Grafik.
– Zugabe der radioaktiven Aminosäuren erfolgt zeitlich vor der Zugabe des Substrats. Kurze Zeit
nach der Zugabe des Substrats sind die ersten Moleküle radioaktiv markierter ß-Galactosidase
festzustellen. Ihre relative Menge nimmt dann linear zu.
$ A2 Mit dem gezeigten Ergebnis konnte die Hypothese widerlegt werden. Erläutern Sie diese
Schlussfolgerung.
– Radioaktive ß-Galactosidase kann nur entstehen, indem neue Proteine mit den radioaktiven
Bausteinen (AS) gebildet werden. Der Zeitpunkt des Nachweises zeigt, dass der Proteinbau erst
nach der Substratzugabe erfolgt.
10 Genetik
DO01045455_Loesung_01.indd 10
14.04.2015 13:51:39
$ A3 Zeichnen Sie das zu erwartende Ergebnis, wenn die Hypothese richtig gewesen wäre.
– Wenn sich die Substrate mit bereits vorhandenen Vorläufer-Proteinen verbinden, um aktive
Enzyme zu erhalten, findet kein Neubau der Proteine statt. Es wäre keine radioaktive ß-Galacto‑
sidase nachweisbar.
$ A4 Erläutern Sie die zeitliche Verzögerung zwischen der Substratzugabe und dem ersten Auftreten radioaktiver b-Galactosidase.
– Nach der Substratzugabe wird etwas Zeit für die Vorgänge der Transkription und Translation
benötigt, bevor die ersten fertigen Proteine nachweisbar sind.
0 A5 Beschreiben Sie die vier Zustände des lac-Operons (Abb. 2) und geben Sie für jeden Zustand
an, ob Lactose und/oder Glucose vorhanden sind.
– 1: Operon aus; kein Repressor gebunden; kein CAP-c-AMP-Komlex gebunden; → Lactose und
Glucose sind vorhanden.
2: Operon aus; Repressor ist gebunden; kein CAP-c-AMP-Komlex gebunden; → keine Lactose
aber Glucose vorhanden.
3: Operon aus; Repressor ist gebunden; CAP-c-AMP-Komlex ist gebunden → weder Lactose noch
Glucose vorhanden.
4: Operon an (Transkription erfolgt); kein Repressor gebunden; CAP-c-AMP-Komlex ist gebun‑
den; RNA-Polymerase ist gebunden und transkribiert die lac-Gene → Lactose ist vorhanden,
Glucose nicht.
. A6 Nehmen Sie begründet Stellung zu folgender Aussage: Die Konzentrationsbestimmungen
von Lactose, Glucose, Glucose-Abbauprodukten, c-AMP und CAP lieferten den Forschern
wichtige Informationen bei der Entschlüsselung der doppelten Kontrolle des lac-Operons.
– Ich halte diese Aussage für richtig, da die Forscher durch die Konzentrationsmessungen sehen
konnten, dass nicht alle Konzentrationen hoch sein mussten, sondern eine Kombination unter‑
schiedlicher Konzentrationen nötig waren, damit die Transkription erfolgt.
. A7 Erstellen Sie Hypothesen, auf welchem Weg Medikamente in die doppelte Kontrolle des lacOperons eingreifen können.
– Medikamente können an vielen verschiedenen Stellen eingreifen. Sie können die Menge des
Repressors oder des Aktivators verändern, ihre Bindungseigenschaften ändern sowie die Bin‑
dungsstellen besetzen.
Modellvorstellungen zur Genregulation bei Eukaryoten (Seite 43)
0 A1 Fassen Sie die Möglichkeiten der Genregulation bei Eukaryoten auf den verschiedenen Ebenen (Transkriptionsebene, RNA-Prozessierungsebene, Translationsebene, Proteinaktivitäts­
ebene) in Form einer Tabelle zusammen.
– siehe Tabelle
Regulations­ebene
Mechanismus
Transkriptionsebene
Proteine (Transkriptionsfaktoren) binden an regulatorische DNASequenzen und aktivieren oder hemmen die Transkription.
RNA-Prozessierungsebene
alternatives Spleißen der m-RNA
Translationsebene
Abbau der m-RNA durch spezielle Enzyme
Proteinaktivitätsebene
Aktivierung bzw. Inaktivierung von Proteinen; Abbau von Proteinen
Epigenetik — Gene und Umwelt (Seite 45)
$ A1 Beschreiben Sie die unterschiedlichen epigenetischen Modifikationen am Beispiel der
Agouti-Maus.
– Das Beispiel der Agouti-Maus zeigt, wie der Aktivitätszustand eines Gens durch Umwelteinflüsse
(Ernährung) beeinflusst werden kann. Beim inaktiven Agouti-Gen liegt durch Methylierung der
DNA das Chromatin so stark komprimiert vor, dass die RNA-Polymerase blockiert wird und die
Transkription unterbleibt. Auch die freien Enden der Histone können methyliert werden und
so weitere Proteine aktivieren, die dann das Anheften der Polymerase und anderer Transkrip‑
tionsfaktoren blockieren (Silencing). Um das Agouti-Gen zu aktivieren, muss die Methylierung
rückgängig gemacht werden. Eine geringere Packungsdichte des Chromatins und eine damit
einhergehende Erhöhung der Transkriptionsrate wird dann zusätzlich durch die Acetylierung der
Histone erreicht.
11 Genetik
DO01045455_Loesung_01.indd 11
14.04.2015 13:51:39
. A2 Entwickeln Sie eine Hypothese hinsichtlich der Wirkung epigenetischer Medikamente zur
Krebstherapie.
– Die Medikamente müssten die epigenetischen Modifikationen beeinflussen können. Damit
könnten z. B. Tumorsuppressorgene aktiviert werden. Dies betrifft laut Abb. 4 insbesondere die
Demethylierung und Acetylierung der DNA, wodurch die Wechselwirkung der Histone mit der
DNA verändert wird. Die lockerere Wicklung sorgt dann für eine höhere Transkritionsrate bei
den Tumorsuppressorgenen. Entsprechend könnten auch Gene, die durch epigenetische Verän‑
derungen die Kontrolle über das Zellwachstum verloren haben, durch Einsatz von Methyltrans‑
ferasen, gezielt stillgelegt werden.
Material: Epigenetik (Seite 46)
0 A1 Vergleichen Sie die Veränderungen durch epigenetische Abweichung in Abb. 1 und ordnen
Sie die Methylierungsmuster begründet dreijährigen bzw. fünfzigjährigen eineiigen Zwillingen zu.
– Im Vergleich der Methylierungsmuster der eineiigen Zwillinge zeigen sich auffällige Unter‑
schiede. Bei dem Chromosomenpaar mit der starken Gelbfärbung sind die Methylierungsmuster
recht ähnlich. Das Maß an Hypo- bzw. Hypermethylierung ist annähernd identisch, d. h. dass
eine Expression gleicher Gene erfolgt. Dieses Muster kann man also dem dreijährigen Zwillings‑
paar zuordnen.
In dem anderen Chromosomenpaar überwiegen in jeweils anderen Bereichen der Chromosomen
die roten und grünen Signale. Hier liegen demzufolge mehr oder weniger ausgeprägte Methy‑
lierungen vor und so ergeben sich jeweils andere Muster. Da die Methylierung die Transkription
der Gene steuert und so deren Genexpression verändert, belegen verschiedenfarbige Bereiche
der angefärbten Chromosomen eine unterschiedliche Genexpression. Dieses Chromosomenpaar
lässt sich deshalb den fünfzigjährigen eineiigen Zwillingen zuordnen, bei denen sich aufgrund
des Alters über einen langen Zeitraum verschiedene Methylierungsmuster entwickeln.
. A2 Formulieren Sie eine Hypothese über die Ursachen der epigenetischen Abweichungen bei
eineiigen Zwillingen.
– Obwohl sie identische Gene besitzen, unterscheiden sich ältere eineiige Zwillinge manchmal
recht stark voneinander. Es ist zu vermuten, dass einige Abschnitte der Erbsubstanz bei einem
Zwilling aktiv und beim anderen inaktiv sind bzw. bestimmte Gene an- oder abgschaltet sind.
Die Ursache dafür sind epigenetische Veränderungen am Erbgut, die im Laufe des Lebens
entstehen und sich ausprägen. So können psychische und physische Krankheiten, Ernährungs‑
gewohnheiten, das Maß an körperlicher Aktivität, Stress und Rauchen zu unterschiedlichen
epigenetischen Mustern und damit zu unterschiedlichen phänotypischen Merkmalen führen.
0 A3 Beschreiben Sie den Einfluss des Gelée Royal auf die Entwicklung in einem Bienenstaat.
– Das fett- und eiweißreiche Gelée Royal hat einen direkten Einfluss auf die Entwicklung der Bie‑
nen und die Arbeitsteilung in einem Staat. Arbeiterbienen und die eierlegende Königin haben
zwar denselben Genotyp, die phänotypische Ausprägung ist jedoch unterschiedlich. Werden
Larven mit Gelée Royal gefüttert, so wachsen sie zu Königinnen heran, während die mit Pollen
und Honig gefütterten Bienenlarven zu Arbeiterinnen werden.
$ A4 Erläutern Sie anhand der Abb. 5 die Wirkung von Methyltransferase-Hemmer auf die Larven.
– Methyltransferase-Hemmer blockieren gezielt die Enzyme (Methyltransferasen), die für Methy‑
lierungen der DNA verantwortlich sind. Abb. 5 zeigt , dass bei der Kontrolle der prozentuale An‑
teil der Methylierung in der DNA der Bienenlarven hoch ist (80 %). Diese Larven entwickeln sich
dann zu Arbeiterinnen, während es deutlich weniger Bienen gibt, deren DNA einen geringeren
Grad an Methylierung aufweist und die damit bezogen auf diesen Parameter „königinnenähn‑
lich“ sind. Unter dem Einfluss eines Methyltransferase-Hemmers sind die Verhältnisse anders.
Das Enzym verhindert eine Übertragung von Methylgruppen, sodass nur etwa 25 % der Larven
zu Arbeiterinnen werden. Dagegen steigt der Anteil an Königinnen stark an. Die Methyltrans‑
ferasen sorgen demnach für ein gänzlich anderes Methylierungsmuster bei den Larven und
steuern damit die Entwicklung von Königinnen.
$ A5 Stellen Sie eine begründete Hypothese auf über die Zusammensetzung des Gelée Royal
hinsichtlich seiner epigenetischen Wirkung.
– Die Ernährung von Bienenlarven mit Gelée Royal ist für die Entwicklung der Bienenkönigin aus‑
schlaggebend und man kann diese Entwicklung auch durch den Einsatz von MethyltransferaseHemmern auslösen. So liegt die Vermutung nahe, dass sich im Gelée Royal auch Methyltrans‑
ferase-Hemmer befinden, deren Aktivität ein zur DNA der Arbeiterinnen unterschiedliches
Methylierungsmuster der Königinnen-DNA bewirkt.
12 Genetik
DO01045455_Loesung_01.indd 12
14.04.2015 13:51:39
$ A6 Ermitteln Sie, welche Folgen eine hohe Pheromonkonzentration für das Sammelverhalten
der Bienen hat.
– Pheromone, die von den älteren Sammelbienen abgegeben werden, signalisieren den Arbeiter‑
bienen, dass genügend Sammelbienen im Stock vorhanden sind und keine jüngeren Bienen zu
Sammlerinnen rekrutiert werden müssen.
Material: Genomische Prägung (Seite 47)
$ A1 Beschreiben Sie die genauen Vorgänge bei der Inaktivierung des X-Chromosoms und stellen
Sie die Kondensation des X-Chromosoms grafisch dar.
– Die starke Kondensierung des X-Chromosoms geht von einem bestimmten DNA-Bereich nahe
des Centromers aus, der sogenannten XIC-Region. Die dort lokalisierten Gene tragen die gene‑
tische Information für die XIST-RNA. Diese RNA-Moleküle binden flächendeckend am gesamten
Chromosom und legen dieses still. Außerdem bewirkt die XIST-RNA eine Methylierung der DNA
sowie eine Abspaltung der Acetylgruppen von den Histonen.
XIST-RNA
zunehmende
Kondensation
des Chromatids
aktives
X-Chromosom
inaktives
X-Chromosom
$ A2 Erläutern Sie die Weitergabe von Methylierungsmustern an Tochterzellen und erörtern Sie
den Begriff „Zellgedächtnis“ am Beispiel der Schildpattkatze.
– Während dem Wachstum und der Entwicklung von Organismen finden besonders viele Zelltei‑
lungen statt. Die damit zusammenhängenden Replikationen der DNA erfordern eine Dekonden‑
sation des X-Chromosoms der Schildpatt-Katze. Allerdings bleibt die Information darüber,
welches X-Chromosom nach der Replikation wieder inaktiviert werden soll, über alle nachfol‑
genden Generationen erhalten. Dies bezeichnet man als Zellgedächtnis. Die Methylierungsmu‑
ster der DNA gehen also während der Replikation nicht verloren.
Nach dem Grundsatz der semikonservativen Replikation besteht die DNA der Tochterzellen aus
einem methylierten Einzelstrang und einem Strang, der an den entsprechenden Stellen (vorwie‑
gend an der Base Cytosin) keine Methylgruppen trägt.
Bestimmte Enzyme, die sogenannten Erhaltungsmethylasen, erkennen das Muster und ergän‑
zen an den jeweiligen Stellen die Methylgruppe.
Da die Gene für die Fellfarbe bei Schildpatt-Katzen auf dem X-Chromosom lokalisiert sind und
in den Zellen jeweils nur ein X-Chromosom (aber nicht stets dasselbe) aktiv ist, kommt es zu
einer zufälligen Expression der Gene für die Fellfarbe — je nach dem, von welchem Elternteil
das jeweils aktive X-Chromosom stammt.
$ A3 Begründen Sie, inwiefern die Inaktivierung eines X-Chromosoms bei Säugetieren ein extremes Beispiel für epigenetische Vererbung darstellt.
– Epigenetische Veränderungen durch Methylierung oder Acetylierung betreffen in der Regel
bestimmte DNA-Abschnitte und beeinflussen damit die Expression einzelner dort lokalisierter
Gene. Bei der Inaktivierung eines X-Chromosoms ist jedoch ein ganzes Chromosom betroffen,
da durch Methylierung und Histondeacetylierung alle Gene eines Chromosoms ausgeschaltet
werden.
RNA-Interferenz und Gen-Silencing (Seite 49)
$ A1 Vergleichen Sie mi-RNA mit si-RNA.
– Beide sind doppelsträngige RNA-Moleküle mit einer Länge von ca. 20 bis 25 Nucleotiden
und beide erhalten ihre Länge durch Schneiden mit Dicer. mi-RNA wird als prä-mi-RNA durch
Transkription zelleigener DNA gebildet, paart sich komplementär, wird geschnitten und richtet
sich gegen zelleigene Gene. si-RNA entsteht durch Schneiden langer, doppelsträngiger RNA, die
zellfremd ist (z. B. viral). Richtet sich gegen zellfremde Gene.
13 Genetik
DO01045455_Loesung_01.indd 13
14.04.2015 13:51:39
$ A2 Erläutern Sie die Unterschiede zwischen der Regulation durch RISC und der durch Transkriptionsfaktoren.
– Regulation durch RISC = posttraskriptional, d. h. Transkription ist gelaufen, m-RNA vorhanden;
wird gesucht und zerstört (nur Hemmung möglich).
Regulation durch Transkriptionsfaktoren = transkriptional, d. h. Regulation erfolgt früher –
bereits auf der Ebene der Transkription; Enhancer beschleunigen die Transkription, Silencer
hemmen sie (beides möglich).
Mutationen (Seite 51)
0 A1 Begründen Sie, warum nicht alle Mutationen zum Nachteil des Trägers sein müssen.
– Zum einen führen nicht alle Mutationen zu einer Veränderung in der Struktur der Proteine,
da z. B. eine Basensubstitution aufgrund der Redundanz des genetischen Codes keine Auswir‑
kungen auf die Aminosäuresequenz haben muss (stumme Mutation). Zum anderen sind Mu‑
tationen notwendig, um ein gewisses Maß an Variation der Erbsubstanz zu ermöglichen, denn
Variationen der Gene können einer Spezies Überlebensvorteile verschaffen.
0 A2 Beschreiben Sie die Ursachen und Folgen der Sichelzellanämie.
– Bei der Sichelzellanämie liegt aufgrund einer Missense-Mutation (Substitution einer Base) und
demzufolge dem Austausch einer Aminosäure in der Peptidkette des ß-Globins ein verändertes
Hämoglobin vor (HbS). Das Sichelzell-Hämoglobin bildet unter Sauerstoffmangel und nach Sau‑
erstoffabgabe sogenannte Aggregate. Die Erythrocyten nehmen dann eine sichelartige Form
an, verklumpen in den Blutgefäßen und können so zu Verschlüssen/ Infarkten führen.
$ A3 Eine DNA-Sequenz im codogenen Strang sei gegeben: CGAAATAAGCTGTTC. Fügen Sie willkürlich jeweils zwei verschiedene Punktmutationen sowie eine Insertion und eine Deletion
ein und erläutern Sie die Auswirkungen auf die Aminosäuresequenz. Nehmen Sie dabei die
Codesonne zu Hilfe.
– z. B: codogener Strang ohne Mutation
CGAAATAAGCTGTCC
m-RNA
GCUUUAUUCGACAGG
AS-Sequenz Ala Leu Phe Asp Arg
Basenaustausch
CGATATAAGCTGTCC
m-RNA
GCUAUAUUCGACAGG
AS-Sequenz Ala Ile Phe Asp Arg
weitere individuelle Lösungen
$ A4 Erläutern Sie die Ursachen für die veränderte Aminosäuresequenz bei der b-Globin-Kette
(Abb. 4).
– Nach dem 7. Basentriplett in der abgebildeten Basensequenz kommt es zu einer zweifachen
Deletion — es fehlen im 8. Triplett zwei Thyminbasen. Es kommt zu einer Verschiebung des
Leserasters ab der Frameshift-Mutation und somit zur Veränderung der Aminosäuresequenz.
Material: Mondscheinkinder und schädliche UV-Strahlung (Seite 52/53)
$ A1 Erläutern Sie, welche Maßnahmen zum Lichtschutz bei einem XP-Patienten noch sinnvoll
sein könnten.
– • Tragen von langer Kleidung, die die sonnenexponierten Hautregionen komplett abdeckt und Tragen einer Sonnenbrille • getönte Fensterscheiben oder UV-abweisende Schutzfolie an Fenstern von Haus und Auto • Sonnencremes mit sehr hohem Lichtschutzfaktor (LSF 60)
0 A2 Vergleichen Sie die Wahrscheinlichkeit, an Hautkrebs zu erkranken, bei XP-Patienten und
Menschen ohne dieses Krankheitsbild (Abb. 2).
– Die Untersuchungsergebnisse zeigen eine signifikante (fast exponentielle) Zunahme der Haut‑
krebswahrscheinlichkeit „erst“ ab einem Alter von etwa 40 bis 50 Jahren bei Menschen ohne XP.
Die Ursache für Hautkrebs sind Mutationen, die vom Reparatursystem nicht behoben werden.
Im Allgemeinen ist mehr als eine Mutation nötig, um alle Veränderungen herbeizuführen, die
eine Krebszelle charakterisieren. Je älter man wird, desto mehr Mutationen häufen sich an und
desto höher wird die Wahrscheinlichkeit für Hautkrebs.
Bei XP-Patienten ist dieses Risiko bereits von Geburt an sehr hoch, da UV-Licht-induzierte DNASchäden nicht repariert werden können. Ab einem Alter von 20 Jahren bleibt das Risiko nahezu
gleich bei 100 %, da die irreversiblen Schäden in den Hautzellen sich kontinuierlich anhäufen.
14 Genetik
DO01045455_Loesung_01.indd 14
14.04.2015 13:51:39
$ A3 Formulieren Sie eine Hypothese über die Auswirkungen der Dimerbildung auf die DNA-Replikation.
– Thymin-Dimere führen zu einer Verformung der DNA, sodass die DNA-Polymerase die DNA an
dieser Stelle nicht mehr passieren kann. Die Replikation der DNA setzt daher aus und der gebil‑
dete Tochterstrang enthält entsprechend weniger Basen als der Mutterstrang .
$ A4 Nennen Sie das dem Reparatursystem der DNA zugrunde liegende Prinzip.
– Spezielle Enzyme erkennen Schäden in der DNA und können die schadhaften Stellen heraus‑
schneiden. Die Lücken werden nach dem Prinzip der komplementären Basenpaarung dann
mit den entsprechenden Basen wieder aufgefüllt. Eine andere Möglichkeit ist die Spaltung der
Thymin-Dimere in Einzelbausteine, die wieder zur komplementären Basenpaarung fähig sind.
$ A5 Erläutern Sie die Bedeutung von Reparaturmechanismen für den Organismus im Allgemeinen und die Excisionsreparatur im Besonderen.
– DNA-Reparaturmechanismen sind enzymatisch gesteuerte Prozesse, die Schäden der DNA
beseitigen und dadurch den reibungslosen Ablauf der Replikation und Transkription gewährleis­ ten. Sie sind dafür verantwortlich, dass sich Mutationen im Erbgut nicht anhäufen können.
Die Exzisionsreparatur erfolgt in Fällen, in denen falsche Basen eingebaut werden. Die
modifizierten Basen müssen entfernt und anschließend ersetzt werden. Diese Stellen werden
von speziellen Endonucleasen erkannt und zusammen mit benachbarten Nucleotiden heraus‑
geschnitten, sodass eine ca. 10 Basen lange Lücke entsteht, die durch die DNA-Polymerase I
aufgefüllt und von der DNA-Ligase wieder geschlossen wird. Der nicht betroffene Strang dient
dabei als Matrize.
$ A6 Beschreiben und erklären Sie die in Abb. 7 dargestellten Versuchsergebnisse.
– Die Versuche zeigen die Überlebensfähigkeit von E. coli-Zellen (Anteil lebender Zellen nach
UV-Bestrahlung) in Abhängigkeit von der Strahlendosis. Dabei erwies sich, dass der Wild‑
typ Bestrahlungen überlebt und der Anteil an lebenden Zellen erst ab einer vergleichsweise
hohen Dosis sinkt. Die UV-sensiblen Mutanten (uvr- und RecA-Mutante) dagegen reagieren
äußerst empfindlich; der Anteil an lebenden Zellen geht bereits bei niedrigen Strahlendosen
stark zurück, wobei die Entwicklung bei der RecA-Mutante noch deutlicher ist. Uvr und RecA
sind Reparatursysteme, die UV-induzierte Fehler in der Basensequenz der DNA erkennen und
reparieren. Bei den UV-sensiblen uvr-Mutanten kam es vermutlich zu einer Mutation in den uvrGenen kommen, die für verschiedene Untereinheiten einer Endonuclease codieren. Diese kann
daraufhin ihre Funktion, die DNA auf Fehler und Schäden zu kontrollieren, nicht mehr ausüben.
Die sich dadurch anhäufenden Schäden führen zu einem Absterben der Zellen. Beim Wildtyp
dagegen greifen die Reparatursysteme und so können die Zellen eine relativ hohe Strahlendosis
tolerieren.
$ A7 Erläutern Sie die Aussage: „Die Haut vergisst nichts.“
– Die Haut vergisst nichts, schon gar nicht einen Sonnenbrand. Oberflächlich betrachtet sieht es
zwar aus, als hätte sich die Haut nach einem ausgeheilten Sonnenbrand erholt. Aber tief im
Innern der Zellen der Ober- und Lederhaut zeigt sich, dass der Schaden, den die UV-Strahlung
in der DNA angerichtet hat, unwiderruflich ist. Wiederholen sich die Sonnenbrände und die
Wirkung lang anhaltender und intensiver Sonnenstrahlung häufiger, kumulieren und festigen
sich die Schäden in den Hautzellen, da das zelleigene Reparatursystem nicht alle Schäden be‑
heben kann. Die Folge ist im besten Fall vorzeitige Hautalterung — im schlimmsten Fall jedoch
Hautkrebs.
0 A8 Beschreiben Sie die Entwicklung der Krebsneuerkrankungen (Abb. 9) und stellen Sie Hypothesen über mögliche Ursachen auf.
– Die Zahl der Neuerkrankungen beim Schwarzen Hautkrebs ist in Deutschland im dem angege‑
benen Zeitraum von 2003 bis 2010 signifikant gestiegen (bei Frauen um ca. 2000 , bei Männern
in etwa um 3000 Fälle). Bis 2007 gab es bei Frauen deutlich mehr neue Fälle von Hautkrebs ,
seit 2008 überwiegt jedoch deren Anteil bei den Männern. Die Zunahme an Neuerkrankungen
ist dabei — unabhängig vom Geschlecht — seit 2007 besonders gravierend. Als mögliche Ursa‑
chen für den starken Anstieg sind folgendes Aspekte denkbar:
• starke und häufige Sonnenbrände in der Kindheit und Jugend
• mangelnde Sorgfalt beim Sonnenschutz
• häufiger und regelmäßiger Besuch von Sonnenbänken und Solarien, vor allem wenn die zuläs‑
sigen Grenzwerte für die UV-Strahlung überschritten werden
• Alterung der Gesellschaft (viele Fälle von Schwarzem Hautkrebs treten erst im Alter auf)
• kontinuierliche Belastung durch UV-Strahlung in Berufsgruppen mit nahezu ausschließlicher
Außentätigkeit (z.B. Landwirtschaft, Seefahrt, Fischerei, Straßenbau)
• verändertes Freizeitverhalten/ größere Mobilität: Urlaube werden ganzjährig in sonneninten‑
siven Regionen verbracht
15 Genetik
DO01045455_Loesung_01.indd 15
14.04.2015 13:51:40
$ A9 Begründen Sie, warum das Maligne Melanom häufig tödlich verläuft.
– Ein Malignes Melanom der Haut, auch Schwarzer Hautkrebs genannt, ist ein bösartiger
(maligner) Tumor, der aus Pigmentzellen der Haut entsteht. Diese Zellen entarten und wuchern
unkontrolliert. Das Maligne Melanom ist eine der gefährlichsten Krebsarten überhaupt, da es
trotz einer relativ geringen Größe bereits frühzeitig Tochtergeschwülste (Metastasen) in Lymph‑
knoten sowie anderen Organen bilden kann.
Proteom und Proteomforschung (Seite 54/55)
0 A1 Beschreiben Sie die verschiedenen Möglichkeiten der Veränderung des Proteoms im Laufe
der Entwicklung eines Organismus.
– Neben unterschiedlichen Aktivitätsmustern von Genen durch Aktivierung oder Stilllegung in
Form von Methylierungen oder Acetylierungen (oder Demethylierungen bzw. Deacetylierungen),
kommt es zu Veränderungen der m-RNA durch alternatives Spleißen und zu Veränderungen der
Polypeptide nach der Translation. Dabei können sich bestimmte Modifikationen in der Tertiär‑
struktur und komplexe chemische Bearbeitungen vollziehen, z. B. Bildung von Glykoproteinen
(Ausbildung von Signalstrukturen) oder Phosphorylierungen bzw. die Bindung an größere
Moleküle.
0 A2 Beschreiben Sie die genauen Arbeitsabläufe bei der Proteomanalyse.
– Zunächst werden aus Patientenproben, wie Gewebe oder Blut, Proteine extrahiert und das
Proteingemisch mit einer 2D-Gelelektrophorese aufgetrennt. In einem speziellen Kunststoffgel
erfolgt die Auftrennung nach Lage und Größe (in zwei Richtungen).
Es entsteht eine Proteomkarte, ein Muster von Flecken, das sowohl Art als auch Menge der
vorhandenen Proteine wiedergibt. Ein Fleck wird dann aus dem Gel herausgeschnitten und
durch Proteasen zerschnitten, sodass unterschiedliche große Proteinbruchstücke entstehen,
die für das jeweilige Protein spezifisch sind. Mithilfe der Massenspektrometrie lässt sich das
Gewicht der einzelnen im Gemisch der Probe enthaltenen Proteine feststellen und jedes Protein
eindeutig identifizieren.
. A3 Auch schon seit langem bekannte genetische Erkrankungen, wie z. B. das Down-Syndrom,
sind Gegenstand der Proteomforschung. Stellen Sie eine begründete Hypothese darüber auf,
wie sich die Trisomie 21 auf das Proteom der Betroffenen auswirken könnte.
– Da bei der Trisomie 21 das Chromosom 21 dreimal vorhanden ist, sollten auch die Proteine, die
durch die Gene auf diesem Chromosom codiert werden, vermehrt auftreten. Welche Proteine
das sind und in welchen Zellen sie exprimiert werden, könnte Rückschlüsse auf das konkrete
Krankheitsbild und den Grad der Down-Syndrom-Erkrankung geben.
16 Genetik
DO01045455_Loesung_01.indd 16
14.04.2015 13:51:40
1. 3 Humangenetik
Befruchtung und Meiose (Seite 57)
$ A1 Nennen Sie Gemeinsamkeiten und Unterschiede bei der Bildung weiblicher und männlicher
Keimzellen.
– männlich: Durch die Meiose entstehen vier gleich große, aber genetisch neu kombinierte
Spermazellen. Sie differenzieren sich zu Spermien (Spermienkopf mit Akrosom, Mittelstück,
Schwanzfaden).
weiblich: Durch die Meiose entsteht eine Eizelle, kleine Polkörperchen werden jeweils nach der
Meiose I und II abgeschnürt. Die Eizelle bildet mit verschiedenen Hilfszellen und Hüllen das Ei.
Die Meiose II wird erst nach dem Eindringen des Spermiums abgeschlossen.
$ A2 Stellen Sie die Vorgänge bei Mitose und Meiose in Form einer Tabelle einander gegenüber.
– Mitose:
• in teilungsfähigen Körperzellen (2n, 4C)
• dauert höchstens einige Stunden
• gegliedert in Prophase — Metaphase — Anaphase — Telophase
• Anaphase: Trennung der Chromatiden am Centromer
• Anzahl der Chromosomensätze bleibt gleich, DNA-Menge wird halbiert
• Tochterzellen sind genetisch gleich (2n, 2C) und ähnlich groß.
Meiose:
• in den Urkeimzellen der männlichen und weiblichen Keimdrüsen (2n, 4C)
• dauert einige Tage, Wochen oder Jahre, besteht aus zwei Teilungsschritten (Meiose I und
Meiose II)
• Prophase I (sehr lang) — Metaphase I — Anaphase I — Telophase I und Interkinese — Prophase II — Metaphase II — Anaphase II — Telophase II
• Prophase I: Paarung der homologen Chromosomen und Stückaustausch (Rekombination)
• Anaphase I: Trennung der homologen Chromosomen (1n, 2C) und anschließend zufallsgemäße
Verteilung auf die Pole (Rekombination)
• Anaphase II: Trennung der Chromatiden am Centromer (1n, 1C)
• Es entstehen genetisch neu kombinierte Tochterzellen.
Chromosomenmutationen (Seite 59)
0 A1 Beschreiben Sie die Ursachen von Monosomien und Trisomien.
– Monosomie und Trisomie sind die Folge einer Nondisjunction bei einem diploiden Organismus
während der ersten oder zweiten Teilung der Meiose, d. h einer Nicht-Trennung eines homologen
Chromosomenpaares mit der Folge, dass beide zu demselben Spindelpol wandern. Durch diesen
Verteilungsfehler entstehen Gameten mit einem überzähligen und einem fehlenden Chromosom
(Genommutation).
Nondisjunction
in der
2. meiotischen Teilung
Nondisjunction
in der
1. meiotischen Teilung
erste
meiotische
Teilung
Spermium
zweite
meiotische
Teilung
Gameten
Befruchtung
Zygote
Trisomie
17 Monosomie
Trisomie
Genetik
DO01045455_Loesung_01.indd 17
14.04.2015 13:51:40
$ A2 Eine Trisomie kann auf eine Nondisjunction in der Meiose I zurückgehen. Entwerfen Sie
analog zur Randspaltenabbildung (s. Seite 58) ein Schema.
– siehe Abbildung
���������������
���������������
Mukoviszidose — eine erblich bedingte Krankheit (Seite 60)
0 A1 Ermitteln Sie anhand von Abb. 1 die Art des genetischen Defekts.
– Bei dem vorliegenden genetischen Defekts (hier der sogenannte delta F508) handelt es sich
um eine Mutation. Es fehlen drei Basen, was zum Fehlen der Aminosäure Phenylalanin führt
(Deletion). Anders als bei Deletionen, bei denen nur eine Base fehlt, wird das nachfolgende
Leseraster jedoch nicht verändert, da eine komplette Aminosäure ausfällt.
. A2 Ermitteln Sie anhand von Abb. 2, wie die in Abb. 1 dargestellte Mutation des CFTR-Gens das
Membrankanalprotein verändert und welche physiologischen Ursachen der Entstehung des
zähen Schleims zugrunde liegen.
– Durch das Fehlen der Aminosäure Phenylalanin ist zu vermuten, dass sich die Struktur des
Proteins stark ändern wird. Die Tertiärstruktur wird sich insoweit ändern, dass es zu anderen
Wechselwirkungen zwischen den Aminosäuren kommt. Damit wird das Membrankanalprotein
in seiner Funktion stark beeinträchtigt oder verliert seine Funktion, das Chlorid aus dem Zell­
inneren herauszupumpen. Dieser Transportmechanismus sorgt im Normalfall für eine erhöhte
Chloridkonzentration an der Oberfläche der Schleimhäute. Wasser kann durch Diffusion die
Zellmembran passieren. Da die Chloridkonzentration an der Oberfläche dann größer ist als
im Zellinneren, wird mehr Wasser aus der Zelle austreten als in die Zelle eindringen. So wird
der zähflüssige Schleim verdünnt. Ist das CFTR-Kanalprotein bedingt durch die beschriebene
Mutation in seiner Funktion beeinträchtigt, laufen die osmotischen Prozesse nicht mehr ab. Der
Schleim bleibt zäh.
Stammbaumanalyse (Seite 61)
$ A1 Erklären Sie den Begriff „Hemizygotie“ an einem Beispiel.
– Bei Hemizygotie ist bei einem diploiden Individuum das Allel für die Blutgerinnungsstörung
(Hämophilie ) nur einmal vorhanden, da dieses Allel auf dem X-Chromosom liegt und auf dem
Y-Chromosom fehlt. Daher prägt sich ein Allel, das geschlechtsgebunden über das X-Chromosom
vererbt wird, bei männlichen Individuen phänotypisch aus.
18 Genetik
DO01045455_Loesung_01.indd 18
14.04.2015 13:51:41
Material: Stammbaumanalyse (Seite 62)
0 A1 Leiten Sei ab, was man unter polygenetisch vererbten Merkmalen versteht und recherchieren Sie Beispiele.
– Bei der polygenen Vererbung wirken mehrere verschiedene Gene zur Ausbildung eines Merk‑
mals zusammen. Beispiele dafür sind: Körpergröße, Gewicht, Pigmentierung (Haarfarbe, Haut‑
farbe, Fellfarbe bei Tieren) und mehrere Krankheiten (Asthma, Bluthochdruck).
$ A2 Erklären Sie, warum ein Elternpaar, das Merkmalsträger ist, ein Kind mit anderem Phänotyp
bekommen kann.
– Jedes Elternteil besitzt zwei Allele, die für die Ausbildung des Merkmals verantwortlich sind.
Wenn das Allel für ein bestimmtes Merkmal dominant ist, können die Elternteile bei gleichem
Phänotyp jeweils ein rezessives Allel besitzen. Die Eltern wären dann heterozygot. Erbt das Kind
von jedem Elternteil jeweils das rezessive Allel, bildet sich ein anderes Merkmal aus.
$ A3 Analysieren Sie mithilfe der Kriterien aus Abb. 1 den Stammbaum für erbliche Kurzfingrigkeit
und Rot-Grün-Sehschwäche.
– Erbliche Kurzfingrigkeit: Es handelt sich um einen autosomal-dominanten Erbgang.
• Kranke Eltern haben gesunde Kinder, Auftreten des Merkmals in jeder Generation, mindestens
ein Elternteil ist Merkmalsträger.
• Ein X-chromosomal-dominanter Erbgang ist auszuschließen, da in diesem Stammbaum kran‑
ke Väter auch kranke Söhne haben (Väter geben jedoch das unbetroffene Y-Chromosom an
ihre Söhne weiter).
Rot-Grün-Sehschwäche: Es handelt sich um einen X-chromosomal-rezessiven Erbgang.
• Das Merkmal tritt nicht in jeder Generation auf, merkmalsfreie Eltern haben phänotypisch
betroffene Kinder.
• Alle Merkmalsträger sind männlich, aufgrund der Hemizygotie prägt sich ein mutiertes Gen
auf einem X-Chromosom phänotypisch aus.
Material: Angewandte Stammbaumanalyse (Seite 63)
$ A1 Analysieren Sie den Stammbaum in Abb. 1 hinsichtlich des vorliegenden Vererbungsmodus
und bestimmen Sie die Genotypen der einzelnen Personen.
– Der Stammbaum in Abb. 1 zeigt den Erbgang zweier Merkmale (Rot-Grün-Blindheit und Hämo‑
philie), die über mehrere Generationen bei den dargestellten Personen in unterschiedlicher
Weise auftreten. Beide Merkmale werden gemeinsam X-chromosomal-rezessiv vererbt:
• Ein dominanter Erbgang lässt sich an Elternpaar 6 und 7 ausschließen: Um ein krankes Kind
zu bekommen, müssten beide Elternteile heterozygot oder ein Elternteil homozygot für die
betreffenden Merkmale sein. Dies ist nicht der Fall.
• Phänotypisch gesunde Eltern haben einen erkrankten Sohn (Pers. 4/5 mit Söhnen 5 und 7).
Da die Mutter Konduktorin ist und sie für beide Merkmale rezessiv ist, gibt sie das betroffene
X-Chromosom an ihre Söhne weiter. Diese prägen die Merkmale aufgrund der Hemizygotie
phänotypisch aus.
• An Rot-Grün-Blindheit und Hämophilie leidende Töchter tauchen in diesem Stammbaum nicht
auf; lediglich Konduktorinnen, die in Bezug auf die Merkmale heterozygot, aber phänotypisch
gesund sind.
– Legende für Genotypen: X = Allel für Farbensehen / Blutgerinnung, Xrh = Allel für Rot-Grün-Blindheit/ Hämophilie
Personen und ihre Genotypen Generation I 1: XrhY 2: XX
4: XY
5: XrhX 6: XY
7: XrhX 8:X Y
Generation II 1: XrhX 2: XrhY 3: XY
9: XrhX
3: XrhY 4: XrhY 5: XrhY 6: XY
7: XrhY 8: XX
Generation III 1: XrhY 2:XY
9: XrhY 10: XY 11: XX 12: XX
$ A2 Ordnen Sie dem vorliegenden Erbgang dem entsprechenden Chromosom in Abb. 2 zu und
begründen Sie Ihre Entscheidung.
– Die beiden Merkmale (Rot-Grün-Blindheit und Hämophilie) werden in dem vorliegenden
Stammbaum gemeinsam (gekoppelt) vererbt, da beide Gene an unterschiedlichen Orten auf
dem X-Chromosom liegen. Dies entspricht dem einfachen Chromosom in Abb. 2. Alle phäno‑
typisch kranken Söhne von Konduktorinnen, die das betreffende X-Chromosom an ihre Söhne
weitergeben, erhalten jeweils beide Gene.
19 Genetik
DO01045455_Loesung_01.indd 19
14.04.2015 13:51:41
$ A3 Untersuchen Sie den Stammbaum in Abb. 3. Stellen Sie eine Vermutung an, welcher Vererbungsmodus des Nagel-Patella-Syndroms vorliegt und begründen Sie Ihre Entscheidung
hinreichend.
– Das Nagel-Patella-Syndrom folgt einem autosomal-dominanten Erbgang.
• Das Merkmal tritt in jeder Generation und bei Frauen und Männern gleichermaßen auf.
• Mindestens ein Elternteil ist krank (hetero- oder homozygot für das Merkmal).
• Aus einer Verbindung mit einem phänotypisch kranken Partner gehen auch gesunde Kinder
hervor.
• Dass kranke Väter (Pers. 5 und 8 ) gesunde Töchter (19 und 21) haben, schließt einen X-chromosomalen Erbgang aus, da die Mütter jeweils homozygot gesund sind und die Väter in
jedem Fall das X-Chromosom mit dem mutierten Gen an ihre Töchter weitergeben.
. A4 Erklären Sie mithilfe der Abb. 3 das gleichzeitige Auftreten des Nagel-Patella-Syndroms mit
bestimmten Blutgruppenmerkmalen und stellen Sie eine begründete Hypothese über die
Fälle auf, bei denen es zu Abweichungen kommt (Personen 7, 10 und 16).
– Bis auf die Abweichung bei den Personen 7, 10 und 16 tritt das Gen für das Nagel-PatellaSyndrom bei allen Erkrankten immer in Verbindung mit der Blutgruppe B auf, die Gene für Blut‑
gruppe B und das Syndrom sind gekoppelt. Alle merkmalsfreien Söhne und Töchter des Paares 1
und 2 haben die Blutgruppe 0.
Bei den Personen 7, 10 und 16 treten abweichend davon andere Merkmalskombinationen auf.
Person 7 und 16 haben Blutgruppe B, sind jedoch nicht vom Nagel-Patella-Syndrom betroffen.
Person 10 ist in Bezug auf diese Krankheit Merkmalsträger, aber hat die Blutgruppe 0. Das
bedeutet, dass die Kopplung der Gene aufgehoben wurde und sich die Gene unabhängig vonei‑
nander vererbt haben.
. A5 Erläutern Sie in Bezug auf Abb. 2, inwiefern sich die Fälle der Personen 7, 10 und 16 mit den
Vorgängen während der Meiose I erklären lassen können.
– Person 10 mit Blutgruppe 0 und dem Nagel-Patella-Syndrom lässt sich damit erklären, dass
die zwei Gene durch Crossingover (Stückaustausch zwischen homologen Chromosomen, s. Abb. 2)
auf zwei verschiedenen Chromosomen zu liegen kommen. In der ersten Reifeteilung werden
die beiden betreffenden Chromosomen voneinander getrennt und so die Blutgruppe B nicht an
Person 10 (mit Blutgruppe 0 und Syndrom) vererbt. Ähnliche Prozesse der interchromosomalen
Rekombination liegen auch bei den Personen 7 und 16 vor. Es kommt also zu einem Kopplungs‑
bruch und einer Neukombination der Gene.
Molekulargenetische Verfahren — Elektrophorese und Sequenzierung (Seite 65)
$ A1 Geben Sie die entstehenden DNA-Fragmente im zweiten Ansatz von Abb. 4 an.
– Möglich sind die folgenden Fragmente:
GATG, GATGTAATCG oder GATGTAATCGA (falls kein ddGTP eingebaut wurde).
Hochdurchsatzsequenzierung (Seite 67)
0 A1 Erklären Sie, weshalb bei der Sequenzierung mit der Fluoreszenzmarkierung in Abb. 1 der
Detektor nicht am Gel entlang geführt werden muss.
– Die markierten Fragmente wandern durch das Gel und kommen nacheinander am Detektor
vorbei.
$ A2 Fassen Sie die Veränderung der DNA-Analyse seit Sanger kurz zusammen und erläutern Sie
die Bedeutung dieser technischen Entwicklung.
– Die Entwicklung der DNA-Analyse geht bei den verschiedenen Generationen zu einer stärkeren
Automatisierung, die durch die Fluoreszenzmarkierung und Detektoren ermöglicht wird. Die
Aufarbeitung der DNA-Fragmente wurde standardisiert und dadurch schneller. Die Nachweis‑
verfahren kommen gleichzeitig mit geringen Basenzahlen aus, sodass die Vervielfältigung der
DNA vor der Analyse entfällt.
Genomik — die Analyse des Genoms (Seite 69)
$ A1 Beschreiben und erklären Sie den Ablauf der Untersuchung zur Genexpression anhand von
Abb. 2 und anhand des Textes.
– Die Untersuchung der Genexpression erfolgt über Microarrays. Hier sind gezielt einsträngige
DNA-Fragmente als Sonden aufgebracht, die gezielt DNA-Abschnitte (Genabschnitte) binden.
Mithilfe von Fluoreszenzmarkern werden gebundene Abschnitte sichtbar gemacht. Gene werden
mithilfe von m-RNA (welche einem Genabschnitt entspricht) und dem Enzym Reverse Transkrip‑
tase in c-DNA umgewandelt und danach untersucht.
20 Genetik
DO01045455_Loesung_01.indd 20
14.04.2015 13:51:41
Genetischer Fingerabdruck (Seite 71)
$ A1 Erklären Sie, warum DNA-Bereiche, die für Proteine codieren, für den genetischen Finger‑
abdruck ungeeignet sind.
– Proteine können ihre Funktion nur dann erfüllen, wenn ihre Struktur dazu geeignet ist. In
Genen, die für Proteine codieren, sind daher wenig Mutationen möglich. Die DNA-Sequenzen in
Genen sind sich sehr ähnlich und bieten kaum individuelle Unterschiede. Sie sind daher für den
genetischen Fingerabdruck ungeeignet.
0 A2 Erklären Sie, warum die Sicherheit eines genetischen Fingerabdrucks mit der Anzahl der
untersuchten STRs steigt.
– Je mehr STRs untersucht werden, umso unwahrscheinlicher ist es, dass jemand genau die glei‑
che Kombination von Wiederholungen in allen untersuchten STRs aufweist.
$ A3 Analysieren Sie das Ergebnis des Vaterschaftstests (Auszug, siehe Randspalte).
– Der Vater ist V4. Die untere Bande der Analyse bei der Tochter findet man bei der Mutter, die
obere stimmt mit dem Test von V4 überein.
Künstliche Befruchtung (Seite 72)
. A1 Im Gegensatz zur Samenspende ist die Eizellspende in Deutschland verboten. Begründen
und bewerten Sie dieses Verbot (s Seite 10).
– Die Eizellspende ist in Deutschland verboten. Gesetzliche Grundlage ist das Embryonenschutz‑
gesetz vom Dezember 1990. Man will damit die Kommerzialisierung der Reproduktionsmedizin
und Leihmutterschaft verhindern. Der Gedanke dahinter ist aber vor allem, dass man verhin‑
dern will, dass ein Kind gewissermaßen zwei biologische Mütter hat: die Spenderin der Eizelle
und die Frau, die das Kind austrägt. Man befürchtet, dass diese gespaltene Mutterschaft zu
besonderen Schwierigkeiten bei der Selbstfindung des Kindes führt und negative Auswirkungen
auf die seelische Entwicklung hat, weil dieses entscheidend sowohl durch die von der gene‑
tischen Mutter stammenden Erbanlagen als auch durch die enge während der Schwangerschaft
bestehende Bindung zur austragenden Mutter geprägt wird. Bewertung: individuelle Lösung
Präimplantationsdiagnostik (Seite 73)
$ A1 In bestimmten Ländern gibt es Listen von Erkrankungen, bei denen eine PID gestattet ist.
Dabei werden z. B. folgende Erkrankungen genannt: Hämophilie, Mukoviszidose, MarfanSyndrom und Amylotrophe Lateralsklerose (ALS). Bilden Sie eine „Ethikkommission“ aus 4 — 5 Mitgliedern. Informieren Sie sich unter anderem in diesem oder anderen Lehrwerken
über die vier oben genannten Erkrankungen. Entscheiden Sie sich in Ihrer „Ethikkommission“, bei welcher dieser Erkrankungen eine PID zulässig sein sollte. Präsentieren Sie Ihr Ergebnis dem Kurs.
– individuelle Lösung
$ A2 Beurteilen Sie die PID als Methode der gezielten Zeugung eines sogenannten „Retterkindes“.
– Eltern haben ein lebensbedrohlich erkranktes Kind, das nur mit einer Transplantation von
Stammzellen gerettet werden könnte. Wenn kein lebender Familienteil als Spender in Frage
kommt und sich keine passende Fremdspende (Knochenmark) finden lässt, besteht die Möglich‑
keit der Erzeugung eines zweiten Kindes, das als Spender geeignet ist.
Der PID-Test wird in Verbindung mit einer In-vitro-Fertilisation durchgeführt. So kann ein „Ret‑
terkind” erzeugt und geboren werden.
Es stellen sich mehrere Fragen; zum einen danach, ob Eltern das Recht haben, ausschließlich
aus diesem Grund und auf diesem Weg ein weiteres Kind zu erzeugen. Zum anderen, ob es eine
Pflicht des „Retterkindes“ auf Knochenmark- oder Organspende gibt. Tatsächlich wird ein Retter‑
kind durch die Entscheidung der Eltern für diesen Schritt einbezogen, ohne gefragt zu werden.
Der Eingriff stellt einen Übergriff in die körperliche Integrität des Kindes dar.
Die Frage, ob dies ethisch vertretbar sei, hängt davon ab, ob das Retterkind durch den Eingriff
oder durch seine Folgen kurz- oder langfristig medizinisch und psychisch unangemessen belas­
tet wird. Es ist zu bedenken, dass das Retterkind einen Schaden erleiden kann, wenn es vom
Grund seiner Erzeugung erfährt. Eine weitere Problematik zeigt sich darin, ob und wie es damit
umgehen kann, wenn die Behandlung des Geschwisterkindes misslingt und dieses verstirbt. Diese Ausgangssituation für die PID ist insofern besonders, als das Kind, das zum Retterkind
wird, für diesen Zweck gezeugt und als Embryo ausgewählt wird. Dies stellt in gewisser Weise
eine Instrumentalisierung dar.
21 Genetik
DO01045455_Loesung_01.indd 21
14.04.2015 13:51:41
Die Eltern eines kranken Kindes, die keinen anderen Ausweg sehen, um ihrem kranken Kind zu
helfen, sehen die Situation vielleicht ganz anders. Sie möchten alles in ihrer Macht stehende
tun, um ihr Kind zu retten. Sie haben in einer solchen Situation eigentlich gar keine andere
Wahl als der Option „Retterkind” zuzustimmen, wenn sie Krankheit und Tod nicht als Schicksal
hinnehmen wollen. In dieser Situation sind die Eltern einem deutlich moralischen Druck ausge‑
setzt, die Technik in Anspruch zu nehmen.
Pränataldiagnostik (Seite 74)
0 A1 Vergleichen Sie die Methoden pränataler Diagnostik und benennen Sie mögliche Risiken.
– Die dargestellten Methoden finden zum einen zu unterschiedlichen Zeiten in der Schwanger‑
schaft statt. Mit einer Kanüle wird bei der Choriozottenbiopsie in der 11. bis 14. Schwanger‑
schaftswoche (SSW) durch die Bauchdecke Gewebe aus dem Mutterkuchen entnommen. Dieses
Verfahren erlaubt mit relativ großer Sicherheit die Diagnose von Chromosomenabweichungen.
Das Fehlgeburtsrisiko als Folge der Untersuchung ist hoch und liegt bei 0,5 bis 2 Prozent. Je
nach Aufbereitung der Zellen kann das Analyseergebnis nach 7 bzw. 21 Tagen mitgeteilt wer‑
den.
Die Amnionzentese wird von der 14. bis 20. Schwangerschaftswoche durchgeführt. Mit einer
Kanüle wird unter Ultraschallkontrolle Fruchtwasser durch die Bauchdecke entnommen. Auch
dieses Verfahren erlaubt mit relativ großer Sicherheit die Diagnose von Chromosomenabwei‑
chungen. Ergebnisse liegen erst nach zwei Wochen vor. Das Risiko, nach dem Eingriff eine
Fehlgeburt zu bekommen, ist stark abhängig von der Erfahrung des untersuchenden Arztes und
liegt zwischen 0,5 bis 1 Prozent. Bei der Nabelschnurblutpunktion wird ab der 18. Schwangerschaftswoche aus der Nabelschnur
kindliches Blut entnommen und die Zellen auf chromosomale Defekte untersucht. Das Fehlge‑
burtsrisiko ist hier noch höher: 1 bis 3 Prozent. Darüber hinaus besteht die Gefahr von Infekti‑
onen, Blutungen und Schmerzen bei der Schwangeren sowie Verletzungsrisiken beim Ungebore‑
nen.
Nicht-invasive pränatale Testverfahren (NIPT) (Seite 75)
$ A1 Behindertenverbände stehen dem neuen Verfahren kritisch gegenüber. Stellen Sie mögliche
Pro- und Contra-Argumente aus der Sicht der Behindertenverbände, aus der Sicht der betroffenen Frauen und aus gesellschaftlicher Sicht gegenüber. Nehmen Sie abschließend Stellung
zum Einsatz des nicht-invasiven pränatalen Testverfahrens.
– individuelle Lösung
$ A2 Diskutieren Sie die Meinungen: „Kein Hoffen ist frei von Bangen und kein Leben ist ohne
Risiko und „Eltern können kein Recht auf die Existenz gesunder Kinder geltend machen“.
– individuelle Lösung
Material: Genetische Beratung (Seite 76)
$ A1 Nennen Sie weitere mögliche Indikationen für eine genetische Beratung.
– • Entwicklungsverzögerung und Fehlbildungen bei Geschwisterkindern • familiäre Häufung von Krebserkrankungen • erbliche Stoffwechselerkrankungen, die in der Familie vorkommen
• Kinderlosigkeit
• Auffälligkeiten bei Ersttrimester-Screening oder beim Ultraschall • eine bevorstehende In-Vitro-Fertilisation • Belastung der Eltern durch Medikamente, Chemikalien, Strahlenbehandlung, die erbschädi-
gend sein könnten oder ähnliche Belastungen während einer bestehenden Schwangerschaft • hoher Verwandtschaftsgrad zwischen den potentiellen Eltern
$ A2 Formulieren Sie aus der Perspektive des Ehepaars Müller mögliche Fragen für ein genetisches Beratungsgespräch.
– • Wie hoch ist vor dem Hintergrund der Erkrankung eines Verwandten die Wahrscheinlichkeit, ein krankes Kind zu bekommen?
• Welche Möglichkeiten der Gendiagnostik bestehen für Herrn und Frau Müller und ihre Kinder?
• Wie werden die Gentests durchgeführt?
• Welche Möglichkeiten der (psychologischen) Unterstützung gibt es bei einem positiven Befund?
22 Genetik
DO01045455_Loesung_01.indd 22
14.04.2015 13:51:41
$ A3 Erarbeiten Sie auf der Basis des vorliegenden Materials Pro- und Contra-Argumente für
einen Gentest bei Herrn und Frau Müller und ihren Kindern.
– Pro:
• Recht auf Wissen/ informationelle Selbstbestimmung
• Ungewissheit kann psychisch stark belasten.
• Test gibt Aufschluss über das Erkrankungsrisiko bei allen Familienmitgliedern.
• Möglichkeit der frühzeitigen Planung der Lebensgestaltung und der medizinischen Behand‑
lung.
– Contra:
• Gewissensprobleme, den Kindern das Ergebnis mitzuteilen und sie damit extrem zu belasten.
• Recht auf Nichtwissen/ informationelle Selbstbestimmung.
• Gentest liefert keine Aussage über den genauen Erkrankungszeitpunkt sowie den Verlauf und
die Schwere der Erkrankung.
• Kosten der Untersuchung (Gentests sind sehr teuer).
• Ein positiver Befund verringert die Lebensqualität einer ganzen Familie über einen langen
Zeitraum.
$ A4 Diskutieren Sie, ob Sie an Stelle von Frau Müller den Gentest durchführen lassen würden
und das Testergebnis wissen wollen.
– individuelle Lösung
Material: Bewertung eines Fallbeispiels für die PID (Seite 77)
0 A1 Informieren Sie sich über die Krankheit Muskeldystrophie Typ Duchenne und beschreiben Sie
den Konflikt des Ehepaares Susanne und Martin S.
– Die häufigste Ursache für eine Muskeldystrophie (MD) im Kindes- und Jugendalter ist ein gene‑
tisch bedingtes Fehlen oder eine Funktionsänderung des Eiweißes Dystrophin. Die Muskeldys‑
trophie Duchenne (DMD) betrifft fast ausschließlich Jungen. Sie tritt mit einer Häufigkeit von
einem unter 3500 neugeborenen Knaben auf. In Deutschland leben 1500 bis 2000 Betroffene,
jährlich muss mit etwa 100 Neuerkrankungen gerechnet werden.
Der Gendefekt und die gestörte Dystrophinbildung sind schon bei der Geburt vorhanden. Bereits
zu diesem Zeitpunkt kann im Blut betroffener Knaben eine stark erhöhte Kreatinkinaseaktivität
festgestellt werden.
Erste Symptome sind: Verzögerung der grobmotorischen Entwicklung, verspätetes Laufen‑
lernen, sehr eingeschränkte motorische Fähigkeiten. Sobald die Jungen frei laufen, sind eine
auffällige Zunahme des Wadenumfangs und der „Watschelgang” ein charakteristisches Zeichen
der beginnenden Muskelschwäche. Bei Fortschreiten der Erkrankung sind bereits mindestens
40 % der Muskelfasern zerstört oder in ihrer Funktion beeinträchtigt. Hinzutretende Schwäche
von Bauch- und Rückenmuskulatur führt zu einem immer stärker werdenden Hohlkreuz, das
Becken kippt nach vorne. Die Gesichtsmuskulatur wird erst in späten Krankheitsstadien mit
erfasst. Dagegen werden die Muskeln, die den Kopf nach vorn beugen, schon früh schwach.
Ohne Behandlung werden die Jungen mit 8–12 Jahren gehunfähig. Sie sind dann zur Fortbewe‑
gung auf den Rollstuhl angewiesen. Danach kommt es in der Regel rasch zu Verbiegungen der
Wirbelsäule (Skoliose), und in der Folge zu einer Verformung des Brustkorbes. Eine Schwäche
auch der Atemmuskulatur wird deutlich und erschwert das Abhusten bei Infekten der Luftwege;
dadurch kann die Lebenserwartung erheblich eingeschränkt werden. Auch der Herzmuskel ist
häufig vom Krankheitsprozess betroffen, der vermutlich darauf beruht, dass auch im Hirngewe‑
be das dort normalerweise in etwas abgeänderter Form vorhandene Dystrophin fehlt. Damit
könnte auch die oft schon früh auffallende Sprachentwicklungsverzögerung zusammenhängen.
(übernommen aus: https://www.dgm.org/.../muskeldystrophie-duchenne-becker)
Da die Eltern bereits ein an Muskeldystrophie erkranktes Kind haben, dessen fortschreitendes
Leiden sie täglich erleben, möchten sie dieses nicht auch einem weiteren Kind zumuten. Die PID
würde ihnen Gewissheit darüber geben, ein gesundes Kind zu bekommen, bedeutet aber, dass
gezeugte Embryonen selektiert werden. Embryonen, die den Gendefekt aufweisen, wäre damit
die Chance auf Leben verwehrt.
$ A2 Nennen Sie mögliche Handlungsoptionen des Ehepaares. Erörtern Sie dies ein Gruppenoder Partnerarbeit mithilfe der Stellungnahmen.
– mögliche Handlungsoptionen:
• Durchführung einer PID, ggf. auch im Ausland
• Verzicht auf ein weiteres Kind
• Adoption eines Kindes
• Risiko einer Schwangerschaft ohne PID in dem Wissen, dass es eine 25%ige Wahrscheinlich‑
keit für einen weiteren kranken Sohn gibt
23 Genetik
DO01045455_Loesung_01.indd 23
14.04.2015 13:51:41
$ A3 Stellen Sie anhand der Stellungnahmen die Pro- und Contra-Argumente bzgl. der Zulassung
der PID tabellarisch gegenüber.
– Pro:
• Paaren mit Kinderwunsch, aber hohen genetischen Risiken, darf der Wunsch nach einem
gesunden Kind nicht verwehrt werden; andernfalls gäbe es nur die Möglichkeit des Verzichts
auf ein Kind oder einer PND mit der Option eines Schwangerschaftsabbruchs.
• Wertungswiderspruch: Pränatale Diagnostik mit möglicher Folge des Schwangerschafts‑
abbruchs erlaubt, Diagnostik vor der Schwangerschaft aber verboten.
• Es gibt keine generelle Garantie für ein gesundes Kind, aber ein Garantie, dass das Kind nicht
an der schweren genetischen Erkrankung leidet, für die familiär ein hohes Risiko besteht.
• Screening-out und Choosing-in als Möglichkeiten reproduktiver Selbstbestimmung
– Contra:
• Nicht alle genetisch bedingten Entwicklungsstörungen lassen sich feststellen.
• Selektion und Verwerfung von Embryonen.
• Eltern und Ärzte dürfen nicht gezwungen werden, zwischen lebenswertem und nicht lebens‑
wertem Leben zu entscheiden.
• Auch ein behindertes Kind hat ein Recht auf Leben.
• Widerspricht u.a. dem Schutzbedürfnis derer, die ihren Willen noch nicht äußern können.
• Medizin kann kein gesundes Kind garantieren.
• PID diskriminiert Menschen mit Behinderungen.
$ A4 Diskutieren Sie in Partnerarbeit die vorliegenden Positionen zur PID und nehmen Sie Stellung zu dem Konflikt.
– individuelle Lösung
24 Genetik
DO01045455_Loesung_01.indd 24
14.04.2015 13:51:41
1. 4 Entwicklung
Differenzierung und Entwicklung (Seite 79)
$ A1 Erläutern Sie an den in Abbildung 1 dargestellten Zellen den Zusammenhang von Struktur
und Funktion.
– Bei allen differenzierten Zellen findet man Strukturen, die eine Angepasstheit an die Funktion
darstellen. Eizelle: großer Vorrat an Nährstoffen; Knorpelzelle: große Oberfläche zur Stofffabla‑
gerung; Knochenzelle: große Oberfläche; glatte Muskelzelle: langgestreckt und innerer Aufbau;
Spermienzelle: Beweglichkeit; Epithelzelle: Oberflächenvergrößerung; Bindegewebszelle: Fort‑
sätze zur Verankerung
$ A2 Beschreiben Sie ein Experiment, mit dem man überprüfen könnte, ob Retinsäure die Flügeldifferenzierung hervorruft (Abb. 2).
– Retinsäure könnte in ein Gewebe des Embryos injiziert werden, aus dem normalerweise keine
Flügel entstehen. Die in der Polarisierungszone vorhandene Retinsäure könnte chemisch so
verändert werden, dass sie unwirksam wird.
$ A3 Erstellen Sie ein Flussdiagramm, das die Hierarchie der Genaktivierungen bei der Entwicklung einer Drosophilalarve veranschaulicht.
– Bicoid-Gen → Transkription der Bicoid-m-RNA → Translation des Bicoid-Proteins → Konzentra‑
tionsgradient des Bicoid-Proteins → Aktivierung von drei Gruppen von Segmentierungsgenen
→ Genprodukte wirken als Transkriptionsfaktoren → Aktivierung von Genen in der Musterbil‑
dungskaskade (homeotische Gene)
$ A4 Mutationen im Bicoid-Gen wirken sich erst in der Nachfolgegeneration aus. Begründen Sie.
– Da die Bicoid-m-RNA von der Mutter erzeugt und in die befruchtete Eizelle eingeschleust wird,
führen Mutationen im mütterlichen Bicoid-Gen zu Entwicklungsstörungen des Eies, also der
folgenden Generation.
Eigenschaften embryonaler und adulter Stammzellen (Seite 81)
0 A1 Fassen Sie die Vorteile der Verwendung von induzierten pluripotenten Stammzellen gegen­
über der von embryonalen Stammzellen zusammen.
– Vorteil aus ethischer Sicht: Keine Verwendung von Embryonen, damit wird die Verwendung von
Stammzellen auch bei Anwendung des Embryonenschutzgesetzes möglich. Vorteil aus immuno‑
logischer Sicht: Induzierte Stammzellen stammen vom Erkrankten selbst und lösen daher keine
Abstoßungsreaktion aus.
$ A2 Recherchieren Sie im Internet zur Möglichkeit der Entnahme von Nabelschnurblut.
– Im Internet findet man viele Anbieter, die die Entnahme und Lagerung von Nabelschnurblut
anbieten. Dies ist häufig mit hohen Kosten verbunden. Eine Nabelschnurblutentnahme ist dann
kostenlos, wenn sie einer Nabelschnurblutbank zur Verfügung gestellt wird. Auf den Seiten des Roten Kreuzes oder der Krankenkassen findet man jedoch auch kritische
Stimmen, die den Nutzen einer Individualspende anzweifeln. Eine Spende für eine Nabelschnur‑
blutbank ist jedoch in jedem Fall sinnvoll.
Krebs — Fehler in der Informationsübertragung (Seite 83)
0 A1 Erläutern Sie, inwiefern es sich bei Krebs um eine genetisch bedingte Erkrankung handelt.
– An der Entstehung von Krebs sind komplexe genetische Faktoren beteiligt. Wachstumsregu‑
lierende Gene wie die Proto-Onkogene und die Tumorsuppressorgene steuern Häufigkeit und
Zeitpunkt der Zellteilungen. Versagt die Regulation der Zellen durch dieses Gene und deren
Produkte infolge von Mutationen, teilen sich Zellen in einem Gewebe zu schnell und unkontrol‑
liert und es bilden sich Tumore.
$ A2 Erörtern Sie die Bedeutung der Proteine Ras und P53 für die Regulation des Zellwachstums
und die Folgen einer Mutation der codierenden Gene.
– Das vom Ras-Proto-Onkogen codierte Ras-Protein ist Bestandteil einer zelleigenen Signalkette,
die Zellteilungen fördert und wird durch spezifische Wachstumsfaktoren aus Nachbarzellen
kontrolliert. Das vom Tumorsuppressorgen p53 codiert für das p53-Protein, der als Transkripti‑
onsfaktor ein Gen aktiviert, dessen Genprodukt wiederum den Zellzyklus vorübergehend stoppt,
damit DNA-Schäden repariert werden können. Bei gravierenden Schäden wird die Apoptose
eingeleitet. Mutationen in diesen wichtigen Genen führen zu unkontrollierten unablässigen
Zellteilungen, ohne dass eine Differenzierung erfolgt. Ein durch Mutation verändertes p53Protein kann beispielsweise den Zellzyklus nicht mehr anhalten, woraufhin es zu schnellerem
Zellwachstum kommt, ohne dass Schäden in der DNA behoben werden können.
Ein verändertes Ras-Protein verursacht demgegenüber eine übermäßige Zellteilung, auch ohne
dass Wachstumsfaktoren von außen an die entsprechenden Rezeptoren binden.
25 Genetik
DO01045455_Loesung_01.indd 25
14.04.2015 13:51:42
. A3 Stellen Sie in einem Schema einer Zelle übersichtlich dar, auf welchen Ebenen die Zellzykluskontrolle mutationsbedingt versagen kann.
– Proto-Onkogen codiert für Wachtstumsfaktor: Bei Krebs führen Mutationen zu einer Überproduktion des Wachstumsfaktors.
Proto-Onkogen codiert für einen Rezeptor eines Wachstumsfaktors: Bei Krebs wird vom Rezeptor das Signal zur Zellteilung auch dann ins Zellinnere geleitet, wenn
gar kein Wachstumsfaktor gebunden hat.
Proto-Onkogen codiert für das Ras-Protein:
Bei Krebs entsteht durch eine Mutation im Ras-Proto-Onkogen ein verändertes Ras-Protein, das
ohne Wachstumssignale von außen eine übermäßige Zellteilung verursacht.
Proto-Onkogen codiert für einen Transkriptionsfaktor: Bei Krebs können Transkriptionsfaktoren ohne Aktivierung in den Zellkern wandern und dort
Gene für die Zellteilung aktivieren.
siehe Abbildung
Proto-Onkogen codiert für Wachstumsfaktor:
Bei Krebs führen Mutationen zu einer Überproduktion des Wachstumsfakors.
Wachstumsfaktor
Rezeptor für
Wachstumsfaktor
Signalmoleküle
Proto-Onkogen codiert für einen Rezeptor eines
Wachstumsfakors: Bei Krebs wird vom Rezeptor
das Signal zur Zellteilung auch dann ins Zellinnere geleitet, wenn gar kein Wachstumsfaktor
gebunden hat.
Proto-Onkogen codiert für das ras-Protein:
Bei Krebs entsteht durch eine Mutation im
Ras-Proto-Onkogen ein verändertes ras-Protein,
das ohne Wachstumssignale von außen eine
übermäßige Zellteilung verursacht.
Transkriptionsfaktor
inaktiv
aktiv
Proto-Onkogen codiert für einen Transkriptionsfakor: Bei Krebs können Transkriptionsfaktoren
ohne Aktivierung in den Zellkern wandern und
dort Gene für die Zellteilung aktivieren.
Altern (Seite 84)
0 A1 Beschreiben Sie anhand der Abb. 2 die Funktion der Telomerase.
– Die Telomerase, die aus Proteinkomponenten und RNA besteht, kann Zellen unbegrenzt tei‑
lungsfähig halten. Die RNA dient als Matrize. Nach dem Prinzip der komplementären Basen‑
paarung werden Nucleotide an die bestehende Telomer-DNA angehängt und diese damit weiter
aufgebaut.
$ A2 Erläutern Sie, inwiefern das Klonschaf Dolly die Telomer-Hypothese unterstützt.
– Dolly wurde aus einer Körperzelle eines fünfjährigen Spenderschafs geklont, also aus einer
Zelle, deren Telomereinheiten bereits verringert waren. Dies führte dazu, dass Dolly schon nach
sechs Jahren Alterserscheinungen zeigte, da der Alterungsprozess in ihren Zellen bereits einge‑
setzt hatte, als Dolly geboren wurde.
$ A3 Beschreiben Sie den Einfluss freier Radikale auf den Prozess des Alterns.
– Freie Radikale bilden sich durch Tabakrauch, UV-Strahlung und können auch während der Atmungskette in den Mitochondrien entstehen. Hier schädigen sie die mitochondriale DNA
sowie die Lipide in der Mitochondrienmembran und die Enzyme. Die mt-DNA besitzt keine
Reparaturmechanismen, sodass sich Fehler, die durch die freien Radikale verursacht werden,
anhäufen. Dies lässt Zellen altern und absterben.
Material: Zelltod (Seite 85)
0 A1 Vergleichen Sie Apoptose und Nekrose in Form einer Tabelle (Abb. 1).
– siehe Tabelle
26 Nekrose
Apoptose
Zellschwellung
Zellschrumpfung
ausgelöst durch Verletzung
programmierter Zelltod
Zerstörung der Struktur der Organellen
Erhalt der Struktur der Organellen
DNA wird zerstört.
DNA zerfällt in gleichmäßige Fragmente.
Auslaufen der Zelle führt zu Entzündungen.
Zellbestandteile sind von Membranen umgeben und
werden von Phagocyten vernichtet.
Genetik
DO01045455_Loesung_01.indd 26
14.04.2015 13:51:42
0 A2 Stellen Sie den Ablauf der Apoptose 1 + 2 in einem Flussdiagramm dar.
– Typ 1: Todesfaktor bindet an Todesrezeptor → Aktivierung der Caspase 8 → Caspase 8 aktiviert
Caspase 3 → Caspase 3 sorgt für die Zerstörung von Prote­inen in der Zelle
Typ 2: Mitochondrien setzen Cytochrom c frei → Cytochrom c aktiviert Caspase 3 → Caspase 3
sorgt für die Zerstörung von Prote­inen in der Zelle
$ A3 Das Protein p53 sorgt in gesunden Zellen dafür, dass bei Schädigungen der DNA von den
Zellen Cytochrom c ausgeschüttet wird. Bei vielen Krebszellen ist das Gen für p53 defekt.
Beschreiben Sie die Auswirkungen.
– p53 sorgt in gesunden Zellen dafür, dass bei einer Schädigung der DNA Cytochrom c ausge‑
schüttet wird. Dies führt zu einer Aktivierung der Caspase 3 und damit zu einer Zerstörung von
zelleigenen Proteinen, was zum Tod der Zelle führt. Fehlt p53, so führen Schäden an der DNA
nicht zu einem Tod der Zelle. Die geschädigte Zelle kann sich weiter teilen und die geschädigte
DNA an ihre Tochterzellen weitergeben.
27 Genetik
DO01045455_Loesung_01.indd 27
14.04.2015 13:51:42
1. 5 Gentechnik
Gentechnische Verfahren im Überblick (Seite 87)
0 A1 Vergleichen Sie die „natürlichen“ Methoden der Mutation und Rekombination mit denen der
Gentechnik.
– Alle 3 Methoden zielen auf die Veränderung des Genoms (DNA). Während die beiden natür‑
lichen Methoden aber zu wahllosen Änderungen führen, arbeitet die Gentechnik gezielt.
0 A2 Begründen Sie, unter welchen Voraussetzungen ein Gen nach der Übertragung in eine andere
Zelle immer noch für dasselbe Produkt codiert.
– Da alle Lebewesen denselben genetischen Code verwenden, erzeugt derselbe DNA-Abschnitt in
unterschiedlichen Organismen das gleiche RNA-Transkript. Sofern das fremde Gen überhaupt
abgelesen wird, sind weitere Voraussetzungen, dass dieselben Bereiche als Exons dienen und
das Transkript beim Spleißen gleich behandelt wird.
$ A3 Ein DNA-Abschnitt für Humaninsulin soll in Bakterienzellen eingebracht werden. Begründen
Sie, welche der hier genannten Verfahren zur Isolierung der Fremd-DNA geeignet sind.
– Da Bakterien nach der Transkription kein Spleißen durchführen, muss ein Isolierungsverfahren
sicherstellen, dass der DNA-Abschnitt keine Introns enthält. Dies ist der Fall, wenn von der m-RNA ausgegangen wird. Ebenso kann bei einer künstlichen Erzeugung des DNA-Abschnitts
die richtige Aminosäuresequenz ermöglicht werden. Geeignet sind also die beiden letzten Isolie‑
rungsverfahren.
Biotechnologie (Seite 89)
�������������
�������
�������������
�������������
�����������
�������������
0 A1 Eukaryotische Gene unterscheiden sich von prokaryotischen Genen. Erläutern Sie mögliche
Schwierigkeiten, die bei der Übertragung von eukaryotischer DNA in Bakterien auftreten
können.
– Die Gene können nicht korrekt translatiert werden, da die Introns in Bakterien nicht entfernt
werden können.
$ A2 Das Enzym „Reverse Transkriptase” ist in der Lage, m-RNA direkt in DNA umzuschreiben.
Erläutern Sie, wie die Reverse Transkriptase sich zur Lösung der in Aufgabe 1 beschriebenen
Schwierigkeiten einsetzen lässt.
– s. Abbildung in der Randspalte
Modellorganismen (Seite 90)
. A1 Diskutieren Sie die Verwendung des Glo-Fish als Haustier.
– Pro: Attraktives, modernes, seltenes Haustier; Nachtlichtersatz; private Verhaltensstudien, Zucht
Contra: Gentechnisch verändertes Lebewesen mit potentieller, schwer abschätzbarer Gefähr‑
dung für die Umwelt; attraktiver „Türöffner“ für die Einfuhr gentechnisch erschaffener Organis‑
men außerhalb der gesicherten Labore; ethische Bedenken
Knockout-Organismen (Seite 91)
0 A1 Vergleichen Sie das „Gene targeting“ mit der RNA-Interferenz (s. Seite 48f).
– Beides führt zum Ausschalten gezielter Gene — auf unterschiedlichen Wegen. Gene targeting: Austausch einer DNA-Sequenz; RNA-Interferenz: Abfangen des Transkripts
durch komplementäre RNA-Stränge
$ A2 Begründen Sie die Verwendung bestimmter Modellorganismen für die genetische Forschung.
– Abhängig von der Fragestellung stehen Einzeller oder pflanzliche/ tierische Vielzeller zur Ver‑
fügung. Durch gentechnische Manipulation kann der benötigte Modellorganismus hinsichtlich
dem Bedarf angepasst werden.
Beispiel: Um die genetischen Grundlagen der Organbildung beim Menschen zu erforschen,
sollte am ehesten die Maus als verwandtes Säugetier genutzt werden. Ferner böte sich auch der
Zebrabärbling als Wirbeltier an, da die Entwicklung der Organe sicherlich gut in den durchsich‑
tigen und außerhalb des Mutterleibes gedeihende Embryonen beobachtet werden kann.
28 Genetik
DO01045455_Loesung_01.indd 28
14.04.2015 13:51:43
Synthetische Organismen (Seite 92)
0 A1 Recherchieren Sie den iGEM-Wettbewerb.
– Bei iGEM (international genetically engineered machine competition) handelt es sich um einen
akademischen und interdisziplinären Wettbewerb auf Basis der synthetischen Biologie, der in‑
ternational Beachtung findet. Initiiert wurde der Wettbewerb im Jahr 2003 vom Massachusetts
Institute of Technology (MIT) in Boston, wo nach regionalen Vorentscheiden alljährlich das Finale
ausgetragen wird. Ziel des Wettbewerbs ist es, mithilfe der synthetischen Biologie, Lösungs‑
ansätze für abstrakte und reelle Probleme zu entwickeln und sich im internationalen Maßstab
zu vernetzen. Dabei kombinieren die meist aus Studenten und Doktoranden bestehenden Teams
vorhandene Bio-Bricks oder konstruieren selber neue, um mit den so neu kreierten Organismen
die gestellten Probleme zu lösen.
Seit der ersten Austragung ist die Zahl der am iGEM-Wettbewerb teilnehmenden Teams stetig
gewachsen. So traten 2012 bereits 193 Teams aus über 25 Ländern an. Jedes Team arbeitet von
April bis September an der Umsetzung und Dokumentation ihrer Projekte. Zu den erfolgreichs‑
ten Teilnehmern zählten unter anderen Teams der Universität Freiburg, des Imperial College
London, aus Harvard, Cambridge und der TU München
. A2 Diskutieren Sie das Zitat von Hutchison, Smith und Venter.
– Sie behaupten, eine synthetische Zelle erzeugt zu haben. Das kann man insofern nachvollzie‑
hen, als dass diese Zelle (dieser Organismus) von einer DNA „gesteuert wird“, die künstlich von
einer Maschine hergestellt wurde. Andererseits sind alle anderen Bauteile/ Systeme der Zelle
noch natürlichen Ursprungs. Daher lässt sich ebenso behaupten, dass dies eine natürliche Zelle
ist, nur eben mit einem synthetisch hergestellten Kopie ihres natürlichen Genoms.
Material: Synthetische Organismen — Einsatzmöglichkeiten und Gefahren (Seite 93)
0 A1 Nennen Sie Gemeinsamkeiten und Unterschiede von Biokraftstoffen der ersten und zweiten
Generation.
– Gemeinsamkeiten: aus Biomase hergestellt; pflanzlichen Ursprungs
Unterschiede: Nutzung von natürlichen, genmanipulierten, synthetischen Organismen.
$ A2 Erklären Sie das besondere Risiko der Ausbreitung einer synthetischen Alge, die eine erhöhte Fotosyntheseleistung aufweist.
– Durch die erhöhte Fotosyntheseleistung ist die synthetische Alge konkurrenzstärker als einhei‑
mische Algenarten. Dies kann zur Verdrängung/ Vernichtung der einheimischen Arten und zur
schnellen Verbreitung der synthetischen Alge führen.
. A3 Diskutieren Sie das Für und Wider der Synthi-Fuel-Herstellung.
– Für: z. B. nachwachsener Rohstoff; klimaneutrale Herstellung; effektive Nutzung von Ressourcen.
– Wider: z. B. Gefahr der Umweltschädigung; nicht einschätzbare Risiken; ethisch-moralische
Werte.
. A4 Bewerten Sie den Einsatz einer synthetischen Alge.
– Der Einsatz ist sehr problematisch. Die Risiken für die Umwelt sind gravierender als der Nutzen
für uns Menschen durch Arbeitsplätze und günstigere Spritpreise.
0 A5 Beschreiben Sie das Wirkschema des Regelkreises.
– Stark fetthaltige Ernährung führt zu hohen Blutfettwerten, die vom Regelkreis erkannt und
verarbeitet werden. Das erzeugte Sättigungsgefühl führt zum gewünschten Gewichtsverlust.
. A6 Prüfen Sie die Aussage: „Bei diesem synthetischen System handelt es sich um ein Frühwarnsystem und eine Therapie in einem.“
– Die Aussage ist richtig, da der Regelkreis sowohl die Werte ständig überwacht und bei zu hohen
Werten direkt Maßnahmen zur Verringerung einleitet, wie bei einer Therapie.
0 A7 Beschreiben Sie die in Abb. 3 dargestellten Ergebnisse.
– Die Grafik zeigt die Abgabe alkalischer Phosphatase in Abhängigkeit von vier unterschiedlichen
Fettsäurekonzentrationen (0, 25, 50 und 100 µM). Getestet wurden gesättigte sowie ungesät‑
tigte Fettsäuren und Fettsäuregemische. Bei allen acht Proben ist zu beobachten, dass bei einer
Konzentration von 0 µM Fettsäuren die Abgabe minimal ist und umso stärker wird, desto höher
die Fettsäurekonzentration ist.
0 A8 Erläutern Sie, weshalb sich die Forscher ausgerechnet dem Thema „Schlankmacher“ gewidmet haben.
– Die WHO schätzt, dass weltweit 1,5 Milliarden Menschen an Übergewicht leiden. Übergewicht
gilt als Zivilisationskrankheit und ist mit vielen Kosten verbunden. Die Forschungsrichtung ist
daher wichtig und stellt zudem einen großen wirtschaftlichen Markt in Aussicht.
29 Genetik
DO01045455_Loesung_01.indd 29
14.04.2015 13:51:43
$ A9 Bewerten Sie den Einbau des Sicherheitsschalters.
– Der Sicherheitsschalter ist zwingend notwendig, da durch ihn das Risiko der Ausbreitung und
damit die Gefährdung der Umwelt massiv verringert werden.
$ A10Erläutern Sie den hier postulierten Paradigmenwechsel.
– Bei gleichem Ziel „Herstellung von Organismen mit für den Menschen nützlichen Eigenschaften“
wurde die grundsätzliche Herangehensweise an das Ziel gravierend verändert.
. A11Beurteilen Sie, ob man auch beim Vergleich von Züchtung und Gentechnik von einem Paradigmenwechsel sprechen kann.
– Ja, denn bei gleichem Ziel „Herstellung von Organismen mit für den Menschen nützlichen Eigen‑
schaften” wurde die grundsätzliche Herangehensweise an das Ziel gravierend verändert.
Gentechnik in der Medizin (Seite 94)
$ A1 Beschreiben Sie das Verfahren der somatischen Gentherapie mithilfe von Abb. 1.
– Bei der somatischen Gentherapie gibt es zwei Vorgehensweisen.
1.Einem Patienten werden kranke Zellen entnommen und in einer Zellkultur vermehrt. Diese Zel‑
len werden mit einem Vektor (z. B. einem Virus) infiziert, in den zuvor eine Kopie des gesunden
Gens eingesetzt wurde. Die Zellen mit dem gesunden Gen werden dem Patienten anschlie‑
ßend wieder zugeführt.
2.Die Viren mit dem intakten Gen werden dem Patienten direkt zugeführt. Voraussetzung für
die Wirksamkeit dieses Verfahren ist, dass die Viren zu den richtigen Zielzellen gelangen.
$ A2 Stellen Sie eine begründete Hypothese dazu auf, warum ein Großteil der gentherapeutischen
Studien sich mit Krebserkrankungen beschäftigt.
– Bisher ist die somatische Gentherapie mit vielen Risiken verbunden. Es ist nicht sichergestellt,
dass die Fremd-DNA sich an die gewünschte Stelle im Genom setzt. Ein falscher Einbau kann
jedoch fatale Folgen haben, außerdem ist die Verwendung von Viren als Genfähren immer
mit einem Risiko verbunden. Deshalb werden zurzeit fast nur Gentherapien bei Erkrankungen
erprobt, bei denen es sonst keine Therapiemöglichkeiten für Patienten gibt.
Material: Reproduktionstechnik, Klonen (Seite 95)
$ A1 „Klonen“ bedeutet die Anfertigung genetischer Doppelgänger, „Klonieren“ die Vervielfältigung eines Gens. Reproduktionsbiologie und Gentechnik werden oft nicht auseinandergehalten. Warum war das Klonen des Schafes Dolly kein gentechnisches Experiment?
– Weil bei Dolly die Erbinformation nicht künstlich verändert wurde. Es handelt sich um ein zell‑
biologisches Experiment.
. A2 Ian Wilmut, der wissenschaftliche „Vater“ des Klonschafes Dolly, warnt vor Klonversuchen am
Menschen, es gäbe „reichlich Beweise, dass dies völlig unverantwortlich“ wäre. Begründen
Sie.
– Dolly zeigte frühzeitige Alterungserscheinungen; hunderte von Versuchen mussten durchgeführt
werden, um zum Erfolg zu gelangen. Angesichts der medizinischen/gesundheitlichen Risiken
wäre es nicht zu verantworten, derartige Methoden am Menschen auszuprobieren.
$ A3 In den meisten Ländern ist das Klonen von Menschen verboten. Nennen Sie Gründe, die das
Verbot unterstützen.
– Medizinische Risiken (s. Lösung zu Aufgabe 2), ethische (Mensch als Schöpfer oder Designer)
und soziale Gründe (s. Lösung zu Aufgabe 6) sprechen für ein Verbot.
0 A4 Die Manipulation an menschlichen Keimen ist in Deutschland grundsätzlich verboten, Grundlagenforschung an importierten menschlichen embryonalen Stammzellen wird auf Antrag
aber genehmigt. Informieren Sie sich über die rechtliche Auffassung in anderen Ländern.
– In den USA und Israel beispielsweise ist Grundlagenforschung an menschlichen Embryonen
erlaubt. Aus diesen Ländern werden auch Embryonen für die Grundlagenforschung nach
Deutschland importiert.
$ A5 Spielen Sie eine Gerichtsverhandlung mit verteilten Rollen durch, in der die geschiedenen
Eheleute sich um das Schicksal ihrer eingefrorenen Embryonen streiten.
– individuelle Lösung
30 Genetik
DO01045455_Loesung_01.indd 30
14.04.2015 13:51:43
$ A6 Mithilfe der Reproduktionsmedizin kann das Alter, in dem eine Schwangerschaft möglich ist,
beträchtlich erhöht werden. In Österreich ging z. B. der Kinderwunsch einer 61-jährigen Frau
in Erfüllung. Dazu wurden einer jungen Spenderin Eizellen entnommen und in vitro mit Spermien des Partners der älteren Frau befruchtet. Die Embryonen wurden in die Gebärmutter
der 61-Jährigen eingesetzt. Welche sozialen Folgen können derartige Praktiken für die Eltern,
die erzeugten Kinder und für die Gesellschaft haben?
– Sexualität, Alter und Schwangerschaft können beinahe vollständig voneinander getrennt wer‑
den. In Frage steht, ob eine Frau mit über 60 Jahren der späten Schwangerschaft und auch der
Erziehung des Kindes körperlich und psychisch gewachsen ist. Das gesellschaftliche Problem,
berufliche Karriere und Schwangerschaft miteinander zu vereinbaren wird technologisch gelöst.
Nur Frauen, die finanziell gut gestellt sind, können sich derartige Praktiken leisten. Kommer‑
zialisierung der intimsten Lebensbereiche; da die meisten Menschen wissen wollen, wer ihre
leiblichen Eltern sind, ist mit späteren familiären Komplikationen zu rechnen.
Gentechnik in der Lebensmittelherstellung (Seite 96)
0 A1 Informieren Sie sich über das Für und Wider des Golden Rice.
– Befürworter: Preiswerte Vitaminquelle, vor Ort produzierbar und leicht lagerfähig;
Gegner: Herstellerfirma verdrängt alte Sorten und verdient später an der patentierten Sorte
Geld, neben dem Gen für Beta Carotin sind noch viele weitere Gene eingefügt worden, deren
Wirkung auf den Körper noch nicht sicher abgeschätzt werden kann.
Material: Gen-Ethik (Seite 97)
0 A1 Recherchieren Sie, welche Lebensmittel unter Beteiligung von Gentechnik hergestellt werden. Nennen Sie Beispiele.
– individuelle Lösung
. A2 Führen Sie eine ethische Bewertung zum Thema „Anbau von Amflora in Europa“ durch.
– individuelle Lösung
Übungen: Genetik (Seite 98/99)
0 A1 Abb. 1 zeigt den Stammbaum einer Familie, in der Chorea Huntington aufgetreten ist. Analysieren Sie den Stammbaum und schließen Sie dabei nicht zutreffende Erbgänge begründet
aus.
– Die Vererbung erfolgt über einen autosomal-dominanten Erbgang. Dies zeigt sich daran, dass
bei Paar 3/4 nur der Vater erkrankt ist und trotzdem erkrankte Kinder aus der Beziehung
hervorgehen. Ein X-chromosomal-dominanter Erbgang kann an den Personen 1 und 4 ausge‑
schlossen werden. Kranke Väter können keine kranken Söhne zeugen, da sie an die Söhne das
Y-Chromosom weitergeben. Alle erkrankten Personen haben den Genotyp Aa und alle gesunden
Personen den Genotyp aa. Rezessive Erbgänge, bei denen gesunde Eltern kranke Kinder haben
können, sind hier demzufolge ausgeschlossen.
0 A2 Erläutern Sie die Methode der PCR sowie weitere Schritte in der Gendiagnostik.
– Die PCR läuft in drei Schritten ab, die 20- bis 30-mal wiederholt werden: Denaturierung: Zunächst werden die Wasserstoffbrückenbindungen zwischen den Einzelsträn‑
gen einer DNA-Doppelhelix bei 95 °C getrennt.
Anlagerung der Primer: Genau wie bei der DNA-Replikation in einer Zelle benötigt man für
die PCR Primer, die die Ansatzstellen für die DNA-Polymerase bilden. Damit die Primer an die
einzelsträngigen DNA-Abschnitte binden können, wird die Temperatur auf etwa 50 °C herunter‑
gefahren. Synthese des DNA-Doppelstrangs: Nachdem die Primer gebunden haben, kann die Taq-Polyme‑
rase bei 72 °C mit der Synthese des komplementären DNA-Strangs beginnen. Vom 3‘-Ende des
Primers an werden freie Nucleotide angelagert und zu einem kontinuierlichen Strang verknüpft. Nach dem dritten Schritt beginnt der PCR-Zyklus von vorn. Die Erhöhung der Temperatur be‑
wirkt, dass die Taq-Polymerase sich ablöst und die Doppelstränge sich wieder voneinander tren‑
nen. Zur Analyse wird die DNA mit passenden Restriktionsenzymen geschnitten und analysiert.
Unterschiedlich große Restriktionsfragmente verschiedener Personen (z. B. Eltern und Kinder)
werden nach Länge durch Gelelektrophorese sortiert und durch Gensonden identifiziert. Für
die genetische Diagnostik von Chorea Huntington nutzt man die DNA-Bereiche, in denen das
Basentriplett CAG gehäuft vorkommt. Die Diagnose gibt Auskunft über die Länge und damit
über die Anzahl der Wiederholungen. So ergibt sich für jeden Menschen ein charakteristisches
Bandenmuster .
31 Genetik
DO01045455_Loesung_01.indd 31
14.04.2015 13:51:43
$ A3 Werten Sie das vorliegende Ergebnis des Gentests in Abb. 3 aus. Gehen Sie davon aus, dass
die Elternschaft beider Elternteile unstrittig ist.
– Für jede Testperson sind zwei Banden zu sehen, da jeder Mensch 2-mal über das Chromosom 4
verfügt. Beim Vater sind zwei Banden zu sehen, eine für einen Genabschnitt mit etwas mehr als
18 CAG-Wiederholungen und eine für einen Abschnitt mit etwas weniger als 18 CAG-Wieder‑
holungen. Da der Vater gesund ist, spricht dies dafür, dass diese Anzahl an Wiederholungen für
ein gesundes Allel steht. Die Mutter trägt ein gesundes Allel mit etwas mehr als 18 CAG-Wieder‑
holungen und ein krankes Allel mit mehr als 48 Wiederholungen.
Kind 1 und 3 haben jeweils vom Vater und der Mutter die gesunden Allele geerbt, werden also
nicht erkranken. Kind 2 und 4 haben von der Mutter das kranke und vom Vater ein gesundes
Allel geerbt. Sie werden an Chorea Huntington erkranken. Kind 5 hat vom Vater das gesunde
Allel und von der Mutter das kranke Allel geerbt. Hier ist es jedoch durch eine Spontanmutation
zu weiteren CAG-Wie­derholungen im Gen gekommen, weshalb das PCR-Produkt etwas länger
ist als beim mütterlichen Allel. Dies Kind wird ebenfalls an Chorea Huntington erkranken.
$ A4 Analysieren Sie die Abb. 4 und 5. Gehen Sie dabei auch auf die Konsequenzen für die in
Abbildung 3 dargestellte Familie ein.
– Die Abbildung zeigt, dass das Erkrankungsalter von der Anzahl der CAG-Wiederholungen
abhängt. Je mehr CAG-Wiederholungen vorhanden sind, desto früher tritt die Erkrankung auf.
Weniger als 30 Wiederholungen scheinen für ein gesundes Allel zu sprechen, da die Grafik zeigt, dass ca. 35 Wiederholungen zu einem Ausbruch der Erkrankung zwischen dem 62. und 75. Lebensjahr führen. Geht man von einer linearen Entwicklung der Grafik aus, dürften Pati‑
enten mit weniger als 30 Wiederholungen vor einem möglichen Ausbruch der Krankheit bereits
verstorben sein. Wiederholungen zwischen 60 und 70 führen dazu, dass Patienten bereits im
Kindesalter erkranken. Bei unserer Familie hat das mütterliche Allel ca. 50 Wiederholungen.
Das bedeutet, dass die Mutter im Alter zwischen 40 und 50 Jahren erkrankt ist. Für die beiden
Kinder, die dieses Allel unverändert tragen, kann man die gleiche Prognose aufstellen. Kind 5
trägt das durch Mutation verlängerte Allel. Bei ihm ist davon auszugehen, dass es bereits im
Alter zwischen 30 und 40 Jahren erkranken wird.
. A5 In Abbildung 6 ist das Verfahren der Antisense-Gentherapie dargestellt. Erläutern Sie mithilfe der Abbildung, wie durch dieses Verfahren verhindert wird, dass das HD-Protein in der
Zelle exprimiert wird.
– Bei der Antisense-Technik wird ein einzelsträngiges DNA-Oligonucleotid in die Zelle geschleust,
das zu einem Abschnitt des HD-Gens komplementär ist. Wird das HD-Gen der Zelle abgelesen,
entstehen einzelsträngige m-RNA-Moleküle. Die Antisense-DNA bindet an die m-RNA des Ziel‑
gens. Das daraus entstehende DNA-RNA-Molekül kann nicht translatiert werden. Es entsteht
kein HD-Genprodukt. Die Antisense-DNA muss jedoch immer wieder neu in die Zelle geschleust
werden, da sie nicht ins Genom eingebaut wird.
$ A6 Lisa und Lena wissen nicht, ob sie die Krankheit von ihrer Mutter geerbt haben. Lisa würde
gern einen Gentest durchführen lassen, Lena lehnt dies ab. Erörtern Sie die Folgen, die die
Durchführung eines Gentests für Lena und Lisa haben könnten. Nutzen Sie bei Ihren Überlegungen die Informationen auf der Methodenseite 10.
– Ein Gentest für Chorea Huntington bedeutet eine zu 100 % sichere Aussage darüber, ob die bei‑
den Schwestern erkranken werden oder nicht. Sollte dieser Test positiv ausfallen, bedeutet das,
dass sie das gleiche Schicksal erleiden werden wie ihre Mutter. Für Lisa und Lena besteht als eineiige Zwillinge eine besondere Situation. Es bedeutet, dass der
Test der einen Schwester auch für die andere gilt. Wenn nur eine Schwester den Test durchfüh‑
ren lässt, ist das Recht auf Nichtwissen der anderen Schwester nur schwer zu gewährleisten.
Ein weiterer Aspekt ist, dass die Schwestern noch ziemlich jung sind. Ohne einen Test gehen sie
das Risiko ein, unwissend das kranke Gen an Kinder weiterzugeben. Es lassen sich aber auch
noch weitere Aspekte berücksichtigen, wie z. B. die Situation eines zukünftigen Lebenspartners.
$ A7 Begründen Sie, warum vor der Durchführung ein umfangreiches Aufklärungsgespräch mit
dem Patienten erfolgen muss und eine nachfolgende Bedenkzeit von drei Monaten verpflichtend ist.
– Durch Gentests ist es möglich, weit vor dem Auftreten jeglicher Symptome bei Menschen aus
betroffenen Familien eindeutig festzustellen, ob sie den zur Chorea Huntington führenden Gen‑
defekt haben oder nicht. Die Entscheidung darüber, ob eine solche Diagnostik gewünscht wird,
ist höchst persönlich und kann nur nach einer umfassenden Aufklärung getroffen werden, die
die persönlichen psychologischen Folgen einer solchen Diagnose für sich selbst und die Familie
in den Blick nimmt. Zugleich muss berücksichtigt werden, dass mit einer solchen Diagnostik
auch Informationen über andere Blutsverwandte bekannt werden. So würde mit einer positiven
Diagnostik bei einem Enkel eines Betroffenen auch klar, dass der entsprechende Elternteil be‑
troffen ist. Die Bedenkzeit zwischen Aufklärung und Durchführung muss die Möglichkeit offen
lassen, die Entscheidung für einen Gentest zu überdenken, zu reflektieren und gegebenenfalls
zu revidieren. Der Ratsuchende muss bestimmen, ob und in welchem Umfang er informiert
werden möchte (Recht auf Wissen bzw. Nichtwissen).
32 Genetik
DO01045455_Loesung_01.indd 32
14.04.2015 13:51:44
2 Neurobiologie
2. 1 Nervenzellen — Bau und Funktion
Vom Reiz zur Reaktion (Seite 102)
$ A1 Erklären Sie die Bedeutung der Reiz-Erregungs-Transformation und erläutern Sie, weshalb
wir trotzdem Töne nicht als optische Reize wahrnehmen.
– Die Reiz-Erregungs-Transformation ist die Umwandlung der auf die Sinnesorgane (Sinneszellen)
eintreffenden Reize in Erregungen, die im Nervensystem zum Gehirn geleitet werden können.
Reize können sehr unterschiedlich sein. Die Bedeutung der Reiz-Erregungs-Transformation liegt
darin, dass sie immer nach dem gleichen Muster abläuft. Man kann trotzdem Töne und Bilder
unterschiedlich wahrnehmen, da die Wahrnehmung erst in den unterschiedlichen Gehirnregio­
nen abläuft.
Die Biomembran —Grundlage der Funktion von Neuronen (Seite 105)
0 A1 Proteine werden in der Nervenzelle hauptsächlich im Zellkörper produziert. Erläutern Sie die
Bedeutung des Cytoskeletts und der Motorproteine unter diesem Aspekt.
– In den synaptischen Endknöpfchen werden für die Verknüpfungen viele verschiedene Substanzen benötigt. Da die Produktion dieser Substanzen im Zellkörper stattfindet und der Transport
über das Axon mithilfe der Diffusion sehr lange dauern würde und ungerichtet wäre, muss ein
schneller Transport für die Verbindung vorhanden sein. Der schnelle Transport erfolgt über die
Mikrotubuli und Motorproteine gezielt zu den synaptischen Endknöpfchen.
$ A2 Beschreiben Sie die Vorgänge in Abb. 4 und vergleichen Sie diese mit denen in Abb. 5. Erläutern Sie, weshalb es sich um Modellvorstellungen handelt.
– In Abb. 4 ist das Modell eines spannungsgesteuerten Ionenkanals dargestellt. Durch die unterschiedlichen Ladungen kann im Modell ein spannungsabhängiges Protein als Tor geöffnet
und geschlossen werden. Hierdurch wird im Modell der Ionenfluss ermöglicht oder gehemmt. In
Abb. 5 ist das Modell eines Liganden gesteuerten Ionenkanals. Dieser reagiert auf Acetylcholin,
welches an einem Protein andockt. Hierdurch kommt es durch Ladungsverschiebungen zu einer
räumlichen Veränderung der Ionenkanalproteine.
Das Ruhepotential (Seite 107)
$ A1 Erklären Sie im Blick auf die Konzentrationsverhältnisse und den elektrischen Gradienten,
weshalb die Chloridionen kaum Einfluss auf das Membranpotential haben.
– Aufgrund des Konzentrationsverhältnisses kommt es zu einem Einstrom der Chloridionen. Da
der elektrische Gradient diesem Einstrom jedoch entgegenwirkt, wird dieser nur sehr schwach
sein.
. A2 An einem Axon wird mithilfe einer geeigneten Versuchsanordnung dafür gesorgt, das kein
Sauerstoff mehr zur Verfügung steht. Geben Sie die eintretende Änderung des Membran­
potentials an und begründen Sie die Änderung.
– Ohne Sauerstoff läuft die Atmungskette nicht mehr ab, d. h. die ATP-Bildung wird verhindert.
Die Natrium-Kalium-Pumpe kann ohne ATP die Ionenleckströme nicht mehr ausgleichen. Die
Ionenkonzentrationen egalisieren sich langsam, das Membranpotential geht gegen Null.
Die Entstehung des Aktionspotentials (Seite 109)
. A1 Beschreiben Sie die Vorgänge an den Na+-Ionenkanälen anhand des Textes und der Abb. 3
und erläutern Sie daran, wie es zu den Phasen des Aktionspotentials in Abb. 2 kommt.
– In Abb. 3 sind die Öffnungsvorgänge an den Ionenkanälen des Axons während eines Aktionspotentials dargestellt. Auf der y-Achse wird der Ionenstrom von Natrium- und Kaliumionen
durch die Membranen in piko-Ampere dargestellt. Auf der x-Achse ist der zeitliche Verlauf in
Millisekunden dargestellt. Mithilfe der Patch-Clamp-Technik werden die Ionenströme einzelner
Kanäle spezifisch gemessen. Durch die Öffnung der Natriumionenkanäle in der Axonmembran
kommt es zu einem schnellen Einstrom von Natriumionen aus dem umgebenden Medium in das
Axon. Der Ionenstrom steigt von 0 auf 4 pA. Der Ionenkanal schließt sich innerhalb von 2 ms und
der Ionenstrom sinkt sofort auf 0 pA. Diese inaktivierten Natriumionenkanäle verändern ihre
Raumstruktur wieder in die geschlossenen Ionenkanäle. Während der Öffnung der Natrium­
ionenkanäle sind die Kaliumionenkanäle geschlossen. Diese öffnen sich erst ca. 2 ms verzögert aber sehr schnell von 0 pA auf 2 pA. Kaliumionen strömen aus dem Axon aus und führen
dadurch zu einem Ausgleich der Ladungsverteilung.
33 Neurobiologie
DO01045455_Loesung_02.indd 33
14.04.2015 13:57:16
Weiterleitung des Aktionspotentials (Seite 110)
$ A1 Im Experiment wird ein Axon in der Mitte gereizt. Erklären Sie, wie sich die Erregungsleitung
im Versuch von der unter natürlichen Bedingungen unterscheidet.
– Unter natürlichen Verhältnissen läuft das Aktionspotential nur vom Axonhügel in Richtung
Synapse, da die hinter dem Aktionspotential liegenden Bereiche refraktär sind. Bei experimenteller Reizung in der Mitte des Axons könnte sich die Erregung nach beiden Seiten ausbreiten.
Umwandlung von Reizen in elektrische Signale (Seite 111)
0 A1 Erklären Sie anhand der Abbildungen den Zusammenhang zwischen den Reizstärken und
Rezeptor- bzw. Aktionspotentialen und beschreiben Sie den Einfluss der Reizdauer.
– Je größer der Reiz, desto höher die Amplitude des Rezeptorpotentials; je länger der Reiz, desto
länger ist die Dauer des Rezeptorpotentials, dessen Amplitude leicht absinkt. Dies lässt sich
über die veränderte Anzahl der intrazellulären Na+-Ionen erklären. Mit zunehmender Amplitude
des sich elektrotonisch ausbreitenden Rezeptorpotentials wird der Schwellenwert bei den
spannungsabhängigen Na+-Ionenkanälen mehr oder weniger lange anhaltend erreicht und löst
daher viele oder wenige Aktionspotentiale aus.
Material: Erkenntnisgewinnung am Beispiel neurobiologischer Forschung (Seite 112/113)
$ A1 Beschreiben Sie die Vorgänge zu den Messwerten der Kalium- und Natriumionen (Abb. 1) und
bringen Sie diese mit der Entstehung des Aktionspotentials in Zusammenhang.
– • Geöffnete K+-Kanäle erzeugen das Ruhepotential, K+-Ionen folgen dem Konzentrationsgefälle nach außen.
• Durch einen Reiz ausgelöste Spannungsänderungen führen zur Öffnung einiger Na+-Kanäle.
Na+-Ionen bewegen sich in Richtung des Konzentrationsgradienten nach außen. Depolarisierung in Richtung des Schwellenwertes.
• Weitere spannungsabhängige Kanäle werden geöffnet (Overshoot).
• Durch Spannungsänderung werden die Na+-Kanäle geschlossen und zeitverzögert spannungsabhängige K+-Kanäle geöffnet. K+-Ionen strömen nach außen (Repolarisierung).
. A2 Stellen Sie die Patch-Clamp-Messung in eigenen Worten dar und erklären Sie Form und
Amplitude der Messergebnisse (Abb. 4).
– Die Messung erfolgt über einen sehr kleinen Abschnitt der Neuromembran. Die Wahrscheinlichkeit der Öffnung einzelner Ionenkanäle kann durch die Leitfähigkeit gemessen werden. Bei den
Einzelkanalmessungen entspricht die Breite der Amplitude der Öffnungszeit. Die Höhe (Amplitude)
ist immer gleich. Dies entspricht dem Zustand: Kanal „offen“ oder Kanal „geschlossen“. Die
Anzahl der Einzelimpulse entspricht der Reizstärke.
. A3 Tetrodotoxin, das Gift von Kugelfischen, verschließt die Natriumionenkanäle im Axon. Erläutern Sie, welche medizinische Bedeutung dieser Stoff bei der Zahnbehandlung hat, wenn er
in die Umgebung der von den Zähnen kommenden Nerven gespritzt wird.
– Tetrodotoxin im Gewebe an den Zähnen blockiert die sensorischen Neuronen durch Hemmung
der spannungsabhängigen Na+-Ionenkanäle. Hierdurch können keine Na+-Ionen einströmen,
trotz der Reizung beim Zahnarzt kann dadurch kein Aktionspotential gebildet werden.
0 A4 Beschreiben Sie die Ergebnisse (Abb. 5) und erklären Sie sie auf molekularer Ebene.
– Wird die extrazelluläre Kaliumionenkonzentration verändert, so verändert sich auch das Membranpotential der Nervenzelle: Bei niedrigen extrazellulären Kaliumionenkonzentrationen ist die
Membran stärker polarisiert als bei höheren Konzentrationen. Die Höhe des Membranpoten­
tials ist abhängig von der Höhe des Konzentrationsunterschiedes der extra- und intrazellulären
Kaliumionen.
0 A5 Zeichnen Sie ein typisches Aktionspotential und tragen Sie die Veränderungen durch die
Verringerung der extrazellulären Na+-Ionenkonzentration ein.
– Bei Verringerung der extrazellulären Na+-Ionenkonzentration wird die im Kurvenverlauf typische
Amplitude (bis ca. 30 oder 50 mV) schrittweise verringert.
$ A6 Erklären Sie die Beobachtungen (Abb. 6) mithilfe der Ionentheorie des Aktionspotentials.
– Nach Öffnung der spannungsabhängigen Na+-Kanäle diffundieren Natriumionen von außen
nach innen. Dies umso mehr, je größer der Konzentrationsunterschied der Natriumionen zwischen außen und innen ist.
34 Neurobiologie
DO01045455_Loesung_02.indd 34
14.04.2015 13:57:16
$ A7 Erläutern Sie was passieren würde, wenn die Na+-Ionen nicht durch Glucosemoleküle ersetzt
würden.
– Die Veränderung der extrazellulären Na+-Ionenkonzentration am Axon führt zu veränderten
osmotischen Werten. Ohne Zugabe der Glucose käme es zu einem Wassereinstrom in die Zelle,
da die Konzentration der gelösten Stoffe in der Zelle höher wäre als außerhalb.
$ A8 Begründen Sie die Wirkung von Cyaniden auf Neurone.
– Wird die Atmungskette blockiert, kann kein ATP mehr gebildet werden. Die Natrium-KaliumPumpe benötigt für den Transport der Ionen Energie in Form des ATP. Die Ionendifferenz scheint
demnach so groß zu sein und die Veränderung der Konzentration während des Aktionspotentials
so gering, dass erst einige Aktionspotentiale entstehen können, bis die Ionenverteilung nicht
mehr zur Auslösung eines neuen Aktionspotentials ausreicht. Durch die geringe Ladungsdifferenz sinkt auch das Ruhepotential. Hinzu kommt, dass die spannungsabhängigen Na+-Ionenkanäle sich nicht mehr öffnen, wenn das Ruhepotential nicht mehr erreicht wird.
$ A9 Berechnen Sie aus den dargestellten Messergebnissen (Abb. 7) die Leitungsgeschwindigkeit.
– Gegeben ist der Abstand der Orte, an denen je ein Stromstoß gesetzt wurde mit 27 cm = 0,27 m.
Die Zeitdifferenz lässt sich aus dem oszillographischen Bild entnehmen und berechnen: 8,4 ms – 3,8 ms = 4,6 ms = 0,0046 s. Die Leitungsgeschwindigkeit beträgt dann 0,27 m : 0,0046 s = 57,7 m/s.
. A10Leiten Sie aus den jeweiligen Daten in Abb. 8 die Faktoren ab, welche die Geschwindigkeit
der Erregungsleitung beeinflussen und begründen Sie Ihre Angaben.
– Faktor Myelinisierung: Axone mit Myelinscheiden haben wesentlich höhere Leitungsgeschwindigkeiten wegen der saltatorischen Erregungsleitung. Faktor Faserdurchmesser: Axone mit größerem Querschnitt haben höhere Leitungsgeschwindigkeiten, weil der innere elektrische Widerstand in Längsrichtung des Axons kleiner ist.
35 Neurobiologie
DO01045455_Loesung_02.indd 35
14.04.2015 13:57:16
2. 2 Neuronale Schaltungen
Synapsen (Seite 115)
. A1 Vergleichen Sie die Unterschiede der Ionenkanäle eines Neurons am Axonhügel, am Axon
sowie im synaptischen Spalt.
– Die Ionenkanäle in der Axonmembran sind spannungsgesteuert, reagieren also auf das
elektrische Feld der Umgebung. In der postsynaptischen Membran (auf den Dendriten und im
Bereich des Zellkörpers) hingegen befinden sich Rezeptorproteine, zu denen die Transmitter‑
moleküle wie ein Schlüssel zum Schloss passen. Dies führt zu einer kurzen Formveränderung des
Rezeptorproteins und zum Öffnen der Ionenkanäle (ligandengesteuerte Kanäle).
$ A2 Erklären Sie die Bedeutung der schnellen Spaltung der Transmittermoleküle im synaptischen
Spalt.
– Die Transmittermoleküle wirken direkt oder indirekt auf die Ionenkanäle im synaptischen Spalt.
Würden sie nicht sehr schnell abgebaut werden, könnten sich die ankommenden Impulse immer
weiter addieren und es gäbe keine Abklingphase in der Erregung.
$ A3 Erklären Sie die Bedeutung der Calcium-, Chlorid- und Natriumionen für die Erregungsweiterleitung.
– An der postsynaptischen Membran der erregenden Synapse werden Na+-Ionenkanäle geöffnet
und führen zu einer Depolarisation. An der postsynaptischen Membran der hemmenden Synapse
werden die Cl–-Ionenkanäle geöffnet und führen zu einer Hyperpolarisation. Die Ca2+-Ionen
spielen auf der präsynaptischen Seite eine Rolle, da sie die Verschmelzung der synaptischen
Bläschen mit der präsynaptischen Membran bewirken.
Verrechnungsprozesse an Synapsen (Seite 117)
$ A1 Erläutern Sie den Einfluss von inhibitorischen postsynaptischen Potentialen auf die räumliche und zeitliche Summation.
– Die Amplitude des entstehenden EPSP ist bei Übertragung einer gleichzeitigen oder schnellen
Folge von Aktionspotentialen wesentlich größer als bei einzelnen Aktionspotentialen. Durch das
Überschreiten des Schwellenwertes wird am Axonhügel das Aktionspotential ausgelöst, da die
spannungsabhängigen Kanäle geöffnet werden. Hemmende Synapsen verringern durch ihre
Wirkung die Amplitude des EPSP. Hierdurch kann der Schwellenwert erst später oder gar nicht
erreicht werden. Erregungen können dadurch „gelöscht“ werden.
Synapsengifte — neuroaktive Stoffe (Seite 118)
$ A1 Botulinumtoxin wird in der kosmetischen Medizin als Anti-Falten-Mittel eingesetzt. Dazu
wird das Synapsengift „Botox“ alle drei bis fünf Monate in die Augenpartie, Stirn oder Mundpartie gespritzt. Erklären Sie die Funktionsweise dieser Behandlung.
– Botolinumtoxin blockiert die Übertragung von Nervenimpulsen auf den Muskel. Im Gesicht
lösen sich Verspannungen, die Falten glätten sich.
$ A2 Erklären Sie, wie sich der Natriumioneneinstrom in der postsynaptischen Membran und die
Konzentration von Spaltprodukten des Acetylcholins nach einer E 605-Vergiftung verändern.
– Da die Acetylesterase gehemmt wird, kann Acetylcholin nicht mehr gespalten werden. Deshalb
gibt es auch keine Spaltprodukte mehr. Acetylcholin bindet immer wieder an die Rezeptoren der
postsynaptischen Membran. Dadurch strömen mehr Natriumionen ein.
Material: Synapsengifte als Arzneimittel (Seite 119)
$ A1 Erläutern Sie die Zusammenhänge zwischen der Bildung von Antikörpern, die sich gegen den
Acetylcholinrezeptor richten, und dem Auftreten der oben beschriebenen Symptome.
– Bei Myasthenia gravis ist die Erregungsübertragung zwischen Nerv und Muskel gestört. Das
Immunsystem bildet Antikörper, die sich gegen die Acetycholinrezeptoren richten und diese
blockieren oder zerstören. Der freigesetzte Transmitter Acetylcholin kann daher nur an wenige
Rezeptoren binden und nur wenige Natriumionenkanäle werden geöffnet. Die Depolarisation ist
zu gering, um ein Aktionspotential auszulösen; eine Kontraktion der Muskelfaser unterbleibt.
$ A2 Entwickeln Sie auf dieser Grundlage mögliche medikamentöse Behandlungsmethoden.
– Acetylcholinesterasehemmer, z. B. Neostigmin, verlängern die Wirkungsdauer des freigesetzten
Transmitters und ermöglichen so eine ausreichende Depolarisation. Denkbar ist auch der Einsatz von Anti-Antikörpern, die sich gegen die schädigenden Antikörper richten.
36 Neurobiologie
DO01045455_Loesung_02.indd 36
14.04.2015 13:57:16
0 A3 Informieren Sie sich im Internet über gängige Therapieverfahren und erläutern Sie diese.
– individuelle Lösung
0 A4 Beschreiben Sie das Experiment und seine Ergebnisse.
– Durch schonendes Abschnüren wird die Blutversorgung eines Beins unterbunden, ohne die
motorischen Nerven zu schädigen. Anschließend wird Curare in den Bauchlymphsack injiziert.
Werden mithilfe von Elektroden die motorischen Nerven, die die Beinmuskulatur versorgen, auf
beiden Körperseiten gereizt, so kontrahiert nur die Muskulatur des Beins, das von der Blutversorgung abgeschnitten ist. Wird dagegen die Muskulatur direkt gereizt, kontrahieren die
Muskeln beider Beine.
$ A5 Erklären Sie die Wirkungsweise von Curare und ermitteln Sie seinen Wirkort.
– Die Versuche von Bernard zeigen, dass Curare die Erregungsübertragung zwischen Nerv und
Muskelfaser an den motorischen Endplatten blockiert.
$ A6 Nennen Sie Eigenschaften eines synaptischen Hemmstoffs, die Voraussetzung für einen
therapeutischen Einsatz sind.
– Die Wirkung des Hemmstoffs muss genau bekannt und vor allem reversibel sein.
$ A7 Alkylphosphate sind nur begrenzt geeignet, die Wirkung von Tubocurarin aufzuheben. Erläutern Sie diesen Zusammenhang.
– Alkylphosphate hemmen das Enzym Acetylcholinesterase irreversibel.
$ A8 Aufgrund der Wirkungsweise von Neostigmin kann man auf den Wirkort von Curare bzw.
Tubocurarin rückschließen. Stellen Sie diesen Zusammenhang dar.
– Eine Hemmung der Acetylcholinesterase erhöht die Wirkungsdauer des freigesetzten Transmitters und hebt die Wirkung von Curare bzw. Tubocurarin auf. Daraus lässt sich folgern, dass
Curare die Acetylcholinrezeptoren der postsynaptischen Membran reversibel besetzt, ohne die
Natriumionenkanäle zu öffnen. Wird der enzymatische Abbau des Transmitters gehemmt, können dennoch genügend Kanäle geöffnet werden, um eine ausreichende Depolarisation für eine
Kontraktion auszulösen.
0 A9 Erläutern Sie die Bedeutung von Atropin bei Augenuntersuchungen.
– Wird Atropin in den Bindehautsack des Auges getropft, erreicht es durch Diffusion die Iris und
den Ziliarmuskel des Auges. Hier blockiert es die Signalübertragung an den parasympathischen
Synapsen. Der Ziliarmuskel erschlafft und die Pupille weitet sich, was eine Untersuchung des
Augenhintergrunds erleichtert.
0 A10Geweitete Pupillen signalisieren anderen Menschen Aufmerksamkeit und machen eine
Person „sympathischer“. Erklären Sie daraus die Bezeichnung „Belladonna“ für das Gift der
Tollkirsche.
– Früher wurde Atropin aus kosmetischen Gründen zur Pupillenerweiterung eingesetzt. Das
erklärt die wissenschaftliche Bezeichnung Atropa belladonna (bella donna, ital. = schöne Frau).
$ A11Atropin wird aber auch als Gegenmittel bei einer Vergiftung mit einem AcetylcholinesteraseHemmstoff gegeben. Erläutern Sie.
– Alkylphospate hemmen die Acetylcholinesterase. Da die Transmittermoleküle nicht abgebaut
werden, bleiben die Natriumionenkanäle der postsynaptischen Membran geöffnet und es
kommt zur Dauerdepolarisation. Atropin hat eine lindernde Wirkung, da es die Natriumkanäle
besetzt und so den Natriumioneneinstrom verringert.
Der neuronale Weg vom Reiz zur Reaktion (Seite 121)
0 A1 Erklären Sie die Unterschiede zwischen den Natriumionenkanälen am Axon, am Axonhügel
und an der postsynaptischen Membran.
– Am Axon: Spannungsgesteuerte Na+-Ionenkanäle, die durch das elektrische Feld geöffnet werden. Sie benötigen eine Refraktärzeit bis zur nächsten Erregung. Am Axonhügel liegen spannungsgesteuerte Na+-Ionenkanäle vor, die sich wie am Axon erst ab
einer konkreten Stärke des elektrischen Feldes öffnen.
An der postsynaptischen Membran: Ligandengesteuerte Natriumionenkanäle, die durch die
Transmitter geöffnet werden. Sie schließen sich, wenn keine Transmitter mehr vorliegen.
37 Neurobiologie
DO01045455_Loesung_02.indd 37
14.04.2015 13:57:16
$ A2 Ordnen Sie Abb. 1 die Frequenz- und Amplitudencodierung zu und erklären Sie den Vorgang
der Umcodierung.
– • Das Rezeptorpotential an den Sinneszellen baut sich auf, dabei verändert sich die Amplitude. Die Frequenz ändert sich nicht, da nur das eine Signal vorhanden ist und sich die Stärke je nach Reiz verändert (Amplitudenmodulation).
• Am Axon werden je nach Reizstärke unterschiedlich viele Impulse weitergeleitet. Die Impulse
haben immer die gleiche Amplitude (Frequenzmodulation).
• An der Synapse und am Muskel liegt eine Amplitudenmodulation vor, da die Amplitude des
Impulses verändert wird, nicht seine Anzahl.
• Die Entstehung des Impulses an den Sinneszellen erfolgt durch die Öffnung von Ionenkanälen und damit durch eine Ladungsveränderung. Diese ist je nach Öffnung der Ionenkanäle
unterschiedlich hoch. Ab einem bestimmten Schwellenwert reicht die Stärke der Ladungsveränderung und damit des entstandenen elektrischen Feldes aus, die spannungsabhängigen
Ionenkanäle zu öffnen. Am synaptischen Spalt erfolgt der umgekehrte Vorgang, da hier je
nach Anzahl der ankommenden Impulse unterschiedlich viele Transmittermoleküle freigesetzt
werden. Diese wirken auf die ligandengesteuerten Ionenkanäle ein und bewirken je nach
Anzahl der geöffneten Ionenkanäle eine entsprechende Amplitude.
Reflexe (Seite 123)
$ A1 Ein barfüßiger Badegast tritt auf eine Muschelschale. Sofort zieht er den Fuß ruckartig hoch.
Fertigen Sie für diesen Reflex ein Schema nach Abb. 3 an und benennen Sie die jeweiligen
Organe.
– Reiz = Muschelschale
Rezeptor = Hautsinneszellen der Fußsohle
Reflexzentrum = Rückenmark
Effektor = Oberschenkelmuskulatur
Reaktion = Wegziehen des Fußes
$ A2 Der Herzschlag wird beim Menschen durch periodische Signale eines Muskelknotens (Sinusknoten) ausgelöst. Vergleichen Sie diesen Vorgang mit dem Ablauf eines Reflexes.
– Die rhythmische Kontraktion beruht auch auf einer einfachen Nervenschaltung, wird aber nicht
durch singulär auftretende Außenreize ausgelöst.
38 Neurobiologie
DO01045455_Loesung_02.indd 38
14.04.2015 13:57:16
2. 3 Sinne — Grundlagen der Wahrnehmung
Menschliches Auge und Netzhaut (Seite 124)
0 A1 Die Elastizität der Linse nimmt im Alter ab. Erklären Sie, weshalb viele ältere Menschen eine
Lesebrille benötigen.
– Die Linse ist an den Zonulafasern aufgehängt und bei entspannten Zonulafasern durch die
Eigenelastizität kugelförmig. Dies ermöglicht den Wechsel von der Fern- zur Naheinstellung
(Nahakkommodation). Die Eigenelastizität lässt mit zunehmendem Alter (individuell unterschiedlich) immer mehr nach. Hierdurch wird die kugelförmige Gestalt der Linse nicht mehr bis
zum Endpunkt erreicht. Durch Linsen wird die Differenz ausgeglichen.
Adaptation — Anpassung der Lichtempfindlichkeit (Seite 125)
$ A1 Beschreiben Sie die Vorgänge im Auge bei starkem und schwachem Lichteinfall mithilfe des
Regelkreismodells in Abb. 2.
– Kommt mehr Licht auf das Auge, wirkt eine größere Größe (Störgröße) auf den Messfühler und
die vorgegebene Regelgröße ein. Der Vergleich von Istwert und Sollwert führt im Regler zum
Stellwert, der auf die Iris einwirkt. Durch die Verkleinerung der Pupille wird der Istwert dem
Sollwert wieder angeglichen.
Funktion der Netzhaut (Seite 127)
0 A1 Menschen sind „Dunkelseher“. Nehmen Sie Stellung zu dieser Aussage.
– Bei einer Erregung durch Licht sind die Na+-Ionenkanäle geschlossen. Bei Dunkelheit sind
viele Na+-Ionenkanäle geöffnet. Bei Lichteinstrahlung ist auf molekularer Ebene durch die
Veränderung des Rhodopsins das Schließen der Na+-Ionenkanäle bedingt. Licht führt daher zur
Hemmung, Dunkelheit zur Erregung der Impulse am Sehnerv.
Fototransduktion — Signaltransduktion (Seite 129)
$ A1 Erklären Sie mithilfe eines Textes, wie es zur Signalverstärkung von einem Molekül auf 1 Million kommt.
– Signale lösen über einen jeweils spezifischen Rezeptor eine Aktivierung von Molekülen innerhalb der Zelle aus. Jedes dieser Moleküle löst im nächsten Schritt die Aktivierung von Enzymen
aus, die zur Umsetzung vieler Moleküle beitragen. Diese aktivieren erneut Enzyme, was schnell
zu einer extremen Zunahme von Molekülen führt, die eine Zellantwort auslösen.
$ A2 Die Signalverstärkung wird auch als Reaktionskaskade bezeichnet. Eine Kaskade ist ein
mehrstufiger Wasserfall, der immer breiter wird. Erläutern Sie anhand von Abb. 2, wie es zu
diesem Vergleich kam, jedoch der Begriff „Kaskade“ zu einer falschen Vorstellung führt.
– Eine Kaskade ist ein Wasserfall, der immer breiter wird. Dies ist auch in Abb. 2 auf der Molekülebene deutlich zu erkennen. Bei dem Vorbild der Wasserkaskade wird jedoch die Fläche breiter, jedoch nimmt die Wassermenge nicht zu. Bei der Signalverstärkung erfolgt eine extreme Zunahme der jeweils verschiedenen Moleküle.
Farben entstehen im Kopf (Seite 130)
0 A1 Beschreiben Sie die Zusammenhänge in Abb. 3 und erklären Sie daran die Aussage „Farben
entstehen im Kopf“.
– Von der Sonne gelangen elektromagnetische Wellen in unsere Umgebung. Diese stellen jedoch
noch keine Farben dar, sondern lösen spezifisch an unseren Zapfen Erregungen aus, die zum
Gehirn geleitet werden. Hier wird den Erregungen eine Farbe zugeordnet. Betrachten wir eine
Tomate, werden bestimmte Wellenlängen an der Oberfläche absorbiert, andere reflektiert. Die
reflektierten Wellenlängen gelangen zu unserem Auge, erregen in der Netzhaut den Rotzapfentyp. Die weitergeleitete Erregung löst im Gehirn die Wahrnehmung der roten Farbe aus.
39 Neurobiologie
DO01045455_Loesung_02.indd 39
14.04.2015 13:57:16
Wahrnehmung (Seite 131)
0 A1 Erklären Sie, weshalb Wanderer in den Bergen bei Wetterlagen mit klarer Sicht Entfernungen nicht richtig einschätzen können.
– Wir können Entfernungen nicht direkt mit dem Auge messen. Entfernungen können wir nur
durch vorhandene Erfahrungen im Gehirn wahrnehmen. Hierzu gehört die Zunahme des
Dunstes und des Blauwertes bei größeren Entfernungen. Bei Wetterlagen mit klarer Sicht ist der
Dunst­anteil in der Luft sehr gering. Die Wahrnehmung der Entfernung erfolgt dadurch falsch,
dass sie auf unsere normalen Erfahrungen zurückgreift. Entfernungen werden geringer eingeschätzt, was zu Fehlern bei der Einschätzung von Wanderzeiten führt.
Kontraste verbessern die Wahrnehmung (Seite 133)
$ A1 Berechnen Sie die Werte der lateralen Inhibition für einen höheren und einen geringeren
Kontrast. Zeichnen Sie jeweils den Kurvenverlauf. Vergleichen Sie die jeweiligen Modellrechnungen.
– Bei den Modellrechnungen wurden folgende Vorgaben festgelegt (nicht gemessen):
1. An der hellen Fläche ist die Reizstärke viermal höher als an der dunkleren Fläche. 2. Über Horizontalzellen erfolgt eine Hemmwirkung von 20 % der Erregungsgröße.
Beispiel 1: siehe Schülerbuch, Abb. 4
Beispiel 2: siehe Tabelle
Reiz an der Lichtsinneszelle
Horizontalzelle
weitergeleitete Erregung
20
20
20
5
5
5
20-4-4
20-4-4
20-4-1
5-4-1
5-1-1
5-1-1
12
12
15
0
3
3
Vergleich: Je größer die Reizunterschiede (der Kontrast), desto größer die Differenz im Erregungsmuster bzw. umgekehrt.
Vom Reiz zum Sinneseindruck (Seite 135)
$ A1 Erklären Sie den medizinischen Fall in der Info-Box mit Erkenntnissen der Hirnforschung.
– Eine Patientin erkannte keine Bewegungen. Sie konnte Tee nicht in eine Tasse gießen, da sie
die Flüssigkeit nicht in Bewegung sah. Sie konnte die Geschwindigkeit von Fahrzeugen nicht
wahrnehmen, da die Fahrzeuge plötzlich hier und dann dort waren.
Die Sehnerven enden im Thalamus. Die Signale werden in die Sehregion der Großhirnrinde
geleitet. Diese teilt sich in verschiedene Rindenbereiche mit unterschiedlichen Aspekten des
Sehens auf, z. B. Registrierung von Erregungen aus den Augen, Farbe, Objekterkennung oder Bewegung. Bei der Patientin war in der Großhirnrinde der Bereich der Bewegungswahrnehmung ausgefallen.
$ A2 Fassen Sie anhand der Situation in Abb. 2 die Abläufe im Gehirn in Form eines Sachtextes
zusammen.
– Einzelne Erregungen der Stäbchen und Zapfen in der Netzhaut werden über den Sehnerv in
den Thalamus geleitet und verschiedenen Bereichen der Rindenfelder zugeordnet. Die Straße
mit dem roten Auto wird nicht im Auge wahrgenommen. Erst in den Rindenfeldern wird das
fahrende rote Auto wahrgenommen, das Gesamtbild entsteht. Die Information — das fahrende
Auto — erhält die größte Aufmerksamkeit und bestimmt die Wahrnehmung, andere Informationen werden ignoriert.
40 Neurobiologie
DO01045455_Loesung_02.indd 40
14.04.2015 13:57:16
2. 4 Bau und Funktion des Nervensystems
Nervensystem des Menschen (Seite 137)
0 A1 Begründen Sie anhand von Abb. 2, welche Körperreaktionen durch die Steuerung des Parasympathicus bzw. Sympathicus zu einer Leistungssteigerung bzw. Entspannung führen.
– Sympathicus: Die Erhöhung der Herzfrequenz, die Erweiterung der Bronchien, die Durchblutung
der Muskulatur, die Adrenalinausschüttung und der Glucoseabbau dienen der Leistungssteigerung. Die Reduzierung der Verdauungsvorgänge und die fehlende Harnentleerung bündeln die
Kräfte für Angriff oder Flucht.
Parasympathicus: Die Verdauungsvorgänge werden durch die Sekretion der verschiedenen
Drüsen und Verdauungsorgane verstärkt. Die geringere Herzfrequenz und die Verengung der
Bronchien sind für die Verdauungsphase ausreichend und energiesparend.
0 A2 Zivilisationskrankheiten, wie z. B. erhöhtes Infarktrisiko, Vergrößerung der Nebennieren,
Störung des Sexualverhaltens u. a., werden auch auf Dauerstress zurückgeführt. Erläutern Sie
die Zusammenhänge.
– Durch die Funktion des Sympathicus wird die ständige Flucht- und Angriffsbereitschaft gewährleistet. Andere Funktionen werden gleichzeitig verringert, um die Energie zu kanalisieren. Verdauungsvorgänge und das Sexualverhalten werden bei Dauerstress langfristig reduziert. Dies
führt zu den Störungen. Die gleichzeitig erhöhte Herzaktivität und Erweiterung der Bronchien
führen zu einer ständigen Überreaktion, die biologisch nur für kurze Zeiten während der Flucht
oder des Angriffs eine Bedeutung hat.
Nerven und Hormone regeln Körperfunktionen (Seite 139)
$ A1 Beschreiben Sie die Abb. 5 und erläutern Sie die Zusammenhänge unter den Aspekten der
Energiebereitstellung und der Signalverstärkung (S. 128).
– In Abb. 3 wird der Aufbau einer Arterie dargestellt. Dargestellt ist die glatte Muskulatur, die
das Lumen der Arterie verringern kann oder eine Gefäßerweiterung zulässt. Innerviert wird die
Arterie durch eine Nervenfaser des Sympathicus. Dies führt zu einer Ausschüttung von Noradre­
nalin, die zur Kontraktion der Arterien und dadurch zu einer geringeren Durchblutung führt.
Adrenalin gelangt durch den Blutfluss zu den spezifischen Abschnitten der Arterie, wo es an die
Adrenalinrezeptoren andocken kann. Dies führt zur Erweiterung der Arterien und somit zu einer
verbesserten Durchblutung. Sie führt zu einer besseren Versorgung des Gewebes mit Sauerstoff
und Nährstoffen. Der Adrenalin-Rezeptor wird angeregt und führt zu Bildung von c-AMP, die
den Abbau von Glykogen in Glucose aktiviert.
$ A2 Beziehen Sie die Ergebnisse aus Aufgabe 1 auf die Vorgänge in den Bronchien und der Blutbahn unter dem Aspekt des Fight-or-Flight-Syndroms.
– Auch in den Bronchien wirken das vegetative Nervensystem und Adrenalin auf die Kontraktion
und Erweiterung, hier jedoch auf die Bronchien. Durch diese Vorgänge wird die Sauerstoffversorgung der Alveolen geregelt und die Leistungssteigerung sowie Leistungsreduzierung (Energiesparmodus) in den jeweiligen Geweben kann gesteuert werden (Fight-or-flight-Syndrom).
. A3 Erläutern Sie die Bedeutung der neuronalen und hormonellen Regelung an den genannten
Beispielen.
– Durch die neuronale und hormonelle Regelung kann kurzfristig und langfristig die Aktivität des
Stoffwechsels geregelt werden.
Modellvorstellungen zum Gedächtnis (Seite 145)
$ A1 Erstellen Sie eine Mind-Map, in der Sie die Teile des inhaltsbezogenen Gedächtnismodells
bewussten und unbewusstem Lernen zuordnen.
– Bei der c-Map müssen folgende Begriffe vorhanden sein: inhaltsbezogenes Gedächtnis
bewusst: episodisches Gedächtnis, Wissensgedächtnis, perzeptuelles Gedächtnis
unbewusst: prozedurales Gedächtnis, Priming
Neuronale Plastizität — Dauerbaustelle Gehirn (Seite 147)
$ A1 Erklären Sie die Bedeutung des Übens und Wiederholens beim Lernvorgang unter dem
Aspekt der Plastizität. Welche persönlichen Lernstrategien entwickeln Sie aus dieser Sicht?
– Üben und Wiederholen ist notwendig für ein erfolgreiches Lernen, da durch die ständige Auseinandersetzung mit dem Gelernten immer mehr Synapsen gebildet werden. Mit jeder Wiederholung ändern sich die Aspekte etwas und die Zusammenhänge werden an zusätzlichen Stellen
gespeichert. Dadurch steigt die Anzahl der Synapsen und es sind mehr zusätzliche Speicherorte.
41 Neurobiologie
DO01045455_Loesung_02.indd 41
14.04.2015 13:57:16
Material: Erforschung der Plastizität (Seite 148/149)
0 A1 Beschreiben Sie die Daten in Abb. 1. Erläutern Sie den Unterschied zwischen den beiden
Stadien nach langzeitigen optischen Reizen.
– In Abb. 1 erkennt man die Verknüpfung untereinander über die Dornen. Mithilfe der Fluoreszenz lassen sich die Neuronen und ihre Veränderungen nachweisen. Nach langfristigen Reizen
erkennt man die Zunahme der Dornen(fortsätze), die seitlich aus dem Axon herauswachsen.
$ A2 Erläutern Sie, weshalb die ersten Ansätze zur Untersuchung der Plastizität nicht die Realität
des Lernvorgangs darstellten.
– In Versuchen an isolierten Neuronen ist keine natürliche Bedingung wie im Gewebe vorhanden.
Daher können dieses Aussagen nur als erste naturwissenschaftliche Erkenntnisse gesehen
werden, müssen jedoch mit dieser Fragestellung im Gewebe bestätigt werden.
$ A3 Nehmen Sie zu der Aussage eines Neurowissenschaftlers Stellung: „Aus Trampelpfaden
zwischen Nervenzellen werden Straßen.“
– Die Aussage der Wissenschaftler vergleicht die Entwicklung vom Trampelpfad zur Straße mit
der Zunahme der Verknüpfungen an den Neuronen. Hier wird ebenfalls durch den ständigen
Gebrauch eine Veränderung herbeigeführt, die zu einer intensiveren Nutzung führt.
$ A4 Beschreiben Sie Abb. 3 und 4 und erläutern Sie die Aussagen.
– In Abb. 3 und 4 sind Untersuchungsergebnisse zur Erinnerung als Säulendiagramm dargestellt.
Auf der y-Achse ist die Anzahl der erinnerten Begriffe aufgetragen bei Versuchen mit Begriffen
mit einer persönlichen Bedeutung und ohne Bedeutung. Die Messungen zeigen, dass bei den
Begriffen mit Bedeutung die Werte bei 7 und 13 erinnerten Begriffen liegen, bei Worten ohne
Bedeutung jedoch nur bei ca. 2. Deutlich wird der höhere Wert von 13 erinnerten Begriffen nach
einer Schlafphase gegenüber 7 ohne Schlafphase. Dieses Aussagen decken sich mit den Ergebnissen in Aufgabe 4. Bei denen ist auf der y-Achse die Hypocampusaktivität aufgetragen. Die
beiden Säulen wurden bei Schlafmangel und genügend Schlaf aufgenommen. Hier zeigen die
Messwerte eine Steigerung der Aktivität bei ausreichendem Schlaf, jedoch eine Verringerung bei
Schlafmangel.
$ A5 Beschreiben Sie das Modell in Abb. 2 und erläutern Sie, wie die Ergebnisse aus den wissenschaftlichen Untersuchungen hier berücksichtigt sind.
– Das Modell zur Bedeutung des Schlafes in Bezug auf die Speicherung von Begriffen geht von
einem Wachzustand und einer Schlafphase aus. Im Wachzustand werden mit Begriffe mit
Emotionen, persönlicher Aufmerksamkeit und Bedeutung mit Begriffen ohne Relevanz aufgenommen. Diese Begriffe werden im Modell während des Wachzustands im Hippocampus
dargestellt. Sie werden den jeweiligen Regionen in der Großhirnrinde zugeordnet. In der Schlafphase erfolgt eine Zuordnung und Löschung der verschiedenen Begriffe und eine Leerung des
Hippocampus. In der folgenden Wachphase ist eine Intensivierung in der Großhirnrinde bei den
Begriffen mit Emotionen, Aufmerksamkeit und Bedeutung erfolgt. Die bedeutungslosen Begriffe
sind sowohl im Hippocampus als auch in der Großhirnrinde verschwunden. Das Modell lässt
sich ableiten aus den Ergebnissen der größeren Effektivität mit Schlafphasen gegenüber dem
Schlafmangel. Ebenso ist die Steigerung der erinnerten Begriffe mit Bedeutung gegenüber den
Begriffen ohne Bedeutung in dem Modell enthalten.
$ A6 Beschreiben Sie die Messergebnisse in Abb. 5a. 1. und 2. Ordnen Sie diese den Versuchsmaterialien 5b zu.
– In Abb. 5b werden Experimente dargestellt, bei denen Gegenstände durch einen anderen ersetzt wurden oder die räumliche Anordnung der Gegenstände verändert wurde. Die Messungen
mithilfe der bildgebenden Verfahren während der Aufgabenstellung sind in Abb. 5a dargestellt.
Im Cortex werden je nach Aufgabe ähnliche Regionen aufgerufen, jedoch mit unterschiedlicher
Aktivität und einer unterschiedlichen Ausdehnung der aktivierten Bereiche. Hierdurch wird
deutlich, dass zwar ähnliche Cortex-Bereiche eine Rolle spielen, die unterschiedlichen Aufgaben
jedoch unterschiedlich wirken.
. A7 Erläutern Sie, ob durch dieses Ergebnis die wissenschaftliche Fragestellung geklärt werden
konnte. Stellen Sie diese Ergebnisse in einen Zusammenhang mit den Aussagen zur Auswertung von optischen Reizen im Gehirn (s. Seite 134).
– Die Fragestellung der Wissenschaftler, ob die gleichen räumlichen Bereiche des Cortes für das
Erkennen der räumlichen Anordnung und der Gegenstände für die Speicherung genutzt werden,
konnten nur teilweise beantwortet werden, da sich Unterschiede zeigen, jedoch viele gemeinsame Bereiche vorliegen, die auch zusätzliche Bedeutungen haben könnten.
42 Neurobiologie
DO01045455_Loesung_02.indd 42
14.04.2015 13:57:16
. A8 In den fMRT-Bildern 3 und 4 (Abbildung 5a) wurden mithilfe eines Computers die jeweiligen
Werte des anderen Teilversuches abgezogen. Erklären Sie, welchen Vorteil diese zusätzliche
Darstellungsform für die wissenschaftliche Auswertung hat.
– In Abb. 5a, Teil 3 und 4 wurden die Messwerte elektronisch bearbeitet. Sie geben die jeweiligen
Differenzen der Messwerte aus den Messungen 1 und 2 wieder. Hierdurch entfallen Bereiche mit
gemeinsamen Aktivitäten, die bisher nicht deutlich wurden. Durch diese Differenzbildung wird
jedoch deutlich, dass verschiedene Regionen auf dem Cortex eine Rolle spielen. Die Fragestellung konnte so eindeutiger bearbeitet werden.
0 A9 Beschreiben Sie die Messergebnisse in Abb. 6. Informationen zur fMRT finden Sie auf Seite
143.
– In Abb. 6 sind verschiedene Aktivitäten in Cortex-Bereichen mithilfe der bildgebenden Verfahren
dargestellt. Hierbei zeigen sich unabhängig von den Inhalten ähnliche Bereiche bei der Wahrnehmung von Bildern, jedoch andere Bereiche bei der Wahrnehmung von Geräuschen.
$ A10Erläutern Sie anhand der Messerergebnisse und des Versuchsaufbaus, ob die Fragestellung
der Wissenschaftler dadurch beantwortet werden konnte.
– Die Fragestellung der Wissenschaftler war, ob mit Begriffen nur visuelle oder auch auditive
Eindrücke verknüpft werden. Hierzu wurden Begriffe entweder mit visuellen oder auditiven Informationen verschiedenen Versuchspersonen gekoppelt. Anschließend werden mithilfe der bildgebenden Verfahren die Cortexregionen untersucht, während die Begriffe vorgetragen werden.
Hier zeigt sich in den Messungen, dass je nach Kombination der Begriffe mit den zusätzlichen
Informationen die auditive oder visuelle Region aktiviert wird. Bei der visuellen Region erkennt
man auch, dass hier spezifische Unterschiede auftreten können. Die Ergebnisse sind daher eine
eindeutige Antwort auf die wissenschaftliche Fragestellung.
$ A11Neue Informationen werden mit vorhandenen Informationen assoziiert (s. Seite 146). Erläutern Sie, welche Auswirkung das Ergebnis auf die Optimierung von Lernen hat.
– Für die Optimierung des Lernens lässt sich aus diesen Ergebnissen folgern, dass eine interessante Lernumgebung, in der die Begriffe z. B. visualisiert werden, zu einer zusätzlichen Abspeicherung im Cortex führen.
Degenerative Erkrankungen — Demenz (Seite 151)
$ A1 Beschreiben Sie die Vorgänge bei den Tau-Proteinen und begründen Sie, weshalb es bei den
Gedächtnis- und Denkleistungen zu Funktionsausfällen kommt.
– Tauproteine stabilisieren das Cytoskelett, das die Aufgabe des Stofftransports zu den Synapsen
hat. Durch eine stärkere Reaktion mit Phosphaten (Phosphorylierung) verfasern die Tauproteine zu Neurofibrillen. Dadurch wird das Cytoskelett zerstört. Die Versorgung der Synapsen ist
unterbrochen, Neuronen sterben ab. Zum Ausfall von Gedächtnis- und Denkleistungen kommt
es besonders, da diese Zerstörung besonders in den Regionen des vorderen Großhirns und des
Hippocampus, den Regionen des Lernens und des Gedächtnisses, ablaufen.
Schlaf und Traum (Seite 153)
$ A1 In der Randspalte ist die Gehirnaktivität eines Gehirns in der Nicht-REM-Phase (1) und in der
REM-Phase (2) dargestellt. Erklären Sie, welche Erkenntnisse aus diesen Messungen gezogen wurden. Die Region mit der sehr hohen Aktivität ist der Thalamus.
– Die Traumarbeit übernimmt die Aufarbeitung wichtiger Gedächtnisinhalte. Im Traum werden
bedeutsame Erlebnisse der letzten Wachphase umstrukturiert und für den Langzeitspeicher
bearbeitet. Thalamus, Hypothalamus, Hippocampus, Sehrinde und Amygdala sind in der REMPhase aktiv (Abb. 2). Der Thalamus verhindert, dass neue Informationen aufgenommen werden
und fördert, dass die vorhandenen umgebaut werden.
0 A2 In der REM-Phase ist in der Hirnrinde ein Hirnareal inaktiv. Erläutern Sie, welche biologische
Bedeutung dies hat.
– Das Hirnareal für Bewegung und Raumwahrnehmung ist gehemmt, sodass es während des
Schlafes keine körperlichen Reaktionen auf die Träume gibt. Die biologische Bedeutung liegt im
Schutz vor Bewegungen in irrealen Traumvorstellungen.
43 Neurobiologie
DO01045455_Loesung_02.indd 43
14.04.2015 13:57:16
Sucht nach Belohnung (Seite 154)
$ A1 Erklären Sie, weshalb das Erscheinungsbild nach Alkoholgenuss sehr unterschiedlich sein
kann.
– • Alkohol wirkt auf viele Rezeptoren, besonders auf die Transmitter Glutamat und GABA. Über das Belohnungssystem (Nucleus accumbens) treten euphorisierende Zustände auf.
• Alkohol erhöht die Aktivität der GABA-Rezeptoren. Dies führt zu einer Verminderung der Erregungen im Bereich der Amygdala. Dies erklärt die beruhigende und angstlösende Wirkung
des Alkohols.
• Die Hemmung im Limbischen System bedingt eine geringe Hemmung im Nucleus accumbens.
Dies führt zu euphorischem Verhalten bis zu Enthemmungserscheinungen.
• Alkohol wirkt auf die Acetylcholin-Freisetzung an der präsynaptischen Membran der Synap­
sen. Hier wird sowohl der neuromuskuläre Teil gehemmt, was zu einer Erschlaffung der
Muskulatur führt, als auch die Aufnahme neuer Informationen in das Gedächtnis. Dies führt
zu Erinnerungslücken.
• Im autonomen Nervensystem im Rückenmark kommt es zu Störungen, wie der Verringerung
der Herzschlagfrequenz.
Material: Psychoaktive Stoffe (Seite 155)
$ A1 Sportmediziner untersuchten verschiedene Personen vor und nach einen Ausdauerlauf. Die
Fragestellung bei dieser Untersuchung war, den Grad der empfundenen Euphorie durch einen Ausdauerlauf zu ermitteln. Beschreiben Sie die Ergebnisse der zehn Läufer und erläutern
Sie, ob die Fragestellung beantwortet werden konnte (Abb. 1).
– Die Versuchsergebnisse in Abbildung 1 zeigen die Messergebnisse vor dem Lauf und nach dem
Lauf von zehn Personen. Die Messergebnisse sind bei den zehn Personen unterschiedlich und
variieren in einem bestimmten Bereich sowohl vor dem Lauf als auch nach dem Lauf. Die individuellen Empfindungen sind trotzdem aussagefähig, da unabhängig vom Ausgangsergebnis
eine Euphoriezunahme stattgefunden hat. Die Fragestellung ist daher sinnvoll, muss jedoch zu
einer konkreten Hypothese führen.
$ A2 Erklären Sie, weshalb diese Ergebnisse mit anderen naturwissenschaftlichen Methoden
unterstützt wurden, um eindeutige Aussagen zu ermöglichen.
– Die Untersuchungen beruhen auf Empfindungen, die zu naturwissenschaftlichen Hypothesen
führen. Diese müssen jedoch mit naturwissenschaftlichen Messwerten zu einer Lösung oder zur
Veränderung der Hypothese führen. Hierzu müssen Messwerte hinzugezogen werden.
$ A3 Beschreiben Sie kurz die Technik des Markierungsexperimentes und erläutern Sie, wie man
das Experiment nutzen konnte, um die Fragestellung zu präzisieren.
– Bei den Experimenten wird eine radioaktive Substanz eingesetzt, die an Opiatrezeptoren binden
kann. Durch die Radioaktivität ist sie im zu untersuchenden Gewebe gut nachweisbar. Sie konkurriert mit den Endorphinen um die Opiatrezeptoren. Je mehr Endorphine im Gehirn freigesetzt
werden, umso geringer ist die Wahrscheinlichkeit, dass die Markierungssubstanz andockt.
Nach dem Lauf ist weniger Markierungssubstanz an den Opiatrezeptoren. Dies bedeutet, dass
während des Laufes viele körpereigene Opiate freigesetzt wurden. Das Experiment kann die
Hypothese also bestätigen.
$ A4 Nehmen Sie Stellung zu der Behauptung, Joggen mache schmerzfrei. Geben Sie hierzu auch
auf die Ergebnisse des ersten Versuchs ein.
– Die Untersuchung mit radioaktiv markierten Substanzen, die im Gehirn direkt nachzuweisen
sind, macht deutlich, dass Regionen der Emotionsverarbeitung und der Schmerzunterdrückung
nach dem Lauf aktiviert sind. Dies erklärt auch die Empfindungen der zehn Testpersonen. Die
Behauptung kann daher richtig sein, jedoch wird die Ursache der Schmerzen hierdurch nicht
beeinflusst.
Neuro-Enhancer — Doping für das Gehirn (Seite 157)
$ A1 Stellen Sie anhand der Fakten aus dem Text Ihre persönliche Einschätzung zu den NeuroEnhancern dar.
– Mithilfe der Seiten 10/11 „Kriterien der Bewertung“ kann die persönliche Bewertung der verschiedenen Kriterien durchgeführt werden. Aspekte sind: Wachmacher, Konzentrationsförderer,
Selbsteinschätzung verändert sich, hauptsächlich Kurzzeitgedächtnis nicht Kreativität gesteigert, Leute mit niedrigem IQ haben mehr Vorteile, Fight-or-flight-Syndrom wirkt ähnlich aber
kurzfristiger, Sucht möglich, psychische Veränderungen, psychischer Absturz nach dem Absetzen
der Substanzen.
44 Neurobiologie
DO01045455_Loesung_02.indd 44
14.04.2015 13:57:17
Übungen: Neurobiologie (Seite 158/159)
0 A1 Fassen Sie anhand der Abb. 1 den Fangvorgang der Venusfliegenfalle zusammen.
– Fliegen gelangen auf die Innenseite des Blattes und berühren die Sinneshaare (1). Hierdurch
schließt sich das Blatt durch Motorzellen, sodass ein geschlossener Raum innerhalb des gefalteten Blatts entsteht, in dem die Fliege gefangen ist (2). Die Verdauungsdrüsen geben Substanzen ab, die zur Verdauung der Fliegen im gefalteten Blatt führen (3).
$ A2 Beschreiben Sie Abb. 2 und erklären Sie das Zustandekommen des Membranpotentials
mithilfe der Ionenpermeabilität.
– In Abb. 2 sind der Potentialverlauf in mV und die Ionenpermeabilität von Kalium- und Chloridionen an der Zellmembran der Motorzellen über einen Zeitraum von 8 s dargestellt. Ohne
Reizung liegt das Membranpotential bei ca. –90 mV. Die Ionenpermeabilität der Chlorid- und
Kaliumionen ist sowohl in die Zelle als auch nach außen durch die Membran ausgeglichen.
Durch einen Reiz erhöht sich die Permeabilität der Chlorid- und Kaliumionen innerhalb einer Sekunde drastisch. Hierbei steigt die Permeabilität der Chloridionen sofort an. Das Potential
steigt schnell auf ca. +40 mV. Durch den starken Ionenfluss der negativ geladenen Chloridionen
aus der Zelle kommt es zu einer Veränderung der Ionenkonzentrationen innerhalb und außerhalb der Zelle. Diese führt zu der Veränderung des Potentials an der Zellmembran. Danach
flacht es innerhalb von 2 Sekunden wieder ab. Der Anstieg der positiv geladenen Kaliumionen
gleicht das Potential wieder aus.
$ A3 Erläutern Sie, wie es zur Schließbewegung kommt.
– Die Veränderung der Ionenkonzentration innerhalb der Motorzellen verändert den osmotischen
Druck der Zelle. Dies wird verstärkt durch die Weiterleitung der Membranpotentiale auf benachbarte Zellen, sodass der osmotische Druck der Zellen (Turgor) in einem ganzen Zellbereich
geringer wird.
. A4 Vergleichen Sie die Potentialbildung an der Membran bei der Venusfliegenfalle mit der einer
tierischen Zelle.
– Bei einer tierischen Zelle verändert sich die Permeabilität der positiv geladenen Natriumionen
beim schnellen Anstieg des Potentials. Dies ist gleichzusetzen mit dem schellen Änderung der
Permeabilität der negativ geladenen Chloridionen bei der Venusfliegenfalle. Der Ausgleich des
Potentials erfolgt bei der tierischen Zelle durch den Einstrom der positiv geladenen Kalium‑
io­nen, bei der Venusfliegenfalle durch den Ausstrom der Kaliumionen. In beiden Fällen erfolgt
ein Ausgleich der Ladungen.
0 A5 Beschreiben Sie den Versuchsaufbau und die Messergebnisse in Abb. 3.
– An einem Axon ist ein Teilstück stark gekühlt. Vor diesem Kälteblock wird ein Reiz ausgelöst. In
unterschiedlichen Abständen nach dem Kälteblock wird eine Potentialmessung durchgeführt.
Die Messergebnisse zeigen, dass hinter dem Kälteblock Potentiale vorliegen. Diese ausgelösten
Potentiale werden mit zunehmender Entfernung immer kleiner.
$ A6 Erklären Sie anhand der Messergebnisse die unterschiedlichen Prozesse am Riesenaxon vor
und nach dem Kälteblock auf molekularer Ebene.
– Die Axonmembran wird durch einen Reiz depolarisiert. Dadurch wird die Leitfähigkeit der Na+Ionen erhöht. Es ändert sich das Membranpotential und durch diese Veränderung des elektrischen Feldes werden die benachbarten spannungsabhängigen Ionenkanäle geöffnet. An der
gekühlten Stelle findet eine geringe Ionenbewegung statt, wodurch sich das Membranpotential
kaum ändert. Es kommt zu keiner Weiterleitung. Das elektrische Feld vor dem Kälteblock wirkt
jedoch noch auf die spannungsabhängigen Kanäle nach dem Kälteblock. Mit zunehmender
Entfernung wird es immer schwächer.
. A7 Erläutern Sie anhand der Messergebnisse, welche der beiden Hypothesen durch die Versuche von Hodgkin bestätigt wurde.
– Die Hypothese, dass Ionen entlang des Axons transportiert werden, konnte widerlegt werden,
da die geringe Temperatur die Ionenbewegung „einfriert“ und keine weiteren Potentiale nach
dem Kälteblock auftreten können. Das elektrische Feld ist kälteunabhängig und nimmt mit der
Entfernung ab, was auch den Messungen von Hodgkin entspricht.
0 A8 Stellen Sie mithilfe eines Textes die Vorgänge in den Lichtsinneszellen, z. B. den Stäbchen,
dar.
– In den Stäbchen der Netzhaut sind die Sehpurpurmoleküle (Rhodopsin). Rhodopsinmoleküle
reichen durch die Membran hindurch. Es besteht aus Retinal und Opsin. Durch Lichteinfall
verändert das Retinal die räumliche Struktur und spaltet das Retinal ab. Dieses wirkt indirekt
auf die Na+-Ionenkanäle ein und führt zum Schließen der Na+-Ionenkanäle. Hierdurch sinkt die
Membranspannung.
45 Neurobiologie
DO01045455_Loesung_02.indd 45
14.04.2015 13:57:17
$ A9 Beschreiben Sie den Verlauf des in Abb. 4 dargestellten Rezeptorpotentials und vergleichen
Sie diesen mit dem Verlauf des Aktionspotentials.
– Das Membranpotential ist bei verschieden intensiven Lichtreizen gegen die Zeit gemessen worden. Je höher die Lichtintensität ist, desto stärker sinkt das Membranpotential. Die unterschiedlichen Reizintensitäten führen hier zu unterschiedlichen Potentialintensitäten, die sich durch die
Höhe des Ausschlags in der Messung zeigen (Amplitude). Das Aktionspotential ist immer gleich
hoch und kommt häufiger oder weniger häufig (Frequenz).
. A10Nennen Sie Ursachen der unterschiedlichen Potentialverläufe.
– In den Stäbchen ist die Potentialhöhe von der Anzahl der gespaltenen Rhodopsinmoleküle
abhängig, die auf die substratgesteuerten Ionenkanäle wirken. Das Aktionspotential wird durch
spannungsabhängige Ionenkanäle ausgelöst.
. A11Deuten Sie die Messergebnisse.
– Je höher die Lichtintensität ist, desto mehr Rhodopsinmoleküle werden im gleichen Zeitraum
gespalten und umso mehr Na+-Ionenkanäle werden geschlossen. Dies führt zu den unterschiedlichen Potentialstärken.
0 A12Beschreiben Sie mithilfe einer Zeichnung und des Textes die Teilschritte der Erregungsweiterleitung an einer Synapse.
– Ein Aktionspotential kommt über das Axon an einer Synapse an. Hierdurch wird in den Endknöpfchen die Ausschüttung von Transmittern ausgelöst. Je nach Anzahl der Potentiale werden
mehr oder weniger Transmitter freigesetzt. An der postsynaptischen Membran werden durch
die Transmitter Ionenkanäle geöffnet, durch die Natriumionen einströmen. Die Transmitter
werden gespalten und können in der Synapse wieder recycelt werden.
$ A13Beschreiben Sie den Aufbau der Messanordnung in Abb. 6. Erklären Sie die drei Messkurven
und stellen Sie dar, auf welche Weise eine Bewegungskoordination mehrerer Neurone erfolgen kann.
– Bei der Ableitung von Muskelspindeln aus den Beinmuskeln (Strecker und Beuger) werden
Reize ausgelöst und an einem Neuron des Rückenmarks mithilfe einer Glasmikroelektrode die
Potentiale gemessen. Es geht um die erregenden und hemmenden postsynaptischen Potentiale. Wird an dem Axon von der Spindel des Beugers ein Reiz ausgelöst, so ist am Neuron ein
erregendes postsynaptisches Potential zu messen. Bei der Erregung des Axons von der Spindel des Streckers ist ein inhibitorisches Potential zu messen. Hier ist ein hemmendes Neuron
dazwischengeschaltet. Werden beide Axone gereizt, entsteht nur ein sehr kleines Potential. Die
Koordination der Bewegung kann hierdurch sinnvoll geschaltet werden, da Bewegungsabläufe
von Antagonisten durch Hemmung und Erregung sinnvoll geregelt werden können. Die Muskeln
werden kontrahiert oder sie erschlaffen.
$ A14Beurteilen Sie an diesem Beispiel die Vor- und Nachteile der Fortleitung über Synapsen.
– Die Leitungsgeschwindigkeit ohne Synapsen ist zwar höher, jedoch sind Verschaltungen zur Verstärkung oder Schwächung von Erregungen nur über Schaltstellen wie den Synapsen möglich.
0 A15Beschreiben Sie die Messergebnisse am Axon in Abb. 7.
– In Abb. 7 ist der Verlauf des Membranpotentials mit und ohne Zugabe von Tetrodotoxin über einen Zeitraum von ca. 5 ms angegeben. Das Membranpotential ohne Tetrodotoxin hat ein Maximum bei ca. +30 mV und zeigt den typischen Verlauf eines Aktionspotentials. Das
Membran­potential mit Tetrodotoxin erhöht sich langsam bis –40­mV und fällt darauf langsam
wieder ohne den charakteristischen Verlauf eines Aktionspotentials.
$ A16Erklären Sie, weshalb am Axon bei Zugabe von Tetrodotoxin kein Aktionspotential ausgelöst
wird und welchen Bezug diese zur Atemlähmung hat.
– Das Tetrodotoxin bindet an die spannungsabhängigen Natriumionenkanäle und verschließt diese dadurch. Ohne die fehlenden Ionenströme kommt es zu keiner Depolarisation an der Axonmembran. Ein Aktionspotential kann nicht entstehen. Hierdurch kommt es an den Nervenzellen
zu keiner Weiterleitung der Aktionspotentiale und somit zu keiner Erregung an den Muskeln der
Atemmuskulatur.
46 Neurobiologie
DO01045455_Loesung_02.indd 46
14.04.2015 13:57:17
3 Ökologie
3. 1 Lebewesen und Umwelt
Wechselbeziehungen in der Biosphäre (Seite 163)
0 A1 Erläutern Sie die Einflüsse auf die Biosphäre 2, wenn sich über einen längeren Zeitraum viele
Wolken am Himmel befinden.
– Durch die geringere Lichteinstrahlung sinkt die Fotosyntheserate und damit auch die Sauerstoffproduktion. Die aeroben Stoffwechselprozesse finden aber weiterhin statt. Der Sauerstoffgehalt in der Biosphäre 2 sinkt.
0 A2 Das Experiment mit der Biosphäre 2 kann man in einem kleinen Rahmen zu Hause durchführen, indem man einen Flaschengarten anlegt. In diesem befinden sich Moose, Farne und
langsam wachsende Pflanzen sowie Tiere wie Hundertfüßer, Asseln und Springschwänze, die
sich in der zugeführten Erde befinden. Beschreiben Sie die Wechselwirkungen innerhalb des
Flaschengartens.
– Moose, Farne und Pflanzen betreiben Fotosynthese und stellen Sauerstoff sowie energiereiche
Stoffe her. Sie werden deshalb auch als Produzenten bezeichnet. Heterotrophe Organismen,
die Tiere, sind die Konsumenten. Sie verstoffwechseln die energiereichen Stoffe zusammen mit
dem Sauerstoff zur Bereitstellung von Energie. Dabei werden Kohlenstoffdioxid und Wasser
produziert, die wieder von den Pflanzen verbraucht werden. Destruenten sind Mineralisierer. Sie
wandeln tote organische Abfallstoffe in anorganische um.
Einfluss der Temperatur (Seite 164)
$ A1 Erläutern Sie Überwinterungsstrategien homoiothermer Lebewesen.
– Zugvögel fliegen im Winter in wärmere Regionen. Sie haben den hohen Energieaufwand für den
Flug, finden in den Überwinterungsgebieten jedoch ausreichend Nahrung. Winterschläfer setzen die Körpertemperatur deutlich herab. Durch den geringeren Stoffwechsel
wird weniger Energie verbraucht. Bei der Winterruhe sinkt die Körpertemperatur nicht so stark
ab. Diese Tiere wachen im Winter mehrfach auf und suchen Nahrung.
Material: Energie und Lebensweise (Seite 165)
$ A1 Erklären Sie anhand der Abb. 1 und der Werte zur Wärmeleitfähigkeit, wie es zu der geringen
Außentemperatur des Seehundkörpers kommt.
– Ein Fell hat einen besseren Wert bei der Isolierung, da die Wärmeleitfähigkeit geringer ist als
die des Fettes. Die gute Isoliereigenschaft wird jedoch durch die im Fell eingeschlossene Luft
bewirkt. Beim Tauchen entweicht sie. Der Blubber ist nicht ganz so optimal wie ein Fell an der
Luft, jedoch besser als ein Fell unter Wasser.
. A2 Beurteilen Sie, ob ein Fell bei dem Seehund den gleichen Effekt zeigen würde.
– Die Wärmeleitfähigkeit verschiedener Stoffe ist sehr unterschiedlich. Luft hat den geringsten
Wert, Wasser hat einen sehr hohen. Seehunde als Regulierer würden im Wasser daher sehr
viel Körperwärme abgeben. Dies wäre ein Nachteil, da sie mehr Nahrung aufnehmen müssten,
um den Wärmehaushalt aufrechtzuerhalten. Seehunde haben eine sehr dicke Blubberschicht
aus Fett. Fettgewebe hat eine geringere Wärmeleitfähigkeit als das Wasser. Die Durchblutung
ändert sich, wenn der Seehund in das kalte Wasser gelangt. Die in der Blubberschicht — nahe
der Körperoberfläche — verlaufenden Blutgefäße werden verschlossen und das warme Blut
durch Gefäße unterhalb des Blubbers geleitet. Hierdurch kommt es zu einer deutlich geringeren
Wärmeabgabe.
0 A3 Beschreiben Sie die Materialien zum Energiehaushalt der Kolibris (Abb. 3 und 4).
– Durch den hohen Wärmeaustausch mit der Umgebung, der durch die große relative Oberfläche
begründet ist, müssen die Kolibris viel energiereiche Nahrung aufnehmen. Da sie nur geringe
Mengen an Reservestoffen speichern können, besteht die Gefahr, dass sie in den kälteren
Tagesstunden oder in der Nacht den Stoffwechsel nicht ausreichend aufrechterhalten können
und sterben. Durch das Absenken der Körpertemperatur wird die Stoffwechselaktivität gesenkt
und der Zeitraum zum Überleben verlängert, da die Reservestoffe nicht so intensiv genutzt
werden müssen. Da die Kolibris in der Torporphase nicht so aktiv sind, besteht die Gefahr, von
anderen Tieren gefressen zu werden. Im Gegensatz zu den Winterschläfern (mit dem gleichen
Mechanismus) ist daher der kurze Zeitraum im Minimalbereich der Energiereserven von Vorteil,
da hierdurch der Schutz vor Fressfeinden besser ist.
. A4 Erklären Sie anhand der Materialien die Bedeutung des Torpors für Kolibris.
– Kolibris haben bei der geringen Körpergröße eine relativ große Körperoberfläche und dadurch
einen hohen Wärmeaustausch mit der Umgebung. Der Sauerstoffverbrauch ist bei den Kolibris
im wachen Zustand bei verschiedenen Lufttemperaturen deutlich höher als bei Kolibris im
Torpor. Die Messwerte zum Torpor liegen nur im Bereich von 0 °C bis 20 °C vor. 47 Ökologie
DO01045455_Loesung_03.indd 47
14.04.2015 14:11:49
Der Sauerstoffverbrauch sinkt mit zunehmender Temperatur. Die Energiereserven eines Kolibris
verändern sich im Laufe des Tages. Sinken die Werte in einen minimalen Bereich, fallen die
Kolibris in den Torpor.
0 A5 Beschreiben Sie Abb. 6 und vergleichen Sie die Daten zu Maus und Zauneidechse.
– Das Diagramm zeigt die Stoffwechselrate einer Maus und einer Eidechse in Abhängigkeit
von der Temperatur. Die Stoffwechselrate der Eidechse steigt kontinuierlich mit zunehmender
Temperatur von 2 bis 40 °C. Die Stoffwechselrate der Maus sinkt von 2 °C bis 28 °C, bleibt dann
bis ca. 35 °C konstant und steigt danach wieder an. Es wird deutlich, dass die Stoffwechselaktivität der Eidechse direkt mit der Außentemperatur gekoppelt ist. Eidechsen sind Konformer,
die Zunahme der Stoffwechselaktivität lässt sich mithilfe der RGT-Regel erklären. Die Maus als
Regulierer hat bei niedrigen Außentemperaturen eine hohe Stoffwechselaktivität, da sie ihre
Körpertemperatur konstant hält. Mäuse gleichen die Körpertemperatur bei höheren Außentemperaturen durch Kühlmechanismen an. Dies erhöht ebenfalls die Stoffwechselrate.
$ A6 Beurteilen Sie anhand der Daten die Vor- und Nachteile der Homoiothermen und Poikilothermen in verschiedenen Lebensräumen.
– Die Regulierer sind zwar unabhängig von der Außentemperatur, benötigen durch die hohe
Stoffwechselrate jedoch genügend Nährstoffe zur Aufrechterhaltung der Stoffwechselrate. Sie
sind jedoch im Vorteil gegenüber Fressfeinden. Die Eidechsen als Konformer benötigen bei Kälte
weniger Energie als die Regulierer, sind jedoch stärker durch Fressfeinde gefährdet.
Ökologische Potenz und Präferenz (Seite 166)
$ A1 Vergleichen Sie das Vorkommen und die Laichzeiten von Bachforelle und Karpfen mit den
Laborergebnissen (Abb. 1).
– Die Alttiere der Bachforelle haben ein Temperaturoptimum von ca. 8 — 12 °C. Damit sind sie an
ihr Habitat (relativ kalte Gebirgsbäche) gut angepasst. Auch die Laichzeit im Winter steht im
Einklang mit dem Optimum bei noch tieferen Temperaturen von ca. 4 — 6 °C. Der Karpfen dagegen zeigt ein Temperaturoptimum von ca. 12 — 26 °C. Damit ist diese eurypotente Art an die
Verhältnisse in stehenden Gewässern gut angepasst, da die Temperatur dort im Jahresverlauf
stark schwankt. In Gebirgsbächen dagegen ist im Jahresverlauf keine große Temperaturschwankung zu beobachten. Dazu passt die Stenopotenz der Bachforelle. Die Laichzeit des Karpfens im
Sommer steht im Einklang mit den Ansprüchen des Karpfenlaichs (hohe Temperaturen zwischen
17 °C und 28 °C).
Material: Präferenz und Toleranz (Seite 167)
$ A1 Vergleichen Sie den Präferenzbereich von Hochmoorameise und Sumpfschrecke (Abb. 1).
Inwieweit lassen sich diese Laborergebnisse auf das Freiland übertragen?
– Die Präferenz der Hochmoorameise liegt bei höheren Temperaturen (um 30 °C +/– 5 °C) und
streut weniger als die der Sumpfschrecke (15 °C +/– 10 °C). Im Freiland werden weitere Faktoren
(Feuchtigkeit, Licht usw.) das Vorkommen beeinflussen.
$ A2 Wie lässt sich der Versuch abwandeln, um zu klären, ob es individuelle Unterschiede in der
Präferenz gibt oder ob die Tiere nur einen bestimmten Abstand zueinander einhalten?
– Man muss die Individuen einzeln auf die Temperaturorgel setzen und ihre Präferenz notieren.
Dann kann das Ergebnis nicht durch innerartliche Konkurrenz beeinflusst werden.
. A3 Die Larven des Mehlkäfers (umgangssprachlich: „Mehlwürmer“) lassen sich in Zoohandlungen als Futtertiere beziehen, treten aber auch als Vorratsschädlinge auf. Stellen Sie ihre
Toleranzkurve (Abb. 3) in Bezug zur temperaturabhängigen Enzymaktivität (Abb. 4).
– Beide Kurven zeigen ein sehr ähnliches Maximum und ähnliche Grenzwerte. Das deutet darauf
hin, dass die Temperaturtoleranz des Mehlwurms durch die physiologischen Grenzen seiner
Enzymaktivität bestimmt wird.
$ A4 Die weiblichen Falter des Kiefernspinners legen im August Eier ab, aus denen zwei bis drei
Wochen später junge Raupen schlüpfen. Erläutern Sie den Schlüpferfolg bei einer Luftfeuchtigkeit von 20 % und einer Temperatur von 20 °C. Verwenden Sie Abb. 2.
– Der Schlüpferfolg beträgt 25 %.
$ A5 Zeichnen Sie unter Verwendung von Abb. 2 die Luftfeuchte-Toleranzkurve für eine Temperatur von 10 °C entsprechend der Vorlage in Abb. 5.
– Wertetabelle bei 10 °C:
rel. Luftfeuchte
20 %
34 %
75 %
86 %
Schlüpferfolg 20 %
25 %
25 %
80 %
48 Ökologie
DO01045455_Loesung_03.indd 48
14.04.2015 14:11:49
Tiergeografische Regeln (Seite 168)
0 A1 Erklären Sie unter Anwendung der Allen-Regel und der Bergmann‘schen Regel das Aussehen
von Rotfuchs und Polarfuchs.
– Der Rotfuchs lebt in einer gemäßigten Klimazone, der Polarfuchs in der nördlichen Polarregion.
Nach der Bergmann‘schen Regel ist zu erwarten, dass der Polarfuchs größer ist als der Rotfuchs.
(Der Fennek ist noch kleiner.) Nach der Allen‘schen Regel sind beim Rotfuchs größere Körperanhänge (Ohren etc.) zu erwarten.
Material: Leben mit wenig Wasser — die Kängururatte (Seite 169)
0 A1 Interpretieren Sie Abb. 2 unter Verwendung des Textes.
– Die Kängururatte ist nur nachts an der Oberfläche aktiv. Zu dieser Tageszeit ist die Temperatur
mit ca. 20 °C mäßig. Während des Tages, wenn die Temperaturen an der Oberfläche bis 60 °C
steigen, hält sich die Kängururatte in ihrem Bau auf. Dort herrschen physiologisch unbedenkliche 30 bis 35 °C.
$ A2 Beschreiben und erklären Sie die Veränderung der Luft beim Ein- und Ausatmen der Kängu­ruratte
(Abb. 3). Bedenken Sie dabei, dass Wasserverdunstung mit Abkühlung verbunden ist.
– Streicht die 30 °C warme, aber trockene Einatemluft (25 % Luftfeuchtigkeit) an der feuchten
Nasenschleimhaut vorbei, nimmt sie Wasser bis zur Sättigung auf (bis 100 % Luftfeuchtigkeit).
Gleichzeitig erwärmt sie sich und nimmt dabei noch mehr Wasser auf. Bis zur Lunge hat sie von
anfangs knapp 10 mg/l Luft nun ca. 55 mg Wasser/Liter Luft (bei 38 °C) aufgenommen. Durch
diese Wasserabgabe (Verdunstung) kühlt die Nasenschleimhaut aus. Wegen der mangelnden
Durchblutung bleibt dieser Temperaturgradient bestehen. Beim Ausatmen wird die 38 °C warme
Ausatemluft durch die kühle Nasenschleimhaut abgekühlt. Dabei gibt sie Wasser an diese ab,
da die kühle Luft weniger Wasserdampf bindet. Im Endeffekt enthält die Ausatemluft bei 27 °C
noch ca. 30 mg Wasser/Liter Luft. Sie hat also ca. 25 mg/Liter, d. h. ca. 45 % wieder abgegeben.
$ A3 Die Nasenschleimhaut der Wanderratte ist besser durchblutet. Ihre Abkühlung durch die
eingeatmete Luft wird rasch durch Wärme aus dem Blut ausgeglichen. Stellen Sie eine Hypothese über die Auswirkung dieser Unterschiede zur Kängururatte auf.
– Die wärmere Luft im Nasenraum der Wanderratte bindet mehr Feuchtigkeit als die kältere Luft
bei der Kängururatte.
0 A4 Erklären Sie die Konsequenzen dieser Unterschiede für den Wasserverlust beim Ausatmen.
– Der Wasserverlust der Wanderratte beim Ausatmen ist größer als bei der Kängururatte.
$ A5 Vergleichen Sie die Wasserbilanz von Känguru- und Wanderratte (Abb. 4) und erklären Sie die
Unterschiede mithilfe aller Materialien.
– Wasserabgabe: Die Kängururatte verliert unter vergleichbaren Bedingungen (100 g Nahrungsaufnahme) 6 g weniger Wasser als die Wanderratte durch Atmung und Verdunstung. Das erklärt
sich aus dem Kondensationseffekt der speziell gebauten Nase (s. Aufgabe 2 — 4). Kot und Harn
sind deutlich weniger wasserhaltig als bei der Wanderratte. Das Material erlaubt dazu keine
Erklärung. Der Kot der Kängururatte ist offenbar sehr trocken. Insgesamt gibt die Kängururatte
pro 100 g Nahrung 23 g weniger Wasser ab als die Wanderratte. Das ist eine Ersparnis von ca. 28 %.
Wasseraufnahme: Die Kängururatte nimmt nur indirekt Wasser auf, im Gegensatz zur Wanderratte trinkt sie nicht. Der Wassergehalt der Nahrung ist bei der Kängururatte mit 6 % deutlich
geringer als bei der Wanderratte (12 %).
Durch den hohen Anteil an Fett (40 %) in der Nahrung spielt das Oxidationswasser mit 54 g eine
um ca. 17 % (8 g/100 g Nahrung) größere Rolle als bei der Wanderratte, deren Nahrung überwiegend aus Kohlenhydraten besteht. Bei deren Oxidation entsteht deutlich weniger (fast nur
die Hälfte an) Oxidationswasser. Die Ersparnis von 28 % bei der Wasserabgabe erlaubt diese
gedrosselte Wasseraufnahme.
49 Ökologie
DO01045455_Loesung_03.indd 49
14.04.2015 14:11:49
0 A6 Fassen Sie alle aus den Materialien ersichtlichen Eigenschaften zusammen, durch die die
Kängururatte an das Leben in der Trockenwüste angepasst ist.
– Insgesamt zeigt die Kängururatte eine ganze Reihe von Angepasstheiten an das Wüstenleben
(s. Tabelle).
nächtliche Lebensweise
Nachts sind die Temperaturen geringer. Dadurch erüb­rigen
sich Kühlungsmechanismen wie Schwitzen etc. Ferner ist
nachts die Luftfeuchtigkeit höher als am Tag.
fettreiche Nahrung
erlaubt effektive Nutzung von Oxidationswasser
gering durchblutete und Wasser
bindende Nasenschleimhaut
vermindert Wasserabgabe mit der Atemluft
springende Lebensweise
ist energiesparend und ermöglicht den Zugang zu weit verstreuter Nahrung
Der Einfluss von Feuchtigkeit (Seite 171)
0 A1 Erklären Sie die Bedeutung der Pflanzengestalt der Besenheide für den Wasserhaushalt und
ordnen Sie die Pflanzen einem Standorttyp zu.
– Die Besenheide hat weit verzweigte Wurzeln, mit denen sie geringe Wassermengen erschließen
kann. Die stark verholzten Sprosse ermöglichen auch bei Trockenheit eine aufrechte Haltung.
Die Blättchen sind klein und haben durch die Lage der Stomata eine geringe verdunstende
Oberfläche, jedoch eine vergrößerte Fotosynthese aktive Fläche.
0 A2 Bei der Schwertlilie sind die Blätter so gefaltet, dass die Blattoberseiten verdeckt und die
Blattunterseiten mit den Spaltöffnungen nach außen gekehrt sind. Begründen Sie, welchen
Standort Sie der Schwertlilie zuordnen.
– Durch die exponierte Lage der Spaltöffnungen kann die Schwertlilie die Transpiration steigern
und dadurch den Wassertransport an einem feuchten Standort sichern.
Zeigerarten — Bioindikatoren (Seite 174
$ A1 Erklären Sie, warum nur stenöke Arten als Zeigerarten infrage kommen.
– Stenöke Arten tolerieren nur kleine Abweichungen eines Umweltfaktors vom Optimum für die
Art. Ihr Vorkommen zeigt an, dass der örtliche Wert nahe an dem (bekannten) Optimum liegt.
Der Einfluss von Sauerstoff auf Tiere (Seite 175)
$ A1 Stellen Sie in einer Tabelle die Anpassungsmechanismen von Tubifex an unterschiedliche
Sauerstoffgehalte des Wassers zusammen.
– siehe Tabelle
Angepasstheit
niedriger O2-Gehalt
hoher O2-Gehalt
Schlängelfrequenz
hoch (starker Wasseraustausch an
der Haut)
niedrig (energiesparend)
Länge im freien Wasser
groß (große Austauschfläche)
gering (geringes Risiko gefressen
zu werden)
Atmung oder Gärung
bei sehr niedrigen O2-Gehalten:
Gärung
Atmung (ökonomischerer Umgang
mit Nährstoffen)
. A2 Begründen Sie die hohe Überlebensrate von Tubifex bei geringem Sauerstoffgehalt (Abb. 1)
mithilfe von Daten aus Abb. 2.
– Tubifex hat ein Hämoglobin mit einer sehr hohen Sauerstoffaffinität. Dieses Hämoglobin kann
also schon bei geringen Sauerstoffgehalten das Gas an sich binden und dem Organismus zur
Verfügung stellen. Allerdings wird Sauerstoff erst bei sehr geringen Partialdrucken wieder freigegeben. Der Sauerstoffpartialdruck im Gewebe von Tubifex muss folglich sehr gering sein.
$ A3 Der Raubfisch Forelle hat einen größeren Sauerstoffbedarf als der Friedfisch Karpfen (0,39
bzw. 0,12 mg O2/kg Körpermasse). Stellen Sie einen Bezug zu den Werten in Abb. 1 und 2 her.
– Der hohe Sauerstoffbedarf der Forelle begründet sich in ihrer Lebensweise: Als Raubfisch muss
sie schnell schwimmen können. Das erfordert einen höheren Energie- und damit Sauerstoffbedarf als beim Friedfisch Karpfen mit seinen langsamen Bewegungen. An diesen hohen Sauerstoffbedarf ist die Forelle auch physiologisch angepasst: Ihr Hämoglobin bindet Sauerstoff
nur locker. Der Sauerstoffgehalt des Gewässers muss folglich hoch sein, da nur unter diesen
50 Ökologie
DO01045455_Loesung_03.indd 50
14.04.2015 14:11:50
Bedingungen ausreichend Sauerstoff an Hämoglobin gebunden wird. Andererseits wird der
Sauerstoff im Gewebe schon bei relativ hohen Partialdruckwerten abgegeben. Damit steht der
Muskulatur der Forelle viel Sauerstoff zur Verfügung. Die etwas festere Sauerstoffbindung des
Karpfen-Hämoglobins erlaubt zwar eine Existenz in sauerstoffärmeren Gewässern, dem Gewebe
wird erst bei einem niedrigen Partialdruck genügend Sauerstoff zur Verfügung gestellt. Der
Sauerstoffbedarf der Karpfenmuskeln ist also geringer.
51 Ökologie
DO01045455_Loesung_03.indd 51
14.04.2015 14:11:50
3. 2 Ökologische Nische
Das Konzept der ökologischen Nische (Seite 177)
. A1 Leiten Sie die Punkte A, B und C in Abbildung 3b aus der Abbildung 3a ab.
– Punkt A und C beziehen sich auf eine Lufttemperatur von 27 °C, die auch im unteren Diagramm
bei 60%iger Luftfeuchtigkeit direkt ablesbar ist (Überlebensrate von 90 %).
Punkt C findet sich bei gleicher Temperatur und 90%iger Luftfeuchtigkeit; die Überlebensrate
beträgt etwa 85 %. Punkt B findet sich im linken oberen Diagramm (12 °C, 20%ige Überlebensrate, dagegen nicht
im unteren Diagramm, da dort keine Werte für 12 °C angegeben sind).
0 A2 Begründen Sie, weshalb die in der Randspalte dargestellten Säugetiere sich sehr ähneln,
obwohl sie keinerlei nähere Verwandtschaft zeigen.
– Alle drei Säugetiere leben unterirdisch und finden dort auch ihre Nahrung. Daher stellt ihr
gleiches Aussehen eine Angepasstheit an sehr ähnliche Lebensräume (hier: unter der Erde) dar.
Diese Angepasstheit ist das Ergebnis eines Evolutionsprozesses, bei dem die Selektionsdrücke
auf die entsprechende Art in etwa gleich waren und sich daher ein sehr ähnlicher Körperbau
dieser drei Säugetiere ergeben hat.
Material: Die ökologische Nische von Strudelwürmern (Seite 178)
0 A1 Beschreiben Sie, in welchen Temperaturgrenzen die drei Arten jeweils im Bachsystem A
vorkommen.
– Verbreitung: Cr. alpina bis ca. 7 °C, P. felina von 7 °C bis 13 °C, D. gonocephala oberhalb von 13 °C.
$ A2 Stellen Sie den Zusammenhang zwischen Sauerstoffverbrauch (Abb. 3), Kriechgeschwindigkeit (Abb. 4) und Temperatur in einem Pfeildiagramm dar (Symbolik wie Seite 180).
– siehe Abbildung
Temperatur
+
(RGT-Regel)
Kriechgeschwindigkeit
+
Energiebedarf
+
Sauerstoffverbrauch
$ A3 Erläutern Sie die Konsequenzen bezüglich der Temperaturtoleranz, die Sie bei den drei Arten
erwarten.
– Der hohe Sauerstoffbedarf von Cr. alpina setzt dieser Art physiologische Grenzen: Im wärmeren
Wasser ist der Sauerstoffgehalt zu gering bzw. der Sauerstoffverbrauch zu hoch. Deshalb ist diese Art stenopotent und an kaltes Wasser angepasst. D. gonocephala ist dagegen an wärmeres Wasser angepasst, da sein Sauerstoffbedarf am geringsten ist. Falls die geringe Kriechgeschwindigkeit kein Problem ist (Nahrungserwerb), sollte diese Art sehr eurypotent bezüglich
der Temperatur sein.
. A4 Stellen Sie eine begründete Hypothese zur Verbreitung der drei Arten im Bachsystem A auf.
– Die Verteilung der drei Arten legt den Verdacht nahe, dass sie sich gegenseitig ausschließen.
Hypothese: Das Material erlaubt als Hypothese nur die Annahme, dass es um Nahrungskonkurrenz geht. Da alle drei Arten dieselbe knappe Ressource Nahrung nutzen, kann nach dem
Konkurrenzausschlussprinzip jeweils nur die best angepasste in einem Abschnitt existieren. Cr. alpina ist kälteangepasst und dort auch am schnellsten. Das ist ein Vorteil beim Nahrungserwerb. Cr. alpina ist den beiden anderen Arten in der Jagd überlegen. Möglicherweise vermindert
seine Population die Beutedichte so stark, dass sie für die Existenz der beiden anderen Arten zu
gering wird. D. gonocephala ist als langsamster Strudelwurm am konkurrenzschwächsten. Er
kann nur dort existieren, wo die beiden anderen Arten aufgrund der physiologischen Grenzen
nicht vorkommen. Polycelis f. ist konkurrenzstärker als D. gonocephala, aber konkurrenzschwächer als Cr. alpina.
52 Ökologie
DO01045455_Loesung_03.indd 52
14.04.2015 14:11:50
0 A5 Nennen Sie mögliche Gründe für das Fehlen von Polycelis felina in Bach B.
– Für Polycelis f. liegt ein pH-Wert von 7,5 bereits im Pessimum. D. gonocephala und Cr. alpina
dagegen können diesen pH-Wert noch gut tolerieren. Dagegen liegt der pH-Wert von 6,7 im
deutschen Bachsystem für alle drei Arten im Optimum. Deshalb können dort alle drei Arten gut
existieren.
$ A6 Vergleichen Sie die Verbreitung der Arten in den beiden Bachsystemen und nennen Sie eine
mögliche Erklärung für die Unterschiede.
– Im französischen Bachsystem besetzt D. gonocephala die Temperaturzone des fehlenden Polycelis felina. Das ist möglich, da dieser Temperaturbereich für ihn keine physiologische Barriere
darstellt, sondern nur eine ökologische (Hypothese: Konkurrenz). Fehlt der Konkurrent, kann
sich D. gonocephala hier ausbreiten.
. A7 Entwickeln Sie Überprüfungsexperimente für Ihre Hypothesen (Aufgabe 6).
– Im Labor werden alle drei Arten bei pH 6,7 und bei pH 7,5 zusammen in Aquarien mit abgestuften Temperaturen gehalten (etwa 5 °C — 10 °C — 15 °C). Die Nahrung wird in einem Versuchsansatz in größerer Menge zur Verfügung gestellt, in einem zweiten Ansatz stark begrenzt. Wenn
die Hypothese zutrifft, sollten die drei Arten im Falle der unbegrenzten Nahrung bei pH 6,7 im
5 °C-Wasser koexistieren können, bei Begrenzung der Nahrung dagegen sollte jeweils wie im
Freiland die best angepasste sich langfristig durchsetzen; die beiden anderen würden jeweils
aussterben. Im 10 °C-Wasser sollte Cr. alpina aussterben, da ihm physiologische Grenzen gesetzt
sind (mit und ohne Nahrungsüberschuss). Entsprechend sollte im 15 °C-Wasser auch bei Nahrungsüberschuss nur D. gonocephala existieren können.
. A8 „Bei konkurrenzstarken Arten gleicht die Fundamentalnische weitgehend der Realnische.“
Überprüfen Sie, inwieweit diese Regel im vorliegenden Fall zutrifft.
– Die Fundamentalnische ist physiologisch und nicht durch Konkurrenz begrenzt. Bei Cr. alpina
entspricht die Fundamentalnische völlig der Realnische. Da diese Art am konkurrenzstärksten
ist, entsprechen sich diese beiden Nischenelemente. Bei D. gonocephala ist die Fundamentalnische (hier: ökologische Potenz bezüglich Temperatur und Sauerstoff) sehr breit, er ist
weitgehend bezüglich Temperatur und pH-Wert eurypotent. Die Realnische ist nur ein kleiner
Ausschnitt dieser Fundamentalnische, da in weiten Teilen die konkurrenzstärkeren Arten dominieren und D. gonocephala verdrängen. P. felina ist konkurrenzstärker als D. gonocephala aber
konkurrenzschwächer als Cr. alpina. Das legen der Sauerstoffverbrauch und die Kriechgeschwindigkeit nahe.
Praktikum: Untersuchungen zur ökologischen Nische (Seite 179)
0 A1 Erstellen Sie jeweils für jedes Untersuchungsgebiet und für jede Art folgendes Raster bzw.
Diagramm:
• senkrecht Beleuchtungsstärke, waagrecht Temperatur (Punkt pro Fund)
• Häufigkeitsverteilung der Arten in Abhängigkeit von der Beleuchtungsstärke.
– individuelle Lösung
0 A2 Vergleichen Sie die Umweltansprüche beider Arten.
– individuelle Lösung
0 A3 Bestimmen Sie alle 15 Minuten die Verteilung der Individuen auf der Temperaturorgel. Verändert sich die Verteilung nicht mehr wesentlich, tragen Sie diese Ergebnisse als Häufigkeitsverteilung grafisch auf.
– individuelle Lösung
0 A4 Berechnen Sie die Temperaturmittelwerte für beide Arten.
– individuelle Lösung
$ A5 Vergleichen Sie diese Ergebnisse mit Ihren Freilandergebnissen.
– individuelle Lösung
$ A6 Bevorzugen die Arten eher Licht oder Schatten? Entwickeln Sie dazu ein einfaches Experiment und führen Sie es durch.
– Bei kleinen Arten kann der Deckel einer Petrischale zur Hälfte dunkel beklebt werden. Die Tiere
werden in die Schale gesetzt und mit dem Deckel zugedeckt (heller Raum). Nach einiger Zeit
werden die Individuen im hellen und dunklen Bereich ausgezählt.
$ A7 Wandeln Sie die oben beschriebenen Untersuchungen so ab, dass Sie die ökologischen
Ansprüche und Präferenzen verschiedener Asselarten bezüglich Temperatur und Luftfeuchtigkeit untersuchen können.
– Durch Erwärmung einer Hälfte der Petrischale von unten bzw. das Auslegen der Petrischale mit
Filterpapier (halb feucht, halb trocken) wird der Aufenthalt nach einiger Zeit bei sonst gleichen
Umweltbedingungen verglichen.
53 Ökologie
DO01045455_Loesung_03.indd 53
14.04.2015 14:11:50
Konkurrenz um Ressourcen (Seite 181)
0 A1 Untersuchen Sie mithilfe der Abbildung 1, inwieweit alle Faktoren mit wechselseitiger Beeinflussung als Ressourcen bezeichnet werden können.
– Faktoren wie Fressfeinde und Artgenossen (Konkurrenten) stehen auch in wechselseitiger Beeinflussung, sind aber keine Ressourcen. Manche Ressourcen wie Sauerstoff oder der Flugraum
zeigen bei Landtieren nicht die typischen Kriterien einer Ressource, nämlich bei hoher Populationsdichte zu verknappen; dazu ist das Angebot zu groß und der Verbrauch zu gering.
$ A2 Vergleichen Sie die Fundamental- und die Realnische der Waldbäume (Abb. 3 und 4) und
erklären Sie die Unterschiede.
– Rotbuche: Fundamentalnische (Optimum) und Realnische gleichen sich weitgehend. Das spricht
für Konkurrenzstärke. Diese begründet sich in den minimalen Lichtansprüchen der Jungbäume,
die als einzige unter dem tatsächlich im Rotbuchenwald herrschenden Lichtangebot liegen.
Die Stieleiche kann nur in den Bereichen als dominierende Baumart existieren, die außerhalb
des Optimums der Rotbuche liegen. Vermutlich ist in diesem Fall das Blätterdach der Rotbuche
nicht so dicht, damit fällt mehr Licht auf den Boden und auch Jungeichen können existieren.
Unklar bleibt, weshalb sich nicht trotzdem die Jungbuchen neben der Stieleiche behaupten.
Die Waldkiefer hat die höchsten Lichtansprüche. Diese sind weder im Buchen- noch im Eichen‑
wald erfüllt. Jungkiefern können also nur in Bereichen aufwachsen, in denen diese beiden
Baumarten nicht — oder nur schlecht — existieren können. Als konkurrenzschwächste Art ist
ihre Realnische am meisten eingeschränkt.
Material: Eichhörnchen und Grauhörnchen (Seite 183)
0 A1 Erklären Sie, in welcher ökologischen Beziehung die beiden Hörnchen zueinander stehen
und ob das Grauhörnchen Ursache für das Verschwinden der Eichhörnchen ist.
– Eichhörnchen und Grauhörnchen stehen in Konkurrenz zueinander, da sich die benötigten
Ressourcen (vor allem Nahrung) deutlich überschneiden. Das Nahrungsspektrum des Grauhörnchens ist jedoch breiter, außerdem ist es größer, das macht es konkurrenzstärker als das
Eichhörnchen. Auch zeigen die Zahlen von Anglesey, dass Grauhörnchen in deutlich höherer
Dichte vorkommen können als Eichhörnchen. Durch diese Eigenschaften scheint das Eichhörnchen aus Gebieten verdrängt zu werden, in denen sich das Grauhörnchen ausbreitet (Konkurrenzausschluss). Dafür spricht auch die Beobachtung auf Anglesey, dass eine Reduktion des
Grauhörnchenbestandes offenbar den Konkurrenzdruck auf die Eichhörnchen nimmt und ihnen
ein Wiederanwachsen der Population ermöglicht.
$ A2 Erklären Sie, inwieweit das Parapox-Virus für das Verschwinden der Eichhörnchen verantwortlich ist und welche Bedeutung die Grauhörnchen dabei haben.
– Parapox-Viren befallen sowohl die Grauhörnchen als auch die Eichhörnchen. Das Immunsystem
der Grauhörnchen kann aber offenbar erfolgreich Antikörper gegen die Viren bilden, sodass
zwar ein erheblicher Teil der Population Antikörper besitzt, aber nicht erkrankt. Das Immun­
system der Eichhörnchen schafft dies jedoch nicht, denn einmal befallene Eichhörnchen sterben
an der Infektion, und nur sehr wenige Individuen können Antikörper ausbilden und überleben
(oder: sie waren evtl. zum Zeitpunkt der Untersuchung noch nicht erkrankt). Die Population der Grauhörnchen stellt eine ständige Infektionsquelle dar; sie wirken für die
Eichhörnchen als Verteiler der Viren und tragen (neben der normalen Konkurrenz) auch über
diesen Weg zum Aussterben bzw. Verdrängen der Eichhörnchen bei.
$ A3 Experten vermuten, dass sich die Situation zwischen Eichhörnchen und Grauhörnchen auf
dem gegenwärtigen Stand stabilisieren könnte. Lässt sich diese Vermutung mit den vorliegenden Informationen stützen?
– Gegenwärtig leben die meisten verbliebenen Eichhörnchen in Schottland. Diesen gebirgigen
Lebensraum besiedeln die Grauhörnchen nicht, sodass hier ein Rückzugsgebiet für die Eichhörnchen existiert. Wenn die Eichhörnchen aus dem übrigen Gebiet der britischen Hauptinsel
verschwunden sind, sollte sich die Situation auf diesem Stand stabilisieren.
54 Ökologie
DO01045455_Loesung_03.indd 54
14.04.2015 14:11:50
Material: Intraspezifische und interspezifische Konkurrenz (Seite 184/185)
0 A1 Beschreiben Sie die Abb. 2 und erklären Sie mithilfe des Textes den Unterschied zwischen
den Springern und den Ansässigen.
– Abb. 2 zeigt im Wattbereich die Territorien der Austernfischer. Die Salzwiesen werden im
vorderen und hinteren Bereich für Nistplätze genutzt. Im Wattbereich sind die wasserfreien
Gebiete die Nahrungsgebiete, in denen auch die Jungvögel bereits ihre Nahrung suchen können.
Nahrung finden die Vögel auch in den teilweise überfluteten Gebieten. Die Springer müssen
ständig zwischen den weiter zurückliegenden Nistplätzen und der Nahrungszone im feuchten
Wattbereich hin- und herfliegen. Die Ansässigen brüten im vorderen Bereich, der gleich in die
Nahrungsterritorien übergeht.
$ A2 Beschreiben Sie Abb. 4 und 5 und erklären Sie die Ergebnisse der Untersuchungen.
– In Abb. 4 sind die Jungtiere pro Paar gegen den Zeitraum der Brut aufgetragen. Bei den
Springern liegen die Anzahlen deutlich unter den Werten der Ansässigen im Zeitraum Mai, im
Bereich Juni gleichen sich die Zahlen an. Das bedeutet, dass über den gesamten Brutzeitraum
die Ansässigen mehr Jungtiere aufziehen können. In Abb. 5 wird die transportierte Futtermenge gegen die Flugzeit aufgetragen. Hier zeigt sich deutlich, dass im konkreten Zeiträumen die
Ansässigen eine größere Futtermenge transportieren als die Springer. Dies liegt daran, dass die
Flugwege für den Futtertransport unterschiedlich lang sind.
. A3 Erläutern Sie anhand der Springer und der Ansässigen die biologische Bedeutung der Verteidigung von Territorien und dem Aspekt der Konkurrenz.
– Die Bedeutung der Territorien ist sehr hoch, da die Anzahl der Nachkommen deutlich von der
Entfernung zur Wasserzone abhängt. Die Anzahl der Nachkommen ist relevant bei der intraspezifischen Konkurrenz der Austernfischer.
0 A4 Beschreiben Sie die verschiedenen Messergebnisse in Abb. 8.
– In Abb. 8 wird die Verteilung von zwei Seepockenarten von Adulten und Larven in Bezug auf die
relativen Auswirkungen verschiedener Faktoren dargestellt. Die Verteilung wird der Austrocknung, der intraspezifischen Konkurrenz und der interspezifischen Konkurrenz im Lebensraum
der Gezeitenzone zugeordnet.
$ A5 Fassen Sie die Untersuchungen und deren Ergebnisse in einem zusammenfassenden Bericht
zusammen.
– Bei der gemeinen Seepocke zeigt sich eine ähnliche Verteilung bei den Adulten und Larven. Bei
den Sternseepocken sind die Adulten im Bereich des mittleren Hochwassers bei Springtide. Beide
Arten sind an der Felsenküste anzutreffen, jedoch sitzen die adulten Seesternpocken meist
höher in der Gezeitenzone als adulte Gemeine Seepocken. Die verschiedenen Faktoren könnten
eine Rolle spielen.
. A6 Erläutern Sie anhand der Untersuchungen, ob unterschiedliche Umweltbedingungen zu der
Trennung der beiden Arten führen oder ob die interspezifische Konkurrenz die ausschlag‑
gebende Rolle spielt.
– Das Verhindern eines Kontaktes der beiden Seepockenarten durch die Wissenschaftler zeigte,
dass die räumlichen Unterschiede bei den adulten Seepocken nicht mehr vorhanden waren.
Daher konnte gezeigt werden, dass die interspezifische Konkurrenz die Trennung der verschiedenen Lebensräume auslöst, da sie überwuchert wurden und kleinere Wuchsformen aufwiesen,
die zu einer geringen Fortpflanzung führen. Die Gemeine Seepocke kommt in der oberen Region
nicht vor. Hier scheint die Austrocknung gegenüber der Sternseepocke eine Rolle zu spielen.
55 Ökologie
DO01045455_Loesung_03.indd 55
14.04.2015 14:11:50
3. 3 Dynamik von Populationen
Wachsende Populationen (Seite 187)
$ A1 Berechnen Sie die Größe der Bevölkerung der beiden Länder (Abb. 1) für die Jahre 2015
und 2020. Gehen Sie vom aktuellen Jahr aus und nehmen Sie vereinfachend exponentielles
Wachstum an.
– Abweichend von der Aufgabenstellung werden als Ausgangswerte die Tabellenwerte für das
Jahr 2010 verwendet: Indien: N0 = 1171 Mio.; r = 0,0135; Kenia: N0 = 40,51 Mio.; r = 0,0266
Jahr 2015: t = 5; Jahr 2020: t = 10
Indien: N5 = 1171 Mio. x (1 + 0,0135)5 = 1171 Mio. x 1,07 = 1253 Mio.; N10 = 1171 Mio. x (1 + 0,0135)10
= 1171 Mio. x 1,14 = 1335 Mio.
Kenia: N5 = 40,51 Mio. x (1 + 0,0266)5 = 40,51 Mio. x 1,14 = 46 Mio.; N10 = 40,51 Mio. x (1 + 0,0266)10
= 40,51 Mio. x 1,3 = 53 Mio.
Räuber und Beute (Seite 191)
0 A1 Erläutern Sie am Beispiel der Schwebfliege das Prinzip ihrer Abwehrmethode.
– Schwebfliegen ahmen die Warntracht von Wespen nach (Mimikry). Wehrhafte Tiere sind häufig
auffällig gefärbt. Durch diese Warntracht werden sie weniger häufig gefressen. Durch die
Ähnlichkeit zu den Wespen werden die Schwebfliegen weniger häufig gefressen, obwohl sie die
Angreifer nicht schädigen können.
0 A2 Erläutern Sie die Schemata in der Randspalte.
– Hohe Beutezahlen fördern Räubervermehrung. Deren Anstieg dezimiert die Beute. Dies verschlechtert die Lage der Räuber. Sinkende Räuberdichte begünstigt die Beutevermehrung usw.
Die Populationsdichten schwanken geregelt.
Modelle zur Räuber-Beute-Beziehung (Seite 193)
$ A1 Untersuchungen an einem mit GPS-Sendehalsband markierten Luchs im Böhmerwald haben
folgendes Beutespektrum aufgezeigt: Rehe 78 %, Damwild 11 %, Hasen 9 % Rotwild 2 %. Erklären Sie anhand der Daten, wieso in der Realität selten periodische Schwankungen
beobachtet werden können.
– Der Luchs ernährt sich nicht ausschließlich von Hasen. Die Hauptnahrungsquelle im mitteleuropäischen Raum sind Rehe. Sollte sich in der Natur die Anzahl der Hasen verringern, kann der
Luchs problemlos auf andere Nahrungsquellen ausweichen.
Mehrartensysteme — Beutewechsel des Luchses (Seite 194)
$ A1 Erörtern Sie, wie sich eine Zunahme der Populationsdichte der Schneeschuhhasen auf die
Dichte der Karibus bzw. Luchse auswirkt.
– Je größer die Dichte der Schneeschuhhasen, desto leichter machen die Luchse Hasenbeute und
schonen die Karibukälber. Der Karibubestand kann sich erholen, der Luchsbestand wächst.
Dadurch werden schließlich die Hasen knapper und die Karibus sind wieder in Gefahr.
$ A2 Beschreiben Sie, welche Rolle der Beutewechsel des Luchses im Nahrungsnetz der Säuger
Neufundlands spielt und vergleichen Sie diese mit der Rolle des Wolfes.
– Der Beutewechsel des Luchses führt zu Dichteschwankungen in den Beutepopulationen, der
Wolf hatte einen stabilisierenden Einfluss.
Material: Rebhuhn-Dichte (Seite 195)
$ A1 Stellen Sie die Positionen der beiden Parteien gegenüber und leiten Sie die Begriffe „Bottom
up“ und „Top down“ ab.
– Den Begriffen „Bottom up“ und „Top down“ liegt die ökologische Pyramide zugrunde, die Dichteregulation im Nahrungsnetz kann von niedrigeren Trophiestufen („Bottom up“) aus erfolgen
oder durch höhere Konsumentenebenen. Die Position des Bundesjagdverbandes lautet: Stärkere Bejagung der Konsumenten (Fuchs,
Rabenkrähe, Elster) des Rebhuhns („Top-down“).
Der NABU fordert den Schutz der Nahrungsgrundlage und des Lebensraumes des Rebhuhns,
also eine Stärkung der potenziellen Beute („Bottom up“).
56 Ökologie
DO01045455_Loesung_03.indd 56
14.04.2015 14:11:50
0 A2 Stellen Sie Argumente zusammen für eine Diskussionsrunde Pro und Contra „Jagd auf Fuchs
und Krähe zum Schutz des Rebhuhns“.
– individuelle Lösung
. A3 Entwerfen Sie eine Versuchsanordnung, um in einem Feldversuch nachzuweisen, ob die Dichte des Rebhuhns von Nahrung und Lebensraum (Bottom up) oder von der Zahl der Beutegreifer abhängt (Top down).
– Beispiel: Zwei landschaftlich vergleichbare Versuchsflächen abgrenzen, die mit einer gleichen
Anzahl Rebhuhnpaaren ausgestattet werden und Deckungsmöglichkeiten sowie Nahrungspflanzen bieten. Auf einer Fläche werden alle Räuber ausgeschlossen, auf der anderen nicht.
Nach einer Saison Bestandszählung. Anschließend die Flächen austauschen, um verdeckte
landschaftliche Unterschiede auszuschließen.
Ernährungsstrategien — Spezialisten und Generalisten (Seite 196)
$ A1 Interpretieren Sie die Angaben zur Beutewahl des Mauswiesels (Abb. 1)
– Die Hauptnahrung des Mauswiesels in Mitteleuropa stellt die Wühlmaus dar. Bei hohen Dichten
dieser Beutetierart wie 1956, 1959, 1963 und 1967 ist die Raubrate bezüglich der Blaumeisennester sehr gering. Das deutet darauf hin, dass in den genannten Jahren die Wühlmäuse die
Hauptnahrung ausmachen, da die Wühlmausjagdkosten in diesen Jahren gering sind. In den
Jahren, in denen die Wühlmauspopulation nur klein ist (1957, 1964 — 1966) sind die Jagdkosten
dagegen hoch. Das Mauswiesel bevorzugt in diesen Jahren in stärkerem Maße die Blaumeisennester als Beute, da vermutlich die Kosten dieses Beuteerwerbs günstiger sind. Im Jahr 1961 ist
dieser Effekt nicht so deutlich. Möglicherweise war eine dritte Beuteart, die besonders häufig
war, in diesem Jahr die bevorzugte Beute.
$ A2 Beziehen Sie die Begriffe „stenopotent“/ „eurypotent“ auf Generalisten und Spezialisten.
– Nahrungsspezialisten zeigen eine geringe Toleranz bezüglich ihrer Beutewahl, sind also stenopotent. Entsprechend sind Nahrungsgeneralisten als eurypotent bezüglich ihrer Nahrungsansprüche einzuordnen.
0 A3 Spezialisten rotten ihre Beute praktisch nie völlig aus. Erklären Sie.
– Beim Zusammenbruch der Beutedichte steigen die Kosten des Beuteerwerbs für die spezialisierten Räuber so stark, dass auch ihre Population zusammenbricht und folglich keinen Einfluss
mehr auf die verbliebenen wenigen Beutetiere haben wird. Die Räuber sterben am Nahrungsmangel oder wandern aus.
Parasitismus (Seite 197)
$ A1 Informieren Sie sich über Krankheitserreger wie Pestbakterium und Salmonellen. Begründen
Sie, ob hier typische Parasitenmerkmale vorliegen.
– Salmonellen: Endoparasit, der den Darmtrakt besiedelt, ohne zwingenden Wirtswechsel, sondern direkte Übertragung über mit Kot verunreinigten Nahrungsmitteln. Der mit der Infektion
verbundene Durchfall erhöht die Wahrscheinlichkeit von Neuinfektionen. Die Erreger sind recht
unspezifisch, auch das erhöht die Wahrscheinlichkeit einer Übertragung auf einen neuen Wirt.
Der Parasit tötet den Wirt nicht zwingend, doch Todesfälle sind nicht selten. Die extrem hohe
Vermehrungsrate der Bakterien ermöglicht dennoch eine Weiterverbreitung des Parasiten.
Pesterreger (Yersinia pestis): Endoparasit im Blut, nicht sehr spezifisch (Mensch, Nagetiere).
Wirtswechsel über den Rattenfloh; durch dessen Stich erfolgt mit hoher Wahrscheinlichkeit
die Übertragung auf die potenziellen Hauptwirte Mensch und Ratte. Für den Hauptwirt häufig
tödlich. Durch die Existenz im Zwischenwirt und die direkte Verbreitungsart (Blut saugender
Rattenfloh, der spezifisch potenzielle Hauptwirte befällt) ist die Verbreitung des Parasiten
gewährleistet.
Symbiose (Seite 198)
$ A1 Die Beziehung zwischen Blütenpflanzen und Insekten wie Hummeln (s. Randspalte) kann als
symbiotisch angesehen werden. Erklären Sie diese Aussage.
– Die Hummeln ernähren sich von dem zuckerreichen Nektar und den Pollen der Blütenpflanzen.
Auf der anderen Seite werden durch die Hummeln die Pollen zur nächsten Blüte übertragen
(Bestäubung).
57 Ökologie
DO01045455_Loesung_03.indd 57
14.04.2015 14:11:50
Material: Pilzsymbiosen (Seite 199)
$ A1 Planen und begründen Sie ein Experiment mit markiertem Phosphat, um die Hypothese zu
überprüfen, dass die Mykorrhiza Bäume mit Phosphat versorgt.
– Die Mykorrhiza nimmt aus dem Boden Phosphat auf, welches sie an die Wurzeln der Bäume
weitergibt. In einer kontrollierten Versuchsumgebung wird radioaktiv markiertes Phosphat dem
Boden zugefügt. Nach verschieden langen Zeiträumen könnte man untersuchen, ob markiertes
Phosphat in der Mykorrhiza zu finden ist. Danach käme der zweite Teil. Hier müssten verschieden lange Zeiträume abgewartet werden, um dann zu untersuchen, ob markiertes Phosphat in
den Wurzeln zu finden ist.
$ A2 Erläutern Sie, ob es sich bei der Lebensweise des Fichtenspargels um eine Symbiose handelt.
Begründen Sie Ihre Aussage im Vergleich zu den Pilzen und Waldbäumen.
– Die Pflanzen versorgen die Mykorrhiza mit Zucker, die Mykorrhiza versorgt die Pflanzen mit
Phosphaten. Dies ist ein Beispiel einer Symbiose. Der Fichtenspargel nutzt den Zucker der
grünen Pflanzen. Hierbei handelt es sich um Parasitismus. Dies konnte mit Tracer-Versuchen
untersucht werden.
Dispersion — Verteilungsmuster in Populationen (Seite 201)
$ A1 Untersuchen Sie auf dem Schulhof während der Pause in einem festgelegten Raster die
Anzahl der verschiedenen Individuen und ordnen Sie sie begründet einem Dispersionstypus
zu.
– Es werden sich aggregative und zufällige Verteilungsmuster finden lassen. Hierbei wird auch die
jeweilige Rolle des untersuchten Ausschnitts des Pausenhofs eine Rolle spielen.
Populationsökologie und Pflanzenschutz (Seite 203)
$ A1 Analysieren Sie die Folgen des Azodrineinsatzes gegen den „Baumwollwurm“ (Abb. 1).
– Die Zahl der Larven ist bei Azodrinanwendung höher als ohne Anwendung. Drastisch reduziert
sind dagegen die Feinde. Vermutlich waren die Larven des Eulenfalters in der Pflanze besser
gegen das Insektizid geschützt als die Feinde. Durch deren Dezimierung konnte auf den behandelten Flächen die Zahl der Schädlingslarven zunehmen.
Ein Beleg für die direkte Wirkung des Giftes auf die Feinde, aber indirekte Wirkung auf die
Baumwollwürmer ist der zeitliche Verlauf: Bei den Baumwollwürmern tritt der Effekt zeitlich
versetzt, bei den Feinden unmittelbar auf. Die Zahl der geschädigten Kapseln unterscheidet sich
nur unwesentlich. Dieser Befund ist schwer zu erklären. Möglicherweise reicht die Larvendichte
in beiden Fällen für eine Schädigung (es werden gleich viele Kapseln geschädigt, die Dichte der
Larven in den befallenen Kapseln ist dagegen unterschiedlich).
$ A2 Vergleichen Sie den Effekt chemischer und biologischer Bekämpfung bei der Schildlaus‑
bekämpfung in einem schweizer Obstanbaugebiet (Abb. 2).
– Die chemische Bekämpfung erweist sich als wenig effektiv. Vermutlich wurden durch die Spritzung zu wenige der Schildläuse direkt erreicht (versteckt in Astritzen, dichtes Laub etc.). Die Parasiten dagegen suchen ihre Wirte direkt auf und erreichen so auch versteckte Schildläuse.
Das Ergebnis zeigt einen mit den Jahren zunehmenden Parasitisierungsgrad. Das liegt zum
einen an der Vermehrung des Parasiten, zum anderen an den von Jahr zu Jahr steigenden Aussetzzahlen. Insgesamt kann die biologische Schädlingsbekämpfung mit der Schlupfwespe als
erfolgreich angesehen werden.
58 Ökologie
DO01045455_Loesung_03.indd 58
14.04.2015 14:11:50
3. 4 Synökologie
Gestufte Systeme (Seite 207)
$ A1 Erläutern Sie die eigenartige Form der Pyramide für den Flächenbedarf (Abb. 1).
– Man erkennt umgekehrte Größenverhältnisse wie bei „normalen“ Pyramiden, weil z. B. die Maus
ein kleineres Revier als die Eule hat, die Eule aber auf einer höheren Trophieebene steht.
Primärproduktion (Seite 208)
$ A1 Die Primärproduktion ist in verschiedenen Ökosystemen unterschiedlich (Abb. 2). Erklären
Sie, welcher Faktor im Einzelfall wahrscheinlich begrenzend wirkt.
– • Bei Ozean, Küstenzone, Mangrove und tropischem Regenwald ist der Nährsalzgehalt begren-
zend (bei tropischen Regenwäldern ist er auch stark von der Beschaffenheit des Unter-
grundes abhängig); Feuchte und Temperatur sind weniger begrenzend.
• Bei kühlfeuchten Wäldern begrenzen die Temperaturen die Produktion; vor allem in gemäßigten Breiten kommen die Jahreszeiten hinzu, die nur periodisches Wachstum ermöglichen.
• In Fels und Eis begrenzt vorwiegend die niedrige Temperatur; daneben kommt auch Trockenheit durch Frost hinzu.
• In Trockenbusch und Savanne begrenzt die fehlende oder nur periodische Feuchte die Produktion; die Temperaturen sind weniger begrenzend.
• In Wüsten ist die Trockenheit begrenzend, in der Tundra zu niedrige Temperaturen und nur
kurze Vegetationsperioden, daneben auch Trockenheit durch Frost.
Spaltöffnungen — Regulation der Transpiration (Seite 211)
$ A1 Die Messwerte in Abb. 1 entstanden an einem sehr heißen Tag im Mittelmeerraum. Beschreiben Sie die Messergebnisse in Abb. 1 und bringen Sie diese in einen Zusammenhang mit
dem Standort der Pflanzen.
– Die Lichtintensität steigt am Morgen schnell an und nimmt bis zum Mittag weiter zu. Im
Bereich des Nachmittags nimmt die Lichtintensität ab und geht zum Abend schnell zurück. Die
Temperatur nimmt im Verlauf des Tages stark zu. Die Transpirationsrate ist nur von 6:00 Uhr bis
8:00 Uhr sehr hoch und geht danach deutlich zurück. Nach 18:00 Uhr nimmt sie noch einmal ab.
Der CO2-Austausch zeigt einen ähnlichen Verlauf. Dies ist dadurch zu erklären, dass von 6:00 Uhr
bis ca. 8:00 Uhr die Lichtintensität schon hoch ist, die Außentemperatur jedoch nicht. Die Stomata sind geöffnet. Mit zunehmender Lichtstärke könnte die CO2-Aufnahme gesteigert werden.
Doch durch die hohen Temperaturen würde auch die Verdunstung steigen. So sind die Stomata
geschlossen, was die Verdunstung des Wassers verhindert, jedoch wird auch die Fotosynthese
eingeschränkt. Gegen Abend sinken die Temperaturen, sodass das restliche Licht noch zur CO2Aufnahme genutzt werden kann
Äußere Einflüsse auf die Fotosynthese (Seite 212)
. A1 In Gewächshäusern werden Pflanzen mit Kohlenstoffdioxid begast. Erläutern Sie die Wirkung dieser Maßnahmen unter Einbeziehung von Abb. 3.
– In Gewächshäusern kann die CO2-Konzentration erhöht und die Temperatur den jeweils kultivierten Pflanzen angepasst werden. Auch die Beleuchtungsstärke wird entsprechend angepasst.
Zusätzlich werden Wasserversorgung und Mineralstoffdüngung geregelt. Durch diese Maßnahmen wird die Fotosyntheserate optimal genutzt: Die Pflanzen wachsen schneller.
Sonnenblätter — Schattenblätter (Seite 213)
$ A1 Nur Pflanzen mit Sonnenblättern erzielen hohe landwirtschaftliche Erträge. Begründen Sie
diese Aussage.
– Pflanzen mit Sonnenblättern haben eine effizientere Fotosynthese gegenüber Pflanzen mit
Schattenblättern. Die gebildete Biomasse ist im gleichen Zeitraum höher als bei den Pflanzen
mit Schattenblättern, da sie mit zunehmender Lichtintensität die Fotosyntheserate steigern
können.
59 Ökologie
DO01045455_Loesung_03.indd 59
14.04.2015 14:11:50
Licht und Schatten im Wald (Seite 215)
$ A1 Beschreiben Sie Abb. 2 und erläutern Sie, weshalb auf Waldlichtungen stickstoffliebende
Pflanzen verstärkt auftreten.
– In Abb. 2 wird die Umwandlungszeit von Humus in Bezug auf verschiedene Bodentemperaturen
dargestellt. Bei 5 °C beträgt die Zeit 4 Wochen bei 20 °C nur eine Woche. Die Werte zeigen, dass
an Lichtungen, an denen die Sonne den Boden erwärmt, der Humusabbau schneller erfolgt und
dadurch mehr Mineralstoffe wie Stickstoffverbindungen für Pflanzen vorhanden sind. Hier sind
daher Stickstoff liebende Pflanzen zu finden.
$ A2 Beschreiben Sie Abb. 5 und erläutern Sie die Messwerte im Jahresverlauf.
– In Abb. 5 ist die Bestrahlungsintensität in verschiedenen Höhen eines Laubwalds im Jahresverlauf dargestellt. Die Bestrahlungsintensität wird in Langley pro Tag angegeben. Im Jahresverlauf sieht man das Optimum bis zum Waldboden im Frühjahr zur blattlosen Zeit mit einem
hohen Sonnenstand. Im weiteren Verlauf nimmt die Bestrahlungsintensität am Boden ab. In
der Blattzone gehen bei der unterschiedlich intensiven Beblätterung die Werte nicht so weit
zurück wie am Boden. Die Bodenpflanzen sind daher jahreszeitenabhängig. Die Bäume mit den
Sonnen- und Schattenblättern sowie den unterschiedlichen Lichtverhältnissen haben genügend
Licht für die Fotosynthese.
0 A3 Erstellen Sie eine Tabelle und geben Sie die Unterschiede zwischen Sonnenpflanzen und
Schattenpflanzen an.
– Sonnenpflanzen: viele Palisadenzellen, hohe Enzymmenge für Synthesereaktion, kleinere Lichtsammelkomplexe pro Fotosynthesesystem, weniger Granastapel
Schattenpflanzen: großes Schwammgewebe, Palisadengewebe einschichtig, Palisadenzellen
mit niedriger Chloroplastenzahl, viele Granastapel, Lichtkompensationspunkt gering.
Leben braucht Energie (Seite 217)
. A1 Beschreiben Sie das Modell in Abb. 3 und beziehen Sie dies auf die realen Vorgänge innerhalb der Mitochondrien und Chloroplasten.
– Die in der Batterie gespeicherte Energie symbolisiert die chemisch gebundene Energie in der
Glucose. Der Stromfluss im Kabel stellt den Elektronenfluss in der Mitochondrienmembran dar.
Die elektrische Wasserpumpe symbolisiert die Protonenpumpen in der Mitochondrienmembran. Die beiden Wassergefäße symbolisieren mit den unterschiedlichen Wassermengen den
Protonengradienten. In dem oberen Wasserreservoir steckt Energie. Diese ist mit der Energie für
die ATP-Synthase vergleichbar.
$ A2 Erläutern Sie, weshalb in den Zellen nicht die direkte Reaktion von Glucose mit Sauerstoff
zur Energiebereitstellung genutzt werden kann.
– Die Energieumwandlung erfolgt über den Protonengradienten in der ATP-Synthase für die
Energiebindung im ATP. Diese erfolgt in kleinen Teilschritten für die Protonenpumpen. Ein hoher
Energieumsatz durch eine direkte Reaktion von Glucose und Sauerstoff, wie bei der Verbrennung
von Zucker, könnte von den Zellen nicht genutzt werden und würde eher zu deren Zerstörung
führen.
Material: Experimente zur zweigeteilten Fotosynthese (Seite 219)
$ A1 Erklären Sie die Ergebnisse der Experimente.
– Aus den Ergebnissen (1 — 4) kann man schließen: Ohne Licht erfolgt keine Fotosynthese, da
nur bei (1) und (3) eine größere Menge an Fotosyntheseprodukten entstanden ist. Belichtung
und Einbau von Kohlenstoffdioxid können offenbar zeitlich und räumlich getrennt werden.
Dies zeigt, dass in den lichtabhängigen Reaktionen Stoffe entstehen, die anschließend ohne
Thylakoide im Stroma beim Einbau von CO2 Verwendung finden. Zusatzversuche: Die Wirkung
der lichtabhängigen Reaktionen kann durch Zugabe von NADPH + H+ und von ATP nachgeahmt
werden. Das lässt darauf schließen, dass diese beiden Stoffe die wesentlichen Produkte der
lichtabhängigen Reaktionen sind.
. A2 Belegen Sie mithilfe der Ergebnisse, wo im Chloroplasten die lichtabhängige und die lichtunabhängige Reaktion ablaufen.
– Ort der lichtunabhängigen Reaktionen ist das Stroma, da es allein den Einbau des CO2 bewirken
kann (Versuch 3). Die lichtabhängigen Reaktionen laufen dagegen in den Thylakoidmembranen
ab, da nur dort das erforderliche Chlorophyll vorkommt.
60 Ökologie
DO01045455_Loesung_03.indd 60
14.04.2015 14:11:50
Fotoreaktion (Seite 221)
0 A1 Beschreiben und erklären Sie die Aussage in Abb. 1 mithilfe des Textes und Abb. 2.
– In Abb. 2 wird schematisch die Absorption und Reflexion des Sonnenlichtspektrums in einem
Blatt dargestellt. Hier wird deutlich, dass hauptsächlich das grüne und gelbe Licht reflektiert
wird. Chlorophyll absorbiert rotes und blaues Licht. Dies wird auch aus den Absorptionsmessungen in Abb. 2 deutlich. Ein zusätzlicher Anteil des Sonnenspektrums wird durch die Caroti­
noide absorbiert.
. A2 Beschreiben Sie den Energiefluss von der Sonnenenergie bis zum ATP.
– Die Sonnenenergie wird in Form eines Teils des Sonnenlichtes in den grünen Pflanzenteilen
absorbiert. In der Lichtsammelfalle wird vom Chlorophyll und den Hilfspigmenten die Energie
aufgenommen und dem Reaktionszentrum zugeführt. Diese Energie wird zur Fotolyse genutzt.
Wasser wird in Protonen, Sauerstoff und Elektronen getrennt. Der Elektronenfluss führt über die
Protonenpumpen zu einem Protonengradienten. Über die ATP-Synthase wird die Energie im ATP
gespeichert. Die Glucosemoleküle werden mithilfe der Protonen und des ATP in der Synthese‑
reaktion als Energiespeicher aufgebaut.
Synthesereaktion — Glucosesynthese (Seite 223)
. A1 Beschreiben Sie die Graphen in Abb. 4 und erläutern Sie diese.
– In Abb. 4 sind die erhaltenen Mengen von Glucose, PGS und RudP beim zeitlichen Verlauf einer
Reaktion mit Licht und ohne Licht dargestellt. Um die Neubildung der drei Substanzen zu
überprüfen, wurde radioaktiv markiertes Kohlenstoffdioxid verwendet. Bei Belichtung steigt der
Gehalt der neu gebildeten RudP und PGS an und geht dann in eine gleichbleibende Konzentration über. Glucose steigt stetig an. Bei Dunkelheit sinkt der RudP-Gehalt, PGS steigt weiter an,
ebenso die Glucose. Nach einiger Zeit bleibt die Konzentration der PGS und Glucose unverändert. PGS wird im Dunkeln weiter aus RudP gebildet. Ohne Licht fehlen ATP und NADH + H+ nach
einiger Zeit. Ebenso sinkt der CO2-Akzeptor RudP, da der Kreislauf unterbrochen wurde.
Fotosynthese in trockenen Regionen — CAM (Seite 225)
0 A1 Stellen Sie alle Faktoren zusammen, durch die Kakteen an das Leben in trockenen Regionen
angepasst sind, und erläutern Sie jeweils kurz deren Bedeutung.
– großes Wurzelsystem, hohe Saugkraft der Wurzeln, Wasserspeicher — große Wasseraufnahme
nach kurzen Regenfällen; verminderte Wasserabgabe, dicke Kutikula; Öffnen der Stomata
nachts, tagsüber geschlossen — geringere Verdunstung; Speicherung von Kohlenstoffdioxid in
Form von Äpfelsäure — Abgabe von Kohlenstoffdioxid tagsüber für die Synthesereaktion.
$ A2 Beschreiben Sie Abb. 2 und 3. Stellen Sie die Aussagen in einen gemeinsamen Zusammenhang. Erläutern Sie, wie anhand dieser experimentell gefundenen Zusammenhänge das
Schema in Abb. 4 entwickelt werden konnte.
– In Abb. 2 sind der Gehalt von Äpfelsäure und Stärke in mmol/kg Frischgewicht gegen die Zeit
im Tagesverlauf aufgetragen. Der Gehalt der Äpfelsäure verändert sich tagesrhythmisch. Er
nimmt mit der beginnenden Dunkelheit zu und nimmt am Tage ab. Der Gehalt an Stärke nimmt
am Tage zu und bei beginnender Dunkelheit ab. In Abb. 3 wird die Aufnahme und Abgabe von
Kohlenstoffdioxid im Tagesverlauf im Vergleich bei Sukkulenten und Nichtsukkulenten dargestellt. Die Kohlenstoffdioxidaufnahme steigt bei Sukkulenten nach 14 Uhr langsam an, da die
Temperaturen langsam abnehmen, von 18 bis 20 Uhr sinkt sie wieder etwas, da die Dunkelheit
schnell eintritt. Nach 20 Uhr steigt die Aufnahme stark an, da dann die Speicherung in der
Äpfelsäure erfolgt. Hierbei wird aus Brenztraubensäure durch die Kohlenstoffdioxidaufnahme
Äpfelsäure. Um genügend Brenztraubensäure zur Verfügung zu haben, wird Stärke zu Glucose
gespalten und daraus die Brenztraubensäure gebildet. Am Morgen mit dem Sonnenaufgang
geht die Aufnahme gegen Null, da die Stomata sich wieder schließen. Bei Nichtsukkulenten
fällt die Kohlenstoffdioxidaufnahme mit Einbruch der Dunkelheit bis zu einem Wert unter Null
und steigt erst wieder sehr schnell mit dem Sonnenaufgang. In der Dunkelheit überwiegt die
Dissimilation, daher wird Kohlenstoffdioxid abgegeben.
61 Ökologie
DO01045455_Loesung_03.indd 61
14.04.2015 14:11:51
Material: Fotosynthese (Seite 226/227)
$ A1 Beschreiben Sie Abb. 2 und deuten Sie die Messergebnisse.
– In Abb. 2 wird der ATP-Gehalt in Halobakterien und der pH-Wert im umgebenden Medium bei
Licht-Dunkel-Wechsel dargestellt. Wird bei Dunkelheit Sauerstoff entfernt, sinkt der ATP-Gehalt
von 100 auf 50 %, der pH-Wert bleibt unverändert. Werden die Halobakterien belichtetet, sinkt
der pH-Wert und der ATP-Wert steigt wieder auf 100 %. Bei erneuter Dunkelheit sinkt der ATPGehalt wieder und der pH-Wert steigt. Durch Lichteinstrahlung auf die Halobakterien werden
Protonen aus dem Inneren der Bakterien in das Medium gepumpt. Dies führt zu einer Zunahme
des ATP-Gehalts.
. A2 Erklären Sie anhand der Deutung und des Modells in Abb. 3 den Vorgang der ATP-Bildung in
Halobakterien.
– Diese Protonenveränderungen werden über Bakterienrhodopsin unter Lichteinfluss bewirkt.
Die Verringerung der Protonenkonzentration gegenüber dem Außenmedium führt zu einem
Protonengradienten. Der Ausgleich erfolgt über die ATP-Synthase, die zur ATP-Bildung führt.
. A3 Vergleichen Sie diesen Vorgang mit der Fotosynthese der grünen Pflanzen.
– Dieser Vorgang entspricht nur einem Teil der Fotosynthese. Der Protonengradient wird ebenfalls
aufgebaut und ATP gebildet. Es entsteht jedoch kein NADPH + H+, da keine Wasserspaltung
stattfindet. Es findet dadurch auch keine Glucosesynthese (Synthesereaktion) statt.
$ A4 Fassen Sie das Experiment von Jagendorf anhand des Textes und Abb. 4 zusammen und
vergleichen Sie dies mit den Ergebnissen der pH-Untersuchungen.
– Jagendorf wollte mithilfe seines Experimentes überprüfen, wodurch in den Chloroplasten ATP
gebildet wird. Thylakoide wurden ohne Licht in ein saures oder leicht alkalisches Medium gegeben. Die Flüssigkeit in den Thylakoiden hatte zu Beginn den Wert von pH 7, dazu wurde die saure
Flüssigkeit mit pH 4 (viele Protonen) gegeben. Nach einiger Zeit glich sich der pH-Wert in den
Thylakoiden an. Es wurde nun ADP und radioaktiv markiertes Phosphat dazu gegeben. Danach
wurde der umgebende pH-Wert auf pH 8 (leicht alkalisch, weniger Protonen) eingestellt. Nach
15 s erfolgte die Messung. Der pH-Wert in den Thylakoiden lag bei pH 8 und es war radioaktiv
markiertes ATP nachzuweisen.
. A5 Erläutern Sie das Ergebnis mithilfe der Abb. 5 und begründen Sie, weshalb die chemische
Hypothese nicht bestätigt werden konnte.
– In Abb. 5 sind die Vorgänge beim Jagendorf-Experiment schematisch dargestellt. In den Thylakoiden sieht man schematisch die Protonen und deren unterschiedliche Konzentrationen. Verdeutlicht wird, dass beim Austritt der Protonen aus den Thylakoiden in das umgebende Medium
ATP gebildet wird. Da in dem umgebenden Medium sich nur die Protonenkonzentration ändert,
jedoch keine chemische Reaktion abläuft, konnte man davon ausgehen, dass die chemiosmotische Hypothese nicht die über chemische Reaktionen bestätigt werden konnte.
0 A6 Vergleichen Sie die Absorptionsspektren der Rot- und Braunalgen in Abb. 8 und 9 mit dem
einer Landpflanze (s. Seite 220).
– Das Spektrum einer Landpflanze zeigt eine große Absorption im Bereich von 400 bis 520 nm und
etwas geringer im Bereich von 600 bis 700 nm. Die Rotalgen haben durch das Phycoerythrine
und das Phyocyanin eine zusätzliche Absorption im Bereich von 500 bis 600 nm. Im Bereich von
600 bis 700 nm ist die Absorption ebenfalls wesentlich höher. Die Braunalgen haben durch das
Fucoxanthin eine starke Absorption zwischen 500 und 560 nm.
$ A7 Beschreiben Sie in Abb. 6 die Veränderung des Lichtspektrums mit zunehmender Tiefe und
erklären Sie die Bedeutung der Farbstoffe der Rot- und Braunalgen in Bezug auf die Gewässertiefe und die Vorgänge bei der Fotosynthese.
– Mit zunehmender Tiefe verändert sich das Spektrum im Wasser. Im Bereich der Grünalgen bei
ca. 15 bis 20 m ist das Spektrum von 400 bis ca. 700 nm vorhanden. Im Bereich der Braunalgen
bei ca. 45 m Wassertiefe ist das Spektrum reduziert auf den Bereich von 450 bis 600 nm. Durch
das Fucoxanthin kann im Proteinkomplex des Lichtsammelkomplexes verstärkt der vorhandene
Restteil des Spektrums genutzt werden. Im Bereich der Rotalgen bei ca. 75 m ist nur noch ein
kleiner Teil des Spektrums zwischen 500 und 550 nm vorhanden. In diesem Bereich haben das
Phycocyanin und das Phycoerythrin eine sehr starke Absorption, die über den Lichtsammelkomplex genutzt werden kann.
62 Ökologie
DO01045455_Loesung_03.indd 62
14.04.2015 14:11:51
Chemosynthese in der Tiefsee (Seite 228)
$ A1 Beschreiben Sie die gegenseitige Abhängigkeit von Röhrenwürmern und Schwefel oxidierenden Bakterien.
– Die Röhrenwürmer besitzen weder eine Mundöffnung noch ein Verdauungssystem. Ihre Ernährung kann daher nur auf Mechanismen beruhen, die dies nicht benötigen. Die Würmer haben
ein funktionstüchtiges Blutkreislaufsystem mit Herz und Kiemen sowie lockeres Gewebe, das
vom Blutkreislauf durchzogen wird und in dem Bakterien leben (Trophosom). Dieses Gewebe
ist einer gut versorgten Bakterienkultur vergleichbar. Alle benötigten Stoffe wie z. B. Sauerstoff,
Kohlenstoffdioxid und Schwefelwasserstoff, liegen dort vor. Die Bakterien sind so in der Lage,
mittels Chemosynthese Glucose aufzubauen und an das Blut der Röhrenwürmer abzugeben.
Im Gegenzug haben die Bakterien auf diese Weise einen geschützten Lebensraum und werden
ständig mit Schwefelwasserstoff versorgt.
Stoffabbau durch Destruenten (Seite 229)
0 A1 Ein Gramm Erde im Boden enthält bis zu 40 Mio. Bakterien. Diese halten sich fast alle in Wurzelnähe auf. Erklären Sie, weshalb abbauende Prozesse in tieferen Bodenschichten relativ
langsam ablaufen.
– In tieferen Bodenschichten findet man in der Regel viel weniger Wurzelwerk als in den höheren
Bodenschichten (Ausnahmen sind Pflanzen mit tiefen Wurzeln, wie z. B. Eichen). Da im tieferen
Bodenvolumen der prozentuale Anteil an Bakterien und Mikroorganismen unter einem Prozent
liegt, ist die Abbaurate entsprechend deutlich langsamer als in Wurzelnähe. Im Wurzelwerk der
Pflanzen dagegen liegen die sogenannten Hotspots des Abbaus.
Kohlenstoffkreislauf (Seite 230)
$ A1 Kohlenstoffatome werden auch weitergegeben, wenn Pflanzenteile einem Pflanzenfresser
als Nahrung dienen und dieser später von einem Raubtier gefressen wird. Ordnen Sie die
Weitergabe in der Nahrungskette in das in Abb. 1 dargestellte System aus Speichern und
Stoffflüssen ein.
– In diesem Fall erfolgt der Kohlenstofffluss nicht zwischen Speichern, sondern zwischen Lebewesen innerhalb eines Speichers.
$ A2 Der Begriff „Kohlenstoffkreislauf“ legt nahe, dass ein Kohlenstoffatom nach unterschiedlichen Stationen wieder in seinen ursprünglichen Speicher gelangen kann. Zeigen Sie unter
Verwendung der Abb. 1 zwei möglichst unterschiedliche Wege eines Kohlenstoffatoms auf
und vergleichen Sie diese.
– Weg 1: Meer: Atmosphäre: CO2 ® An den Strand gespülter Seetang Abbau durch Destruenten Fixierung durch Fotosynthese
Landlebewesen: Tier Landlebewesen: Pflanze frisst Pflanzen und atmet C als CO2 aus
Atmosphäre: Regen über dem Meer ® Meer
Weg 2: Atmosphäre ® Landlebewesen: Pflanze fixiert C in Fotosynthese Landlebewesen: Tier
Tier frisst Pflanze und baut C in Knochen ein Sedimente: Knochen werden zu Fossilien Verwitterung Atmosphäre (Durch Verwitterung wird Fossil frei. Carbonat reagiert mit Regenwasser; CO2 steigt auf.)
Stickstoffkreislauf und Energiefluss (Seite 231)
$ A1 Eine Wassermühle soll als Modellvorstellung für die enge Verbindung zwischen Stoffkreislauf
und Energiefluss dienen. Erläutern Sie die Vorzüge und Grenzen der Modellvorstellung.
– Stoffe reagieren unter Energieaufnahme — Rad dreht sich; Energie wird dabei (teilweise) entwertet. Energiefreisetzung durch Stoffumwandlungen wird nicht dargestellt.
63 Ökologie
DO01045455_Loesung_03.indd 63
14.04.2015 14:11:51
Biodiversität (Seite 233)
. A1 Erläutern Sie mögliche Probleme, wenn der Diversitätsindex in einem Lebensraum (z. B. ufernahe Wildwuchsfläche) vor und nach einer Umgestaltungsmaßnahme erhoben werden soll.
– Die Schwierigkeit liegt darin, dass zunächst die Anzahl sowie die in etwa gleiche Häufigkeit
möglichst aller vorhandenen Arten bekannt sein muss. Dies dürfte in der Praxis kaum oder nur
mit extremem Aufwand zu leisten sein. In der Praxis wird der Diversitätsindex daher gelegentlich auf bestimmte Arten (alle Kleinsäuger, alle Vögel und/oder alle Gräser) eines Ökosystems
beschränkt.
64 Ökologie
DO01045455_Loesung_03.indd 64
14.04.2015 14:11:51
3. 5 Land- und Gewässerökosysteme
Der Wald (Seite 235)
0 A1 Prüfen Sie, inwiefern das Basiskonzept Kompartimentierung im Ökosystem Wald zutrifft.
– Aufgrund der Lebensweise der unterschiedlichen Organismen gibt es sowohl getrennte Bereiche
(z. B. Vögel in den Baumkronen, Destruenten im Boden) als auch ökologisch getrennte Bereiche
(z. B. Produzenten, Konsumenten). Deshalb kann man von Kompartimenten sprechen.
0 A2 Der Massenbefall durch Laub fressende Schadinsekten stellt nur sehr selten eine wirkliche
Bedrohung der Wälder dar. Begründen Sie diese Aussage.
– Physiologische Begründung: Bäume haben nur einen relativ kleinen Teil ihrer Biomasse als
Laubblätter angelegt. Bei Verlust der Blätter reichen die Mineralstoffvorräte in der Regel für
einen neuen Austrieb aus. Die Insektenlarven sind dann durch Verpuppung verschwunden. Ökologische Begründung: Das vielfältige Nahrungsnetz im Wald führt dazu, dass eine Vielzahl
von Fressfeinden (Insekten fressende Vögel, Spinnen, Raubinsekten wie Ameisen) die Zahl der
Schädlinge nachhaltig dezimieren können.
Sukzession (Seite 237)
$ A1 Erläutern Sie die Angepasstheit von Pionierpflanzen im Hinblick auf deren Zuordnung zu den
K- bzw. r-Strategen (Basiskonzept Variabilität und Angepasstheit).
– An Initialstandorten herrschen Bedingungen vor, die solchen Pflanzen einen raschen Aufwuchs
ermöglichen, die in kurzer Zeit ihre Populationsgröße erhöhen können: hohes Lichtangebot,
hohes Nährstoffangebot, Konkurrenzfreiheit. An diese Bedingungen sind Pionierpflanzen als
r-Strategen angepasst. Sie bilden in kürzester Zeit eine große Menge von Samen, die ebenfalls
nach sehr kurzer Zeit wieder auskeimen. Diese Strategie wird durch den Wegfall der oben
genannten Bedingungen limitiert.
Praktikum: Wald (Seite 238/239)
$ A1 Mikroskopieren Sie die Probe in Tagesabständen (Mikroskop, Stereolupe) und protokollieren
Sie die Veränderungen. Vergleichen Sie die Beobachtungen in den verschiedenen Bodenproben.
– Bei diesen Untersuchungen sollte man darauf achten, dass beim Mikroskopieren das Präparat
durch die Beleuchtung erwärmt wird und dadurch schnell austrocknen kann. Es ist darauf zu
achten, dass die Feuchtigkeit immer ausgeglichen wird, da sonst Messergebnisse verfälscht
werden.
. A2 Ordnen Sie das Vorkommen der gefundenen Pflanzen im Wald den gemessenen abiotischen
Faktoren zu und vergleichen Sie Ihre Befunde mit der Abbildung unten rechts. Erläutern Sie
die Vorteile der Zeigerarten gegenüber den physikalischen Messungen (s. Seite 238).
– Die biologischen Befunde werden nicht immer mit den abiotischen Messwerten übereinstimmen, da viele Pflanzen kurzfristige Schwankungen durchaus ertragen können.
$ A3 Stellen Sie mithilfe der gesammelten, abgestorbenen Substrate des Waldbodens die
fortschreitende Zersetzung auf einem Plakat dar. Ordnen Sie den jeweiligen Zersetzungsstufen die gefundenen Kleintiere zu und notieren Sie diese auf dem Plakat. Erläutern Sie die
Bedeutung dieser Kleinlebewesen bei der Mineralisierung. Gehen Sie hierbei auch auf die
Präferenzen der gefundenen Bodenbewohner ein.
– siehe Abbildung
Regenwurm
Springschwanz
Milbe
Amöbe
65 Ökologie
DO01045455_Loesung_03.indd 65
14.04.2015 14:11:51
Der See im Jahresverlauf (Seite 241)
$ A1 Erklären Sie die Temperaturschichtung im See im Sommer und in einem eiskalten Winter.
– Im Sommer spielt die Durchmischung des Sees durch Wind außer in der Deckschicht (Epilimnion) keine größere Rolle; die Dichteunterschiede des Wassers sind beträchtlich. Das kältere
Tiefenwasser gelangt durch den Dichteunterschied nicht in den Bereich des Oberflächenwassers. Es setzt sich nach unten ab. Das Oberflächenwasser wiederum wird durch die intensiven
Sonnenstrahlen stark erwärmt. Nachts kommt es durch Abkühlung zur sogenannten Teilzirkulation. Nur in diesem Wasserbereich findet also ein Temperaturaustausch statt. Zwischen
der Deckschicht und der Tiefenschicht (Hypolimnion) kommt es zur Bildung der Sprungschicht
(Metalimnion), in der die Temperatur Richtung Grund rapide absinkt. Im Winter ist das 4 °C
kalte Wasser am schwersten. Weniger dichtes, noch kälteres Wasser lagert sich darüber, bis
schließlich gefrorenes Wasser folgt (Eisschicht).
Der eutrophe See (Seite 243)
$ A1 Erklären Sie die in Abb. 2 unten dargestellten Messwerte.
– Zu Beginn des Frühjahres, Ende des Winters, nehmen die Temperaturen und die Menge an Licht
allmählich wieder zu. Fotosynthetisch aktives Phytoplankton kann sich daher gut vermehren.
Der Anteil an gelösten Mineralstoffen, den das Phytoplankton benötigt, wird geringer.
Zeitlich versetzt nimmt auch die Menge des Zooplanktons, welches sich vom Phytoplankton
ernährt, zu. Daher nimmt der Anteil an gelösten Mineralstoffen weiter ab. In der Mitte des
Frühjahrs kommt es dann aufgrund der hohen Zooplanktonvermehrung zu einem Einbruch des Phytoplanktons (Klarwasserperiode). In der Folgezeit bricht aber auch die Zooplankton‑
population stark ein, sodass sich das Phytoplankton wieder stärker vermehren kann. Ende des
Sommers/ Anfang Herbst gehen die Biomassen beider Planktonarten allmählich zurück und
erreichen Ende Herbst ihr jeweiliges Minimum.
Mineralstoffe im See (Seite 245)
$ A1 Begründen Sie, weshalb das „Umkippen“ eines Sees vor allem im Sommer gegen Ende der
Nacht erfolgt.
– Die hohen Wassertemperaturen im Sommer senken den Sauerstoffgehalt und steigern den Sauerstoffverbrauch im Gewässer. Nachts findet keine Fotosynthese und damit keine Sauerstofffreisetzung statt. Folglich ist der Sauerstoffgehalt morgens am niedrigsten.
Material: Daphnien im See (Seite 246/247)
$ A1 Klären Sie weitere Auslöser der Vertikalwanderung anhand der Abb. 5 und der Tabelle 4.
– Es ist eine Kombination aus zwei Einflüssen: Wichtigster Auslöser ist das Licht. Morgens bei
einsetzender Helligkeit wandern die Daphnien in tiefere Wasserschichten, abends bei einsetzender Dunkelheit steigen sie wieder auf. Ob die Wanderungen überhaupt stattfinden oder
unterbleiben, hängt von der Anwesenheit von Fischen ab: fehlen die Fische, so unterbleibt auch
die Wanderung.
. A2 Erklären Sie, welchen Vorteil die Vertikalwanderung für die Daphnien darstellt.
– Bei Anwesenheit von Fischen ist es von Vorteil, tagsüber dem Räuberdruck durch Wanderung in
die Tiefe entgehen zu können, da Fische ihre Beute vorwiegend visuell orten. Ohne Fische ist es
dagegen vorteilhaft, tagsüber die Zeit hoher Produktion der Algen für die Nahrungsaufnahme
nutzen zu können. Das Verhalten bzw. sein möglicher Wechsel ist daher entsprechend dem
Kosten-Nutzen-Prinzip sehr gut angepasst.
$ A3 Erläutern Sie anhand der Daten in Abb. 6 die Vor- und Nachteile der Vertikalwanderung.
– siehe Lösung zu Aufgabe 4
$ A4 Stellen Sie die Unterschiede zwischen D. hyalina und D. galeata zusammen. Begründen Sie
das Zustandekommen der einzelnen Unterschiede. Informieren Sie sich gegebenenfalls noch
einmal über die Bedeutung der RGT-Regel.
– Im Vergleich zu D. hyalina gilt für D. galeata:
• D. galeata wandert nicht tagesperiodisch, D. hyalina schon
• mehr Eier, kurze Entwicklungsdauer
• geringere Populationsdichte, aber stärkere Zunahme
• deutlich höhere Geburtenrate, aber auch deutlich höhere Sterberate
66 Ökologie
DO01045455_Loesung_03.indd 66
14.04.2015 14:11:52
– D. galeata lebt auch tagsüber im Oberflächenwasser. Sie kann dort die aktuelle Produktion
fressen und ist daher besser genährt. Das führt u. a. zu einer höheren Reproduktion (mehr Eier,
höhere Geburtenrate). Außerdem ist das Oberflächenwasser wärmer, was die raschere Entwicklung der Nachkommen erklärt. Das Leben im Oberflächenwasser führt aber auch zu einer
höheren Sterberate, da die optisch jagenden Fische ihre Beute gut wahrnehmen können. In
der Summe ergibt sich zwar für D. galeata ein stärkeres Populationswachstum (ca. 4-mal von
August bis September) als bei D. hyalina (ca. 3-mal), aber die Population erreicht dennoch nur
ein niedrigeres Niveau.
$ A5 Erklären Sie den Einfluss des Zooplanktons auf das Phytoplankton des Bodensees. Was würde sich mit einer größeren Population von D. galeata bzw. d. hyalina ändern?
– Beide Daphnienarten nutzen die Produktion des Phytoplanktons als Nahrungsressource. D. hyalina kann aber davon nur nachts profitieren, wenn sie an die Oberfläche kommt. Sie
ist dann auf die Planktonmenge angewiesen, die D. galeata übrig gelassen hat. Eine größere
Population von D. galeata würde damit die Population von D. hyalina beeinträchtigen. Andererseits würde sie aber auch die Fischpoulationen fördern und damit die Sterberate der eigenen
Population erhöhen. Eine größere Population von D. hyalina (bei kleinerer Population von D. galeata) würde das
Algenwachstum weniger beeinträchtigen, da sich die Algen tagsüber ungestörter vermehren
könnten. Die Fischpopulationen hätten jedoch größere Schwierigkeiten, Nahrung zu finden.
$ A6 Erklären Sie, wie die unten dargestellten Unterschiede in der Talsperre vor und nach der
Biomanipulation zustande kommen.
– Durch den Einsatz der Raubfische verringert sich die Menge der planktivoren Fische. Die daraufhin besser überlebenden Zooplanktonarten bauen höhere Populationsdichten auf, die wiederum
das Phytoplankton stark reduzieren. Insgesamt haben sich geringe Dichten in hohe gewandelt
und umgekehrt.
. A7 Die künstlich geschaffene Situation ist auf längere Sicht nicht stabil, vor allem wenn Nachwuchs von Hechten und Barschen vorhanden ist. Die Populationen müssen daher gegebenenfalls eingestellt werden. Erklären Sie diese Zusammenhänge.
– Die Nahrungspyramide beginnt mit dem Phytoplankton, auf seiner Produktion bauen alle anderen Stufen auf. Damit bestimmt das Phytoplankton aufwärts (Bottom-up) die nachfolgende
Stufe. Die weiteren Ebenen sind in der Regel alternierend bestimmt (Top-down, dann wieder
Bottom-up, usw.).
$ A8 Erklären Sie, welche Form der Kontrolle vor und nach der Biomanipulation in der Talsperre
vorliegt.
– Die Biomanipulation kehrt die Einflüsse um. Die Population der Raubfische ist nun für das Gewässer zu groß, vor allem, wenn sie sich vermehren und Hunger leiden, weil ihre Nahrungsbasis
zu klein ist. Langfristig ist die künstlich eingestellte Situation daher nicht stabil und entwickelt
sich wieder auf den ursprünglichen Zustand zurück. Will man den Vorteil sauberen Wassers
weiterhin bewahren, muss man die manipulierte Situation immer wieder einstellen.
Fließgewässer (Seite 249)
. A1 Stellen Sie die Parameter BSB5, Ammonium/ Ammoniak- und Sauerstoffgehalt (Abb. 2) in
eine kausale Beziehung.
– Ein hoher BSB5-Wert zeigt eine starke Sauerstoffzehrung an. Folglich zeigt das Gewässer dann
vor allem in größerer Wassertiefe einen geringen Sauerstoffgehalt. Als Folge ergibt sich ein
recht hoher Ammonium- bzw. Ammoniakgehalt, da unter diesen Bedingungen Nitratatmung
stattfindet.
$ A2 Stellen Sie begründete Hypothesen zur Wirkung von Wärme und Schwermetalleintrag in
Fließgewässer auf.
– Schwermetalle werden in Fließgewässern u. a. vom Zooplankton aufgenommen und reichern
sich weiter über die Nahrungskette stark an. Für alle Lebewesen einschließlich des Menschen,
die an dieser Nahrungskette beteiligt sind, bedeutet dies eine Aufnahme dieser Schwermetalle.
Diese lassen sich im Körper von Lebewesen nicht abbauen und führen zu Vergiftungen der
entsprechend beteiligten Lebewesen. Auch Wärme, wie sie beispielsweise durch Kraftwerke entsteht, belastet ein Fließgewässer. Dies
gilt vor allem für warme Sommertage, da die Sauerstofflöslichkeit in Wasser mit zunehmender
Temperatur sinkt und den Lebewesen in Fließgewässern entsprechend weniger Sauerstoff zur
Verfügung steht. Bei entsprechender Wärmeeinleitung verstärkt sich dieser Effekt daher noch.
Einige Lebewesen erleiden daher Sauerstoffmangel.
67 Ökologie
DO01045455_Loesung_03.indd 67
14.04.2015 14:11:52
Flussauen als Rückzugsraum (Seite 250)
0 A1 Bei Flussauen spricht man von Anlandung, bei Seen von Verlandung. Nennen Sie Unterschiede und berücksichtigen Sie dabei besonders die Sedimente.
– Bei der Entstehung von Auwäldern steht die Ablagerung von Kies, Sand und Lehm stromabwärts im Vordergrund. Es handelt sich also um einen Fremdeintrag von Sedimenten. Diese
Sedimente sind gut mit Sauerstoff versorgt, es fehlt ein Reduktionshorizont. In Seen lagern sich
Pflanzenteile ab, die aus dem See selbst stammen. Die Sedimente sind reich an organischen
Verbindungen und bereits in geringer Tiefe sauerstofffrei. Sie neigen zur Torfbildung, die die
Verlandung einleitet oder über Niedermoore zu Bruchwäldern führt.
0 A2 Wie wirkt sich ein erhöhtes Wasseraufkommen auf den Wasserstand in städtischen Gebieten
aus?
– In städtischen Gebieten sind die Böden durch Häuser und Straßen versiegelt. Dem Hochwasser fehlen Verteilungsräume. Es kann schlecht versickern und wird nicht durch die Vegetation
aufgenommen und durch Verdunstung abgegeben.
$ A3 In der Weichholzaue fehlt der Frühjahrsaspekt. Erklären Sie.
– Frühblüher des Waldes haben mit Knollen oder Zwiebeln als Nährstoffspeicher überwintert und
nutzen die Frühjahrswärme und das Licht der laubfreien Wälder. In der Weichholzaue würden
die Knollen im Winter im feuchten Boden verfaulen. In der Hartholzaue blühen auf trockenerem
Boden Schneeglöckchen, Bärlauch und Blaustern.
Praktikum: Freilandökologie an Gewässern (Seite 252/253)
A1 – A13individuelle Lösungen
Meer als Lebensraum (Seite 255)
$ A1 Nennen Sie Gemeinsamkeiten und Unterschiede der Gliederung und der Umweltfaktoren
von Meer und See.
– Meer und See sind in das freie Wasser (Pelagial) und den bodennahen Bereich (Benthal) gegliedert, von letzterem wird der lichtversorgte Bereich als Litoral abgegrenzt.
Im Meer lassen sich Benthal und Pelagial durch die Wirkung zusätzlicher abiotischer Faktoren
weiter unterteilen. Unterschiedliche Überflutungsdauer durch die Gezeiten trennt im Litoral das
Supra-, Eu- und Sublitoral voneinander. Darunter reicht das Licht zur Fotosynthese nicht mehr
aus, ermöglicht als Dämmerlicht aber noch eine gewisse Orientierung (Bathyal). Unter etwa
1000 m Tiefe ist es absolut dunkel (Abyssal). Extrem hoher Druck kennzeichnet die Tiefseegräben
(Hadal). Das Pelagial ist entsprechend vertikal gegliedert. Auf den Lichtbereich (Epipelagial),
folgt der Dämmerlichtbereich (Bathypelagial) und dann die absolute Dunkelheit am Tiefseeboden (Abyssopelagial). Das freie Wasser der Tiefseegräben wird Hadopelagial genannt.
$ A2 Erläutern Sie, wie sich die Rolle des Herings im Nahrungsnetz in Abhängigkeit von seinem
Alter ändert (Abb. 3).
– Junge Heringe, die kleiner als 12 mm sind, ernähren sich von Geißeltierchen, sie sind also Primärkonsumenten. Sie werden von räuberischen Arten verfolgt, vor allem von Quallen, Seestachelbeeren und Sagitta, einem pelagischen Pfeilwurm. Die größeren Heringe fressen vor allem
Kleinkrebse und Krebslarven. Sie sind Sekundärkonsumenten. Erwachsene Heringe regulieren
auch den Bestand von Sagitta, dem Räuber der Jungen. Hier hat sich die Ernährungsbeziehung
also umgekehrt.
68 Ökologie
DO01045455_Loesung_03.indd 68
14.04.2015 14:11:52
3. 6 Mensch und Umwelt
Weltbevölkerung (Seite 256)
$ A1 Informieren Sie sich über den möglichen Zusammenhang von Säuglingssterblichkeit und
Bevölkerungswachstum. Erläutern Sie.
– Bei hoher Säuglingssterblichkeit kann in traditionellen Gesellschaften der Wunsch nach Arbeitskräften und Altersversorgung zu einer hohen Nachkommenschaft führen.
Regenerative Energiequellen (Seite 257)
$ A1 Bewerten Sie den Einsatz von Mais unter dem Aspekt der Nachhaltigkeit. Berücksichtigen
Sie dabei mögliche räumliche und soziale Fallen.
– Biogaserzeugung aus Mais nutzt einerseits die durch die Fotosynthese fixierte Sonnenenergie
und kann dadurch fossile Energieträger wie Erdgas o. ä. ersetzen. Andererseits werden dadurch
Anbauflächen beansprucht, die der Erzeugung von Nahrungsmitteln dienen könnten. Damit
wird der Futteranbau von heimischen Flächen auf solche Anbauflächen verlagert, auf denen
günstig Futtermittel erzeugt werden können. Das könnten Länder mit Nahrungsmittelknappheit
sein. Damit könnte die Entscheidung, Biogasanlagen mit Mais zu betreiben, eine räumliche
und soziale Falle darstellen. Sie ist damit nicht nachhaltig. Auch andere Argumentationen sind
möglich.
$ A2 Wissenschaftler gehen derzeit davon aus, dass „Brennstoffernten“ jährlich im Idealfall ca.
10 000 Liter Heizölersatz pro Hektar liefern. Der derzeitige weltweite Erdölverbrauch pro Jahr
beträgt ca. 4,4 Billionen Liter. Berechnen Sie, welche Fläche hierfür für den oben beschriebenen Idealfall gebraucht wird und wie hoch dieser Anteil bezüglich des zur Verfügung
stehenden Acker- und Weidelandes ist (siehe Abb. 2).
– 4 400 000 000 000 Liter / 10 000 Liter pro Hektar an Ertrag (Idealfall) = 440 Mio. Hektar an Bedarf
weltweit. Dies ergäbe bei insgesamt 2505 Mio. Hektar, die an Acker- und Weideland weltweit
existieren und genutzt werden, einen Flächenverbrauch von einem Fünftel der Gesamtweltfläche für sogenannte „Brennstoffernten“.
Umweltschutz — unsere Verantwortung (Seite 258)
$ A1 Reflektieren Sie Ihren Standpunkt zu einem aktuellen Umweltschutzthema und überlegen
Sie, inwiefern persönliche Sichtweisen hierdurch beeinflusst werden.
– Bei der Bearbeitung dieser Aufgabe sind nur individuelle Lösungen möglich. Aspekte hierzu:
Auffassung von der Stellung des Menschen zur Natur in den verschiedenen Religionen und
bei Naturvölkern gegenüber der Bevölkerung in Industrienationen. Wichtig bei diesen Überlegungen ist es, innerhalb des persönlichen Standpunktes die Frage nach der eigenen Verantwortung für die Natur und die Folgen in der Zukunft zu klären.
Der ökologische Fußabdruck (Seite 260)
$ A1 Ermitteln Sie mithilfe des Internets, welche Unterschiede sich im ökologischen Fußabdruck
für das tägliche Verkehrsmittel zur Schule ergeben, wenn das Fahrrad, der Bus, der Zug oder
ein Privat-Pkw benutzt werden.
– Der ökologische Fußabdruck wird häufig in globalem Hektar pro Person abgebildet (gha/P.).
Eine solche Einheit entspricht der durchschnittlichen biologischen Aktivität eines Hektars.
Fahrrad: 0,007 gha/P., Bus: 0,0318 gha/P., Zug: 0,0316 gha/P., Auto: 0,1821 gha/P.
Schutz der globalen Vielfalt (Seite 261)
$ A1 2011 wurde von den Vereinten Nationen zum Jahr der Wälder erklärt. Recherchieren Sie im Internet, zu welchen entsprechenden Themengebieten bekannte Umweltverbände wie
NABU oder WWF Informationen bereithalten, und halten Sie über ein selbst gewähltes Thema aus diesem Bereich ein Kurzreferat.
– Man findet u. a. Artikel zu folgenden Themen: Naturschutz im Wald, Waldpolitik, Holznutzung,
Holz-Zertifizierung, Waldzustand, Regenwälder, Urwälder in Europa etc.
69 Ökologie
DO01045455_Loesung_03.indd 69
14.04.2015 14:11:52
$ A2 Nehmen Sie, unter Bezug auf den oberen Text, Stellung zu der Aussage: „Natur- und Umweltschutz sind immer Ländersache“.
– Viele Tier- und Pflanzenarten sind über Ländergrenzen hinweg verbreitet. Das gleiche gilt natürlich auch für geografische Gegebenheiten wie Flüsse, Seen, Meere, Gebirge und Wälder, die eine
bedeutende Rolle im Umweltschutz und Naturschutz spielen. Sinnvoll geplanter Umwelt- und
Naturschutz darf daher nicht nur national begrenzt bleiben, sondern muss die entsprechenden
geografischen Gegebenheiten einschließen. Diese verlangen häufig eine internationale Verständigung und Einigung zum Erreichen bestimmter Ziele.
Übungen: Ökologie (Seite 262/263)
$ A1 Erklären Sie anhand der Daten in der Abbildung 5 die Veränderungen, die durch das Fernhalten der Beringsmöwen und Braunmantel-Austernfischer zustande kommen.
– Das Fernhalten der Beringmöwen und Braunmantel-Austernfischer führte nicht zu der deutlichen Veränderung der bevorzugten Beutetiere, wie man es erwartet hatte. Hier sind andere
Faktoren mitbestimmend. Der Platzbedarf an der Steilküste ist der entscheidende Faktor. L. strigatella ist dem Konkurrenzdruck der anderen Arten unterlegen. Durch das Fehlen der
Entenmuschel wird sogar die Pflanzenwelt verändert, da durch das geringere Abweiden durch
die Napfschnecken mehr thallöse Algen vorhanden sind.
. A2 Erörtern Sie, weshalb während des Experimentes die Anzahl von Lottia pelta nicht zunimmt,
obwohl sie von den Seevögeln als Beute bevorzugt werden. Benutzen Sie hierzu auch die
untersuchten Zusammenhänge (1—7) zwischen den einzelnen Lebewesen.
– Die verschiedene Tiere und Pflanzen zeigen zusammen einen größeren Zusammenhang als
einzelne Beobachtungen von jeweils zwei Arten. Dies liegt daran, dass Platzprobleme durch
die festsitzenden Lebewesen auf engem Lebensraum mit den räuberischen Feinden in einem
Zusammenhang stehen. Zusätzlich kommt hinzu, dass bestimmte Napfschnecken die festsitzenden Algen dezimieren und so auch zu veränderten Platzbedingungen durch Pflanzen führen.
$ A3 Beschreiben Sie vergleichend die Häufigkeitsverteilung der Waldkiefer in Abhängigkeit vom
Faktor Bodenfeuchte in Versuchsbeeten und an natürlichen Standorten nach Abb. 8 und Abb. 9.
– Der physiologische Toleranzbereich der Waldkiefer reicht von trocken bis nass mit einem deutlichen Optimum bei feuchtem Boden und nur geringer Verbreitung auf trockenen und nassen
Standorten. Das natürliche Vorkommen ist im Gegensatz dazu auf trockene und nasse Standortextreme beschränkt.
$ A4 Erklären Sie mit Bezug auf die Abbildungen die Begriffe „ökologische Toleranz“ und „ökologische Potenz“ und deuten Sie die Befunde unter diesen Aspekten.
– Die breite ökologische Toleranz ermöglicht es der Waldkiefer, unter Konkurrenzbedingungen an
extremen Standorten zu wachsen, weit entfernt vom Optimum ihrer physiologischen Potenz. Die
reale ökologische Potenz hängt wesentlich von den Konkurrenzarten ab.
0 A5 Beschreiben Sie den Frühjahrs-, Sommer- und Herbstaspekt im Buchenwald.
– Im Diagramm ist die Lichtintensität in relativen Einheiten in Prozent über den Jahresverlauf
dargestellt. Die Messungen sind für die Kronenschicht und die Krautschicht erfolgt. Als zweiter
Faktor wurde CO2-Assimilation der Sonnenblätter in relativen Einheiten in Prozent über den
Jahresverlauf dargestellt. Im April bis Mai steht der Wald vor der Laubentfaltung. In der Krautschicht ist im März und April die Lichtintensität relativ groß. Sie sinkt nach der Laubentfaltung
und steigt erst wieder nach dem Laubfall. Die Buche setzt vor der Laubentfaltung (Februar)
Kohlenstoffdioxid frei, sie mobilisiert über die Dissimilation Energie aus gespeicherter Glucose
oder Stärke für den Blattaustrieb. Die Fotosynthese und damit die Kohlenstoffdioxid-Assimila­
tion steigen mit der Laubentfaltung und sinken mit dem Laubfall im Oktober wieder auf Null.
$ A6 Erläutern Sie mögliche Zusammenhänge der dargestellten abiotischen und biotischen Faktoren im Jahreslauf.
– Im Sommer ist die Buche voll belaubt. Ihre Fotosyntheserate ist maximal infolge der hohen
Lichtintensität mit steigendem Sonnenstand. Nur wenige schattenliebende Pflanzen sind unter
dem Kronendach zu finden, wie der Waldziest. Andere Pflanzen der Krautschicht sind bereits
früher im Wachstum, wenn die Belaubung noch nicht ausgeprägt ist.
70 Ökologie
DO01045455_Loesung_03.indd 70
14.04.2015 14:11:52
4 Evolution
4. 1 Evolution — Veränderung und Vielfalt
Veränderungen in großen und kleinen Schritten (Seite 267)
$ A1 Erläutern Sie die Aussage des Textes, dass die Merkmalszusammensetzung einer gegenwärtigen Generation die Angepasstheit der vorigen Generation widerspiegelt.
– Die Individuen, die in einer Generation (der „N-ten“ Generation) die beste Angepasstheit an die
derzeitigen biotischen und abiotischen Lebensbedingungen aufweisen, haben einen Konkurrenzvorteil und können sich deswegen verhältnismäßig erfolgreicher fortpflanzen. Dadurch
sind in der nächsten Generation (der „N+1-ten“ Generation“) die Individuen mit den Merkmalen
der N-ten Generation zahlenmäßig am stärksten vertreten – auch wenn sich inzwischen die
Bedingungen wieder geändert haben. In dieser N+1-ten Generation können sich wiederum
die Individuen am besten fortpflanzen, die derzeit die beste Angepasstheit aufweisen – in der
Merkmalszusammensetzung der Population spiegelt sich die Angepasstheit der N+1-ten Generation dann in der N+2-ten Generation wider.
. A2 Beziehen Sie die Karikatur (Abb. 2) auf die Aussagen im Text.
– Die Karikatur soll auf mehrere Widersprüche und Fehlvorstellungen hinweisen: Evolution ist
ein fortlaufender Prozess, der aufgrund verschiedener Faktoren wie Selektion oder Migration
zu der Entstehung verschiedener Arten geführt hat. Es gibt keine „spontane“, schon gar keine
zielgerichtete Entstehung neuer Arten oder Eigenschaften, welche die Fitness eines Individuums
bestimmt.
Variabilität und Artenvielfalt (Seite 269)
0 A1 Erläutern Sie den Unterschied zwischen morphologischem und biologischem Artbegriff.
• Morphologischer Artbegriff: Die Artzuordnung erfolgt nach dem morphologischen Erscheinungsbild, d.­h. sie orientiert sich an der Gestalt der Individuen.
• Biologischer Artbegriff: Die Artzuordnung orientiert sich an der (möglichen) Zugehörigkeit von
Individuen zu einer Fortpflanzungsgemeinschaft.
• In einigen Fällen kommt die Anwendung der beiden Artbegriffe zum gleichen Ergebnis, in anderen Fällen, wie z. B. Vogelfalter und Zwerg- sowie Mückenfledermaus, zu unterschiedlichen.
$ A2 Beschreiben Sie die Eigenschaften, die zur Abgrenzung einer Art beachtet werden. Erläutern
Sie anhand des Fledermausbeispiels, ob es wichtigere und weniger wichtige gibt und ob das
für alle Organismen gleich ist.
• Eigenschaften zur Abgrenzung: Aussehen (z. B. Größe, Gestalt, Färbung), Lautäußerungen
(z. B. Balzgesang, Echolotrufe), Verhaltensmerkmale (z. B. Paarungsverhalten, Konkurrenzverhalten), Habitatwahl, Nahrungsquellen, Aktivitätszeiten
• Besonders wichtig sind Eigenschaften, die in irgendeiner Weise an Fortpflanzung gebunden
sind — im Fall der Fledermäuse sind dies die Echolotrufe.
. A3 Begründen Sie, wozu es nützlich ist, eine Art von der anderen zu unterscheiden.
– Für den Artenschutz ist dies sehr wichtig: Der Schutzstatus einer Art und Schutzmaßnahmen
können nur dann effektiv bestimmt werden, wenn klar ist, welche Individuen zu einer Fortpflanzungsgemeinschaft gehören. Andere mögliche Antworten:
• Zur Erfassung von Artenvielfalt in einem Gebiet.
• Zur Priorisierung von Schutzgebieten (anhand von Artenzahlen).
• Zur Erforschung der Artentstehung.
Variabilität und ihre Ursachen (Seite 271)
0 A1 Erläutern Sie den Unterschied zwischen modifikatorischer und genetischer Variabilität.
– Während die genetische Variabilität auch in der Folgegeneration zu finden ist, sinkt die modifikatorische Variabilität drastisch, wenn die Folgegeneration unter gleichen Umweltbedingungen
heranwächst.
$ A2 Nennen Sie Faktoren, die zutreffen müssen, damit sich eine Mutation phänotypisch auswirkt.
– Mutationen müssen in Genombereichen stattfinden, die entweder verantwortlich für die
Protein­codierung sind oder regulatorische Funktionen haben und somit die Genexpression
beeinflussen.
$ A3 Erläutern Sie, warum die genetische Vielfalt deutlich höher ist als Abbildung 3 vorgibt.
– Während der Meiose kommt es zu zufälligen Überkreuzungen zweier homologer Chromosomen.
Bei diesen Überkreuzungen kommt es immer wieder zum Austausch von Stücken (Crossingover).
Dadurch erhöht sich die genetische Vielfalt innerhalb einer Art zusätzlich zu den unterschiedlichen Rekombinationsmöglichkeiten.
71 Evolution
DO01045455_Loesung_04.indd 71
14.04.2015 14:19:33
Natürliche Selektion (Seite 273)
0 A1 Beschreiben Sie den Zusammenhang zwischen Selektionsdruck und der Geschwindigkeit
evolutionärer Prozesse.
– In der Regel gilt: Je höher der Selektionsdruck, desto effektiver und somit schneller wirkt Selektion.
Deutlich macht dies das Beispiel zur Fellfarbe von Mäusen: Bewirkt z. B. eine Änderung der
Untergrundfarbe einen höheren Jagderfolg von Mäusen einer bestimmten Fellfarbe, so ist der
Selektionsdruck gegen diese Fellfarbe hoch.
$ A2 Erläutern Sie die Bedingungen für natürliche Selektion.
– Zunächst muss Konkurrenz um Ressourcen herrschen, damit sich die besser angepassten
Individuen verhältnismäßig erfolgreicher fortpflanzen. Dies ist fast immer für alle Ressourcen
gegeben. Die Merkmale, auf die Selektionsdruck herrscht, müssen dann variabel sein und sich
phänotypisch ausprägen. Weiter müssen sie sich durch Vererbung von einer Generation auf die
nächste übertragen lassen.
. A3 Bei dem Beispiel in Abb. 3 können alle drei Typen der Selektion beobachtet werden. Stellen
Sie eine begründete Hypothese auf, wie es bei Schmetterlingen zu a) gerichteter, b) disruptiver und c) stabilisierender Selektion kommen kann.
– Gerichtete Selektion kann dann erfolgen, wenn die Merkmalsausprägung „dunkle Fügelfarbe“
den Trägern einen Vorteil verschafft und gleichzeitig das Merkmal „helle Flügelfarbe“ dessen
Trägern einen starken Nachteil verschafft. Die Träger des Merkmals „helle Flügelfarbe“ erhalten
keine Nachkommen mehr, die Träger dunkler Flügelfarbe besonders viele. Disruptive Selektion kann dann erfolgen, wenn sowohl die Merkmalsausprägung „dunkle
Fügelfarbe“ als auch die Ausprägung „helle Flügelfarbe“ den Trägern einen Vorteil liefert und
gleichzeitig die mittleren Flügeltypen einen Nachteil haben, der zu geringem Fortpflanzungs‑
erfolg führt. Dies ist zum Beispiel bei zwei verschiedenen Habitattypen denkbar.
Stabilisierende Selektion kann dann erfolgen, wenn die Träger mittlerer Flügelfarbentypen
einen Vorteil haben, der zu besonders hohem Fortpflanzungserfolg führt, indem die Träger der
extremeren Flügelfärbungen sehr wenige oder keine Nachkommen produzieren können.
Der Weg zur Angepasstheit (Seite 275)
0 A1 Erläutern Sie Vor- und Nachteile verschiedener Körpergrößen bei Möwen.
– Kleine Möwen haben den Vorteil, kaum Fluganlauf zu benötigen und können somit an geschützten Orten wie Steilküsten nisten. Größere Möwen hingegen erreichen höhere Fluggeschwindigkeiten und können so andere und mehr Nahrungsquellen nutzen.
$ A2 Stellen Sie die Begriffe „Angepasstheit“ und „Anpassung“ gegenüber.
– Angepasstheit ist das Ergebnis der Selektion, wohingegen als „Anpassung“ der Selektionsprozess verstanden werden kann.
$ A3 Viele Biologen kritisieren den Begriff „Präadaptation“, da dieser eine gezielte Vorbereitung
der Populationen auf Veränderungen suggeriert. Nehmen Sie Stellung zu dieser Kritik.
– Genetische Vielfalt ist zunächst zufällig vorhanden und zum Teil neutral. Welche der Varianten
in Zukunft eine Angepasstheit darstellt, ist in der Gegenwart unbekannt.
. A4 Nennen Sie Merkmalskombinationen bei Pflanzen, die Anpassungskompromisse darstellen.
– Habitus und Wuchshöhe (z. B. krautig — klein), Fruchtgröße und Fruchtansatz (schwere Frucht
— Kauliflorie), …
. A5 Erläutern Sie, warum die Ergebnisse aus dem Penicillinversuch im Naturschutz relevant sein
können.
– Genetische Variabilität innerhalb von Populationen ist wichtig, um auf veränderte Umweltbedingungen „reagieren“ zu können. Durch fortbestehenden Fortpflanzungserfolg von Trägern
bestimmter Merkmale, die unter den früheren Umweltbedingungen unwichtig (bzw „neutral“)
waren, können einige Individuen einer Population auch bei stark veränderten Umweltbedingungen den Fortbestand einer Population bewirken. Es reicht deswegen nicht, nur wenige
Individuen einer Popualtion oder Art zu erhalten, denn je mehr genetische Variabilität, desto
wahrscheinlicher ist es, dass einige Individuen Träger solcher Merkmale sind.
. A6 Entwerfen Sie ein Experiment, mit dem Sie die Begrenztheit der Evolution (evolutionary
constraints) des Verhältnisses Körpermasse und Extremitätenlänge zeigen können.
– Es werden Daten der Variablen Körpermasse und Extremitätenlänge von mehreren Individuen
verschiedener Tierarten erhoben und in einem Graphen aufgetragen. Dabei sollte man von jeder
Tierart zunächst einige Individuen vermessen und die Daten dann für jede Art als ein artspezifisches Datenpaar im Graphen auftragen. Liefert das Ergebnis annäherungsweise eine Gerade,
so ist gezeigt, dass beide Variablen voneinander abhängen.
72 Evolution
DO01045455_Loesung_04.indd 72
14.04.2015 14:19:33
Material: Selektion (Seite 276/277)
$ A1 Gräser haben im Gegensatz zu Laubblättern einen hohen Kieselsäuregehalt und nutzen die
Zähne schneller ab. Erläutern Sie den Zusammenhang zwischen Lebensraum, Zahnstruktur
und Knochenbau hinsichtlich der Evolution des Pferdes.
– Die Pferde passten sich nach und nach an die neuen Bedingungen einer Steppenlandschaft an.
Mit langen Beinen und im Zehenspitzengang konnten sie sich in der freien Landschaft schneller
fortbewegen. Die Umstellung von Laubnahrung auf das harte Grasfutter bedeutete für Individuen mit hochkronigen widerstandsfähigeren Zähnen einen Vorteil.
0 A2 Berechnen Sie das Oberflächen-/Volumen-Verhältnis für Würfel von 1, 2, 3, 4 und 5 cm Kantenlänge und stellen Sie dies in einem Schaubild dar.
– Das Oberflächen-/ Volumen-Verhältnis der fünf Würfel von 6; 3; 21,5 und 1,2 soll über der entsprechenden Kantenlänge aufgetragen werden.
$ A3 Nachts ändert sich der Stoffwechsel von Kolibris. Recherchieren Sie die Anpassungsstrategien des Kolibris an diesen Zustand.
– individuelle Lösung
$ A4 Beschreiben Sie die Abbildung 2 mit eigenen Worten.
– Je größer die Körpermasse eines Tieres ist, desto weniger Sauerstoff (gemessen in ml) verbraucht die Tierart pro Stunde und g Körpermasse.
0 A5 Nennen Sie die Angepasstheit von gleichwarmen Tieren an die kalte Jahreszeit.
– Aufplustern und Winterschlaf
. A6 Erläutern Sie, warum die dicksten Schlangenarten in den Tropen leben, während in nördlichen Ländern nur dünne Arten vorkommen. Begründen Sie, warum die größten Schlangenarten nicht in der Wüste vorkommen.
– Als wechselwarme Tiere müssen die Schlangen Wärme über ihre Oberfläche aus der Umgebung
aufnehmen. Bei großen Schlangen mit einer relativ geringeren Körperoberfläche würde das
Aufwärmen unter gemäßigten Klimabedingungen zu lange dauern. Besonders weit nördlich
vorkommende Schlangen (z. B. in Kanada) sind entsprechend klein und dünn.
Das Oberflächen-Volumen-Verhältnis ist bei den starken Temperaturunterschieden Nacht — Tag
in der Wüste ungünstig. Eine sehr große Schlange würde sehr lange benötigen, um sich am Tag
nach der sehr kalten Nacht aufzuwärmen.
$ A7 Beschreiben Sie die drei Trendkurven in Abbildung 7 unter Berücksichtigung von Abbildung 8.
– Die drei Trendkurven zeigen in beiden Graphen ähnliche Entwicklungen: Sowohl das Alter zur
Geschlechtsreife als auch das Wachstum der Tiere im Jahr nimmt zwischen 1980 und 1990 in allen drei Populationen ab. Hierbei variieren die Populationen etwas, wobei die blaue Population
besonders stark, die rote am wenigsten betroffen ist. Dies lässt sich eventuell durch zeitweilige
Fangquotenreduktion erklären. Während das Alter der Geschlechtsreife auch nach den 1990er-Jahren weiterhin abnimmt
und erst um 2000 wieder leicht zunimmt, nimmt das Wachstum der Fische im Jahr nach den
Tiefpunkten Mitte der 1990er-Jahre wieder stetig zu — vermutlich als Folge des Fangverbots in
den frühen 1990er-Jahren. Hierbei erholt sich die blaue Population am schnellsten — vermutlich
durch besonders strikte Fangverbote.
$ A8 Erläutern Sie die von Olsen aufgestellte Hypothese zur Evolution des atlantischen Kabeljaus.
– Große Tiere hatten einen Nachteil gegenüber kleinen Tieren, da sie, einmal im Netz gefangen,
der Population entnommen wurden. Kleinere Fische, die durch die Netze schlüpfen konnten,
hatten plötzlich einen sehr großen Vorteil. Ihre reproduktive Fitness war wesentlich größer als
die der — normalerweise vermutlich fruchtbareren — größeren Individuen. Dadurch nahmen sie
in der Population schnell zu.
$ A9 Erklären Sie, warum durch die künstliche Selektion beim Kabeljau eine frühe Geschlechtsreife
begünstigt wird.
– Durch die starke Befischung des Kabeljaus ist die Wahrscheinlichkeit, dass die Tiere ein höheres
Alter erreichen, drastisch gesunken. Dadurch haben jene Tiere einen entscheidenden Vorteil, die
genetisch bedingt früher geschlechtsreif werden. Varianten, die später geschlechtsreif werden,
sterben aus oder werden zurückgedrängt.
73 Evolution
DO01045455_Loesung_04.indd 73
14.04.2015 14:19:33
Selektion verändert Populationen (Seite 279)
$ A1 Auf der Suche nach dem Vorteil der Lactosetoleranz fanden Stoffwechselbiologen eine Verbindung zum Calciumhaushalt: Außer den Nährstoffen liefert Milch auch Vitamin D, das die
Vorstufe des Hormons Calcitrol ist. Es steuert die Aufnahme von Calcium im Darm und den
Auf- und Abbau der Knochensubstanz. Muss unser Organismus Vitamin D selbst herstellen,
benötigt er dazu die UV-Strahlen der Sonne in ausreichendem Maß.
Erläutern Sie die Vorteile derjenigen Menschen in nördlichen Gebieten, die lebenslang Lactose
verwerten können.
– Die Menschen, die Lactose auch noch im Erwachsenenalter verwerten können und damit auch
Vitamin D direkt aufnehmen, gehen der Gefahr aus dem Weg, selbst nicht ausreichende Mengen des Vitamins synthetisieren zu können. Bei relativ geringer Sonneneinstrahlung im Norden
im Vergleich zum Süden und bei entsprechend ungünstiger Hautfarbe kann diese eventuell unzureichende Vitamin-D-Produktion der Haut somit ausgeglichen werden. Kommt es hingegen zu
Vitamin-D-Mangel und damit zu Calcitriolmangel, das die Aufnahme von Calcium aus dem Blut
in das Knochenmark fördert, so entsteht Rachitis (Skelettverformungen aufgrund von Instabilität, durch Calciummangel verursacht). Heute weiß man, dass vor allem die frühen Neandertaler
in Europa an Rachitis litten.
0 A2 Beschreiben Sie die Situation der Menschen in den untersuchten Regionen in Afrika und
erläutern Sie, welche Selektionsfaktoren die Lactosetoleranz begünstigt haben könnten.
– In den untersuchten Gebieten herrscht vorwiegend Trockenheit und keine permanente Verfügbarkeit von Wasser. So kann die Kuh als wandernde Flüssigkeitsquelle betrachtet werden und
bietet einen großen Vorteil, wenn Milch als Flüssigkeitsquelle genutzt werden kann.
$ A3 Fassen Sie zusammen, was die konvergente Evolution der Lactosetoleranz begünstigt hat.
– Der Selektionsdruck in den betroffenen Populationen war hoch: Die Individuen, die Milch ver‑
tragen konnten, hatten einen erheblichen Fitnessvorteil gegenüber Konkurrenten in der Population. Dies gilt für alle betroffenen Populationen. Jede Merkmalsänderung, die eine bessere
Milchverträglichkeit bewirkte, war vorteilhaft. So kam es zur Selektion an unterschiedlichen
Genorten (konvergente Evolution), die den gleichen Phänotyp (Milchverträglichkeit) zur Folge
hatte.
. A4 Stellen Sie eine Vermutung an, für welche Merkmale man sich konvergente Evolution vorstellen könnte.
– Alles, was einem sehr starken Selektionsdruck bewirkt, z. B. Entgiftung, Antibiotikaresistenz, etc.
. A5 Die Menschen des Hazda-Volkes in Tansania zeigen eine sehr hohe Lactasebildung im
Erwachsenenalter. Dieses Volk hat aber so gut wie nichts mit Kühen zu tun. Stellen Sie eine
Hypothese auf, wie es dazu gekommen sein könnte.
– Es könnte sein, dass für die Vorfahren der Hazda die Milchverträglichkeit ein Vorteil war. Diese
Milchverträglichkeit könnte sich (auch ohne vorteilhaft zu sein) erhalten haben, indem dieses
Merkmal an ein anderes, heute vorteilhaftes Merkmal gekoppelt ist.
Das Hardy-Weinberg-Gesetz (Seite 281)
0 A1 Nennen Sie die Bedingungen, die für eine ideale Population erfüllt sein müssen.
– Die ideale Population zeichnet sich aus durch: Größe (hohe Anzahl an Individuen), Panmixie
(zufällige Verpaarungen), keine Selektion, keine Migration, keine Mutation.
$ A2 In der untersuchten Erdbeerfröschchen-Population wurde folgende Allelfrequenz ermittelt:
0,4 R (rotes Allel), 0,6 g (gelbes Allel). Berechnen Sie die unter Hardy-Weinberg-Bedingungen
zu erwartenden Genotypfrequenzen.
– p (rotes Allel) = 0,6; q (gelbes Allel) = 0,4
Genotypfrequenz RR + Rg + gg = 1; p2 + 2 pq + q2
(0,6)2 x 2 x (0,6 x 0,4) x (0,4)2 → RR = 0,36; Rg = 0,48 ; gg = 0,16
$ A3 Die Verteilung in der untersuchten Population sieht wie folgt aus: RR = 0,55; Rg = 0,1 und gg = 35. Erläutern Sie, wie die Anzahl heterozygoter Individuen vom Hardy-Weinberg-Gesetz
abweicht.
– Die beobachtete Heterozygotenzahl (0,1) ist wesentlich geringer als erwartet (0,48)!
. A4 Stellen Sie eine Hypothese auf, wie sich die Frequenzen der gelben Frösche verändern werden, wenn das Allel für „rot“ dominant gegenüber dem gelben Allel ist.
– Unter dem Hardy-Weinberg-Gleichgewicht ändern sich nur die Phänotypfrequenzen, die Genotypfrequenzen werden von Dominanz nicht unmittelbar beeinflusst, da phänotypisch sowohl
Frösche mit den Gentypen RR als auch mit den Genotypen Rg rot gefärbt sind und nur Frösche
mit den Genotypen gg gelb gefärbt sind.
74 Evolution
DO01045455_Loesung_04.indd 74
14.04.2015 14:19:33
Material: Selektion bei der Felsen-Taschenmaus (Seite 283)
0 A1 Erklären Sie, warum in der Studie gerade der Melanocortinrezeptor 1 (MC1R) näher untersucht wurde.
– Der Melanocortinrezeptor 1 (MC1R) ist eines der Schlüsselproteine für die Regulation von Haut
und Haarfarbe bei Säugetieren. Es ist bekannt, dass genetische Variationen im MC1R-Gen mit
unterschiedlichen Haut- und Haarfarben assoziiert sind. Somit ist es ein gutes Kandidatengen,
um die beiden Phänotypen auf genetische Unterschiede zu untersuchen.
$ A2 Beschreiben Sie anhand der Abb. 3, wie viele Änderungen in der Gensequenz zum dunklen
Phänotyp führen. Erläutern Sie in diesem Zusammenhang die Bedeutung des Polymorphismus (A/C) am Position 14.
– In diesem Beispiel führen Mutationen an 4 Basenpositionen (1, 8, 9, 14) zum dunklen Phänotyp.
Zwei Chromosomen (3a und 5a) tragen einen weiteren Polymorphismus an Position 6, der nicht
zum dunklen Phänotyp beiträgt (denn in den anderen dunklen Tieren ist er nicht vorhanden).
$ A3 Erklären Sie den evolutionären Prozess der Entstehung des dunklen Phänotyps bei der
Felsen-Taschenmaus.
– In einer Mäusepopulation mit hellem Fell hatten die dunkler gefärbten auf dunklem Untergrund einen Selektionsvorteil, da sie weniger leicht sichtbar für Raubvögel waren. Sie lebten im
Verhältnis zu den hellen Individuen länger und bekamen so mehr Nachkommen, die wiederum
länger lebten und mehr Nachkommen bekamen. So stieg der Anteil der dunkel gefärbten Mäuse
in der Population über die Generationen an.
$ A4 Berechnen Sie die nach dem Hardy-Weinberg-Gesetz zu erwartende Anzahl an Heterozygoten. Beginnen Sie dazu mit der Berechnung der Genotypfrequenzen (Abb. 4).
– Die Genotypenfrequenzen berechnen sich über den Anteil der Individuen mit bestimmtem
Genotyp über die Gesamtzahl der untersuchten Mäuse. So ergeben sich folgende Genotypfrequenzen: DD = 0,41; Dh = 0,21; hh = 0,38.
Die Allelfrequenzen lassen sich aus der Genotypenverteilung ableiten. Für D ergibt sich 0,52, für
h 0,48. Die erwartete Heterozygotenzahl lässt sich aus dem Hardy-Weinberg-Gesetz errechnen
und ergibt 0,5. Damit ist die beobachtete Heterozygotenzahl wesentlich geringer als die zu
erwartende.
$ A5 Die Abweichung vom Hardy-Weinberg-Gleichgewicht ist ein wichtiges Kennzeichen für
Selektion. Diskutieren Sie das Ergebnis von Aufgabe 4 im Hinblick darauf, welche Form von
Selektion auf die Felsen-Taschenmaus wirkt.
– Es gibt weniger Heterozygote als erwartet, d. h. die „Extremtypen“ dunkel- und hellfarbig sind
stärker vertreten als erwartet. Dies deutet auf eine disruptive Selektion hin.
. A6 Stellen Sie eine Vermutung auf, warum sich anhand des Stammbaums (Abb. 5) noch keine
Aufspaltung der Populationen erkennen lässt.
– Der mt-Stammbaum der Taschenmäuse deutet nicht auf eine Aufspaltung der Population hin,
sonst würden die Individuen jeweils nach Fellfarbe clustern.
Gendrift (Seite 285)
0 A1 Beschreiben Sie Ereignisse, die zu Gendrift führen.
– Alle Ereignisse, die zufällig in Populationen eingreifen, können zu Drift führen, z. B. das Umstürzen eines Baumes, ein Straßenbau, jeder Fußtritt, etc.
$ A2 Erläutern Sie, warum man bei „Gendrift“ auch von „neutraler Selektion“ spricht. Stellen Sie
den Unterschied zur natürlichen Selektion dar.
– Bei Driftereignissen selektiert der Zufall. Natürliche Selektion beruht dagegen auf Vor- oder
Nachteilen, die an bestimmte Merkmalsausprägungen und Umweltbedingungen geknüpft sind.
$ A3 Aus ökologischer Sicht sind nicht nur von Wasser umgebene Landteile Inseln. Begründen Sie
die Aussage.
– Entscheidend ist die isolierende Wirkung der Umgebung. Es kann sich genauso gut um eine
Lichtung im Wald oder eine Oase in der Wüste handeln.
. A4 Begründen Sie, inwiefern die genetische Verarmung einer Population nach einem „Flaschenhalsereignis“ häufig durch Inzucht und dem Zufall bei der Rekombination verstärkt wird.
– Dadurch dass es nur noch wenige Individuen gibt, ist die Wahrscheinlichkeit, dass sich verwandte Individuen verpaaren, größer als unter den Ausgangsbedingungen. Dadurch kann es zu
Homozygotie kommen, d. h. dass Individuen an vielen Genorten zwei gleiche Allele haben.
75 Evolution
DO01045455_Loesung_04.indd 75
14.04.2015 14:19:33
Material: Populationsgenetik (Seite 286/287)
$ A1 Beschreiben Sie, was nach der 1., der 10. und der 19. Generation zu sehen ist und wie die
Grafik nach weiteren 10 Generationen wohl aussieht. Erläutern Sie, inwieweit sich das Experiment geändert hätte, hätte Buri mit Populationen von 100 Tieren gestartet.
– Nach der ersten Generation beobachtet man, dass die meisten Populationen ungefähr gleich
viele Allele A und B haben, einige Populationen haben jedoch schon eine auf bis zu 25 %
reduzierte Allelfrequenz eines der beiden Allele. Nach der 10. Generation sind bereits einige
Populationen für ein Allel fixiert und nur sehr wenige Populationen haben noch ungefähr
gleiche Allelfrequenzen für die Allele A und B. Nach 19 Generationen sind bereits mehr als die
Hälfte der Popualtionen genetisch fixiert und noch weniger Populationen haben noch ähnliche
Allelfrequenzen für die Allele A und B.
Nach mehr Generationen werden mehr Populationen genetisch fixiert sein, d. h. entweder keine
Kopien des Allels „A“ oder „B“ aufweisen. Hätte Buri mit 100 Tieren pro Population gestartet, hätte sich Drift nicht so schnell ausgewirkt,
die Fixierung einzelnen Popualtionen hätte länger gedauert.
$ A2 Nennen Sie die Faktoren, von denen das Schicksal eines Allels abhängt, wenn als einzige
evolutionäre Kraft Gendrift wirkt.
– Beeinflussende Faktoren sind die Populationsgröße und die Anzahl der Kopien des betreffenden
Allels (Allelfrequenz).
$ A3 Abbildung 1a und 1b stellt schematisch genetische Drift und Migration dar. Vergleichen Sie
die Auswirkungen beider Ereignisse auf die Variabilität von Populationen.
– Genetische Drift verringert Variabilität, Migration erhöht sie in der Regel. Zudem wirkt Drift
zufällig, Migration nicht: Es migrieren meist bestimmte Individuen. Migration hat in der Regel
eine stärkere Wirkung als Drift.
$ A4 Abbildung 1c und 1d stellt die beiden Extreme „Gründereffekt“ (links) und „Flaschenhalseffekt“ (rechts) dar. Vergleichen Sie beide Ereignisse hinsichtlich der ursprünglichen und neuen
Genpools.
– Gründereffekt: Der ursprüngliche Genpool erfährt so gut wie keine Änderung. Der neue Genpool
hat eine geringere Variabilität als der ursprüngliche Genpool, allerdings können nach einigen
Generationen neue Allele durch Mutationen hinzukommen.
Flaschenhalseffekt: Der Genpool der Population weist nach dem Driftereignis eine stark reduzierte Variabilität aus.
$ A5 Berechnen Sie anhand der Tabelle 3
a) die Allelfrequenzen und b) die nach dem Hardy-Weinberg-Gesetz erwarteten Genfrequenzen in Generation n + 1.
Erläutern Sie, welche Rückschlüsse Sie auf die evolutionären Prozesse an diesem Genotyp
ziehen.
– a) siehe Tabelle
Ib
0,835
0,156
0,009
0,913
0,087
Ie
0,834
0,159
0,008
0,9135
0,0875
Cb
0,332
0,486
0,182
0,575
0,425
Ce
0,331
0,489
0,181
0,575
0,425
Db
0,297
0,507
0,196
0,55
0,45
De
0,303
0,495
0,203
0,5505
0,4495
Nb
0,301
0,495
2,204
0,548
0,452
Ne
0,3
0,495
0,204
0,5485
0,4515
b) Die beobachteten Allelfrequenzen entsprechen den erwarteten Allelfrequenzen. Ebenfalls
entsprechen die beobachteten den erwarteten Genotypfrequenzen – das System ist im HardyWeinberg-Gleichgewicht. Dieser Genort steht nicht unter Selektion.
$ A6 Bestimmen Sie die Allelhäufigkeiten der Ausgangs-, der Gründer- und der 1. Folgegeneration.
– Durchführung und Protokollierung der Simulation
. A7 Wiederholen Sie den 2. Spielabschnitt 7-mal und bestimmen Sie die Allelhäufigkeiten aller
Folgegenerationen. Stellen Sie Ihr Ergebnis grafisch dar.
– Durchführung und Protokollierung der Simulation
76 Evolution
DO01045455_Loesung_04.indd 76
14.04.2015 14:19:33
. A8 Vergleichen Sie Ihr Ergebnis mit den Ergebnissen der anderen Gruppen. Deuten Sie die Kurvenverläufe.
– Die Kurvenverläufe sollten von Gruppe zu Gruppe unterschiedlich sein und so den Einfluss des
Zufalls verdeutlichen.
$ A9 Vergleichen Sie die drei Grafiken. Deuten bzw. erklären Sie die Unterschiede und Gemeinsamkeiten.
– In den unterschiedlich großen Mehlkäferpopulationen wird die Häufigkeit des Allels B in den
ersten 20 Generationen verfolgt. In den Ausgangspopulationen haben das Allel B und damit
auch das Allel A jeweils die Häufigkeit 0,5. Je kleiner die Ausgangspopulation ist, desto mehr
schwankt die Häufigkeit des Allels B. Tendenziell nimmt sie in allen drei Populationen zu. Die
Schwankungen können aber im Versuch mit der kleinsten Populationsgröße so groß sein, dass
das Allel B ausstirbt bzw. nach wenigen Generationen zu 100 % vorliegt. Da die Schwankungen
um so größer sind, je kleiner die Population ist, sind sie auf Zufall zurückzuführen. Es liegt also
Gendrift (Gründereffekt) vor. Die tendenzielle Zunahme des Allels B in allen drei Populationen
ist auf Selektion zurückzuführen. Gendrift und Selektion überlagern sich in diesem Beispiel.
$ A10Berechnen Sie mit der Hardy-Weinberg-Regel, wie viele homozygot und heterozygot dunkle
Tiere in einer Population mit 10 000 Individuen vorhanden sind.
– Melanismusallel: A; Normalallel: a; 1 % der Tiere sind dunkel, 99 % hell gefärbt. Allelfrequenz von a: q2 = 0,99; q = √0.99 ≈ 0,995 Allelfrequenz von A: p = 1 – q = 1 – 0,995 = 0,005 Genotypenfrequenz von Aa: 2 pq = 2 x 0,005 x 0,995 ≈ 0,00995 Genotypenfrequenz von AA: p2 = 0,005 x 0,005 = 0,000025 Absolute Anzahl des Genotyps Aa: 0,00995 x 10000 = 99,5 Es sind 100 heterozygote Tiere in der Population zu erwarten. Absolute Anzahl des Genotyps AA: 0,000025 x 10000 = 0,25 Es ist nicht zu erwarten, dass homozygote Tiere in der Population sind.
. A11Abb. 7 zeigt den zeitlichen Verlauf der Genotyphäufigkeitgen für den Fall, dass infolge von
Luftverunreinigungen die Baumrinden dunkel gefärbt werden. Erklären Sie den Verlauf der
Genotyphäufigkeiten, insbesondere Anstieg und Abnahme beim Genotyp Aa.
– Sind die Baumrinden dunkel, so haben die melanistischen Tiere gegenüber den hellen Tieren einen Selektionsvorteil. Der Anteil der hellen Tiere (Genotyp aa) nimmt ab, der Anteil der dunklen
Tiere mit dem Genotyp AA steigt. Die Genotypenfrequenz der dunkel gefärbten Tiere mit dem
Genotyp Aa beträgt nach der Hardy-Weinberg-Regel 2 x p x q. Dieses Produkt ist klein, wenn
anfänglich die Allelfrequenz p für das Melanismusallel A klein ist. Es finden also selten helle
Tiere einen dunklen Kreuzungspartner. Nimmt die Allelfrequenz p im Verlauf zu, so wächst auch
die Genotypenfrequenz 2 x p x q. Jetzt finden immer mehr helle Tiere einen dunklen Kreuzungspartner, unter deren Nachkommen heterozygote sind. Im weiteren Verlauf wird infolge der
Selektionswirkung die Allelfrequenz p für das Allel A immer größer, jedoch nimmt jetzt q ab. Das
Produkt 2 x p x q wird wieder kleiner. Es nimmt die Anzahl heller Organismen immer weiter ab
und dadurch entstehen bei den Kreuzungen weniger heterozygote. Das Maximum ist erreicht,
wenn p = q = 0,5 ist.
. A12Erklären Sie, ob es möglich ist, dass die Genotypen Aa und aa bei sehr großen Populationen
unter den Selektionsbedingungen von Aufgabe 6 verschwinden, wenn man Neumutationen
ausschließt.
– Unter den herrschenden Selektionsbedingungen sind nur helle Tiere mit dem Genotyp aa
benachteiligt. Daher ist zu erwarten, dass in großen Populationen stets ein gewisser Anteil
heterozygoter Organismen existiert. Bei der Kreuzung dieser Tiere untereinander werden immer
auch helle Nachkommen mit dem Genotyp aa entstehen. Die Genotypen Aa und aa werden
also nicht völlig verschwinden. Bei einer Umkehr der Selektionsbedingungen, also der erneuten
Hellfärbung der Baumstämme, ermöglicht das in der Population erhaltene rezessive Allel a, auf
das die Selektion nicht direkt wirkt, die erneute Anpassung der Population an die veränderten
Selektionsbedingungen.
77 Evolution
DO01045455_Loesung_04.indd 77
14.04.2015 14:19:33
4. 2 Artbildung
Isolation und Artbildung (Seite 289)
$ A1 Erläutern Sie, inwiefern die Betrachtung nah verwandter Arten bei der Diskussion um die
Vorgänge bei einer Artaufspaltung dienlich sind.
– Nah verwandte Arten lassen sich gut genetisch und morphologisch vergleichen. Es können
Theorien aufgestellt werden, wie es zum Beispiel zu den heutigen Verbreitungen kommt. Eine
mögliche künstliche Verpaarung hilft beim Aufdecken von Isolationsmechanismen.
0 A2 Nennen Sie prä- und postzygote Isolationsmeachnismen, die bei der Trennung der Spechte
wirken könnten.
– Als präzygote Isolationsmechanismen könnten zum Beispiel ein unterschiedliches Paarungsverhalten oder eine zeitlich unterschiedliche Paarungszeit wirken, als postzygote Isolationsmechanismen jegliche Unterlegenheit der Hybriden.
. A3 Grünspecht und Grauspecht haben unterschiedliche ökologische Nischen. Stellen Sie Hypothesen auf, wie man diese Auseinanderentwicklung erklären kann.
– Durch unterschiedliche Bedingungen, z. B. andere Artgemeinschaften, andere Habitate oder
andere Nahrungsquellen, werden andere Selektionsereignisse gewirkt haben. Heute ist diese
Auftrennung von Vorteil und kann sich noch verstärkt haben, da so die Konkurrenz zwischen
Individuen beider Arten reduziert ist.
. A4 Bestehen zwischen divergierenden Populationen bereits postzygote Isolationsmechanismen,
kommt es in der weiteren Entwicklung häufig zur Evolution von präzygoten Isolationsmechanismen. Erläutern Sie unter Verwendung des Fitnessbegriffs, wie dies zu erklären ist.
– Investition in Verpaarung trotz postzygoter Isolationsmechanismen (also Hybridensterblichkeit
oder Hybridenunterlegenheit) stellt unter normalen Bedingungen eine Verschwendung von
Ressourcen dar. Individuen, die sich nur mit Ihresgleichen verpaaren, investieren hingegen erfolgreicher ihre Ressourcen. Somit herrscht ein Selektionsdruck auf die Entwicklung vererbbarer
Mechanismen, die eine „Fehlverpaarung“ bereits vor der Verpaarung vermeiden.
Artbildungsmodelle (Seite 291)
$ A1 Ordnen Sie die verschiedenen Artbildungsmodelle nach dem Ausmaß möglichen Genflusses
zwischen den Teilpopulationen.
– sympatrisch → parapatrisch → allopatrisch
$ A2 Erläutern Sie, warum man bei der Erforschung der Artbildung von Modellen spricht.
– Der Artbildungsprozess nur in den wenigsten Fällen beobachtbar, ein Endpunkt ist schlecht zu
bestimmen.
$ A3 Begründen Sie folgendes Statement: Der Prozess der Artbildung verläuft je nach Organismengruppe unterschiedlich.
– Hier sind viele Antworten denkbar, z. B.:
• Bei Pflanzen kann es zur Artbildung durch Polyploidisierung kommen.
• Manche Tierarten sind beweglicher als andere (z. B. Vögel), Genfluss findet hier eher statt.
• Stark spezialisierte Tierarten können durch „Umspezialisierung“ einer Teilgruppe divergieren
(z. B. phytophage Insekten).
$ A4 Vergleichen Sie die allopatrische Artbildung durch die Teilung einer Gesamtpopulation, z. B.
durch eine neu entstandene geografische Barriere, mit der Besiedlung eines neuen Habitats.
– Im letzten Fall ist Auseinanderentwicklung häufig schneller, da sich Genfrequenzen stärker
unterscheiden (wenn Gründung durch sehr wenige Individuen erfolgt ist) und das neue Habitat
häufig neue Selektionsbedingungen hat.
Hybride und Hybridzonen (Seite 293)
0 A1 Nennen Sie Fitnessnachteile, die durch Hybridisierungen entstehen können.
– Sterilität, Lethalität, Konkurrenzunterlegenheit, usw.
$ A2 Erläutern Sie, warum nach Hybridisierungen unter Vogelarten meist die Weibchen steril sind.
– Folgt Haldanes Regel: Weibchen sind bei Vögeln heterogametisch.
. A3 Diskutieren Sie, warum zum Teil die Breite einer Hybridzone als Maß für die zeitliche Trennung zwischen Populationen bzw. Arten genutzt werden kann.
– Je schmaler desto stärker der Selektionsdruck, sich nicht zu verpaaren.
78 Evolution
DO01045455_Loesung_04.indd 78
14.04.2015 14:19:34
Hybridzonen der Hausmaus in Deutschland (Seite 295)
$ A1 Deuten Sie die Ergebnisse, die in der Tabelle dargestellt sind, hinsichtlich der Fitness der
Männchen.
– Mittleres Körpergewicht unterscheidet sich zwischen den Gruppen der reinerbigen Tiere. Die
Individuen der Hybriden liegen vom Körpergewicht zwischen diesen Werten, zeigen also eine
intermediäre Ausprägung. Die Merkmale, die für Fortpflanzungserfolg stehen können (Anzahl
der Spermien und Hodengewicht), sind bei den Hybriden stark reduziert. Dies deutet darauf hin,
dass die Fitness der Männchen der Hybriden reduziert ist.
. A2 Stellen Sie dar, ob und inwiefern Hybridisierungsereignisse Vor- bzw. Nachteile für eine Art
haben können.
– Vorteile:
• Neue genetische Informationen (Allele) können gegebenenfalls Anpassungen (z. B. an neue
Umweltbedingungen) ermöglichen.
• Bei sehr wenigen Individuen einer Art kann eine Hybridisierung den Fortpflanzungserfolg von
Individuen sichern.
– Nachteile:
• Hybride sind oft schlechter angepasst, da die Merkmale intermediär ausgeprägt sind. Wenn
nur noch wenig Individuen einer Art existieren, stellen diese schlecht angepassten Individuen
ggf. eine „Verschwendung“ dar.
Adaptive Radiation (Seite 296)
. A1 Evolutionsbiologen sprechen auch von der „Radiation der Säugetiere“. Erläutern Sie, was
damit gemeint ist.
– Radiation, also Aufspaltung einer Art in zahlreiche Geschwisterarten, kann erfolgen, wenn plötzlich Habitate neu entstehen (z. B. Kraterseen nach Vulkanausbrüchen), neu besiedelt werden
(z. B. durch Kolonisierung von Inseln) oder dadurch, dass bestehende Habitate „frei“ werden.
Dies lässt sich im Fall der Säugetiere vermuten, für die mit dem Aussterben der Dinosaurier
Konkurrenten um Habitate und Ressourcen verschwanden und sie diese durch Anpassungen
besetzen konnten.
Material: Artbildung (Seite 297)
0 A1 Beschreiben Sie die Abbildung 2. Analysieren Sie, was die Daten hinsichtlich einer eventuel­
len Populationsaufspaltung zeigen.
– Die Abbildung zeigt, dass es zwei Gruppen der Larven gibt, die sich hinsichtlich Entwicklungsdauer und Größe bei der Metamorphose unterscheiden. Vor allem die kleineren und schneller
sich entwickelnden Tiere sind fast alle im Habitat „Bach“ gefangen worden. Allerdings gibt es
auch einige Tiere, die in den beschriebenen Merkmalen eher dem anderen Habitat zuzuordnen
wären. Eine Erhebung von Daten weiterer Tiere wäre hilfreich, um zu klären, ob sich das Bild
hält.
$ A2 Diskutieren Sie, inwiefern dieses Beispiel die verschiedenen Artbildungsmodelle unterstützt.
– Das Beispiel unterstützt das Modell der parapatrischen Artbildung: Unterschiede in den Tieren
werden durch Besetzung unterschiedlicher ökologischer Nischen und eine unterschiedliche
Anpassung daran begünstigt.
. A3 Entwickeln Sie weitere Versuche, um eine eventuelle Populationsdivergenz zu überprüfen.
– Folgende Versuche könnten zur weiteren Klärung beitragen:
• Beobachtung der beiden Larventypen nach Metamorphose, um festzustellen ob Habitatwahl
vererbt ist.
• Common Garden Experimente: Sind Larven des Habitats A in Habitat B genauso fit wie die
anderen Larven, oder kann man schon weitere Anpassungen erkennen?
• Partnerwahlversuche um zu beobachten, ob eine gewisse reproduktive Isolation bereits zu
beobachten ist.
0 A4 Beschreiben Sie die Färbung der Kehlsäcke der drei Arten anhand von Abbildung 3.
– Anolis websteri hat einen komplett roten oder teilweise roten Kehlsack, während Anolis brevirostris keine Kehlsackfärbung aufweist. Einige Individuen von Anolis caudalis weisen eine ca.
50%ige Rotfärbung des Kehlsacks auf, andere eine geringe bis sehr geringe Kehlsackfärbung.
79 Evolution
DO01045455_Loesung_04.indd 79
14.04.2015 14:19:34
. A5 Erklären Sie die Vielfalt der Kehlsackfärbung von A. caudalis in Abbildung 3.
– Möglichkeit A: Kontrastverstärkung
Möglichkeit B: Durch ähnliche Anpassung an ähnliche Habitate. Diese Erklärung ist weniger
wahrscheinlich, da an den Grenzen zu den Artarealen der anderen Art jeweils der andere Phänotyp vorhanden ist.
Coevolution — Anpassung und Gegenanpassung (Seite 299)
0 A1 Beschreiben Sie den Prozess der Coevolution.
– Coevolution bezeichnet das Phänomen ständiger gegenseitiger Anpassung von Arten, die mit­
einander in enger Wechselbeziehung stehen.
. A2 Wir sehen in einer Beziehung von Organismen nur den Ist-Zustand. Dabei können die aktuel­
len Beziehungen so unauffällig sein, dass man nicht an Coevolution denkt. Erläutern Sie in
diesem Zusammenhang die Bedeutung des Wasserfloh-Experiments.
– Durch die Dauerstadien können vergangene Generationen beider Organismen „beobachtet“
werden. Durch die Übereinanderschichtung im Schlick des Sees lassen sich die verschiedenen
Stadien der beiden Organismen zeitlich relativ zu einander zuordnen, sodass man eine chronologische Reihe verschiedener Merkmale erhält und somit die Coevolution (das Wettrüsten)
nachvollziehen kann.
Material: Malaria und Sichelzellanämie (Seite 300/301)
0 A1 Beschreiben Sie die Entwicklung des Malaria-Erregers anhand von Abb. 2.
– Die Entwicklung der Parasiten in der Mücke ist von der Temperatur abhängig. Bei niedrigen
Temperaturen, wie z. B. in Mitteleuropa, verläuft sie wesentlich langsamer als in den Tropen
und Subtropen. Bei Temperaturen unter 15 °C unterbleibt sie. Dies ist die Hauptursache für die
geografische Beschränkung der Malaria.
$ A2 Beschreiben Sie den Krankheitsverlauf der Malaria und erläutern Sie die Bedeutung des
Häm.
– Der Krankheitsverlauf bei einer Malariainfektion beginnt mit der Freisetzung von Merozoiten
aus den Erytrocyten. Dabei verursacht der Zerfall der Erythrocyten auch die Freisetzung von
Häm, das die Fieberschübe auslöst. Eine Fieberpause stellt sich ein, wenn das Häm dieser
ersten Freisetzungsrunde abgebaut ist und die Merozoiten sich in neu infizierten Erythrocyten
vermehren. Der nächste Fieberschub erfolgt wieder bei Freisetzung der Merozoiten und dem
Zerfall der Erythrocyten.
. A3 Erklären Sie die genetischen Ursachen der Sichelzellanämie und stellen Sie den Erbgang
mithilfe eines Stammbaums bildlich dar.
– Verursacht wird die Sichelzellanämie durch eine Mutation auf Chromosom 11 im Gen hbb (Hämoglobin b). Der Austausch einer einzigen Base in der genetischen Sequenz (SNP) bewirkt die Änderung einer Aminosäure in den b-Ketten des Hämoglobin A.
$ A4 Sichelzellanämie wirkt sich negativ aus. Erklären Sie, warum sich die Erbkrankheit dennoch
in einigen Populationen hält.
– Die Erbkrankheit erhält sich in Populationen, die in Regionen mit Malaria-Vorkommen leben.
Dort bietet der heterozygote Zustand einen Selektionsvorteil, sodass Heterozygote verhältnismäßig mehr Nachkommen bekommen als homozygote Nicht-Träger. So wird das Allel weiter
getragen.
0 A5 Noch im 19. Jahrhundert war die Sichelzellanämie in Süditalien ziemlich weit verbreitet. Begründen Sie ihr Verschwinden, nachdem alle größeren Sümpfe trocken gelegt worden sind.
– Durch die Trockenlegung der Sümpfe verloren die Stechmücken als Vektoren der Malaria das
Habitat. Die Malaria ging zurück und mit ihr der Vorteil für Heterozygote Träger der Sichelzellanämie. Durch negative Selektion gegen Homozygote verschwand das Allel aus der Popula­
tion.
. A6 Diskutieren Sie mögliche Ursachen für die unterschiedlichen Frequenzen des A-Allels in den
verschiedenen Unterpopulationen (Abb. 3 und Abb. 5).
– Das A Allel bewirkt in heterozygotem Zustand nur dort Fitnessvorteile, wo Malaria vorkommt.
Da es im homozygoten Zustand nur Nachteile bringt, ist der Verlust des Allels durch negative
Selektion in den Regionen vorhersehbar, in denen keine Malaria vorkommt. Umkehrt ist der
Erhalt des Allels in Regionen vorhersehbar, in denen Malaria vorkommt und Heterozygote einen
Fitnessvorteil gegenüber Homozygoten T-Trägern haben.
80 Evolution
DO01045455_Loesung_04.indd 80
14.04.2015 14:19:34
. A7 Beschreiben Sie Abb. 6 unter Verwendung des Begriffs „Coevolution“.
– Abbildung 6 zeigt die zeitliche Abfolge der Entwicklung neuer Malariamedikamente und die
darauffolgende Resistenzbildung. Man könnte diesen Prozess als „Coevolution“ bezeichnen,
in dem sich beide Arten jeweils aneinander anpassen. Werden neue Medikamente entwickelt,
„antwortet“ der Parasit durch die positive Selektion von Trägern mit neu entstandenen Resistenzen. Sind neue Resistenzen entstanden, entwickelt der Mensch neue Medikamente, etc.
. A8 Diskutieren Sie folgende Aussage: „Eine alternative Option gegenüber der Entwicklung
neuer Medikamente im Kampf gegen Resistenzen ist es, die Evolutionsrate von Pathogenen
zu senken.“
– Mutationen, die zu Resistenzen führen, erfolgen zufällig und breiten sich dann durch Selektionsvorteile für die Träger sehr schnell aus. Würde es gelingen, die Mutationsraten herabzusenken,
würden weniger zufällige Mutationen entstehen, von denen dann einige die Resistenz bewirkten. Insgesamt würde das den Prozess der Resistenzbildung verlangsamen.
81 Evolution
DO01045455_Loesung_04.indd 81
14.04.2015 14:19:34
4. 3 Reproduktion und Fitness
Evolution und Verhalten (Seite 302)
0 A1 Vergleichen Sie die Lebenslaufstrategien der beiden Schwanzlurche. Berücksichtigen Sie
dabei dei Trade-offs im Zusammenhang zum natürlichen Lebensraum der beiden Arten.
– Der Teichmolch produziert jedes Jahr zahlreiche Jungtiere, die als Larven in Teichen ideale Entwicklungsbedingungen finden, untereinander aber um die vorhandenen Ressourcen konkurrieren. Der Alpensalamander hingegen sichert die eher geringe Nachkommenschaft durch eine
lange Tragzeit, in der sich wenige Larven im Weibchen zu fertigen Jungtieren entwickeln.
$ A2 Entwickeln Sie eine Hypothese, warum der Fortpflanzungserfolg so schwierig zu messen ist.
– Im Freiland ist es sehr schwer bis unmöglich, die genaue Anzahl der Nachkommen zu bestimmen. So müsste man ein Individuum über Jahre verfolgen und jeden Nachkommen registrieren
können. Bei geteilten Vaterschaften ist dies noch schwieriger. Hat ein Weibchen mit mehreren
Männchen Nachkommen gezeugt, müssten zum Teil Vaterschaften über DNA-Tests bestimmt
werden. Auch wenn die Weibchen alleine die Jungen aufziehen, ist es schwierig, für die Männchen den Reproduktionserfolg festzustellen.
Habitatwahl (Seite 303)
0 A1 Nennen Sie Faktoren, die die Habitatqualität beeinflussen.
– Viele biotische und abiotische Faktoren wie Prädationsrisiko, Futterangebot, pH-Wert, Temperatur, Struktur (Schutz und Brutstätten), dichteabhängige Konkurrenz, etc.
. A2 Erläutern Sie folgende Aussage: „Unterschiedliche Arten mit identischen Habitatansprüchen
können nicht koexistieren.“
– Diese Arten wären Konkurrenten um jeder Ressource. Da ein Selektionsvorteil die Vermeidung
von Konkurrenz darstellt, wäre der Selektionsdruck auf die Entwicklung alternativer Habitatnutzung in beiden Arten so hoch, dass eine unterschiedliche Spezialisierung sehr wahrscheinlich ist.
. A3 Beschreiben Sie mögliche Auswirkungen von Habitat-Heterogenität auf die Anpassung von
Populationen an ihre Lebensbedingungen.
– Die Habitat-Heterogenität kann sowohl zu verschiedenen Verhaltensstrategien (genetisch bedingt) als auch Verhaltenstaktiken führen. Allgemein fördert die Heterogenität eine genetische
und phänotypische Vielfalt in der Population.
Paarungssysteme (Seite 305)
$ A1 Erläutern Sie den Zusammenhang zwischen Paarungssystemen und der Investition von
Ressourcen in die Nachkommen.
– Entscheidend ist die Fitnessmaximierung: Häufig ist es so, dass das Geschlecht, das bereits viel
in die Nachkommen investiert hat (sei es durch einen hohen Energieaufwand bei der Produktion
von Eizellen oder der Verteidigung eines Reviers), auch in die Brutpflege Ressourcen investiert.
So sichert es, dass die Investitionen nicht „umsonst“ waren, d. h. dass die Nachkommen selbst
zur Fortpflanzung gelangen.
$ A2 Erklären Sie die Vorteile biparentaler Brutpflege am Beispiel des Kaiserpinguins.
– Die Aufzucht junger Pinguine ist in den antarktischen Habitaten eine große Herausforderung,
die nur durch den Einsatz beider Eltern zu schaffen ist. Würde die Brutpflege nur von einem
Elternteil übernommen, so wäre der Fortpflanzungserfolg zu gering, da viele der Jungtiere nicht
das erste Jahr erreichen würden.
. A3 Stellen Sie eine begründete Hypothese auf, warum die Verteilung der Brutpflegeform (Abb. 1)
je nach Wirbeltiergruppe variiert.
– Dies hängt von der Investition in Keimzellenproduktion und Verpaarung ab. Je höher die Investition in Keimzellen und/oder Verpaarung, desto höher die Investition in Brutpflege.
Material: Sexualstrategien (Seite 306/307)
0 A1 Erläutern Sie anhand der Abbildung 2, inwiefern die Studie das Bateman-Prinzip in freier
Wildbahn nachweisen konnte.
– Die Studie zeigt, dass die Unterschiede der Anzahl von Paarungspartnern und Nachkommen
unter Männchen wesentlich höher sind als unter Weibchen. Zudem steigert sich bei den Männchen die Anzahl der Nachkommen abhängig von der Anzahl der Verpaarungen. Bei Weibchen
können mehr Verpaarungen höchstens einen sehr geringen Zugewinn an Nachkommen bewirken.
82 Evolution
DO01045455_Loesung_04.indd 82
14.04.2015 14:19:34
. A2 Der individuelle Fortpflanzungserfolg der Schwertträger wurde mit genetischen Markern
bestimmt. Erläutern Sie, inwieweit die genetische Variabilität einer Population für solche
Versuche eine Rolle spielt.
– Für die Verwendung von genetischen Daten zur Vater- oder Mutterschaftsbestimmung bedarf es
variabler genetischer Marker. Das bedeutet, man benötigt eine gewisse Variabilität innerhalb
der Population, damit sich die Nachkommen einem bestimmten Vater zuordnen lassen können.
Ist keine solche genetische Vielfalt vorhanden, dann unterscheiden sich viele Individuen nicht an
den gewählten Markern (Genabschnitten), sodass eine eindeutige Zuordnung der Nachkommen
nicht erfolgen kann.
0 A3 Fassen Sie die Aussagen der Abb. 3 zusammen und interpretieren Sie die Versuchsergebnisse.
– Ältere Männchen singen länger als junge. Im Nest lange Strophen singender Männchen findet
man weniger Junge mit einem anderen Vater. Das Weibchen verpaart sich also weniger mit
anderen Männchen.
. A4 Stellen Sie dar, inwiefern es sich hier um einen Geschlechterkonflikt handelt und erläutern
Sie, welche männlichen Anpassungen entstanden sind oder entstehen können.
– Während der Seitensprung für das Weibchen einen Vorteil durch die erhöhte Qualität der
Nachkommen bringt, bedeutet er für das Männchen einen Nachteil, da bei der gemeinsamen
Jungenaufzucht das Männchen seine Ressourcen auch in Nachkommen eines anderen Männchens investiert. Als Anpassung investiert das Männchen in die intensive Bewachung des
Weibchens vor der Eiablage, um diese Seitensprünge zu verhindern. Da dennoch Seitensprünge
nicht auszuschließen sind, besteht ein Selektionsdruck auf weitere Anpassungen zur Reduktion
der Fehlinvestition in fremde Nachkommen. Eine denkbare Anpassung wäre die Unterscheidung
fremder und eigener Jungtiere, wodurch das Männchen selektiv in die Aufzucht investieren
könnte.
0 A5 Beschreiben Sie die Vor- und Nachteile bezüglich der Fortpflanzung bei Orang-Utans für
kleine und große Männchen.
– Große Männchen haben die Möglichkeit, eine hohe Nachkommenzahl durch Verpaarungen mit
vielen Weibchen zu erzielen, indem sie sich durch Dominanz und die Ausprägung sekundärer
sexueller Merkmale mit wesentlich mehr Weibchen verpaaren können, als kleinere Männchen.
Vor allem auf Sumatra können sie so zu höherem Verpaarungserfolg und darüber zu mehr
Nachkommen gelangen. Vor allem auf Borneo zeigt sich, dass diese Dominanz der großen
Männchen auch Kosten hat: Die „Monopolisierung“ der Weibchen kostet Ressourcen, da Konkurrenten vertrieben („klein gehalten“) werden müssen. Hier gelangen kleine Männchen einfacher
zu Verpaarungen, da sie unauffällig im Revier der großen Männchen leben, keine Ressourcen in
Konkurrenz investieren müssen und sich Verpaarungen „erschleichen“ können.
. A6 Begründen Sie, warum beide Fortpflanzungstechniken erfolgreich nebeneinander bestehen
können.
– Beide Fortpflanzungstaktiken können erfolgreich nebeneinander bestehen, da beide Männchentypen durch unterschiedliche Vorteile zur Fortpflanzung gelangen. Der Vorteil der dominanten
Männchen besteht darin, von den Weibchen als Paarungspartner bevorzugt zu werden. Allerdings müssen sie in diese Vormachtstellung ständig investieren, indem sie Konkurrenten aus
ihrem Revier vertreiben. Kleine Männchen müssen zwar Verpaarungen erzwingen, investieren
dafür aber keine Ressourcen in die Erhaltung der Vormachtstellung. Dies ist vor allem dort von
Vorteil, wo relativ wenig dominante Männchen zur Verfügung stehen und die Weibchen eher in
eine Kopulation mit einem kleinen Männchen einwilligen.
. A7 Begründen Sie, warum die Weibchen der Kopulation mit dominanten Männchen zustimmen.
Nehmen Sie dabei auf das Prinzip von Bateman Bezug.
– Weibchen haben nur sehr begrenzt die Möglichkeit, die Anzahl der Nachkommen durch vermehrte Verpaarungen zu steigern. Sie investieren daher anstatt in die Anzahl der Verpaarungen
in die Verpaarung mit dem „besten Männchen“, um die Qualität der Nachkommen und somit
den Fortpflanzungserfolg zu steigern. Ist Dominanz vererbbar, steigern sie durch die Wahl eines
dominanten Männchens die Möglichkeit, dass ihre männlichen Nachkommen ebenfalls dominante Männchen werden.
83 Evolution
DO01045455_Loesung_04.indd 83
14.04.2015 14:19:34
Material: Fortpflanzungstaktiken der Heckenbraunelle (Seite 308/309)
0 A1 Fassen Sie anhand der Informationen aus Text und Grafiken (Abb. 2 und 3) zusammen, unter
welchen Bedingungen die verschiedenen Paarungssysteme entstehen.
– Paarungssysteme entstehen durch die Überlappung von Revieren der Männchen und Weibchen.
Die Größe des Weibchenreviers hängt von dem Nahrungsangebot des Raumes ab. Die Größe der
Männchenreviere hängt nicht von der Nahrungsversorgung ab, sondern von den Möglichkeiten,
den Raum zu verteidigen. Aus den Überlappungen unterschiedlich großer Reviere ergeben sich
die verschiedenen Paarungssysteme. Je größer das Revier eines Weibchens ist, desto eher kommen zwei oder sogar drei Männchen darin vor (Abb. 3).
0 A2 Beschreiben Sie anhand der Informationen, wie die Häufigkeit der Paarungssysteme von
Jahr zu Jahr wechseln kann.
– zu Abb. 4: Während die relative Häufigkeit von Heckenbraunellen-Männchen in kalten Wintern
nicht signifikant zurückgeht, haben Weibchen in schneereichen Wintern größere Verluste. Dies
ist auf das Rangordnungsverhalten zurückzuführen. An den verbleibenden schneefreien Futterstellen bildet sich unter den anwesenden Tieren eine Rangordnung aus, in der die Männchen
die ranghöchsten Plätze einnehmen. Die rangniederen Weibchen scheinen vom Futterplatz
vertrieben zu werden. In einem beobachteten Fall, in dem zwei Männchen von einer Katze
gefressen wurden, hielten sich die verbleibenden Weibchen anschließend signifikant häufiger
an der Futterstelle auf. Wegen der schlechteren Nahrungsversorgung fliehen anscheinend die
Weibchen bei Greifvogelangriffen als letzte und kehren als erste zurück, was dazu führt, dass
sie häufiger als die Männchen gefressen werden.
zu Abb. 5: Als Folge der unterschiedlichen Wintersterblichkeit von Männchen und Weibchen
erreichen mehr Männchen das nächste Frühjahr, sodass sich als Folge gehäuft polyandrische
Paarungssysteme ausbilden, da die Weibchen größere Reviere ausbilden können.
$ A3 Arbeiten Sie aus den geschilderten Sachverhalten die verschiedenen Mechanismen heraus,
die
a) vor der Kopulation
b) nach der Kopulation, bzw.
c) nach der Eiablage
wirken und dadurch dem einzelnen Männchen Fortpflanzungsvorteile sichern.
– Taktiken der Verhinderung von Fremdkopulation: Männchen erkämpfen ein Revier. Können sie
alle anderen Männchen vertreiben, haben sie alleinigen Zugang zu einem oder mehreren Weibchen. Ist dies nicht möglich, versuchen Männchen nach Rangordnungen Paarungen konkurrierender Männchen zu verhindern. Nach der Kopulation eines Weibchens mit mehreren Männchen konkurrieren die Samenzellen
mehrerer Männchen um die Eizellen des Weibchens. Dabei befruchten am wahrscheinlichsten
Samenzellen desjenigen Männchens die Eizellen, das die meisten Spermien abgibt und sich
am häufigsten mit dem Weibchen paart. Heckenbraunellen verhalten sich — wie die Paarungshäufigkeiten in den verschiedenen Systemen belegen — so, als ob sie diesen Zusammenhang
kennen. Eine weitere Taktik, die eigene Fortpflanzung zu sichern, ist das „Kloakenpicken“.
Vogelweibchen besitzen Spermienbehälter, die bei häufigen Kopulationen mit einem Männchen
voll sein können. Wenn diese Behälter aufgefüllt sein sollten, kann ein Männchen nur dann
erfolgreich Spermien im Weibchen unterbringen, wenn dieses die Spermienbehälter vorher
geleert hat. Aus der „Sicht“ des Männchens können die schon vorhandenen Spermien von einem
fremden Männchen sein. Die von ihm abgegebenen Spermien sind dagegen sicher von ihm
selbst. Da das Verhalten die Vaterschaftssicherheit steigert, könnte es auch die Bereitschaft zur
Mithilfe bei der Bruthilfe steigern. (Durch das Picken an der Kloake gibt das Weibchen die von
einer vorherigen Paarung noch vorhandenen Spermien ab.) Aufgrund der Konkurrenz entwickelten sie die großen Hoden. Eine Fortpflanzungstaktik, die nach der Eiablage wirkt, ist Infantizid durch die ß-Männchen. Durch Beseitigung der Gelege bzw. der Jungtiere legt das Weibchen
bald neue Eier, die befruchtet werden können. Dabei hat das ß-Männchen erneut die Chance,
mit dem Weibchen zu kopulieren und muss nicht warten, bis eine Brut großgezogen wurde, d. h.
es hat Zeit gewonnen.
$ A4 Stellen Sie einen Sachzusammenhang zwischen den Aussagen beider Abbildungen (Abb. 8
und 9) her.
– Abbildung 8 zeigt, wie viele Jungtiere einer Brut vom β-Männchen gezeugt wurden, in Abhängigkeit von der Häufigkeit, mit der das β-Männchen sich mit den Weibchen paaren konnte. Es
zeigt sich klar, dass von der Paarungshäufigkeit auch die Nachkommenshäufigkeit abhängt. Die
Paarungshäufigkeit mit den β-Männchen hängt von der Fähigkeit des Weibchens ab, sich der
Bewachung durch das α-Männchen zu entziehen.
Abbildung 9 zeigt den Anteil der Mithilfe bei der Brutpflege durch das β-Männchen in Prozent
der Fütterungen durch die Männchen in Abhängigkeit von der Fähigkeit des Weibchens, sich der
Bewachung durch das α-Männchen zu entziehen. Je erfolgreicher die Bewachung zum Zeitpunkt
84 Evolution
DO01045455_Loesung_04.indd 84
14.04.2015 14:19:34
der Kopulation war, desto weniger hilft das β-Männchen mit. Anders ausgedrückt: Je häufiger
das β-Männchen mit dem Weibchen kopulieren konnte, desto bereiter ist es, bei der Brutpflege
mitzuhelfen. Die β-Männchen verhalten sich so, als verstünden sie, dass mit den häufigeren
Kopulationen auch die Vaterschaftssicherheit erhöht wird. Sie sind aber nicht „bereit“, in fremde
Nachkommen zu investieren.
$ A5 Werten Sie in diesem Zusammenhang die Daten von Abb. 10 mit aus.
– Nach soziobiologischer Theorie ist zu erwarten, dass Individuen das Sozialsystem anstreben
bzw. das Verhalten zeigen, das für sie am meisten Nachwuchs erbringt. Wie die Untersuchungsergebnisse aus Abbildung 10 zeigen, sind diese Zahlen für Weibchen und Männchen unterschiedlich, sodass Konflikte vorprogrammiert sind.
$ A6 Erläutern Sie, wodurch es zwischen verschiedenen Partnern zu Konflikten kommen muss,
indem Sie aufzeigen, wie Fitnessgewinn beim einen zu Fitnessverlust beim anderen führt.
– Für Weibchen ist ein polyandrisches System am bes­ten, in dem beide Männchen füttern. Hier
sind die Verluste unter den heranwachsenden Jungen am geringsten. Den nahezu gleichen
Fortpflanzungserfolg kann ein Männchen erreichen, wenn es in einem polygynen System mit
zwei Weibchen brütet. Während Männchen also ein polygynes System anstreben „sollten“, sind
die Weibchen an polyandrischen Systemen „interessiert“ und kopulieren möglichst mit beiden
Männchen, wodurch sie sich die Mithilfe des β-Männchens sichern.
Sexuelle Selektion und Partnerwahl (Seite 311)
$ A1 Von „kryptischer Weibchenwahl“ spricht man im Fall von Spermienkonkurrenz. Erläutern Sie,
was gemeint ist.
– Konkurrenz zwischen Spermien unterschiedlicher Individuen entsteht im weiblichen Reproduktionstrakt, wenn sich ein Weibchen mit mehreren Männchen im gleichen Fortpflanzungszyklus
verpaart hat. Häufig kommt es zur ungleichen Verteilung von Befruchtungen, d. h. die Spermien
eines Männchens sind häufig erfolgreicher als die des/der anderen Männchen. Verschiedene
Mechanismen ermöglichen dem Weibchen, die Befruchtung für bestimmt Spermien zu bevorzugen. Da diese Partnerwahl aber nicht äußerlich und nicht für das Männchen sichtbar ist, wird
der Begriff „kryptische Weibchenwahl“ verwendet.
. A2 Als Hypothese zur Ausbildung übertriebener Ornamente wird die „Handicap-Hypothese“ aufgeführt. Diese besagt, dass Männchen mit einem extremen Merkmal sich zur Schau stellen,
dass sie sich dieses „leisten können“. Erläutern Sie anhand des Pfaus, welche Argumente für
eine solche Hypothese angeführt werden könnten.
– Das Männchen des Pfaus trägt einen so langen Schwanz, der ihn beim Fliegen und Laufen hinderlich ist. Außerdem ist er sehr auffällig gefärbt, wodurch er für Fressfeinde gut erkennbar ist.
Dass der Pfau diesen Schwanz, an dem so viele Behinderungen hängen, dem Weibchen trotzdem möglichst auffällig präsentiert, kann bedeuten: Sieh her, ich habe trotz dieses auffälligen
und hinderlichen Schwanzgefieders Erfolg — ich habe andere so gute Eigenschaften, die dieses
„Handicap“ unwichtig machen.
. A3 Wählen Sie eine der dargestellten Hypothesen zur Entstehung von Partnerwahl und entwerfen Sie eine Studie, mit der man die überprüfen könnte.
– Die „Gute-Gene-Hypothese“ und die „Kompatible-Gene-Hypothese“ könnte man überprüfen,
indem man Verpaarungen durch Partnerwahl ermöglicht und andere Verpaarungen zufällig
selbst auswählt (letztere als Kontrollgruppe). Fitnessbestimmungen der Nachkommen sollten
zum Ergebnis haben, dass gewählte Partnerschaften fittere Nachkommen (mit einem höheren
Fortpflanzungserfolg in der F2-Generation) bekommen als zufällig gewählte Partnerschaften. Die Sexy-Sohn-Hypothese könnte man testen, indem man beobachtet, ob männliche Nachkommen besonders begehrter Männchen ebenfalls besonders begehrt sind, d. h., ob „sexy sein“
vererbt wird.
Material: Reproduktion und Fitness (Seite 312)
$ A1 Nennen Sie die Kosten, die bei der Fortpflanzung für Männchen bzw. Weibchen entstehen.
– Männchen investieren in die Spermatophoren, Weibchen in die Eier, die sie einzeln ablegen.
Beide investieren in das Balzverhalten.
$ A2 Diskutieren Sie, welchen potenziellen Gewinn die Männchen bei der Bevorzugung von gro­
ßen Weibchen haben könnten.
– Die Weibchen bilden in der Winterruhe die Eier aus. Besonders große oder dicke Weibchen
könnten mehr Eier enthalten, das für das Männchen bedeuten würde, ggf. mehr Nachkommen
zu erhalten.
85 Evolution
DO01045455_Loesung_04.indd 85
14.04.2015 14:19:34
$ A3 Entwerfen Sie einen Versuchsaufbau, um das Vorhandensein einer Präferenz der Männchen
für größere Weibchen zu überprüfen.
– Männchen werden mit großen und kleinen Weibchen zusammengesetzt und es wird beobachtet, zu welchem Weibchen das Männchen geht, bei welchem es mehr Balzverhalten zeigt oder
für welches es mehr Spermatophoren absetzt.
$ A4 Beschreiben Sie die Besonderheiten des Paarungsverhaltens des Bergmolchs (Abb. 2).
Recherchieren Sie dazu auch geeignete Dokumentationen im Internet, die diese Abläufe in
Echtzeit zeigen. Erörtern Sie, welche Merkmale des Weibchens und welche des Männchens
unter sexueller Selektion stehen könnten.
– Die Paarung der Bergmolche findet am Gewässergrund statt. Meistens beginnt das Männchen
mit der Kontaktaufnahme durch Beriechen und Verfolgung des Weibchens. Kurz danach beginnt
es mit dem Schwanz zu fächeln, und zwar jeweils für wenige Sekunden bis Minuten, unterbricht
dann kurz und beginnt wieder zu fächeln, häufig von unterschiedlichen Seiten. Dieses Verhalten
kann über lange Zeit bis hin zu einer Stunde gehen, wobei das Männchen sich zum Teil auch
immer wieder zurückzieht oder das Weibchen das Weite sucht, bei genug Interesse vom Männchen dann aber wieder eingeholt wird. Ist das Männchen zur Abgabe einer Spermatophore
bereit, kriecht es direkt vor dem Weibchen und zittert dabei mit dem Schwanz. Ist das Weibchen
zur Paarung bereit, kriecht es hinter das Männchen und berührt den Schwanz. Erfolgt dies
mehrfach, so gibt das Männchen eine Spermatophore am Gewässergrund ab, woraufhin das
Weibchen diese aufnimmt. Ist das Männchen noch nicht zur Abgabe der Spermatophore bereit,
kann sich die Fächel- und Beschnupperphase auch wiederholen, bis es entweder zur (mehrfachen) Spermatophorenübergabe oder zum Abbruch des Paarungsverhaltens kommt.
Merkmale unter Selektion: Beide Geschlechter weisen einen orangen Bauch auf, ein Merkmal,
das unter sexueller Selektion stehen könnte. Es erfolgt allerdings kein „Zeigen“ des Bauches
während des Balzverhaltens und es ist nicht geklärt, ob es tatsächlich ein Signal für den Partner darstellt. Weitere Merkmale, die unter sexueller Selektion stehen könnten sind der erhöhte
Rücken- und Schwanzkamm des Männchens während der Wasserphase und die Färbung der
Tiere.
0 A5 Interpretieren Sie Abbildung 4.
– Aus Abb. 4 wird ersichtlich, dass Individuen mit Karotenoid-angereicherter Nahrung einen röteren Schnabel haben als Tiere aus der Kontrollgruppe. Ebenfalls ist gezeigt, dass die Individuen
dieser Gruppe eine stärkere Aktivierung des Immunsystems zeigen.
$ A6 Erläutern Sie, was ein Individuum mit besonders hoher Rotfärbung signalisiert.
– Ein Individuum mit besonders roter Körperfärbung signalisiert, dass es zum einen in der Lage
ist, sich Zugang zu Karotenoiden enthaltende Nahrungsquellen zu verschaffen. Zum anderen
signalisiert es, dass es sich leisten kann, diese Farbstoffe anstatt in die Immunabwehr in die
Hautfärbung zu investieren, was anzeigt, dass es gesund ist.
Material: Investment (Seite 313)
0 A1 Beschreiben Sie die Fitnesskonsequenzen des „Milchklaus“ für die fremden Jungen bzw. die
noch säugenden Muttertiere.
– Für den Milchdieb ist der Milchklau ein Zugewinn an Fitness, wohingegen es für das fremde
Weibchen eine Fehlinvestition in fremde Nachkommen bedeutet.
$ A2 Erläutern Sie Abbildung 1 in Bezug zum Fortpflanzungserfolg der Individuen. Nennen Sie
Möglichkeiten eines Männchens bzw. Weibchens, seine reproduktive Fitness zu erhöhen.
– Während nur die ranghöchsten Männchen eine hohe Nachkommenzahl erlangen, sind die
Unterschiede bei den Weibchen deutlich geringer und selbst rangniedrigste Weibchen gelangen
noch zur Fortpflanzung. Die Maximierung ihres Fortpflanzungserfolgs liegt vor allem in der
Investition in die Nachkommen (und die Vermeidung von Fehlinvestitionen durch „Milchdiebe“).
Die Männchen maximieren ihren Fortpflanzungserfolg bei der Eroberung der vorderen Plätze in
der Rangordnung.
$ A3 Nehmen Sie an, in aufeinander folgenden Jahren steht besonders wenig Nahrung für die
Seeelefanten zur Verfügung. Stellen Sie eine Vermutung auf, in welche Nachkommen ein
Weibchen bevorzugt investieren sollte: in männliche oder in weibliche Jungtiere.
– Weibchen sollten eher in weibliche Nachkommen investieren, da diese bei Überleben mit
höherer Wahrscheinlichkeit selbst zur Fortpflanzung gelangen als männliche Nachkommen, die
für die Rangkämpfe besonders kräftig sein müssen.
0 A4 Beschreiben Sie die Fortpflanzungsstrategien der beiden Geschlechter.
– Die Männchen investieren nur in den Bau der Lauben und die Spermien, wobei die Weibchen in
Eizellen, Nestbau und Aufzucht der Jungen investieren.
86 Evolution
DO01045455_Loesung_04.indd 86
14.04.2015 14:19:34
$ A5 Erläutern Sie, welche der Hypothesen (s. Seite 311: Sexy-Sohn-Hypothese, Kompatible-GeneHypothese, Gute-Gene-Hypothese, etc.) bezüglich Vorteile durch Partnerwahl hier für das
Weibchen zutreffen könnte.
– Durch die Wahl des Männchens mit der attraktivsten Laube setzen die Weibchen entweder auf
gute Gene (Gute-Gene-Hypothese) oder auf männliche Nachkommen mit besonderen Fähigkeiten zum Bau attraktiver Lauben (Sex-Sohn-Hypothese).
$ A6 Vergleicht man mehrere Arten, kann beobachtet werden, dass je unscheinbarer ein Männchen gefärbt ist, desto prachtvoller die Laube ausfällt. Erläutern Sie mögliche Zusammenhänge.
– Jede Investition muss in einem guten Verhältnis zum Nutzen stehen. Ein farbenprächtiges
Gefieder ist durch die verwendeten Ressourcen und eine bessere Sichtbarkeit für Feinde bereits
eine Investition, die auf einen Nutzen durch erhöhten Paarungserfolg abzielt. Der zusätzliche
Gewinn an Nutzen durch aufwändige Lauben ist vermutlich nicht groß genug, um diese weitere
Investition zu rechtfertigen.
Altruismus und Selektion (Seite 315)
0 A1 Tiere zeigen immer das Verhalten, welches ihnen den höchsten Fortpflanzungserfolg bietet.
Belegen Sie diese Aussage und begründen Sie sie mit dem Begriff der Gesamtfitness.
– Die Gesamtfitness setzt sich aus eigener Fitness (der Anzahl und Qualität der Nachkommen)
und der Fitness von Verwandten (der indirekten Fitness) zusammen. Zur Maximierung der Gesamtfitness investieren Individuen bevorzugt in die eigene Fitness. Ist dies jedoch aus bestimmten Gründen nicht oder beschränkt möglich, investieren sie auch in die Fitness von Verwandten
und somit in ihre indirekte Fitness.
$ A2 Erfahrene Buschblauhöher ziehen ohne Hilfe im Jahr durchschnittlich 1,62 Junge groß, mit
Unterstützung eines Helfers sind es 1,94. Die Anzahl der von einem erstmalig allein brütenden Paar aufgezogenen Jungen liegt dagegen bei durchschnittlich 1,36.
Belegen Sie anhand des Zahlenmaterials, dass sich Bruthelfen als Alternative zum Nichthelfen ohne Revierbesitz evolutiv durchsetzen konnte.
– Die Zahlen zeigen, dass sich Bruthilfe positiv auf den Fortpflanzungserfolg der Eltern auswirkt.
Ganz schlecht schneiden die Jungtiere ab, die zum ersten Mal ohne Bruthelfer brüten. Dies
zeigt, dass eine Investition in die Nachkommen der Verwandten einen höheren Zugewinn an
Gesamtfitness liefern könnte (da hierbei weniger Ressourcen „verschwendet“ werden).
$ A3 Um den Erhalt altruistischer Verhaltensweisen in einer Population zu verstehen, reicht es
nicht aus zu begründen, dass dieses Verhalten der Arterhaltung dient. Da Selektion am Individuum angreift, muss das Individuum einen Selektionsvorteil haben, wenn es eine altruistische Verhaltensweise zeigt. Erklären Sie, worin dieser Selektionsvorteil besteht und wie das
Verhalten an die nächste Generation weitergegeben wird.
– Es besteht nur dann ein Selektionsvorteil, wenn der Altruismus mitvererbt wird.
. A4 Obwohl die Königin ebenso viele männliche wie weibliche Eier legt, beträgt das Geschlechterverhältnis in einem Bienenstock etwa 3 : 1 (Weibchen : Männchen). Diskutieren Sie diese
Gegebenheit und beziehen Sie Ihre Überlegungen in der Verwandtschaftsgrade mit ein.
– Die weiblichen Nachkommen sind mit den pflegenden Arbeiterinnen näher verwandt. Diese
pflegen die weiblichen Larven aus diesem Grund besser. So überleben die weiblichen Nachkommen besser als die männlichen.
Altruismus und Kooperation (Seite 316)
$ A1 Biologen sehen im reziproken Altruismus die Grundlagen menschlicher Moral. Bewerten Sie
diese Aussage.
– individuelle Lösung
87 Evolution
DO01045455_Loesung_04.indd 87
14.04.2015 14:19:34
Material: Kooperation (Seite 317)
$ A1 Vergleichen Sie Gewichtszunahme und -verlust sowie Zeitgewinn und -verlust für die betei­
ligten Partner und erläutern Sie, welche Vor- und Nachteile für sie entstehen.
– Wie aus Abbildung 2 zu entnehmen, ist der Verlust für einen Blut abgebenden Partner geringer
als der Nutzen für den Hungernden, da dieser durch die Spende in der nächsten Nacht auf
Nahrungssuche gehen kann. Für den Geber entstehen Nachteile, die nur dadurch ausgeglichen
werden können, dass der derzeitige Empfänger bei umgekehrtem Versorgungszustand auch
bereit ist, Futter abzugeben. Nicht verwandte Altruisten, deren Hilfe nicht erwidert wird, müssen
dauernd Verluste einstecken und sollten eine Nahrungsabgabe verweigern.
0 A2 Erläutern Sie die Vor- und Nachteile für verwandte und nicht verwandte Individuen mit den
Begriffen von Fitnessgewinn bzw. -verlust.
– Nach einer Runde des gegenseitigen Austauschs von Hilfe zwischen den gleichen Individuen
(A, B) ist die Fitnessbilanz positiv, falls b > c. Der Austausch erfolgt aber zusätzlich präferentiell
zwischen Verwandten. Es handelt sich also um eine Mischung von reziprokem Altruismus und
Verwandtenselektion.
$ A3 Begründen Sie, warum es biologisch sinnvoll ist, dass „Vampire“ nur an sehr vertraute Nichtverwandte Futter spenden.
– Nur von ihnen können sie sich erhoffen, im gegenteiligen Fall selbst Nahrung zu erhalten.
0 A4 Benennen Sie die Fähigkeiten, die für die Entstehung kooperativen Verhaltens wichtig sind.
– Wichtig ist die Entwicklung sozialer (Gruppen-) Verbände, in denen sich die Individuen untereinander „kennen“, bzw bekannte von unbekannten Individuen unterscheiden können. Ebenfalls
ist das Erkennen und die Bestrafung von Betrügern wichtig.
$ A5 Erörtern Sie, wie die Experimente mit den trainierten Kapuzineraffen das kooperative Verhalten belegen.
– Eine Mithilfe erfolgte bei leerer Futterschale nur dann, wenn es auch einen Gewinn dafür gab.
Ein eigener Vorteil ist Voraussetzung für kooperatives Verhalten.
Material: Verhalten und Evolution (Seite 318/319)
$ A1 Werten Sie Abbildung 2 aus und deuten Sie das Ergebnis im Sinne einer Lebenslaufstrategie.
– Die Einsiedlerkrebse können bei Gehäusemangel nicht wachsen, da sie kein neues größeres Gehäuse finden würden, also setzen sie die aufgenommene Nahrung in die Produktion von Eiern
ein. Stehen genug Gehäuse zur Verfügung, beginnen sie nicht nur später mit der Eierproduktion,
sondern investieren weniger in die Gelege und wachsen weiter.
$ A2 Fassen Sie die Ergebnisse zusammen und stellen Sie Zusammenhänge zwischen den Einzelergebnissen her.
– Mit der Zunahme der Jungenzahl im Nest erreichen die Jungtiere ein geringeres Durchschnittsgewicht. Von den ausgeflogenden Jungtieren fand man umso mehr wieder, je kräftiger sie beim
Verlassen des Nestes waren. Jungtiere aus sehr kleinen und sehr großen Gelegen wurden später
seltener wieder eingefangen. Dies liegt im unteren Bereich an der geringen Zahl der Nachkommen und im oberen Bereich an der schlechten Überlebensfähigkeit, die aus a und b hervorgeht.
Das Überleben der Eltern hängt von der Anzahl der zuvor aufgezogenen Jungen ab. Je mehr
Jungtiere großgezogen werden, desto häufiger müssen die Eltern Futter bringen. Dies erfordert
viel Zeit und Energie und erschöpft die Eltern bei hoher Jungenzahl so, dass sie den nächsten
Winter zum Teil nicht überleben. Da die einzelnen Jungtiere weniger Futter bekommen, bleiben
sie kleiner.
$ A3 Nennen Sie Faktoren, die die optimale Gelegegröße bestimmen.
– Die Eltern sollten so viele Junge großziehen wie möglich, die jedoch noch genug Futter bekommen, um gute Überlebenschancen zu haben. Außerdem sollten sie nur so viele Junge großziehen, dass sie nicht vorzeitig sterben, da sonst die Fitness gesenkt wird.
. A4 Stellen Sie eine Hypothese auf, welchen Einfluss ein gutes Futterangebot auf die Fortpflanzungsrate hat.
– Gutes Futterangebot kann die Futterversorgung erleichtern, ein höheres Jungengewicht und
eine bessere Überlebensrate der Jungen und der Eltern bewirken.
88 Evolution
DO01045455_Loesung_04.indd 88
14.04.2015 14:19:34
$ A5 Erklären Sie, warum Hamletbarsche nicht alle Eier auf einmal ablegen.
– Die Eier sind eine wesentlich kostspieligere Ressource als die Spermien (Anisogamie). Wenn
ein Tier alle Eier auf einmal abgäbe, würde die Gefahr bestehen, dass das andere Tier diese befruchtet und dann für seine Eier einen anderen Partner wählt. So kann es zu starken Ungleichgewichten im Fortpflanzungserfolg kommen, da Spermien in größeren Mengen in einem Tier
zur Verfügung stehen. Um dies zu vermeiden, legen die Tiere nur wenige Eier ab, im nächsten
Zug ist das andere Tier mit der Abgabe der energiereichen Eier an der Reihe.
$ A6 Beschreiben Sie die unterschiedlichen Fortpflanzungsstrategien der Guppys in den beiden
Gewässertypen.
– In Gewässer A, in dem besonders die großen ausgewachsenen Guppys erbeutet werden, bleiben
die Weibchen und Männchen klein und stecken den größten Teil der Biomasse in die Reproduktion. Sie reproduzieren in kurzen Abständen in produzieren kleine Nachkommen. In Gewässer B
stecken die Fische zunächst einen größeren Anteil an Biomasse in das Wachstum, wachsen so
aus der „gefährdeten“ Größe heraus und reproduzieren sich dann.
$ A7 In anderen Versuchen konnte gezeigt werden, dass die Fortpflanzungsstrategien der Guppys
erblich bedingt sind. Erklären Sie die Entstehung der unterschiedlichen Lebenslaufstrategien.
– Lebenslaufstrategien sind von den gegebenen Bedingungen abhängig. In den beiden Gewässertypen besteht ein unterschiedlicher Feinddruck. Die Population in Gewässertyp A) investiert in
die Anzahl der Nachkommen und die Population in Gewässertyp B) in das Wachstum (Biomasse) der Nachkommen. Dadurch hat sich die jeweilige reproduktive Fitness erhöht und ist im
jeweiligen Genpool verankert.
0 A8 Protokollieren und vergleichen Sie die Ergebnisse der verschiedenen Gruppen.
– individuelle Lösung
89 Evolution
DO01045455_Loesung_04.indd 89
14.04.2015 14:19:35
4. 4 Evolutionstheorien
Synthetische Evolutionstheorie (Seite 321)
$ A1 Ein einzelnes Individuum besitzt immer nur einen Teil der Allele, die in einer Population insgesamt vorkommen. Bestätigen Sie diese Aussage mithilfe der Blutgruppenallele (Informationen aus dem Internet sammeln) und mithilfe der Sichelzellallele (s. Seite 50/51).
– Im AB0-System gibt es Individuen mit den Allelen A1/A2, B und 0. Nicht alle Allele treten bei
allen Individuen auf — höchstens 2. Ebenso kommt das Sichelzellallel nicht bei allen Individuen
vor — es gibt heterozygote Individuen mit dem Sichelzellallel und homozygote Individuen für
das Sichelzell- sowie das Wildtypallel.
Pioniere der Evolutionsforschung (Seite 322)
0 A1 Erläutern Sie, inwiefern heute Lamarcks Theorien widerlegt sind.
– Lamarck ging davon aus, dass es einen inneren Drang von Tieren gibt, sich anzupassen (Trieb
nach Vervollkommnung). Durch Gebrauch bzw. Nichtgebrauch von Organen käme es zu ihrer
stärkerer Ausprägung bzw. zu deren Rückbildung. Die so erworbenen Merkmale würden weiter
vererbt. Aus wissenschaftlicher Sicht ist der Lamarckismus widerlegt, weil Vererbung genetisch
bedingt ist und somit nur geänderte Gene zu geänderten Merkmalen führen, denn nur diese
werden von einer auf die nächste Generation übertragen.
. A2 Versetzen Sie sich in die Lage von Wallace und Darwin und stellen Sie Vermutungen an,
warum beide zur Theorie der natürlichen Selektion kamen.
– Beide beobachteten eine enorme Arten- und Formenvielfalt bei ihren Expeditionen und suchten
nach einer Begründung für dieses Phänomen. Eine Erklärung ist die Konkurrenz um Ressourcen
zwischen und innerhalb von Arten durch eine Überproduktion von Nachkommen und die „Antwort“ durch Anpassungen und Spezialisierungen.
Nicht naturwissenschaftliche Theorien (Seite 323)
$ A1 Grenzen Sie die Synthetische Theorie der Evolution von den nicht naturwissenschaftlichen
Positionen ab und nehmen Sie zu diesen begründet Stellung.
– Die Synthetische Theorie der Evolution geht davon aus, dass sich die Arten aufgrund zufälliger
genetischer Veränderungen bei anschließender Selektion entwickeln. Die nicht naturwissenschaftlichen Positionen gehen von einem Schöpfer aus, der die Erde mit all ihren Arten in einem
Akt geschaffen habe. Das widerspricht den Ergebnissen der Paläontologie. Sie identifiziert eine
zeitliche Aufeinanderfolge des Auftretens der Arten. Die zeitliche Abfolge wird durch Stratigraphien und naturwissenschaftliche Zeitbestimmungen belegt. Mit dem Intelligent Design
erfolgte eine Weiterentwicklung, die sich einen wissenschaftlichen Anstrich gibt. Hier wird
davon ausgegangen, dass komplexe Strukturen, wie etwa das Auge, nicht durch eine Folge von
sukzessiven Veränderungen entstehen können, sondern von einem Designer geschaffen werden
müssen. Das widerspricht der biologischen Forschung in soweit, als Sehfähigkeit von lediglich
Hell-Dunkel-Unterscheidung per spezieller Hautzellen in Abstufungen bis zur Sehfähigkeiten des
Menschen und besser in hoch spezialisierten Augen gefunden hat.
90 Evolution
DO01045455_Loesung_04.indd 90
14.04.2015 14:19:35
4. 5 Ähnlichkeit und Verwandtschaft
Homologie und Analogie (Seite 325)
$ A1 Erläutern Sie, wie das jeweilige Beispiel (Abbildung 1, 3 und 4) die Homologiekriterien erfüllt.
– Obwohl die Gesamtstruktur von Walflosse und Menschenhand sehr verschieden in Gestalt und
Funktion ist, finden sich alle einzelnen Strukturen in der gleichen Anordnung. Dieses Beispiel
erfüllt das Homologiekriterium der Lage. Hautschuppen eines Hais und Säugetierzähne haben
trotz ihrer unterschiedlichen Funktion den gleichen Aufbau und bestehen aus den gleichen
Substanzen. Somit erfüllen sie das Kriterium der spezifischen Qualität.
$ A2 Entwerfen Sie einen hypothetischen Stammbaum, mit dem Sie darstellen, dass ein abgeleitetes Merkmal zweier Arten analog ist, und einen Stammbaum, in dem ein Merkmal homolog ist.
– siehe Abbildung: Das Merkmal „schwarzer Kreis“ im Stammbaum rechts wäre analog, während
es im Stammbaum rechts homolog wäre. Wichtig wäre, dass das Merkmal abgeleitet ist und
nicht vor der Aufspaltung der Arten entstanden ist und dann im Lauf der Evolution sekundär bei
den mit dem grauen Kreis gekennzeichneten Taxa verlorengegangen ist.
. A3 Ein Sonderfall sind Fangbeine. Fertigen Sie eine Zeichnung an, in der Sie die Vorderbeine der
Gottesanbeterin mit dem Grundbauplan homologisieren.
– siehe Abbildung
Schenkel
Schiene
Hüfte
Schenkelring
Fußglieder
Rudimente und Atavismen (Seite 326)
0 A1 Erläutern Sie den Unterschied zwischen Rudimenten und Atavismen.
– Rudimente sind Merkmale, deren Ausbildung im Vergleich zum ursprünglichen Merkmal reduziert sind. Häufig haben sie eine neue Funktion erlangt. Atavismen hingegen sind Merkmale,
die für die betreffende Art im Laufe der Stammesgeschichte zurück entwickelt wurden und im
Normalfall nicht mehr ausgebildet werden, bei einigen sehr wenigen Individuen aber auftreten.
Eine Funktion haben sie nicht.
Material: Homologie und Analogie (Seite 327)
0 A1 Nennen Sie die Strukturen im Linsenauge des Tintenfischs, die mit den Augen der Säugetiere
vergleichbar sind.
– Hornhaut, Linse, Netzhaut, Sehnerv
$ A2 Begründen Sie, ob die Augen der beiden Tiergruppen homolog sind oder nicht. Nennen Sie
die Homologiekriterien, die Sie für Ihre Argumentation verwenden.
– Lagekriterium: Die beiden Augentypen findet man bei verschiedenen Tierstämmen (Weichtiere, Wirbeltiere), die jeweils eigene Baupläne besitzen. So sitzen die Augen der Wirbeltiere in
knöchernen Augenhöhlen. Die Kopffüßler haben dagegen kein Kopfskelett. Das Lagekriterium
ergibt keinen Hinweis auf Homologie. 91 Evolution
DO01045455_Loesung_04.indd 91
14.04.2015 14:19:35
Stetigkeitskriterium: Wendet man dieses Kriterium auf die beiden Augentypen an, so wird
ersichtlich, dass keine Übergangsformen entstehen. Bei den Wirbeltieren entwickeln sich
Netzhaut und Pigmentepithel aus einer becherartigen Vorstülpung des Zwischenhirns, während
bei den Kopffüßern das gesamte Auge aus einer Epidermiseinstülpung hervorgeht. Danach liegt
keine Homologie vor.
$ A3 Beschreiben und vergleichen Sie die evolutive Entwicklung von Augen bei Kopffüßern und
bei Säugetieren. Verwenden Sie bei Ihrer Antwort auch das Ergebnis aus Aufgabe 2.
– Die beiden Augentypen sind nicht homolog. Es gab also keine gemeinsamen Vorfahren, die Linsenaugen besaßen. Die beiden Augentypen sind im Verlauf der Evolution unabhängig voneinander entstanden.
0 A4 Vergleichen Sie die Blätter der abgebildeten Pflanzen.
– Die Blätter des Leberblümchens sind klein und herzförmig, die der Küchenschelle schmal und
lang, die des Buschwindröschens sind relativ groß und lappig sowie tief eingeschnitten.
0 A5 Ordnen Sie die Pflanzen in Bezug auf die Lage der Hochblätter in eine Reihe.
– Buschwindröschen, Küchenschelle, Leberblümchen
$ A6 Erklären Sie, wie sich aus der Abbildung ersehen lässt, ob die Kelchblätter des Leberblümchens aus Laubblättern hervorgegangen sind.
– Beim Buschwindröschen sehen die Hochblätter wie Laubblätter aus. Es lässt sich ein Übergang
der Hochblätter zu den Kelchblättern beim Leberblümchen beobachten. Nach dem Kriterium der
Stetigkeit sind die Blätter homolog. Demnach sind die Kelchblätter aus Laubblättern entstanden.
Merkmale und Merkmalsprüfungen (Seite 328)
$ A1 Analysieren Sie die wesentlichen Schritte der Merkmalsprüfung.
– Zuerst muss geklärt werden, ob ein gemeinsames Merkmal homolog ist, da nur dies auf
Verwandtschaft hindeutet. Um eine genauere Zuordnung zu erreichen, sollte das Merkmal abgeleitet sein, also nur bei einer begrenzten Gruppe von Arten vorkommen. Der Außengruppenvergleich kann die Verwandtschaft bestätigen, wenn sich ergibt, dass das Merkmal außerhalb
des Taxons nicht vorkommt.
Morphologische Rekonstruktion von Stammbäumen (Seite 329)
$ A1 Skizzieren Sie den im Text als weniger wahrscheinlich vorgestellten Stammbaum (Vorlage:
Stammbaum in Abb. 1).
– Der Verwandtschaftsgrad zu einer Schwester ist r = 0,5, der zu ihren Kindern r = 0,25. Der Verwandtschaftsgrad zu eigenen Kindern ist r = 0,5. Zwei eigene Kinder stellen eine direkte Fitness
von 2 x 0,5 = 1 dar. Wenn keine eigenen Nachkommen großgezogen werden, wird die gleiche
indirekte Fitness erreicht, wenn die Schwester durch die angenommene Hilfe vier zusätzliche
Junge großziehen kann.
Molekulare Verwandtschaft (Seite 331)
$ A1 Auch DNA-Abschnitte, die nicht der natürlichen Selektion unterliegen, verändern sich im
Laufe der Generationen. Erläutern Sie, wie dies zu erklären ist.
– Mutationen treten an vielen Genomabschnitten auf, unabhängig davon, ob diese Genomabschnitte für Proteine codieren und somit der Selektion unterliegen. Unterliegen sie nicht der
Selektion, weil Veränderungen in dem bestimmten Genomabschnitt sich nicht auf die Fitness
der Trägerindividuen auswirken, wirken keine Kräfte, die diese Mutationen aus der Population
entfernen. Der Fortbestand der Mutationen hängt dann nur von Gendrift, d. h. Zufallsereignissen, ab. Im Laufe der Generationen sammeln sich so Mutationen an, die durch Zufall in Populationen und Arten fixiert werden.
$ A2 Abbildung 1 stellt DNA-Sequenzen desselben Fragments sechs verschiedener Individuen
dar. Identifizieren Sie hier den konservierten und den am stärksten variablen Bereich (unter
Angabe der Basenpositionen).
– Konservative Regionen sind die Regionen, in denen kein Basenaustausch stattgefunden hat
(Pos 1—18, 20—26, 28—32, 35—42, 44—62, 65—76, 88—89). Die größten konservativen Regionen sind die zwischen den Positionen 1—18 und 44—62. Im Gegensatz dazu sind die Regionen
variabel, bei denen die meisten Basenaustausche festzustellen sind. Dies ist die Basenposition
43. In Region 63–65 sind alle drei Basenpositionen in Folge variabel. Diese Regionen enthalten
vergleichsweise viel Informationsgehalt.
92 Evolution
DO01045455_Loesung_04.indd 92
14.04.2015 14:19:35
Molekulare Uhren (Seite 332)
$ A1 Berechnen Sie mithilfe der Abb. 2 die Zeit für den Austausch einer Aminosäure bei den drei
Proteinen.
– Man wählt auf jeder Ausgleichsgeraden einen Punkt, der möglichst weit vom Ursprung entfernt
liegt. Aus dem Quotienten aus Zeit und Änderungen berechnet man die Austauschzeit für eine
Aminosäure.
Beispiele:
• Cytochrom c: Ausgleichsgerade geht durch den Punkt (30 Änderungen/ 600 Mio. Jahre); daraus folgt: 600 Mio. Jahre/ 30 Änderungen = 20 Mio. Jahre/ 1 Änderung; es ist eine Änderung
alle 20 Mio. Jahre zu erwarten.
• Globine: Ausgleichsgerade geht durch den Punkt (100 Änderungen/ 600 Mio. Jahre); daraus
folgt: 6 Mio. Jahre/ 1 Änderung.
• Fibrine: Ausgleichsgerade geht durch den Punkt (100 Änderungen/ 100 Mio. Jahre); daraus
folgt: 1 Mio. Jahre/ 1 Änderung.
$ A2 Vergleichen Sie den Stammbaum in Abb. 1 mit der Systematik des Tierreiches (s. Seite 361).
– Die großen Äste der beiden Stammbäume stimmen überein: Pilze, Pflanzen, Tiere. Bei den
Tieren ist auch eine Einteilung in Großgruppen (Nematoden, Insekten, Vertebraten) angedeutet.
Allerdings besitzt der Cytochrom c-Stammbaum einen starken Schwerpunkt bei den Wirbeltieren, während die Abbildung auf Seite 361 im Schülerband alle Organismen etwas gleichmäßiger
betrachtet. Das lässt einen Vergleich im Detail nicht zu.
Neue Gene entstehen (Seite 333)
$ A1 Beschreiben Sie die Vorteile mehrerer Hämoglobinvarianten beim Sperbergeier.
– Der Sperbergeier ist beim Flug in unterschiedlichen Höhen bis auf Höhen von 11 000 m unterschiedlichen Sauerstoffpartialdrücken ausgesetzt. Die verschiedenen Hämoglobinvarianten sind
eine Angepasstheit an diese unterschiedlichen Bedingungen und ermöglichen den Sauerstofftransport durch den Körper in unterschiedlichsten Höhen.
DNA-Datenbanken (Seite 335)
0 A1 Recherchieren Sie den Unterschied von Gendatenbanken und Genbanken.
– Genbanken verwalten / bewahren genetische Vielfalt in Form von lebenden oder überdauernden
Individuen (z. B. Pflanzensamen, Sporen, etc), während Gendatenbanken DNA-Sequenzen als
Daten verwalten.
. A2 Stellen Sie eine mögliche Sequenziermethode vor (s. Seite 64) und begründen Sie deren
Einsatz.
– Rechercheaufgabe: In der Evolutionsforschung werden Hochdurchsatzmethoden vor allem für
die Untersuchung großer Individuen- und Artgruppen (z. B. bei der Untersuchung der Bodenfauna oder des Meeresplanktons) verwendet. Die Eignung der unterschiedlichen Methoden hängt
von der jeweiligen Fragestellung ab.
Material: Gen-Datenbanken (Seite 336/337)
0 A1 Beschreiben Sie anhand Abb. 1 den Zusammenhang zwischen der Entwicklung von Sequenziermethoden und dem Datenwachstum in der NCBI-Genbank.
– Je billiger, schneller und einfacher Sequenzdaten durch die Entwicklung der Sequenziermethoden erhoben werden können, desto höher steigt die Anzahl der verdateten Sequenzen in der
Genbank.
$ A2 Stellen Sie eine begründete Vermutung für die unterschiedliche Anzahl an Sequenzen in der
Genbank auf.
– Abbildung 2 zeigt, dass die mit Abstand größte Anzahl an Sequenzdaten in der Genbank vom
Menschen stammt, gefolgt vom Schimpansen. Dies ist auf der einen Seite durch das große Interesse der Biomedizin in Sequenzdaten zu erklären. Andererseits interessieren wir Menschen uns
am meisten für die Evolution des Menschen. Da der Schimpanse unser nächster Verwandter ist,
liegt ein Sequenzvergleich Mensch — Schimpanse nahe, um herauszufinden, was uns genetisch
von unserem nächsten Verwandten trennt, d. h. was den Menschen zum Menschen macht (bzw.
gemacht hat).
93 Evolution
DO01045455_Loesung_04.indd 93
14.04.2015 14:19:35
$ A3 Beschreiben Sie die Sequenzpolymorphismen des dargestellten Genabschnitts.
– Es finden sich über die Sequenzen verteilt 7 variable Basenpositionen. Die unterschiedlichen
Phänotypen „klein“, „mittelgroß“ und „groß“ haben unterschiedliche Genotypen.
$ A4 Nennen Sie die mögliche Kernaussage der Autoren für diese Populationsuntersuchung.
– Eine mögliche Aussage wäre, dass eine genetische Trennung zwischen den unterschiedlichen
Phänotypen besteht. Eine solche Aussage wäre aber nur berechtigt, wenn man wüsste, um
welchen DNA-Abschnitt es sich handelt. Handelt es sich um einen neutralen DNA-Abschnitt,
der nicht für Proteine codiert, wäre die Vermutung berechtigt, dass eine genetische Trennung
zwischen den Individuen der unterschiedlichen Phänotypen besteht. Handelt es sich um einen
Genabschnitt, der in irgendeiner Weise die Größe beeinflusst, ist das Sequenzergebnis nur die
Widerspieglung des phänotypischen Bildes und ist zu erwarten. Dies ist aber bei dem Merkmal
„Körpergröße“, einem Merkmal, das auf vielen verschiedenen Genorten beruht, eher unwahrscheinlich.
$ A5 Beschreiben Sie anhand der Abbildung 5, wie sich mithilfe des DNA-Barcodings die Wirtspflanze eines Organismus bestimmen lässt.
– Durch die Sammlung, Extraktion und Sequenzierung kleiner DNA-Mengen am Pflanzenschädling lassen sich DNA-Barcodes ermitteln, die durch den Abgleich mit DNA-Barcode-Sequenzen
einer Datenbank zur jeweiligen Wirtspflanzen führen.
$ A6 Beschreiben Sie basierend auf dem Ergebnis aus der Tabelle in Abbildung 5 den Nutzen der
BLAST-Suche für die Aufstellung phylogenetischer Stammbäume.
– Die BLAST-Suche liefert die Anzahl der Übereinstimmung von Basen an bestimmten Positionen
verschiedener Sequenzen. Durch ein Ranking der Übereinstimmung lassen sich so Stammbäume
erstellen. Wichtig ist es dabei jedoch, eine Ausgangssequenz zu haben, von der man weiß, dass
sie die ursprüngliche Sequenz darstellt. Eine relative verwandtschaftliche Nähe verschiedener
Sequenzen (bzw. der Individuen oder Arten) lässt sich auch ohne eine solche „Ausgangssequenz“
ermitteln.
Methoden der Paläontologie (Seite 339)
$ A1 Erläutern Sie die Bedingungen für Fossilienentstehung.
– Um die Zersetzung zu verhindern, müssen sowohl Destruenten als auch Sauerstoff vom organischen Material (den Überresten des betroffenen Organismus) ferngehalten werden. Dies kann
dadurch geschehen, indem es schnell von Sedimenten oder organischer Substanz in Flachwasserbereichen bedeckt wird. Zusätzlich müssen für die von Sediment bedeckten Materialien
geeignete Mineralien am Fundort vorliegen, damit die Organismen versteinern oder verkieseln.
Ein besonderer Fall des Sauerstoffabschlusses erfolgt durch Harzeinschluss z. B. von Insekten,
was zu Bernstein führte.
$ A2 Erklären Sie die Unterschiede zwischen relativer und absoluter Altersbestimmung von Fossilien.
– Die relative Altersbestimmung ergibt sich aus der Stratigrafie ungestörter Fundstellen. Angegeben wird die zeitliche Aufeinanderfolge, in der die Fossilien in das Sediment gelangt sind.
Dabei gilt: Oben ist jünger als unten. Die absolute Altersbestimmung erfolgt mit Methoden, mit
denen sich Zeiten messen lassen, wie zum Beispiel der 14C-Methode. Ihr Ergebnis ist die Zeit, die
zwischen heute und dem betrachteten Ereignis vergangen ist, z. B. die Zeit nach dem Sterben
eines Organismus.
Lebende Fossilien (Seite 340)
$ A1 Erläutern Sie, warum lebende Fossilien vor allem in Lebensräumen vorkommen, in denen
sich die Lebensbedingungen über lange Zeit gleich gehalten haben.
– Die Änderung der Lebensbedingungen wirkt wie ein Motor der Evolution. Die Evolution läuft im
Takt mit den Lebensraumänderungen. Ist die Taktfrequenz sehr niedrig, ändern sich die Arten
wenig und weisen alte bis sehr alte Merkmale auf, weshalb man sie als „lebende Fossilien“
bezeichnet.
. A2 Stellen Sie eine begründete Hypothese auf, wieso es in Australien besonders viele lebende
Fossilien gibt.
– Australien ist seit geologisch langer Zeit von den anderen Kontinenten isoliert. Dadurch haben
sich dort Lebensbedingungen (z. B. Räuber-Beute-Beziehungen) über lange Zeit konstant erhalten — die Bedingung für ein Vorkommen „lebender Fossilien“.
94 Evolution
DO01045455_Loesung_04.indd 94
14.04.2015 14:19:36
Brückentiere (Seite 341)
$ A1 Erläutern Sie, warum lebende Fossilien und Brückentiere wichtige Beweise für die Evolutionstheorie sind.
– Lebende Fossilien sind Beweise für die Evolutionstheorie, weil sie in konstanten Lebensräumen
vorkommen und dort Selektion nicht oder kaum stattfindet. Dies steht im Einklang mit der
Evolutionstheorie, nach der Veränderungen mal schnell, mal langsam ablaufen. Anders die
Brückentiere. Sie zeigen die laufenden Veränderungen an, wodurch die Veränderung von Merkmalen (und Arten) dokumentiert wird.
$ A2 Stellen Sie dar, warum der Wal kein Brückentier ist.
– Der Wal ist kein Brückentier. Er hat als Säugetier seinen Lebensraum vom Land ins Meer verlegt. Er ist also nicht etwa ein ursprünglicher Fisch mit Säugetiermerkmalen.
95 Evolution
DO01045455_Loesung_04.indd 95
14.04.2015 14:19:36
4. 6 Evolution des Menschen
Der Mensch ist ein Primat (Seite 342)
$ A1 In jüngerer Zeit geht man vermehrt davon aus, dass Werkzeugbenutzung bei Primaten eher
eine Folge der Intelligenzentwicklung war als eine Ursache. Entwickeln Sie zur Erklärung
eine Hypothese.
– In morphologischer Hinsicht fällt bei Homo sapiens die Zunahme des Gehirnvolumens und im
Vergleich zu seinem Gesamtkörpergewicht (und zu anderen Hominiden) die hohe Leistungsfähigkeit des Gehirns (Intelligenz) auf. Sein aufrechter Gang ermöglichte aller Wahrscheinlichkeit
nach den Gebrauch seiner Hände. Für diesen differenzierten filigranen Gebrauch benötigt das
Gehirn u .a. beträchtliche Speicherkapazitäten. Dies förderte wahrscheinlich neben der Höherentwicklung des Sozialverhaltens auch den Werkzeuggebrauch. Somit wäre, dieser Hypothese
folgend, der Werkzeuggebrauch eine Folge der Intelligenzentwicklung.
Unsere nächsten Verwandten (Seite 343)
$ A1 Begründen Sie, warum in der modernen Forschung die DNA-Hybridisierung nach Sibley und
Ahlquist in der Stammbaumforschung keine große Rolle mehr spielt.
– Die DNA-DNA-Hybridisierungsmethode nach Sibley und Ahlquist stellt eine relativ grobe Methode
dar, die zwar die systematischen Zusammenhänge relativ gut erfassen kann, für eine feinere
phylogenetische Aufgliederung jedoch weniger geeignet ist. Mit den heute angewendeten
Sequenziermethoden (z. B. Hochdurchsatzsequenzierung) lassen sich gezielt homologe Gen‑
sequenzen mithilfe von Phylogenieprogrammen deutlich genauer analysieren.
$ A2 Entwickeln Sie ein Dendrogramm für Menschenaffen und Menschen auf der Basis der ∆T50H-Werte (Darstellung wie in Abb. 2 auf Seite 350).
– siehe Abbildung
Bonobo
Schimpanse
Mensch
Gorilla
OrangUtan
0,69
1,635
2,28
3,567
. A3 Stellen Sie Argumente für und gegen die Forderung zusammen und nehmen Sie Stellung.
– Während die Werte aus der DNA-Hybridisierung gegen die Einordnung in die Gattung Homo
sprechen, liefern Untersuchungen zum genetischen Abstand eher Argumente dafür. Die Erkenntnisse der Verhaltensforscher lassen eine Ordnung in die Gattung Homo möglicherweise sinnvoll
erscheinen. Entsprechende Untersuchungen an anderen Primaten könnten zeigen, ob der
Schimpanse hier eine Ausnahme bildet.
Mensch und Schimpanse — ein Vergleich (Seite 345)
$ A1 Zeigen Sie die hier genannten Beispiele für das Basiskonzept Struktur und Funktion auf.
– Beispiele: Die Form der Wirbelsäule des Menschen ermöglicht die Funktion als „Stoßdämpfer“.
Der Anschluss des opponierbaren Daumens des Menschen ermöglicht präzises Greifen.
$ A2 Werten Sie die DNA-Sequenzen der drei Lebewesen in Abbildung 1 aus. Erklären Sie, weshalb
die Sequenz des Huhns ebenfalls analysiert wurde.
– Die Evolution dieses Gens war bis vor ca. 6 Mio. Jahren relativ langsam verlaufen, denn zwischen Hühnern und Schimpansen, deren Abstammungslinien sich vor 300 Mio. Jahren trennten,
gibt es nur 2 Basenunterschiede in der DNA, während in den letzten ca. 6 Mio. Jahren zwischen
Schimpanse und Mensch allein 18 Mutationen auf der DNA auftraten. Die Analyse der DNASequenz des Huhns war notwendig, um die Gemeinsamkeiten bzw. die geringe Anzahl an
Mutationen auf diesem Gen innerhalb eines sehr großen vergangenen Zeitraumes zu belegen.
Deutung: Es verwundert aus heutiger Sicht nicht, dass ein regulatorisches Gen, das für die Entwicklung des Gehirns und der Sprache eine bedeutende Rolle spielt, deutliche Veränderungen
während der letzten 6 Mio. Jahre durchlief: Schimpanse und Mensch besitzen genau hier
zentrale Unterschiede. Man weiß laut Text, dass HAR1-Gene in Neuronen bestimmten Typs aktiv
sind, welche die Furchungen der Großhirnrinde während der Embryogenese steuern. Treten also
negative Mutationen auf, verlaufen diese häufig tödlich. Bezüglich der Gehirnentwicklung sind
bei diesem Gen hingegen kaum Unterschiede innerhalb der letzten 294 Mio. Jahre festzustellen,
also innerhalb des Zeitkorridors, in dem sich die Wirbeltiere und späteren Säugetiere weiterent-
96 Evolution
DO01045455_Loesung_04.indd 96
14.04.2015 14:19:36
wickelt haben. Anmerkung: Bei Mutationen auf diesem Gen, die nicht tödlich verlaufen, sind
solche Menschen nicht mehr in der Lage, schnell hintereinander ablaufende Gesichtsmuskelbewegungen auszuführen. Die Artikulation ist bei diesen Personen somit negativ beeinflusst.
$ A3 Zeichnen Sie anschließend hierfür ein Dendrogramm und beschriften Sie es (Vorlage: Abb. 2
auf Seite 350).
– siehe Abbildung
Huhn
Schimpanse
Mensch
Die Herkunft des heutigen Menschen (Seite 350)
$ A1 Vergleichen Sie das Dendrogramm (Abb. 2) mit dem in Abb. 1 dargestellten Ausbreitungsweg.
– Einer genetischen Distanz von 0,2 entsprechen ca. 100 000 evolutiv getrennte Jahre. Die Afrikaner weisen eine genetische Distanz von 0,2 gegenüber den übrigen Menschen aus, vor 100 000
Jahren wanderten die Menschen also aus Afrika aus. Sie gelangten vor etwa 60 000 Jahren
(genetische Distanz 0,12) nach Eurasien und etwas später nach Australien, vor 35 000 Jahren
nach Amerika (0,07).
$ A2 Stellen Sie die wichtigsten Aspekte des „Out of Africa“-Modells und der Hypothese von der
multiregionalen Entwicklung gegenüber. Beurteilen Sie, nach welcher der Theorien die gemeinsame Wurzel aller Menschen weiter zurückliegt.
– „Out of Africa“: Homo sapiens entstand vor höchstens 200 000 Jahren in Afrika und verdrängte
vor 100 000 Jahren die Neandertaler, die von einer früheren Besiedlungswelle vor etwa 1 Million
Jahren von Homo erectus/Homo ergaster abstammten. Es gab in Europa zwei weit auseinander
liegende Besiedlungswellen von Homo.
Multiregionale Entwicklung: Auch nach der multiregionalen Theorie stammt die Gattung Homo
aus Afrika. Homo erectus bzw. ergaster gelangte vor etwa 1 Million Jahren nach Europa und
Asien und entwickelte sich dort parallel und unabhängig voneinander weiter zum modernen
Menschen, zum Neandertaler und asiatischen Formen. Es gab also nur eine Besiedlungswelle.
Nach der multiregionalen Theorie liegt die Wurzel aller Menschen weiter zurück, sie sind also
weniger verwandt als nach der „Out of Africa“-Theorie.
Material: Neandertaler und moderne Menschen (Seite 353)
$ A1 Stellen Sie die wesentlichen Merkmale im Schädel- und Skelettbau von Neandertaler und
modernem Menschen gegenüber.
– siehe
Tabelle
Körperbau
Neandertaler
Mensch
gedrungen, muskulös, ca. 1,5 m
grazil, damals ca. 1,75 m
Schädelform
lang, niedrig
hoch, rund
Oberaugenwülste
vorhanden
fehlen
Kinn
fliehendes Kinn
Vorspringen des Kinns
Gehirnvolumen
1200 —
1700 cm2
1200 — 1450 cm2
$ A2 Stellen Sie einen möglichen Zusammenhang zwischen dem Körperbau des Neandertalers,
seiner Verbreitung und dem damals herrschenden Klima her.
– Der gedrungene Körperbau und die damit verbundene relativ kleine Körperoberfläche können
ein Vorteil bei eiszeitlichen Lebensbedingungen sein, da dadurch die Wärmeabgabe reduziert
ist. Allerdings konnte auch der moderne Mensch diese klimatischen Bedingungen vertragen, da
Feuergebrauch und Kleidung die Anpassungsunterschiede verringerten.
97 Evolution
DO01045455_Loesung_04.indd 97
14.04.2015 14:19:36
$ A3 Leiten Sie aus dem Bau der in Abbildung 2 dargestellten Kehlköpfe von Neandertaler,
Mensch und Schimpanse ab, warum der Neandertaler wahrscheinlich anders gesprochen hat
als der moderne Mensch.
– Für die Stimmbildung und die Ausformung verschiedener Tonhöhen ist die Lage des Rachenraumes entscheidend. Je tiefer der Kehlkopf nach unten verlagert wird, desto länger ist der Ton
erzeugende Rachenraum und desto tiefer sind die erzeugten Töne. Wie man aus der Schädelbasis-Form erschließen konnte, ist der Rachenraum der Neandertaler wesentlich kürzer als der
des modernen Menschen gewesen. Neandertaler konnten wahrscheinlich keine tiefen Vokale
produzieren.
$ A4 Erklären Sie das Fehlen von Neandertalergenen bei Menschen südlich der Sahara.
– Die mt-DNA-Analyse zeigt keinen Überlappungsbereich der Kurven von Neandertaler/ Mensch
und Mensch/ Mensch. Demnach hat es keine genetische Vermischung gegeben. Eine fruchtbare
Kreuzung findet nur unter Individuen der gleichen Art und deren Unterarten statt. Stuft man
den Neandertaler als eigene Art ein, hält man also eine Vermischung mit anatomisch modernen
Menschen für nicht möglich. Der Neandertaler ist dann eine Schwesterart, aber kein direkter
Vorfahre des heutigen Menschen.
Material: Hautfarbe und Sonnenlicht (Seite 355)
$ A1 Die Färbung der Haut lässt sich auf das Pigment Melanin zurückführen. Es wird auch als
„natürlicher Sunblocker“ bezeichnet, denn es schützt die Haut vor der mutagenen Wirkung
des UV-Lichtes und damit vor der Entstehung von Hautkrebs. Beschreiben Sie anhand Abb. 1.
– Das von den Melanocyten der Oberhaut gebildete Melanin gelangt über Zellausläufer in benachbarte Zellen und bildet auf der dem Licht zugewandten Seite des Zellkerns eine Kappe, die
den Zellkern vor Lichtstrahlen schützt.
$ A2 Hautkrebs entsteht meist im fortgeschrittenen Alter von Menschen, die sich in der Vergangenheit zu hohen Sonnenintensitäten ausgesetzt haben. Was bedeutet das für ihre reproduktive Fitness?
– Die Reproduktionsphase ist dann bereits abgeschlossen, sie wird durch Hautkrebs also nicht direkt beeinflusst. Allerdings haben auch Senioren bzw. Großeltern einen sozialen Einfluss
bei der Betreuung der Enkelkinder, können also einen indirekten Einfluss auf die reproduktive
Fitness haben.
$ A3 Das UV-Licht der Sonne beeinflusst auch die Bildung und den Zerfall von Vitaminen. Beschreiben Sie dies anhand des Schemas (Abb. 3).
– Durch UV-Licht wird die Bildung von Provitamin D und der Zerfall von Vitamin B gefördert.
$ A4 Folsäuremangel in der Schwangerschaft einer Frau erhöht das Risiko für Neuralrohrdefekte
beim ungeborenen Säugling. Vitamin-D-Mangel erschwert die Calciumaufnahme im Verdauungskanal und damit die normale Entwicklung des Skelettsystems. Begründen Sie, warum in
sonnenreichen Regionen Menschen mit dunkler Hautfarbe begünstigt sind, in Regionen mit
einer geringeren täglichen UV-Strahlung dagegen solche mit heller Hautfarbe.
– Dunkelhäutige Menschen in sonnenreichen Regionen sind vor zu viel Sonnenlicht geschützt, das
zum Zerfall des B-Vitamins Folsäure führen könnte. Für die Vitamin-D-Bildung reicht das Licht
aus. Da sich die Vitaminversorgung besonders in der Schwangerschaft und frühen Kindesentwicklung auswirkt, haben sie in einer sonnenreichen Umgebung einen Selektionsvorteil gegenüber hellhäutigen Menschen. Bei hellhäutigen Menschen in einer sonnenarmen Umgebung
verhält es sich genau umgekehrt.
$ A5 Beschreiben Sie die Verteilung der Hautfarben auf der Erde (Abb. 2) und formulieren Sie eine
evolutionsbiologische Erklärung.
– Helle Hautfarben findet man nur in geografischen Regionen mit einer geringen Sonneneinstrahlung. In diesen Regionen stellt der UV-Schutz durch das Melanin in der Haut keinen Anpassungsvorteil dar. Mehr eindringendes Sonnenlicht sorgt für eine bessere Vitamin-D-Versorgung.
$ A6 Bei der geografischen Verteilung gibt es auch Abweichungen von der aufgrund der UVIntensität erwarteten Hautfarbe, z. B. sind viele heutige Bewohner Australiens heller als die
Ureinwohner (Aborigines). Nennen Sie mögliche Ursachen. Berücksichtigen Sie dabei die
heutigen Lebensumstände der Menschen.
– Die Abweichungen sind auf Ein- und Auswanderungen von Bevölkerungsteilen zurückzuführen.
Unter den heutigen Lebensumständen des Menschen beeinflussen Hautfarbe und Sonnenlicht
die Reproduktionsrate nicht mehr so sehr, weil Vitamine medizinisch verordnet und eingenommen werden können. Außerdem gibt es Möglichkeiten, sich vor zu viel Sonne durch Behausung,
Bekleidung oder Hautcremes zu schützen.
98 Evolution
DO01045455_Loesung_04.indd 98
14.04.2015 14:19:36
4. 7 Die Evolution des Lebens auf der Erde
Frühe biologische Evolution: Erste lebende Zellen (Seite 356)
$ A1 Anaerobe Bakterien findet man heute beispielsweise im Faulschlamm in Kläranlagen. Begründen Sie das Vorkommen.
– Anaerobe Bakterien gehen bei Kontakt mit Sauerstoff zugrunde, da sie keinen Oxidationsschutz
besitzen. Sie können daher nur in anaeroben Lebensräumen wie Faulschlamm existieren.
. A2 Cyanobakterien waren die größten Umweltverschmutzer in der Geschichte der Erde. Nehmen
Sie Stellung zu dieser Aussage.
– Durch die Fotosynthese der Cyanobakterien entstand erstmals Sauerstoff als Abfallprodukt in
großen Mengen. Derzeit lebten nur anaerobe Urzellen, für die die oxidative Wirkung des Sauerstoffs tödlich war.
Mehrzeller entstanden mehrmals in der Evolution (Seite 357)
0 A1 Die Grünalge Volvox gilt als besonders einfacher Mehrzeller. Beschreiben Sie Bau und Organisation dieser kugelförmigen Alge (s. Randspalte).
– Bis zu 20 000 Zellen sind durch Plasmabrücken verbunden und umkleiden gemeinsam eine Hohlkugel. Es gibt Zellen, die auf Fortbewegung, Ernährung oder sexuelle Fortpflanzung spezialisiert
sind. Tochterkugeln entstehen vegetativ durch Abschnürung von Zellgruppen in das Kugelinnere
und werden erst durch das Absterben der Mutterkugel freigegeben.
$ A2 Gibt es nach phylogenetischen Gesichtspunkten eine systematische Gruppe der „Mehrzeller?
Begründen Sie.
– Nein, denn das hieße, dass sich alle Mehrzeller (Säugetiere, Rosengewächse, Fliegenpilze usw.)
auf eine gemeinsame Stammart zurückführen ließen. Tatsächlich stammen die mehrzelligen
Pflanzen von Grünalgen ab, die mehrzelligen Tiere sind unabhängig von den Pilzen aus heterotrophen Einzellern entstanden.
Tier- und Pflanzengeografie (Seite 359)
0 A1 Erklären Sie die Verteilung der Fossilfundstellen von Cynognathus (Abb. 1) mithilfe der Kontinentalverschiebung (Abb. 2).
– Fossilien von Cynognathus findet man in Zentralafrika sowie in Ostbrasilien. Diese Landesteile
waren ursprünglich miteinander verbunden und gehörten zum Kontinent Gondwana. Hier lebte
Cynognathus. Gondwana zerbrach im Laufe der Kreidezeit und bildete die Kontinente Südame­
rika und Afrika. Die Fossilien von Cynognathus sind deswegen auf beide Kontinente verteilt.
Umgekehrt sind sie ein Indiz für die ehemalige Existenz von Gondwana und die Kontinentaldrift.
$ A2 Nord- und Südamerika waren fast immer getrennte Kontinente, erst vor 2 Millionen Jahren
entstand eine Landbrücke im heutigen Panama. Erklären Sie vor diesem Hintergrund die in
Abb. 3 dargestellten Veränderungen der Säugerfamilien Nord- und Südamerikas.
– Mit dem Kontakt der Kontinente wanderten einige Familien auch in den anderen Kontinent.
Dies erhöhte die dortige Familienanzahl (mittlere Säulen). Damit erschienen für einige Familien
u. a. neue Konkurrenten, die dieselbe ökologische Planstelle besetzten (Stellenäquivalenz).
Diese Situation führte zum Verschwinden einiger konkurrierender Arten, sodass zuletzt wieder
die gleiche Familienanzahl vorkam wie vor dem Kontakt. Manche Neueinwanderer sind wieder
verschwunden, andere haben sich gegen die „alteingesessenen“ Familien behaupten können
(rechte Säulen).
99 Evolution
DO01045455_Loesung_04.indd 99
14.04.2015 14:19:36
Systematik der Lebewesen (Seite 360)
0 A1 Stellen Sie die verschiedenen im Text genannten Systeme einander grafisch gegenüber.
– siehe Tabelle
prokaryotische Einzeller
(kein Zellkern)
Linné
5 Reiche
3 Domänen
eukaryoti­
sche Ein­
zeller und
einfache
Mehrzeller
mehrzellige
Pilze (heterotroph,
unbeweglich)
grün: Pflanzen, farblos: Tiere
Monera (Bakterien)
Archaea
Bacteria
Archaebakterien
Eubakterien
mehrzellige
Pflanzen
(autotroph,
unbeweglich)
Pflanzen
Protista
Pilze
Protista
Pilze
Pflanzen
mehrzellige
Tiere (heterotroph,
beweglich)
Tiere
Tiere
Eukaryota
Pflanzen
Tiere
Übungen: Evolution (Seite 362/363)
$ A1 Tragen Sie die Merkmale der Buntbarsche zusammen, die sie für die Evolutionsforschung
besonders geeignet machen.
– Folgende Eigenschaften machen die Buntbarsche zu geeigneten Studienobjekten der Evolution:
• Sie haben sich vor relativ kurzer Zeit zu solch vielen Arten aufgespalten. Viele Arten sind noch
untereinander im Labor kreuzbar. So kann man (auch auf genetischer Ebene) nach Schlüsselereignissen bei der Artaufspaltung suchen, d. h., was sind die ersten Schritte, die zur Aufspaltung führen.
• Die junge und schnelle Evolution kann auch Zwischenschritte auf dem Weg zur Artauftrennung sichtbar machen.
• Ihre unterschiedlichen Formen, Lebensweisen und Fortpflanzungsstrategien, die häufig unterschiedlich voneinander in den verschiedenen Seen entstanden sind und somit konvergente
Entwicklungen darstellen (Abb. 3).
• Günstig ist auch, dass man Fische relativ gut im Labor halten kann (weniger Aufwand als z. B.
Vögel). Zudem ist die Generationszeit der meisten Arten relativ kurz.
$ A2 Erläutern Sie das in Abb. 1 dargestellte Modell und geben Sie Beispiele für Artentstehungsprozesse.
– Zunächst erfolgte Artbildung durch geografische Trennung der Gründerpopulationen von der
Ausgangspopulation. Bei der Besiedlung des neuen Lebensraumes erwarben dann unterschiedliche Populationen
der Einwanderer zunächst Angepasstheiten an die zur Verfügung stehenden unterschiedlichen
Habitaten. Innerhalb der Habitate spalteten sich im Folgenden die Populationen durch Spezialisierung auf
unterschiedliche Nahrungsquellen und die damit verbundenen unterschiedlichen Angepasstheiten auf.
Weiterhin konnte eine Divergenz durch sexuelle Selektion erfolgen, indem unterschiedliche
Körperfärbungen einhergehend mit divergierender Partnerwahl auftraten.
. A3 Vergleichen Sie die Radiation der Buntbarsche mit der der Darwin-Finken und stellen Sie
Gemeinsamkeiten und Unterschiede heraus (s. Seite 263).
– Beide Radiationen beruhen auf der Besiedlung „leeren“ Lebensraumes, die Buntbarsche in
Ostafrika sind aber wesentlich artenreicher als die Finken der Galapagos Inseln und ihre Artaufspaltung hat vor wesentlich kürzerer Zeit stattgefunden.
$ A4 Erläutern Sie, durch welche Prozesse es unabhängig zu den ähnlichen Formen und Farben
der Fische kommen konnte.
– Die Lebensräume, die in den verschiedenen ostafrikanischen Seen zur Verfügung standen,
waren sich untereinander ähnlich und lieferten ähnliche Lebensbedingungen. Die Anpassungen
an diese Habitate und Lebensbedingungen „formten“ parallel und unabhängig voneinander
ähnliche Phänotypen, wobei die genetische Basis dieser nicht ähnlich sein muss — unterschiedliche genetische Merkmale können zu ähnlichen phänotypischen „Ergebnissen“ führen. Die
Lebensweise der Fische (Räuber, Algenfresser, Uferbewohner, …) prägt einen hier wie dort
idealen Phänotyp durch gleiche oder sehr ähnliche Anforderungen (z. B. Schwimmgeschwindigkeit — Körperform, Tarnungsbedarf — Körperfärbung, etc.).
100 Evolution
DO01045455_Loesung_04.indd 100
14.04.2015 14:19:36
. A5 Entwerfen Sie eine Studie, durch die Sie die Hypothese der unabhängig entstandenen Formengleichheit überprüfen könnten.
– Um zu prüfen, ob die Formengleichheit unabhängig voneinander entstanden ist, könnte man
mittels molekularer Verwandtschaftsanalyse überprüfen, wie nah die Arten gleichen Phänotyps
unterschiedlicher Seen zueinander und zu Arten anderen Phänotyps des jeweils gleichen Sees
sind. Findet man eine nähere Verwandtschaft zu anderen Phänotypen im eigenen See, kann
man davon ausgehen, dass die phänotypische Ähnlichkeit unabhängig voneinander entstanden
ist.
$ A6 Erläutern Sie, inwiefern die Daten der Feldstudie Hinweise auf den Artbildungsmechanismus
geben.
– Die Grafik stellt dar, dass nur der Midas-Buntbarsch sich von Algen ernährt, der Pfeil-Buntbarsch von Zooplankton. Dies deutet auf eine andere Ökologie zwischen den beiden Arten hin.
Die Tatsache, dass die Algen vor allem in Ufernähe auftauchen, das Zooplankton in tieferen
Gewässern, unterstützt diese Annahme. Vermutlich handelt es sich hier um parapatrische Artbildung, bei der sich eine Population auf ein neues Habitat — die tieferen Gewässer — spezialisiert
hat.
. A7 Stellen Sie dar, inwiefern genetische Fingerabdrücke von Individuen der beiden Fische im
Kratersee und des Midas-Buntbarschs in anderen Seen Nicaraguas weitere Hinweise auf die
Artentstehung geben könnten.
– Wenn der Pfeil-Buntbarsch aus Populationen des Midas-Buntbarschs im Kratersee hervorgegangen ist, müssten molekulare Verwandtschaftsanalysen dieser Arten und Midas-Buntbarschen anderer Lokalitäten zeigen, dass die Kratersee-Arten näher miteinander verwandt sind
als die verschiedenen Populationen des Midas-Buntbarschs.
$ A8 Beschreiben Sie die Aussage in Abb. 6 und erläutern Sie, warum dieses Ergebnis für die
weitere Versuchsauswertung dargestellt werden muss.
– Abbildung 6 zeigt, dass die Größe der Jungtiere durch die Ernährungsqualität (gut vs. schlecht)
stark beeinflusst wird. So ist anzunehmen, dass den Elterntieren zwei unterschiedliche Jungtiergruppen (Stichproben) präsentiert werden. Hätte die unterschiedliche Behandlung vor dem
Versuch keinen messbaren Unterschied herbeigeführt, wäre das Versuchsergebnis wenig aussagekräftig gewesen (wobei zu bedenken ist, dass die Fische vielleicht einen Unterschied zwischen
den Jungtieren beider Gruppe wahrgenommen hätten, der den menschlichen Experimentatoren
nicht aufgefallen wäre).
. A9 Erläutern Sie anhand von Abb. 7 und 8 die Ergebnisse des Verhaltensversuchs. Erklären Sie
die Unterschiede in der Brutpflege aus evolutionsbiologischer Sicht.
– Abbildung 7 zeigt, dass Mütter schlecht ernährter Jungtiere wesentlich eine geringere Aggression (in Form von Attacken gegen den Partner) zeigen als Mütter gut genährter Jungtiere. Aus
evolutionsbiologischer Sicht lässt sich dies so deuten, dass jedes Verhalten stets Nutzen und
Kosten mit sich bringt. Im Laufe der Evolution bilden sich Mechanismen heraus, die dieses Verhältnis zugunsten des „Nutzens“ optimieren. Aggressionsverhalten gegen potenzielle Gefahren
für die Jungtiere stellen eine Investition der Mutter dar — im Falle der schlecht genährten
Jungtiere scheint sich das Weibchen gegen diese Investition zu entscheiden: Für diese Jungtiere
„lohnt“ sich der Aufwand nicht, da sie ohnehin weniger konkurrenzfähig sind als gut genährte
Nachkommen, in die man in der Zukunft investieren könnte. Durch eine Verminderung der
Attacken sparen die Mütter Energie, die sie anderweitig, etwa in die Produktion kostspieliger
Eizellen, für konkurrenzfähige künftige Nachkommen investieren können.
Abbildung 7 zeigt, dass die Zeit, die die Elterntiere die Jungtiere bewachen, zunächst bei beiden
Versuchsgruppen gleich ist. Bei der Gruppe schlecht ernährter Jungtiere nimmt die investierte
Zeit durch Männchen oder Weibchen relativ schnell ab, wohingegen sie bei der Gruppe gut ernährter Jungtiere wesentlich langsamer abnimmt. Auch dieses Ergebnis zeigt die Evolution von
Verhaltensanpassungen zur Optimierung des Nutzen-Kosten-Verhältnisses.
$ A10Erläutern Sie die Ergebnisse des Versuchs mithilfe von Abb. 9. Analysieren Sie das Ergebnis in
HInsicht auf Genfluss und Artdivergenz.
– Die Weibchen beider Arten zeigen eine deutliche Signifikanz für das Männchen der eigenen
Art, und zwar in vergleichsweisem Ausmaß. Die P. pundamilla-Weibchen zeigen allerdings nur
geringfügig weniger Präferenz für das Hybridmännchen als das reinerbige Männchen. Dieser
Unterschied ist bei den P. neyererei-Weibchen größer — sie scheinen sich hier stärker zu unterscheiden. Diese Tatsache zeigt, dass zwar eine Divergenz in der Partnerwahl zu erwarten ist, ein
Genfluss aber vermutlich nicht ausgeschlossen ist, sollten sich die Tiere in der freien Wildbahn
begegnen.
101 Evolution
DO01045455_Loesung_04.indd 101
14.04.2015 14:19:37
. A11Beschreiben Sie, welches Ergebnis man nach dem biologischen Artkonzept erwartet hätte
und begründen Sie, warum bei einer ökologischen Trennung der Arten dies nicht relevant
hinsichtlich der Artdivergenz wäre.
– Nach dem biologischen Artkonzept hätte man eine Trennung der Tiere in zwei getrennte
Fortpflanzungsgemeinschaften erwartet. Weibchen hätten nur eine Präferenz für das jeweilig eigene Männchen gezeigt. Bei einer ökologische Trennung, bei der zum Beispiel durch
Nahrungs- oder Aktivitätsspezialisierung Populationen getrennt wurden, ist dies dann nicht
ausschlaggebend für die Divergenz, wenn sich Tiere im natürlichen Habitat durch populationsspezifische Merkmale als „eigen“ und „fremd“ unterscheiden können (dies im Labor aber nicht
nachstellbar ist).
. A12Nennen Sie Faktoren, die den Versuch so beeinflussen könnten, dass das Ergebnis verfälscht
würde. Beschreiben Sie, wie man solchen „Fehlern“ vorbeugen könnte.
– Verschieden Faktoren können die Verhaltensversuche so beeinflussen, dass die Ergebnisse verfälscht werden. Wichtig ist es, den unterschiedlichen Gruppen gleiche Bedingungen zu bieten,
z. B. nicht immer eine Art in einer Aquariumhälfte zu testen. Die Tiere sollten möglichst zufällig
auf die Aquarien verteilt werden, um Effekte z.B. durch Seitenbevorzugung zu vermeiden.
Wichtig ist auch, sicher zu gehen, dass die Präferenz für das Männchenmerkmal „Art“ untersucht wird. Problematisch kann es z. B. sein, immer die drei gleichen Männchen zu verwenden,
sodass die Präferenz der Weibchen sich an den jeweiligen Individuen (z. B. Gesundheitszustand,
Ernährung, Verhalten) und nicht an der Artzugehörigkeit orientieren könnte. Dies kann vermieden werden, indem verschiedene Individuen der Arten jeweils unterschiedlich zusammengesetzt
als Testmännchen dienen.
Wichtig ist bei Verhaltensversuchen auch, nicht voreingenommen an die Beobachtung zu gehen.
So sollte jemand die Beobachtungen machen, der die Fragestellung nicht kennt, um nicht unterbewusst, zur Bestätigung der eigenen Annahme, die Ergebnisse zu verfälschen.
102 Evolution
DO01045455_Loesung_04.indd 102
14.04.2015 14:19:37
Basiskonzepte
Basiskonzept: System (Seite 365)
A1 Erläutern Sie die Bedeutung der verschiedenen Systemebenen, um biologische Zusammenhänge unter dem Aspekt eines besseren Verständnisses an einem Beispiel zu betrachten.
– Biologische Fragestellungen gehen von verschiedenen Systemebenen aus. Um ein Ökosystem
verstehen zu können, benötigt man die Kenntnisse der verschiedenen Organismen. Diese basieren aber auf den Grundlagen spezifischer Vorgänge in den Zellen. Einzelne Systemebenen allein
verdeutlichen nicht die Zusammenhänge.
A2 Beschreiben Sie an einem Beispiel aus der Evolution die Selektion und die unterschiedlichen
Aspekte durch die verschiedenen Systemebenen.
– Die Selektion erfolgt über Organismen, die z. B. von anderen Organismen gefressen werden. Die
Angepasstheit kann durch eine optimierte Tarnung erfolgen. Diese Färbung basiert auf Stoffwechselvorgängen in der Zelle. Diese wiederum werden gesteuert durch die DNA im Zellkern.
Die Selektion wirkt also über den Organismus bis auf die molekulare Ebene.
A3 Erläutern Sie die Bedeutung der Fotosynthese auf den Systemebenen der Moleküle, Zellen,
Organismen, Ökosysteme und der Biosphäre.
– Die Bedeutung der Fotosynthese als Energieumwandlung ist auf molekularer Ebene über die
chemischen Vorgänge bis hin zur ATP-Bildung erklärbar. Auf der Zellebene spielt die Betrachtung von Chloroplasten und deren Anzahl eine große Rolle. Auf der Organismenebene können
die Anordnung, die Größe oder der spezifische Aufbau der Blätter für die Bedeutung genutzt
werden. Im Ökosystem spielen angepasste Pflanzen eine große Rolle für die verschiedenen Trophieebenen. Der Aspekt der Biosphäre ist z. B. der Kohlenstoffdioxidhaushalt in der Atmosphäre.
Basiskonzept: Struktur und Funktion (Seite 367)
A1 Die Stoff- und Energieumwandlung ist durch Strukturen in ihrer Funktion festgelegt. Nennen
Sie auf den verschiedenen Systemebenen Beispiele und erklären sie die jeweilige Bedeutung
der Struktur.
– Die Stoffumwandlung ist gebunden an verschiedene Enzyme und deren Strukturen. Sind diese
spezifischen Proteine nicht vorhanden können Stoffwechselwege nicht funktionieren. Energieumwandlung kann ebenfalls auf verschiedenen Systemebenen betrachtet werden. Die Muskeln
lassen sich auf der Organismusebene z. B. betrachten, da hier chemisch gebundene Energie in
mechanische Energie umgesetzt wird. In den Mitochondrien erfolgt auf der Ebene der Organellen eine Stoffumwandlung. Die Struktur ist hier gekennzeichnet durch Membranen, durch die
ein Protonengradient aufgebaut werden kann. Gleichzeitig spielt auch das Prinzip der Oberflächenvergrößerung eine Rolle.
A2 Stellen Sie Regelvorgänge aus den Bereichen Genetik, Ökologie, Neurobiologie und Evolution
zusammen und erklären Sie deren jeweilige Bedeutung.
– Regelvorgänge im Bereich der Genetik liegen in der Genregulation vor. Hierdurch können Gene
aktiviert werden und Vorgänge im Zellstoffwechsel verändern. Dies führt zu einer Optimierung
des Zellstoffwechsels in Abhängigkeit von anderen Faktoren. Im Bereich der Ökologie wird die
Wasserabgabe bei Pflanzen durch die Stomata reguliert. Dies erfolgt über spezifisch angepasste Zellen. In der Neurobiologie wird z. B. die Aktivität eines Organismus reguliert. Aktivitätsund Ruhephasen haben eine große Bedeutung aus energetischer Sicht. In der Evolution können
die jeweiligen Angepasstheiten als Regulation der Organismen auf Umweltbedingungen auf
lange Sicht betrachtet werden.
A3 Variabilität und Angepasstheit ist ein Kriterium des Basiskonzepts Struktur und Funktion.
Erläutern Sie anhand von Beispielen deren Bedeutung.
– Die Variabilität der Schnabelform bei den Darwinfinken führt durch unterschiedlich aktivierte
Gene zur Ausbildung verschiedener Merkmale. Diese vielen Formen führen zu verschiedenen
Angepasstheiten in verschiedenen Regionen, z. B. durch unterschiedliche Ernährungsmöglichkeiten.
A4 Erklären Sie den Vorteil der Oberflächenvergrößerung an verschiedenen Beispielen und machen Sie daran die Möglichkeit der Regelung von stoffwechselphysiologischen, neuronalen
und genetischen Vorgängen deutlich.
– Das Prinzip der Oberflächenvergrößerung ist sehr oft zu finden, weil hierdurch die Stoffaufnahme
und -abgabe sowie der Energieaustausch optimiert werden kann. Die Auffaltung des Darms bis
zu den Mikrovilli und Alveolen in der Lunge oder die Auffaltung der inneren Membran in den
Mitochondrien sind typische Beispiele. Auf neuronaler Ebene sind die vielen Synapsen und die
Plastizität ein Beispiel für Oberflächenvergrößerungen. Im Bereich der Genetik ist die räumliche
Veränderung der DNA während der Bildung der m-RNA ein typisches Beispiel.
103 Basiskonzepte
DO01045455_Loesung_04.indd 103
14.04.2015 14:19:37
Basiskonzept: Entwicklung (Seite 369)
A1 Stellen Sie tabellarisch Beispiele verschiedener Entwicklungen auf verschiedenen System­
ebenen zusammen. Erläutern Sie, weshalb die Mechanismen der genannten Vorgänge nicht
alle vergleichbar sind.
– Die Entwicklung von der befruchteten Eizelle zu einem Organismus ist auf zellulärer und
Organismus-Ebene, auch die Alterung und der Tod von Zellen sind durch die Teilung der Zellen
und die Spezifizierung zu erklären. Die Sukzession ist ebenfalls eine Entwicklung auf der Ebene
der Organismen und des Ökosystems, bei der ausgehend von einem Ausgangsstadium über
verschiedene Zwischenschritte ein Klimaxstadium erreicht wird. Die Evolution ist ebenfalls eine
Entwicklung, die jedoch über die verschiedenen Evolutionsfaktoren gesteuert wird. Es liegt bei
diesen Entwicklungen von den Mechanismen her keine Gemeinsamkeit vor.
A2 Erläutern Sie den Unterschied zwischen den Veränderungen des Genoms und des Epigenoms.
– Veränderungen des Genoms sind Mutationen, die z. B. durch einer Veränderung des Leserasters
oder der Nucleotidanordnung auf der DNA erfolgen. Veränderungen unter dem epigenetischen
Aspekt sind z. B. unterschiedliche Methylierungen, welche die jeweiligen Genbereiche freigeben
oder blockieren. Hierbei ändert sich jedoch nicht das Genom.
104 Basiskonzepte
DO01045455_Loesung_04.indd 104
14.04.2015 14:19:37