Molekulare und pathologische Diagnostik, gezielte Therapie
Werbung
Molekulare und pathologische Diagnostik, gezielte Therapie, personalisierte Therapie Semmelweis Universitat, II. Institut für Pathologie LABORATORIUM für MOLEKULARE PATHOLOGIE Dr. med. habil András Kiss, Ph.D., D.Sc. 2016 Oktober 28. Makroskopische Pathologie Rokitansky- WIEN 1840 Pathologische Anatomie Lobarpneumonie Histopathologie 1590- Lichtmikroskop (Loewenhook) 1810 Laennec: Leberzirrhose, TBC 1858: Virchow Zellularpathologie XX. Jahrhundert Makroskopie Zytologie Histologie Zytochemie Immunozytochemie Elektronmikroskopie Molekulare Biologie Molekulargenetik XXI. Jh. 2. Dimensionelle Molekularpathologie . . . Query: 266 tgcaactcatcacgcagctcatgcccttcggctgcctcctggactatgtccgggaacaca 325 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2603 tgcagctcatcacgcagctcatgcccttcggctgcctcctggactatgtccgggaacaca 2662 FISH Query: 326 aagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaaagggcatga 385 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2663 aagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaaagggcatga 2722 481bp Exon 18-21 NM_005228.3 2312-2793 N-MYC Molekulare Klassifikation der hematologischen Malignitaten mutation Target therapy AML FLT3, NPM1, CEPBPA (ATRA) CML BCR-ABL Imatinib, dasatinib, nilotinib CLL CD20 Rituximab etc B-NHL CD20 „ Myeloma multiplex FGFR3, MMSET, CCND3, MAF KRAS/NRAS/BRAF „Next Generation Sequencing” „Precision medicine” Myseq: 1000-USD genome GezielteTherapie Wachstumfaktoren, Rezeptoren Gene Angiogenese Tumor pH ABER: Diese Wege sind nicht ausschliesslich ! DEFINITION: • Solche Medikamente, Wirkstoffe, Antikörper, die Signaltransduktionswege, Prozesse, pathophysiologische Tatigkeit zielen. Diese sind in Tumorzellen spezifisch und eigenartig unter oder überproduziert/aktiviert ! Judah Folkman: Angiogenese Der erste Forscher der hat die Bedeutung der Angiogenese in malignen Tumoren in 1971 beschrieben ! Hypoxie Signaltransduktion Angiogenese Genetische Eigenschaften der Nierentumoren • Familiare Nierentumoren: VHL mutiert • Sporadische klarzellige Nierenkarzinomen VHL ist mutiert oder methiliert …….. • ERGEBNISS: VHL inaktivation Endothelzelle RCC Zelle Primer RCC Gefassdensitat des Tumors (CD34+) VEGF ! Bevacizumab (Avastin) Presta et al. Cancer Res. 1997;57:4593. Nexavar (Sorafenib) Multi-kinase inhibitor Raf-1 VEGFR-2 VEGFR-3 PDGFR-B Bürckstümmer et al, FEBS Letter, 580:575-580, 2006 Raf-1 kinase associates with hepatitis C virus NS5A and regulates viral replication Adhesion - EMT MDCK NIH3T3 stark, stabil: E-cadherin basiert Locker, vorübergehend N-cadherin basiert Ca 2+ Wnt E-Cadherin Frz II β-catenin P p120 α-catenin APC Dsh Axin actin filaments Gsk3β P Tcf/Lef Extracellular Space Cadherine: grundsatzliche Regulatoren der Morphologie • Adhesive Funktion : „ molekulares Klebstoff „ AJ’s Typ der Cadherin Stabiliziert die Junktion Adhesion Rho-GTP-ase Passive Hemmung Aktiver Promoter Motilitás CDKI: p27/p21 Wnt Proliferation Cadherine Rezeptor Signaling EGF FGF PDGF Actin Cytoskeleton Transkriptionale/ nukleare Rolle β-catenin/Wnt P120/kaiso in der Nukleus α-catenin Rho-GTPases Arp2/3 16 asymptomatische Patiente: 13 einverstanden in totale Gastrektomie Preoperative Diagnostik: PET scan 13/13 negativ 2 Patiente multiplex Magenbioptaten: in 1 Fokus diffuses / Siegelringzelliges Krz. Gastrektomie: pathologische Aufarbeitung: 12/13 invasci diffuses Sigelringkarzinom 1 Patient war tumorfrei. ErbB Family and Ligands EGF TGF-α Amphiregulin β-cellulin HB-EGF Epiregulin No Known Ligands Heregulins HB-EGF Heregulins β-cellulin Extracellular Tyrosine Kinase Domain Intracellular ErbB-1 HER1 EGFR ErbB-2 HER2 neu ErbB-3 HER3 ErbB-4 HER4 HER Gen Familie HER1 / EGFR(1): Ligande sind bekannt (TGFa, EGF ) + Kinase Aktivitat HER2 / EGFR2: kein Ligand, Kinase Aktivitat HER3 / EGFR3: Ligande: TGFa, EGF etc., keine Kinase Aktivitat HER4 / EGFR4: Ligande sind bekannt + Kinase Aktivitat Merkmale: viele Kooperatione EGFR(1) AKT EGFR2/HER2 Signaltransduktion Anti-HER2 AK Gezielte Therapie Anti VEGF Antikörper : bevazicumab (AVASTIN) VEGF Anti EGFR (ERBB1) Antikörper: Cetuximab (ERBITUX), Panitumumab (VECTIBIX) Anti ERBB2 (HER2) (EGFR-2) Antikörper: trastuzumab (HERCEPTIN) EGFR EGFR kinase Inhibitor : gefitinib (IRESSA) erlotinib (TARCEVA) Aktivierende Ras Mutationen GTP Exchange GTP Hydrolysis p21ras 12&13 59&61 ** *** ** GTP/GDP Binding Switch Region GTP GDP Structures from Sprang S.R., Annu. Rev. Biochem 1997. 66:639-78 * EGFR-RAS paradoxon • wtEGFR--------------wtRAS (EGFR kann amplifiziert sein ) CRC, NSCLC, HNSC • wtEGFR---------mutiertes RAS (EGFR kann amplifiziert sein ) CRC, NSCLC, Pancreaskarzinom • Mutiertes EGFR---------vwtRAS (EGFR kann amplifiziert sein ) NSCLC • Mutiertes EGFR----mutiertes RAS…sehr seltene Konstellation HER2 Tumorgenetik HER2 mutation Brust cc. :DIC EC-delp95 Magencc. Ovarium cc. Endometrium cc. amplification + + + + Brustkrebs Histologische Klassifikation des Brustkarzinoms Invasiv duktales Karzinom IDC (75%) Invasiv D/L Karzinom (7%) Invasiv lobulares Karzinom (8%) Kolloid Karzinom (2.4%) Medullares Karzinom (1.2%) Inflammatorisches Karzinom (1.5%) Tubulares Karzinom (1.5%) Papillares Karzinom (1%) HER2 in Brustkrebs 3+ CB11…Immunhistochemie Amp HER2/CEP17: FISH MOLEKULARE PATHOLOGIE HER-2 – Brustkrebs HER2 Amplifiziert normal Disease-Free Survival Romond H et al. Trastuzumab plus Adjuvant Chemotherapy for Operable HER2-Positive Breast Cancer NEJM 2005; 353:1673-1684 AC TH 87% 85% AC T 75% % 67% N Events AC T 1679 261 AC TH 1672 134 HR=0.48, 2P=3x10-12 Years From Randomization B31/N9831 Zieltherapie in Brustkrebs ER HER2 Therapie Luminal-A - - Chemoth Luminal-B + - Antioestrogen Her2 +/- +++ Anti-HER2 Basal-like - - ? Magenkrebs Carl-McGrath et al: Gastric adenocarcinoma: epidemiology, pathology and pathogenesis (Cancer Therapy Vol 5, 877-894, 2007 ) Intestinaler Typ (Darml) Typ Magen Adenokarzinom Diffus Typ (Siegelringzellkarzinom) PAS 4B5: 3+ SP3: 3+ H.T.: 3+ FISH: Ampl. 4B5: 3+ 4B5: 3+ H.T.: 2+ ! H.T.: 2+ ! FISH: Ampl. SP3:3+ SP3: 3+ Lungenkrebs LUNGenkrebs Histologische Klassifikation des Lungenkrebs Vor 2000 Kleinzelliges Karzinom From 2004 Nicht Kleinzelliges Krz. Genmutationen in Lungenkrebs Lungenkrebs Bronchoskopie: - Bürstenzytologie - Gewebsbiopsie 3 Probe von einem Tumor ist empfohlen !!! Chirurgische Resektion: - op. Resekate PATHOLOGISCHER BEFUND: Es sollte spezifisch sein, die NOS Kategorie sollte nur in begründeten Fallen verwendet sein ! Kleinzelliger (SCLC) ? Nicht-Kleinzelliger (NSCLC) TUMOR HETEROGENITAT ! BIOPTATEn, UNSICHERHEIT DER ZYTOLOGIE, KLEINE GRŐSSE ! SCHLECHT DIFF. TUMOREN in HŐHEREN % in der fortgeschrittenen FALLEN ! Differenzialdiagnose des Lungenkrebs Primary lung cancer Neurogenic marker+ (TTF1+) Neurogenic marker- SCLC/LCNEC NSCLC, NOS adenocarcinoma TTF1+, p63-,CK7+, HMWCKPemetrexed Avastin Neurogenic marker- Poorly differenciated NSCLC squamous P63+, TTF1-, HMWCK+ no no no no Rossi et al. Int J Surg Pathol 3:206,2009 PATHOLOGISCHE DIAGNOSTIK Kleinzelliger (SCLC) ? Nicht-Kleinzelliger (NSCLC) Subtyping of undifferentiated non-small cell carcinomas in bronchial biopsy specimens. Loo PS, Thomas SC, Nicolson MC, Fyfe MN, Kerr KM. J Thorac Oncol. 2010 Apr;5(4):442-7. A reevaluation of the clinical significance of histological subtyping of non--small-cell lung carcinoma: diagnostic algorithms in the era of personalized treatments. Rossi G, Pelosi G, Graziano P, Barbareschi M, Papotti M. Int J Surg Pathol. 2009 Jun;17(3):206-18. Review. PATHOLOGISCHE DIAGNOSTIK PRIMER Lungenkrebs NE Markers + TTF-1 + p63 – HMWCKs (CK 5/6) – CD56 + Neuro-endokr. Markers andere NSCLC, n.o.s. SQC SCLC / LCCNEC ADC TTF-1 + p63 – CK7 + HMWKCKs - schlecht diff. Karzinom vorübergehendes Phenotyp TTF-1 P63 - TTF-1 p63 + CK7 -/+ CK 5/6 + HMWKCKs + S100A7 + A reevaluation of clinical significance of histological subtyping of non-small cell lung carcinoma: diagnostic algorithms in the era of personalized treatments. Rossi G, Pelosi G, Graziano P, Barbareschi M, Papotti M. Int J Surg Pathol. 2009 Jun;17(3):206-18. Review Plattenepithel Krz. Adenokarzinom BAC Adenokarzinom Sequist L V et al. Ann Oncol 2011;22:2616-2624 © The Author 2011. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: [email protected] ALK-mutations in Lunge Adenokarzinom Defekt Folge ALK Mutation/amp/LO H Y1604+ALK ALK EML4-ALK inv(2)(p21p23) ALK+IHC Konst akt ALK EML4-ALK CRC,BRC ALK TGF-ALK 2/3tr ALK+, konst akt ALK KIF5B-ALK 2/10tr ALK+, konst akt ALK-Translokation Diagnostik wtALK Split signal ALK Zieltherpie in LungeAdenokarzinom Target therapy K-RAS mutation TKI resistance EGFR mutation EGFR TK inhibitor (Gefitinib, Tarceva, Afatinib) ALK translocation ALK inhibitor (Crizotinib) Plattenepithelkarzinom 20 FGFR1 4 PI3KCA EGFRvIII FGFR1: Amplifikation PI3KCA: Amplifikation (Mutation 3%) EGFRvIII: ECD del AKT1: Mutation DDR2:Mutation SOX2: Amplifikation 5 5 20 AKT1 33 ismeretlen DDR2 SOX2 Gold et al. Clin Canc Res 18:3002,2012 Kleinzelliges Karzinom MYC CREB 10 16 SLIT2 EPHA7 FGFR1 18 MYCL1: Ampl, N-MYC: Amp. FGFR1: Ampl. SLIT2: , Mutation EPHA7: Mutation CREB: Mutation MLL: Mutation 6 ismeretlen MLL 10 10 Peifer et al. Nature Genetics 2012 doi10.1038 Kolorektales Karzinom Adenoma carcinoma Dickdarmkarzinom (CRC) (Avastin) EGFR Rezeptor und kolorektales Karzinom On the surface of normal cells 40.000-100.000 On the surface of tumor cells 2.000.000 Cetuximab (Erbitux) Panitumumab (Vectibix) EGFR Kolorektales Karzinom Microsatellite Instabile (15%) Stabile (85%) mutation Mlh1/Msh2/MSH6/PMS2 ---------------------- hypermutant „Non-hyper” TGFBR2 APC, p53, SMAD4 B-RAF RAS Driver mutation EGFR Signaltransduktionsweg Molekulare Klassifikation des Kolonkarzinoms K-RAS KRAS BRAF B-RAF PI3KCA PIK3CA PTEN NRAS 34 „wt” 10 8 8 RAS Mutations in kololrektalem Karzinoms in patienten an Semmelweis Universitat Anti- EGFR Resistenz: k-RAS Mutation Klonselektion Misale et al. Nature486:532,2012 Zieltherapie in Kolonkarzinom Target therapy RAS , B-RAF wild type Anti-EGFR ab RAS mutant Target th resistant B-RAF mutant „ MSI-H 5-FU resistance Melanoma EGFR MET KIT GRIN2A MC1R GNAQ GNA11 ADC Ca++ PSD95 nNOS PLA2-AA N-RAS B-RAF PKA PKC MAPK MITF PI3K PTEN AKT mTOR MITF SAPK NFkB NR4A DNArepair Geanderte, wichtige molekulareSignaltransduktionswege in Melanom Larynxkarzinom EGFR Expression in Larynx Plattenepithelkarzinom (CONFIRM) EGFR: 3+, 100% Cetuximab (Erbitux) EGFR: 3+, 30% Positive Kontrolle HPV und Larynxkarzinom in Ungarn Lokalizáció Méhnyak Penis Szájüreg Gége Nyelőcső Cardia Tüdő Szentirmay et al. Canc Met Rev 2005 HPV előfordulási gyakoriság (%) 64.5 52.4 48.5 35.7 33.3 37.0 16.0 HNSC prediktive Pathologie • • • • CPD+5FU indukció======ChRT HPV16:titer= ffi / nemdohányzó / fiatal HPV16 titer: IC resp /CTR resp / 4 year OS Worden et al. JCO 26:3138,2008 • IC /ChRT szervmegtartás és túlélés • Alacsony EGFR, HPV+/magas p16: RRjó, OS magas • Magas EGFR, alacsonyp53/magas BCLxL, nő, dohányzó: kedvezőtlen terápiás válasz, alacsony túlélés….. • Kumar et al. JCO26.3128,2008 Molekulare Klassifikation des Melanoms Histological classification Molecular classification Pathway(s) SSM NM LMM AM dpm nem bnm cgnm MuM UM RGP BRAF (>50%) NRAS (<20%) VGP N-RAS (>30%) BRAF (<50%) KIT(20%) MITF (20%) KIT GRIN2A (30%) PTEN (30%) PI3K AKT CDKN2A (50%) CDK4 p53 (20%) KIT GNAQ GNA11 Growth factor receptor Growth factor receptor Growth factor receptor Growth factor receptor Ca++ Growth factor receptor cyclins apoptosis DNA repair Growth factor receptor MC1R Genomische Landkarte des primeres Melanoms (Haut) mutations BRAF NRAS (HRAS, KRAS) KIT NF1 PREX2 CDKN2A CDK4 TP53 PTEN selected rare events (<10%) ALK ARID2 STK19 IDH1 RAC1 MAPK2K1 RB1 GRIN2A/NMDAR2 EGFR4 VEGFC NOTCH2NL ADAMTS18 WT1 CTNNB1 RB1 PPP6 amp MITF BRAF NRAS KIT TERT CCND1 CDK4 MET LOH PTEN rearrangements FHIT PTEN ETV1 MACROD1 CSMD1 MAGI2 A2BP1 PREX2 TERT ALK Zieltherapie in Melanom defect therapy B-RAF mutation mBRAF inhibitors N-RAS mutation MEK inhibitor KIT mutation Gleevec Histologische Klassifikation des Schilddrüsekarzinoms Papillares Follikular Anaplastisches Medullares * * * * Pax8/tf GDNF= glial derived neurotrophic factor NRTN= neurturin PSPN= persephin ARTN= artemin Molekulare Klassifikation der Schilddürsetumoren pathway Gene defect histology % Membrane receptor RET-TK mutation medullary 50 RET-TKfusion gene papillary 15 NRAS mutationc61 follicular 40 NRAS papillary mutation-c61 15 B-RAF mutation papillary 45 PAX8/PPARγ fusion follicular 30 OXPHOS Hürthle cell 80 MAPK signaling mitochondrium Zieltherapie der Schilddrüsetumoren Vandetanib (RET inhibitor) Medullares Krz. RET-TK Mutation, RET-PTC Fusion (Papillares Krz. ) Vemurafenib (mB-RAF Inhibitor) Papillares Karzinoms Gastrointestinal Stromales Tumor (GIST) Gleevec CD117/KIT C-KIT mutations in GIST Exon 11 (juxtamembranous): EC domain deletion EC TK-Domain Zytoplasmisch KIT-IHC Cod557,558: schlechte Prognose !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! •Exon 9, 13,17 Mutation ist selten (9-EC, 13,17 TK) •Ex 17-mut: GLEEVEC RES •Klassische Morphologie::::::::::::::::::::::::::::::::: KEINE GEN-AMPLIFIKATION (kein FISH) Tabone et al BBA 1741:165,2005 PDGF Rezeptor Mutations in GIST Exon 12 (deletion or missense) EC domain del Exon 18 (del or missense) GLEEVEC-RES Exon 14 point mutation EC domain Kein parallel c-kit Mutation Morphologie : pleiomorphe, riesenzellig Lokalisation: Magen (ex14/cod2125) epitheloid PDGFR: zytoplasmatisch (dot) Lasota et al. Lab Invest 86:94,2006 Martin et al. JCO 23:6190,2005 Zeiltherapie in GIST KIT mutant: KIT-TKI Inhibitors: Imatinib PDGFR Mutation: PDGFR-TKI Inhibitors: Sutent Die Wirkung der Fixierzeit an die histologischen Strukture 1 nap 3 nap 10 nap Die Bedeutung der Fixierung–Helico FISH überfixiert richtig fixiert Die Bedeutung der Vorbehandlung – Mikrowelle Behandlung (HER2 FISH) „ Gjedrum és mtsai: J. Mol. Diagnostics, 6:42-51, 2004 „ Real-time quantitative PCR of Microdissected Paraffin-Embedded Breast Carcinoma „ Die Bedeutung der Vorbehandlung – enzimatische Behandlung (HER2 FISH) unterverdaut überverdaut Die Wirkung der Fixierzeit an die Qualitat des isolierten DNS 3 nap 1 nap 10 nap Die Wirkung der Fixierzeit an die Qualitat des isolierten RNS 3 nap 1 nap 10 nap MILESTONE TissueSAFE High Vacuum Biospecimens Transfer System ™ Niere bei Ankommen (0. Tag) Niere 6. Tag Niere 3. Tag Niere 10. Tag Niere, 0. Tag, Niere, 3. Tag, HE, 400x HE, 400x VACUUM FOLIE, PARAFFIN Einbettung Niere Niere, 6. Tag, Niere, 10. Tag, HE, 400x HE, 400x Niere, 0. Tag, Niere, 3. Tag, HE, 400x HE, 400x VACUUM FOLIE, PARAFFIN Einbettung Niere Niere, 6. Tag, Niere, 10. Tag, HE, 400x HE, 400x Niere, 0. Tag, Niere, 3. Tag, HE, 400x HE, 400x VACUUM FOLIE, PARAFFIN Einbettung Niere Niere, 6. Tag, Niere, 10. Tag, HE, 400x HE, 400x