GENETIK

Werbung
13
Anfang des Kapitels
Was sind Gene und was kann uns eine
Genanalyse sagen?
GENETIK
Was sind Gene?
GENETIK
Was sind Gene?
Zellen
(50 bil)
Menschlicher
Körper
Chromosom
DNA
Doppelhelix
Pigment-Gen
Blaue Augen
13
Ende des Kapitels
Was sind Gene?
14
Anfang des Kapitels
Was kann uns eine Genanalyse sagen?
GENETIK
Was sagt uns eine Genanalyse?
GENETIK
Was sind Gene?
Fehler oder MUTATIONEN ändern den genetischen Code
Gerinnungs-Gen
(Faktor V)
Enzym-Gen
(Laktase)
Knochenaufbau-Gen
(Col1A1)
TTGCTAGACTGTGCTAGACTTTGCTAAACTTTGCTAGACTTTGCTAGACTATGCTAGACT
AACGATCTGACACGATCTGAAACGATTTGAAACGATCTGAAACGATCTGATACGATCTGA
Hemmt
Blutgerinnselbildung
Verdauung von Laktose
Starke Knochen
Thrombose
Laktose Intoleranz
Osteoporose
Jeder trägt etwa 2.000 Gendefekte in sich
GENETIK
Wie entstehen Mutationen?
Radioaktivität
UV-Strahlung
Ruß/Rauch
Kopierfehler
ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT
Ca. 3 pro
Generation
GENETIK
Auswirkungen von Mutationen
Gerinnungs-Gen
(Faktor V)
Laktose-Enzym-Gen
(Laktase)
Nierengewebe-Gen
(COL4A5)
Fettaufnahme-Gen
(FABP2)
Eisenaufnahme-Gen
(HFE)
ATTCGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCTCGATCTTCGGGAAAATATTGTTTT
Verhindert
Blutgerinnselbildung in den
Gefäßen
Spaltet
Laktose im
Darm
Baut starkes
Nierengewebe
auf
Reguliert die
Fettaufnahme
aus der
Nahrung
Reguliert die
Eisenaufnahme
aus der
Nahrung
GENETIK
Auswirkungen von Mutationen
Nierengewebe-Gen
(COL4A5)
ATTCGGTTGTTGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGG
G
Baut starkes Nierengewebe auf
GENETIK
Auswirkungen von Mutationen
Nierengewebe-Gen
(COL4A5)
G
ATTCGGTTGTTGCGGCTTATTAGGCCGGGGCTTAATATCGCTTATGAAACCATCGG
Baut starkes Nierengewebe auf
Nierenversagen
???
Genanalyse (€1500)
Diagnose (ALPORT SYNDROM) 1 von 50.000
GENETIK
Auswirkungen von Mutationen
Seltene
Krankheiten
Häufige Krankheiten
Leistungssport
Talente
Medikamente
Körpergewicht
Ernährung
GENETIK
Was sind Polymorphismen?
ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT
Etwa alle 1.000 Basen ein Unterscheid
ATTAGGGTGGTACCATTGCCGGGGGCTTAATATCGCTTATGAAACGATCGGTCTCGGGAATTCTCGGATATTTGGTTCTTCGGCGCGATTCGGATAATATCATCTTCGGGAAAATATTGGTTT
Etwa alle 100 Basen ein Unterscheid
ATTAGGGTGGTACCATTGCCGGGGGCTTAATATCGCTTATGAAACGATCGGTCTCGGGAATTCTCGGATATTTGGTTCTTCGGCGCGATTCGGATAATATCATCTTCGGGAAAATATTGGTTT
GENETIK
Was sind Polymorphismen?
ATTAGGGTGGTACCGTTGCCGGGGGCTTAATATCGCTTATGAAACCATCGGTCTCGGGAATTCTCGGATATTAGGTTCTTCGGCGCGCTTCGGATAATATCATCTTCGGGAAAATATTGTTTT
ATTAGGGTGGTACCATTGCCGGGGGCTTAATATCGCTTATGAAACGATCGGTCTCGGGAATTCTCGGATATTTGGTTCTTCGGCGCGATTCGGATAATATCATCTTCGGGAAAATATTGGTTT
Single Nucleotide Polymorphismen (SNPs / „SNIPS“)
Sehr häufig
ca. 10 Mio bekannt
Großteil ohne Auswirkung
ca. 2.000 pro Person, die die Gesundheit negativ beeinflussen
Ein häufiges Beispiel
GENETIK
Laktose-(in)Toleranz
GLU
GLU
Laktase-Gen
GENETIK
Laktose-(in)Toleranz
GLU
GLU
Alter++
Laktase-Gen
GENETIK
Laktose-(in)Toleranz
Laktose-Enzym
1 von 6 Europäer: Laktase-Enzym
wird allmählich abgeschalten
Leichte Symptome
Mittlere Symptome
Laktose Intoleranz
Schwere Symptome
10
20
30
40
50
Alter (Jahre)
60
70
GENETIK
Laktose-(in)Toleranz
GLU
GLU
SNP
Alter++
Laktase-Gen
GENETIK
Laktose-(in)Toleranz
5 von 6 Europäer: Laktose-Enzym wird konstant produziert
Laktose-Enzym
1 von 6 Europäer: Laktose-Enzym
wird allmählich abgeschalten
Leichte Symptome
Mittlere Symptome
Laktose Intoleranz
Schwere Symptome
10
20
30
40
50
Alter (Jahre)
60
70
GENETIK
Laktose-(in)Toleranz
GENETIK
Laktose-(in)Toleranz
GENETIK
Laktose-(in)Toleranz
GENETIK
Eisenspeicherkrankheit und Prävention
Zu 76%
Fehldiagnostiziert!!
Üblicher Ablauf
Gentest
Eisen im Blut
Aderlass-Therapie
Zhirrose, Diabetes etc.
bestehen
10
20
30
40
50
Alter (Jahre)
60
70
GENETIK
Eisenspeicherkrankheit und Prävention
Üblicher Ablauf
Gentest
Eisen im Blut
Aderlass-Therapie
10
Gesund
4-6x Jährlich Blutspenden
Gentest
20
30
40
50
Alter (Jahre)
60
70
GENETIK
Auswirkungen von Mutationen
Seltene
Krankheiten
Häufige Krankheiten
Leistungssport
Talente
Medikamente
Körpergewicht
Ernährung
GENETIK
Pharmakogenetik – Medikamente und
Nebenwirkungen
Medikamente wirken nur bei 60% der Population wie gewünscht
>>>
Nebenwirkungen (Tödlich)
>>>
Keine Wirkung
Einer von 12 Klinikpatienten erleiden schwere Nebenwirkungen
Einer von 250 Klinikpatienten stirbt daran
Die fünft häufigste Todesursache der westlichen Welt
Mehr als 100.000 Tote pro Jahr (USA)
Gene steuern den Abbau von Medikamenten
CYP 2D6, CYP 2C9, CYP 2C19
GENETIK
Pharmakogenetik
Medikament
zeigt seine
Wirkung
Medikament wird
eingenommen
Enzym-Gen
Medikament wird von
Enzym zum Abbau vorbereitet
Medikament landet im Urin
GENETIK
Pharmakogenetik
Ein Medikament wird ins Blut aufgenommen und wieder herausgefiltert.
Medikament im Blut
Für dauerhafte Wirkung wird es täglich eingenommen
Einnahme
Wirkungsbereich des Medikaments
1d
2d
3d
Zeit (Tage)
4d
GENETIK
Pharmakogenetik
Medikament
zeigt seine
Wirkung
Medikament wird
eingenommen
Enzym-Gen
Medikament wird nicht
abgebaut
Beispiel Warfarin
Medikament wird nicht aus
dem Körper gefiltert
GENETIK
Pharmakogenetik
Medikament im Blut
NEBENWIRKUNGEN
Einnahme
Wirkungsbereich des Medikaments
1d
2d
3d
Zeit (Tage)
4d
GENETIK
Auswirkungen von Mutationen
Seltene
Krankheiten
Häufige Krankheiten
Leistungssport
Talente
Medikamente
Körpergewicht
Ernährung
GENETIK
Genetik von Übergewicht
FETT
FETT
Fettaufnahme-Gen
GENETIK
Genetik von Übergewicht
FETT
FETT
FETT
FETT
FETT
FETT
Fettaufnahme-Gen
GENETIK
Genetik von Übergewicht
LOW FAT
AM EFFEKTIVSTEN
?
LOW CARB
BALANCED,
WENIG
KOHLENHYDRATE
BALANCED,
WENIG FETT
BALANCED
GENETIK
Auswirkungen von Mutationen
Seltene
Krankheiten
Häufige Krankheiten
Leistungssport
Talente
Medikamente
Körpergewicht
Ernährung
GENETIK
Ernährungsgenetik
Rotes Fleisch
Weizen
Milchprodukte
Laktose intolerant
Gluten intolerant
Eisenspeicherkrankheit
Für Jeden treffen andere Ernährungsempfehlungen zu!
GENETIK
Auswirkungen von Mutationen
Seltene
Krankheiten
Häufige Krankheiten
Leistungssport
Talente
Medikamente
Körpergewicht
Ernährung
GENETIK
Gene und Leistungssport
AUS
AUS
AUS
KRA
KRA
KRA
Kraft-Gene
14%
3%
Kontrollgruppe
Athleten (WM/Olympia)
5x schlechtere Chance in
die WM-Liga zu kommen
GENETIK
Die verschiedenen Analysekategorien
SPEZIALFÄLLE
Seltene
Krankheiten
Medikamente
Häufige Krankheiten
MEDIZINISCHE
ANALYSEN
Leistungssport
Talente
LIFESTYLE
ANALYSEN
Körpergewicht
Ernährung
14
Ende des Kapitels
Was kann uns eine Genanalyse sagen?
Herunterladen
Random flashcards
Erstellen Lernkarten