Q1/2Bio5

Werbung
Von: Claudio & Christoph
Q1/2Bio5
Genetischer
Fingerabdruck
Von: Claudio & Christoph
Q1/2Bio5
Gliederung
• Einführung
• Methode
–Ansatz/Prinzip
–Durchführung
• Einsatzmöglichkeiten
• Sicherheit/Fehler
• Fazit
• Quellen
Von: Claudio & Christoph
Q1/2Bio5
Einführung
Unter dem genetischen Fingerabdruck versteht man ein DNA-Profil eines Individuums, das für
dieses in hohem Maße charakteristisch ist. Die DNA wird aus Zellen gewonnen, die wiederum im
Sperma, Hautzellen oder Speichel des Individuums vorhanden sind. Daher ist die DNA eines wenn
nicht sogar das wichtigste Molekül im menschlichen Körper. Die Informationen auf der DNA
bestehen aus 4 „Bausteinen“; Adenin, Cytosin, Guanin und Thymin1. Beim genetischen
Fingerabdruck wird auf einem bestimmten Abschnitt, der DNA, analysiert, wie oft sich die Basen
wiederholen. Diese Kombination aus Basen ist bei jedem Individuum einzigartig und damit
eindeutig identifizierbar. Da die Informationen/Merkmale vererbbar sind, kann man mit dem
genetischen Fingerabdruck Aussagen über den Verwandtschaftsgrad zwischen Personen machen.
Aber man kann mit ihm nicht Aussagen über Merkmale, wie z.B. Aussehen oder Gesundheit einer
Person, machen.
(Quelle: http://www.biologie-schule.de/img/dna.gif)
1. organische Basen, die folgendermaßen verbunden werden können: A-T, T-A, G-C, C-G
Von: Claudio & Christoph
Q1/2Bio5
Ansatz/Prinzip
Um nun den genetischen Fingerabdruck einer Person zu bestimmen, betrachtet man zwei Allele 2,
die als Allel1 und Allel2 bezeichnet werden, eines DNA-Abschnitts (Genom 3) genauer an. Dabei
schaut man sich kurze Wiederholungssequenzen(STR4), die aus vier Nukleotidpaaren bestehen, an.
Untersucht man jetzt z.B den Genom mit der wissenschaftlichen Bezeichnung "TPOX" könnte man
z.B. folgende Zusammensetzung finden.
Allel1: AATGAATGAATGAATGAATGAATG
6 Wiederholungen
Allel2: AATGAATGAATGAATGAATGAATGAATG
7 Wiederholungen
Die Ergebnisse kann man dann folgendermaßen festhalten:
Locus
TPOX
Allel1
Allel2
6
7
Die Wahrscheinlichkeit das zwei Personen auf dem gleichen Abschnitt die gleiche Anzahl an sich
wiederholenden Sequenzen ist sehr gering und führt daher zum eindeutigen bestimmen einer
Person.
2. alternative Form einer Gensequenz an der entsprechenden Stelle des Schwesterchromosoms. Jeder Mensch erbt
jeweils ein Allel von Mutter und Vater
3. die Position eines Gens auf einem Chromosom
4. short tandem repeats
Von: Claudio & Christoph
Q1/2Bio5
Durchführung
Die am häufigsten verwendete Methode um genetisches Material einer Person zu analysieren, ist die
PCR-Methode5. Man benutzt diese um bestimmte Gen-Sequenzen in einem DNA-Abschnitt zu
vervielfältigen. Dieses Verfahren besteht aus einer Anzahlt von ca. 20-50 Zyklen, die in einem
Thermocycler6 durchgeführt werden.
1.Denaturierung
– die Doppelstränge, der DNA werden auf 94-96°C erhitzt, um diese zu trennen
– die Wasserstoffbrückenbindungen zwischen den Strängen der DNA werden
aufgebrochen
– das Erhitzen kann oft einen längeren Zeitraum in Anspruch nehmen, da man sichergeht,
dass sich die Ausgangs-DNA und die Primer7 vollständig gelöst haben
– danach wird auf 65°C abgekühlt, um eine Rückbildung zu verhindern
2.Primerhybridisierung
– die Temperatur wird ca. 30 Sekunden gehalten, was eine spezifische Anlagerung der
Primer erlaubt
– die Temperatur wird durch die Länge und die Sequenz der Primer bestimmt
– wird die Temperatur falsch gewählt, kommt es zu keiner ineffizienten Produkten
3.Elongation
– die DNA-Polymerase füllt die fehlenden Stränge mit freien Nukleotiden auf
– sie beginnt am 3'-Ende des angelagerten Primers und folgt dann dem DNA-Strang
– dieser Schritt dauert etwa 30 Sekunden je 500 Basenpaare
– Thermocycler kühlen die Reaktionsansätze nach Vollendung aller Zyklen auf 4–8°C ab
5. Polymerase-Kettenreaktion
6. Ein Gerät, das in der Lage ist, die Temperaturzyklen einer Polymerase-Kettenreaktion selbständig durchzuführen
7. ein Oligonukleotid bezeichnet, das als Startpunkt für DNA-replizierende Enzyme wie die DNA-Polymerase dient
Von: Claudio & Christoph
Q1/2Bio5
Die Sequenzen des Produktes der Polymerase-Kettenreaktion werden mit der AgaroseGelelektrophorese8 der Größe nach geordnet, um sie dann anschließend mit anderen Produkten zu
vergleichen. Ein so genantes Bandenmuster (genetischer Fingerabdruck) entsteht
(Quelle: http://upload.wikimedia.org/wikipedia/commons/4/4a/Polymerasekettenreaktion.svg )
(Quelle: http://commons.wikimedia.org/wiki/File:Pcr_machine.jpg )
(Quellehttp://edoc.hu-berlin.de/dissertationen/wolf-reinhard-2003-06-12/HTML/Wolf_html_72dfeeff.jpg :
8 Ein Verfahren, bei der DNA in Agarose-Gel eingebracht wird und anschließend eine Spannung angelegt wird
Von: Claudio & Christoph
Q1/2Bio5
Einsatzmöglichkeiten
•
Vaterschaftstest und Verwandtschaftsanalyse:
Die genetischen Fingerabdrücke der entsprechenden Personen werden miteinander
verglichen. Je ähnlicher das Muster, desto enger die Verwandtschaft.
•
Kriminaltechnik:
Genetische Fingerabdruck ist ein wichtiges Mittel zum Täternachweis. Genetische Spuren,
die am Tatort gefunden werden, können benutzt werden um den Täter zu identifizieren. Des
Weiteren können Leichen/Brandleichen identifiziert werden.
•
Botanik:
Die Eigenschaften des genetischen Fingerabdrucks können natürlich auch auf botanische
Objekte, wie Pflanzen, angewendet werden.
•
Medizin:
Auch in der Medizin findet der genetische Fingerabdruck seine Verwendung, wie z.B. zur
Genomkatierung, bei der Krebsbehandlung oder in der Transplantationsmedizin
Von: Claudio & Christoph
Q1/2Bio5
Sicherheit/Fehler
Die Fehlerquote betrug bei von 1998 bis 2002 durchgeführten Versuchen ca. 0,5%, aber die meisten
Fehler wurden beim Vertauschen von Proben und bei der Vermittlung von Ergebnissen verursacht
und nicht beim genetischen Fingerabdruck.
Fazit
Der genetische Fingerabdruck beruht auf der Analyse spezifischer Abschnitte eines Genoms, die
durch das mehrfache wiederholen bestimmter Sequenzen charakteristisch ist. Diese Muster ist für
jedes Individuum einzigartig und dadurch lässt sich zuverlässig ein genetischer Fingerabdruck einer
Person zuordnen. Des Weiteren ist der genetische Fingerabdruck ein wichtiges Mittel in vielen
Gebieten, wie in der Kriminaltechnik oder bei Vaterschaftstest.
Von: Claudio & Christoph
Q1/2Bio5
Quellen
• http://www.lerntippsammlung.de/GenetischesFingerabdruckverfahren.html
• http://www.meine-molekuele.de/der-genetischefingerabdruck/
• http://de.wikipedia.org/wiki/Genetischer_Fingerabdruc
k
• http://www.genetischer-fingerabdruck.de/index.htm
• http://www.genetischerfingerabdruck.de/layout/popup_frames.htm?
Title=Glossar&Pic=glossar&Width=470&Url=/dna/glo
ssar.php4&Aname=Allele&g_sLang=genfing
• http://flexikon.doccheck.com/de/Genetischer_Fingerab
druck
• http://flexikon.doccheck.com/de/PCR
• http://de.wikipedia.org/wiki/Desoxyribonukleins
%C3%A4ure
• http://de.wikipedia.org/wiki/PolymeraseKettenreaktion
Herunterladen
Random flashcards
Erstellen Lernkarten