Einführung
in die schulmedizinische
Tumortherapie
der menschliche Körper besteht
aus 100 Billionen Zellen
• eine 1 mit 14 Nullen 100.000.000.000.000
• beim einem erwachsenem Menschen
werden in jeder Sekunde etwa 50
Millionen Zellen abgebaut
• und es bilden sich fast ebenso viele Zellen
neu
• aber eben nur fast!
• der erwachsene Mensch baut nach und
nach ab!
der menschliche Körper besteht
aus 100 Billionen Zellen
• unser Gehirn besitzt 20 Milliarden
Nervenzellen
• täglich verlieren wir 100.000 Nervenzellen,
• dies entspricht ungefähr der Größe eines
Fliegenhirns
der menschliche Körper besteht
aus 100 Billionen Zellen
• die Zellen unserer Lippen werden 2
Wochen alt
• die Leberzellen 8 Monate
• die Knochenzellen bis 30 Jahre alt
Alle Zellen entstehen durch
Zellteilung
• pro Menschenleben sind das 1016
Zellteilungen
• eine 1 mit 16 Nullen (10.000.000.000.000.000)
• eine Zellteilung dauert ungefähr 24
Stunden
• bei jeder Zellteilung wird die
Erbinformation identisch an beide
Tochterzellen weitergegeben
Alle Zellen entstehen durch
Zellteilung
• alle Zellen eines Organismus gehen auf
eine befruchtete Eizelle zurück, also
enthalten alle Zellen die gleiche
genetische Information
jeder Mensch besitzt etwa 28.000
Gene
• Gene machen uns zu dem was wir sind
• Gene bestimmen mit, welche Augen- oder
Haarfarbe wir besitzen
• ob wir ein großes oder geringes Risiko
haben, an Krankheiten, wie z.B. Krebs zu
erkranken
• jedes Gen steuert eine definierte Funktion
einer Zelle bzw. eines Gewebes
jeder Mensch besitzt etwa 28.000
Gene
• die Gene liegen gut geschützt im Zellkern
auf den Chromosomen
• jedes Chromosom besteht aus einzelnen
DNA Fäden
• DNA ist die chemische Substanz der Gene
• besteht aus einer Strickleiter, der
Doppelhelix
jeder Mensch besitzt etwa 28.000
Gene
• die Sprossen der
Strickleiter bestehen aus
den Kernbasen:
•
•
•
•
Adenin
Cytosin
Thymin
Guanin
• das Alphabet der Gene
jeder Mensch besitzt etwa 28.000
Gene
• das Gen-Alphabet übersetzt die
genetische Information in eine Anleitung
für den Bau von Proteinen
• das Hämoglobin- Gen zum Beispiel
beginnt mit
CCCTGTGGAGCCACACCCTAG ……….
• und ist insgesamt 43.000 Bausteine lang
jeder Mensch besitzt etwa 28.000
Gene
• seit dem Jahre 2003 wissen die
Genforscher, das 3,2 Milliarden solcher
Bausteine auf dem DNA-Faden des
Menschen Platz haben
• nicht alle Abschnitte der DNA enthalten
Informationen
• in einem recht großen Anteil scheinen
tatsächlich keinerlei Informationen zu sein
• Junk - DNA , also Abfall - DNA
Vom Gen zum Protein
• Grundbaustein der Proteine ist ein Satz
von 20 Aminosäuren
• Proteine machen erst das Wesen der
Zelle aus als
• Enzyme
• Hormone
• Immunoglobuline
Vom Gen zum Protein
• sie transportieren im Körper bestimmte
chemische Verbindungen z.B. Eisen
(Transferrin)
• der komplette Energiehaushalt wird von
Proteinen organisiert
• Zellen bestehen neben Wasser zum
größten Teil aus Proteinen
Vom Gen zum Protein
• Der Schritt vom Gen zum Protein ist
aufgeteilt in
• Transkription:
geschieht im Zellkern, das Enzym RNAPolymerase kopiert die DNA Information
in RNA
• es entsteht die so genannte mRNA
Thymin wird durch Uracil ersetzt
Vom Gen zum Protein
• das Überschreiben von DNA auf RNA
ist vergleichbar mit einer
Sicherheitsmaßnahme der Natur:
• die Orginalversion verlässt den
schützenden Zellkern nicht
• zum Protein übersetzt wird lediglich eine
Kopie
• dies geschieht außerhalb des Zellkerns in
den Ribosomen
Vom Gen zum Protein
• dieser zweite Schritt bei der Entstehung eines
Proteins heißt :
Translation
• jeweils drei Bausteine auf dem mRNA Faden
werden in bestimmte Aminosäuren
umgewandelt
• aus CUU wird z. B. Leucin
• aus AGA wird Arginin
• die einzelnen Aminosäuren reihen sich
aneinander und aus der entstehenden Kette
faltet sich das dreidimensionale Protein
Vom Gen zum Protein
Der Zellzyklus
• den Zellzyklus kann man in zwei Phasen
einteilen
• Mitose, gleich Zellkernteilung, und der
• Interphase: Zeitraum zwischen den
Kernteilungen, sie ist die längste Phase
des Zellzyklus
• kann bei teilungsaktiven Zellen bis zu
90 % des gesamte Zellzyklus ausmachen
Der Zellzyklus
Der Zellzyklus
• Zellen, die sich im Zellzyklus befinden
bei denen sich Zellwachstum und
Zellteilung fortwährend abwechseln
werden als proliferierend bezeichnet
• die Anzahl der Zellteilungen pro Zeiteinheit
ist die Teilungsrate
• diese ist für jeden Zelltyp spezifisch
Regulation des Zellzyklus
• äußere Faktoren sind unter anderem das
Nährstoffangebot
• die Anzahl der Nachbarzellen
• Wachstumsfaktoren: Proteine, die als
Signal von einer Zelle auf die nächste
übertragen werden
• Z. B. Fibroblast growth factor ( FGF )
Schlüsselrolle bei der Differenzierung der
Zellen
Regulation des Zellzyklus
• innere Faktoren und Kontrollpunkte:
so genannte Tumorsuppressorgene
überwachen die korrekte Abfolge der
Basenpaare nach jeder Reduplikation
• entscheiden über die Notwendigkeit von
Reparaturvorgängen, halten den Zellzyklus an,
bis Reparaturen ausgeführt sind,
• und veranlassen gegebenenfalls den
programmierten Zelltod = Apoptose
Die Apoptose
• die Apoptose, also der Selbstmord
einzelner Zellen, kann auch von außen
angeregt werden, z. B. von Immunzellen
• während der Apoptose schrumpft die
Zelle, die DNA wird von bestimmten
Enzymen, den Endonukleasen abgebaut,
• die Apoptose gewährleistet, das die
betreffende Zelle ohne Schädigung
von Nachbarzellen zugrunde geht
Die Apoptose
•
•
•
•
•
Apoptose ist unerlässlich:
zur Kontrolle der Zellzahl und der Größe von
Geweben
bei der Verjüngung von Geweben z. B.
Riechepthel der Nase
bei Selektion und Abbau unnötiger Zellen des
Immunsystems
zur Eliminierung entarteter Zellen
zur Selektion von Keimzellen, 95% der Eizellen
werden über Apoptose abgetötet
Die Apoptose
• ein Ziel der Krebsforschung ist es, kontrollierte
Apoptose bei Tumorzellen auszulösen
dummerweise nutzen auch Krebszellen den
Apoptosemechanismus um Abwehrzellen, so genannte
Tumorinfiltrierende Lymphozyten
auszuschalten
an der Oberfläche verschiedener Tumorzelllinien ein
Apoptose- auslösendes Protein, den CD95- Liganden
(Fas Ligand )
• diesen Mechanismus bezeichnet man als
Tumor counterattack
Wie entsteht Krebs
Wie entsteht Krebs
• die Zellteilung, und deren korrekter
Ablauf wird von über 5000 Genen überwacht,
• diese Gene nennt man treffenderweise auch
Wächtergene
• = Tumorsuppressorgene , z. B.
• p53, p16, p27
• eine Krebszelle entsteht, wenn in mindestens
einem der Wächtergene ein Defekt vorliegt
Wie entsteht Krebs
• dieser kann spontan auftreten, durch
äußere Einflüsse wie z. B.
• Strahlung
• oder wird in vielen Fällen auch von den
Eltern geerbt
Wie entsteht Krebs
• da es unglaublich viele Wächtergene gibt, die
alle verschiedene Aufgaben haben, also für
unterschiedliche Bereiche zuständig sind
• und weil die DNA ein sehr, sehr langes Band ist,
führt der Defekt eines Wächtergenes nicht
zwangsläufig
• vor allem auch nicht sofort zu krankhaften
Veränderungen
Wie entsteht Krebs
• damit die mutierte Zelle nicht erkannt wird,
muss der Aufgabenbereich des defekten
Wächtergens und
• der Fehler, der bei der Kopie entsteht, exakt
übereinander liegen
• ansonsten würde der Fehler von einem anderen
Gen erkannt ,und somit repariert, oder die Zelle
würde eliminiert
Wie entsteht Krebs
• Aufgrund der millionenfachen
Zellteilungen die täglich in unserem Körper
stattfinden, wird der genetische Defekt mit
fortschreitender Zeit immer
wahrscheinlicher
• bis schließlich die eine fehlerhafte Zelle
entsteht, die
• nicht repariert wird, und auch nicht dem
programmierten Zelltod zugeführt wird,
Wie entsteht Krebs
• diese eine fehlerhafte Zelle mit der
Fähigkeit sich zu teilen, wird mit hoher
Wahrscheinlichkeit
• Tochterzellen produzieren, die noch mehr
• Mutationen aufweisen
• die Ent-artung der Zellen steigt mit jeder
neuen Teilung, und immer
• gefährlichere Tumorzellen entstehen
Tumorstoffwechsel
• neben der Eigenschaft sich nun unkontrolliert zu
vermehren ,entstehen völlig andere
Stoffwechsel- Eigenschaften :
• die Abgabe von immunsuppressiven
Substanzen
• Expression des Pyruvatkinase-Isoenzyms Typ2
= Tumor M2-PK
• Hemmung der ß – Oxidation = Fettstoffwechsel
Tumorstoffwechsel
• hohe Aktivität der Glycolyse – Enzymen
• hohe Glutaminolyse - Kapazität
• anaerober Stoffwechsel unter Bildung
von Laktat = Milchsäure
• die Vergärung von Glucose liefert
wesentlich weniger Energie, daher
• nehmen Tumorzellen 20- bis 30-mal
mehr Glucose auf
Tumorstoffwechsel
• dabei produzieren sie große Mengen
Laktat, welches in der Leber unter
• erheblichem Energieaufwand erneut
• in Glucose umgebaut werden muss, um
dann wieder von den
• Tumorzellen als Energielieferant benutzt
zu werden
Tumorstoffwechsel
• erklärt auch den bei Tumorpatienten erhöhten
Energiebedarf, die Kachexie = Auszehrung :
• anaerobe Glycolyse führt zu
• Hypoglycämie und Azidose, dies
• triggert die Ausschüttung von
• Adrenalin, Glucocorticoiden und
• Glucagon, daraus erfolgt
• Lipolyse und Proteinlyse aus Muskel• und Fettgewebe
Tumorstoffwechsel
• die Abhängigkeit der Tumorzellen von
Sauerstoff nimmt drastisch ab
• das Abschalten der Mitochondrien führt zu
Resistenzen gegenüber vielen
Chemotherapeutika
Tumorformen
• in Abhängigkeit von seiner Fähigkeit Metastasen
zu bilden ,unterscheidet man
• benigne = gutartige
• maligne = bösartige
• und semimaligne Tumoren = Basalgiom
• maligne Tumoren werden außerdem in
• niedrig-maligne und
• hochmaligne eingeteilt,
Tumorformen
• benigne Tumoren = gutartige
Gewebeveränderungen
• wachsen langsam, sind gut abgrenzbar,
gut differenziert,
• bilden keine Metastasen
• die Benennung erfolgt durch die
angehängte Endung “-om“ an den
lateinischen Namen des
Ursprungsgewebes
Tumorformen
•
•
•
•
•
Fibrom: Stielwarze, Fleischwarze
Chondrom: gutartiger Tumor des Knorpels
Adenom: gutartiger Tumor des Drüsengewebes
Meningeom: gutartiger Tumor der Hirnhaut
Adenomatoidtumor: gutartiger Tumor im
Bereich der Genitalien
• Myom: gutartiger Tumor des Muskelgewebes, z.
B. Uterusmyom
Tumorformen
• benigne Tumoren beeinträchtigen den Körper in
der Regel nicht
• allerdings können einige benigne Tumoren zu
malignen Zellen mutieren, z.B. Dickdarmpolypen
die häufig zum Karzinom entarten
• Hormonproduzierende Adenome können durch
ihre Hormonwirkung zu Erkrankungen führen
• Tumoren können durch ihre Raumforderungen
„ maligne“ sein: z.B. das Meningeom
Tumorformen
• maligne Tumoren = bösartige
Gewebeveränderungen
• wachsen schnell und invasiv, sind schlecht
abgrenzbar,
• Zellen sind atypisch verändert
• bilden Metastasen
• auch bösartige Tumoren werden, soweit
noch erkennbar nach dem
Ursprungsgewebe benannt
Tumorformen
• Karzinome = das lateinische Wort für Krebs
• machen 80 % der Krebserkrankungen aus, und gehen
• vom Epithelgewebe aus:
• Plattenepithelkarzinome: Schleimhaut, verhornt und
unverhornt
• Adenokarzimone: vom Drüsenepithel ausgehend
• Urothelkarzinome: entstehen in der Epithelschicht
• der ableitenden Harnwege
• Chorionkarzinome: entstehen aus pluripotenten
Keimzellen
Tumorformen
• Sarkome= das griechische Wort für
Fleisch
• leiten sich aus dem Binde- und
Stützgewebe ab
• sind mit 1% aller malignen Erkrankungen
selten
Tumorformen
• Osteosarkom: vom Knochen ausgehend
• Rhabdomysarkome: von der quergestreiften
Muskulatur ausgehend
• Angiosarkome: von den Blutgefäßen
ausgehend
• Leiomyosarkome: von der glatten Muskulatur
ausgehend
• Liposarkom: vom Fettgewebe ausgehend
• Fibrosarkom: Form von Hautkrebs
• Neurogenes Sarkom: vom peripheren
Nervensystem ausgehend
Tumorformen
• Blastome = Tumoren die aus embryonalen
Zellen, während der Gewebe- oder
Organentwicklung entstehen
• Retinoblastom: von embryonalen
Netzhautzellen ausgehend
• Medulloblastom: von embryonalen
Kleinhirnzellen ausgehend
• Nephroblastom: ( Wilms-Tumor ) von
embryonalen Nierenzellen ausgehend
• Hepatoblastom: von embryonalen Leberzellen
ausgehend
Tumorformen
• Hämatologische Tumoren= Tumoren die
sich aus Blut- oder Blutstammzellen
entwickeln:
• Leukämien: gehen von den Leukozyten
aus
• Lymphome: gehen von den Lymphozyten
aus
Krebsauslösende Faktoren
• grundsätzlich sind Zellen während der
Zellteilung besonders anfällig
• Physikalische Noxen:
• Ionisierende Strahlung wie ultraviolettes
Licht, Röntgen –
• oder Gammastrahlung,
• elektromagnetische Felder wie Mobilfunk,
Mikrowelle
Krebsauslösende Faktoren
• Chemische Noxen: die wichtigsten sind polyzyklische
Kohlenwasserstoffe:
• Benzol: früher als Lösungsmittel verwendet, zu 1% im
Benzin enthalten, in USA verboten
• Benzpyren: in Zigarettenrauch, Teer- und Abgasen
• Chrom- VI – Verbindungen: Korrosionsschutzmittel in
Kühlschränken
• Nitrosamine: geräucherte Fleisch- und Fischware
Krebsauslösende Faktoren
• Onkoviren: nach Schätzung der
amerikanischen Krebsgesellschaft werden
etwa 15-20 % der Krebsfälle durch
Onkoviren verursacht
• wichtige Onkoviren sind:
• Papillomaviren ( HPV )
• Retroviren
( HIV )
• Hepadnaviren ( HBV )
• Herpesviren
Krebsauslösende Faktoren
• Beispiel Papillomaviren:
• eine HPV Infektion mit den so genannten high
risk Viren – Stämmen ist in
• 99,7 % die Ursache für ein Zervixkarzimon
• das Virus stimuliert die Zellproliferation
• verzögert die Differenzierung der infizierten
Zelle,
• Genprodukte des Virus unterdrücken
Reparaturen der DNA
• und letztlich die Apoptose
Krebsauslösende Faktoren
• es kommt zur genetischen Instabilität
der befallenen Zervixzellen
• PAP III d = Dysplasie, Nachweis von
Zellen mit leichten bis mittelschweren
Zellveränderungen,
• wird in der Regel alle 3 Monate kontrolliert
• PAP IV = Konisation
Krebsauslösende Faktoren
• Onkogene
• Gene, die das Wachstum von Tumoren
auslösen können,
• entstehen aus Proto-Onkogene,
• durch Veränderungen an Gensequenzen=
Mutationen
• Auslöser: ionisierende Strahlung,
chemische Substanzen
• und Onkoviren
Krebsauslösende Faktoren
• die Proliferation einer Zelle wird positiv
von Protoonkogenen,
• und negativ durch Tumorsuppressoren wie
p 53 oder
• p RB reguliert
Krebsauslösende Faktoren
• Embryonale Stammzellen können unter
bestimmten Umständen Krebs auslösen
• Stamm – und Krebszellen sind bildlich
gesprochen, die zwei Seiten einer Medaille
• die embryonale Stammzelle ist „pluripotent“,
kann sich also in jede einzelne Zellart wandeln,
zum Beispiel in eine
• Knochen, Muskel – oder Nervenzelle
• und
• kann sich im Prinzip unendlich oft teilen, ist
unsterblich!
Krebsauslösende Faktoren
• ausgerechnet diese Eigenschaft hat sie mit der
tödlichen Tumorzelle gemeinsam
• man weiß erst seit wenigen Jahren , das es
neben den guten Stammzellen, auch höchst
gefährliche Krebs-Stammzellen gibt
• Forscher vermuten sogar das Tumoren durch
einige wenige
• Krebs-Stammzellen überhaupt erst tödlich
werden
Statistik
• Statistisch gesehen entwickelt jeder dritte Europäer
im Laufe seines Lebens Krebs!
• die meisten Fälle treten im Alter über 60 Jahren auf
• einer US-Studie zufolge sterben weltweit jeden Tag etwa
20.000 Menschen an den folgen einer Krebserkrankung
• demnach gab es in Deutschland erkranken jährlich rund
400.000 Menschen an Krebs 2008 7,6 Millionen Tote
durch Krebs
Statistik
• übrigens ist Krebs keinesfalls eine
Erkrankung der Neuzeit
• die ältesten Krebsbefunde liefern
Saurierknochen
• in Papyrusschriften sind
Krebserkrankungen aus der Zeit
1550 vor Christi Geburt erwähnt
Statistik
• die 5 Jahres Überlebensrate betrug in den
80er Jahren:
• Frauen 53 %
Männer 35%
• 2004 betrug die Überlebensrate:
• Frauen 55%
Männer 47%
Folgen des Tumorwachstums
• die meisten Patienten sterben nicht an der
primären Tumorerkrankung, sondern an
den Metastasen
• häufig betroffen sind:
• Leber, Lunge, Knochen,
• Gehirn, Lymphknoten
• Metastasen entstehen, indem sich
Krebszellen vom Primärtumor ablösen
Folgen des Tumorwachstums
• schon sehr kleine Tumoren können
metastasieren, z.B. beim Brustkrebs
• sind ab einem Tumordurchmesser von
1cm schon 20% metastasiert
• Voraussetzung für die Metastasierung:
der Krebs wächst invasiv in angrenzende
Strukturen mit Durchbruch in
• Blut- und Lymphgefäße
Folgen des Tumorwachstums
• Fähigkeit körpereigene Strukturen wie:
• die Basalmembran
• die Blut-Hirn-Schranke zu durchdringen
• aktiv in ein Gefäß einzudringen
• bezeichnet man als Invasion
Folgen des Tumorwachstums
• die Invasion ist eine aktive Leistung maligner
Krebszellen
• abhängig von den jeweiligen genetischen
Eigenschaften des Tumors
• wie verminderte Expression von Klebemolekülen
auf der Zellmembran
• nur etwa 0,01% aller im Blut zirkulierenden
Krebszellen schafft es eine metastatische
Kolonie zu bilden
Folgen des Tumorwachstums
• bei der Anheftung spielen wieder andere
Membranstrukturen
• so genannte Integrine = Eiweißmoleküle,
welche Zellen verbinden- eine Rolle
• dieses Thema ist Gegenstand aktueller
Forschungen
Folgen des Tumorwachstums
• Angiogenese
• Krebszellen sind im Gegensatz zu
normalen Zellen in der Lage, umgebende
Blutgefäße zum Ausspossen zu
veranlassen
• Tumoren ohne diese angiogenetische
Fähigkeit werden nicht
• Größer als 0,3mm
Folgen des Tumorwachstums
• Knochenabbau
• im Skelett müssen körpereigene
Osteoklasten gezwungen werden
Knochensubstanz abzubauen
• damit die Metastase wachsen kann
Metastasierung
• man unterscheidet gemäß der TNMKlassifikation
• zwischen lokalen
• regionären- und
• Fernmetastasen
Metastasierung
• Lokale Metastasen entstehen in
unmittelbarer Nähe des Primärtumors
durch Verschleppung bösartiger Zellen
in das umliegende Gewebe
• entsteht diese Verschleppung über
Stichkanäle ( Biopsien )
• oder Schnitte im Tumorgewebe spricht
man von Impfmetastasen
•
Metastasierung
• regionäre Metastasen entstehen wenn
Tumorzellverbände in die Lymphgefäße
abschilfern, und sich in den ortsnahen
• Lymphknoten festsetzen
• Einteilung der Lympfknotenmetastasen
durch N-Kategorie
Metastasierung
• Fernmetastasen entstehen, wenn
Tumorzellverbände in Venen
abschilfern und in entfernte Organe absiedeln
• werden auch hämatogene Metastasen genannt,
und durch
• die M- Kategorie klassifiziert
•
Metastasierung
• manche Tumorarten metastasieren in
ganz spezifische Organe
• so gut wie nie von Metastasen betroffen
sind:
• Herz, Milz und Nieren
• grundsätzlich ist der Zielmechnismus nicht
völlig verstanden
Metastasierungswege
• Lungentyp= arterieller Typ
• über das linke Herz in den großen
Kreislauf :
• ZNS, Skelett, Leber, Nebennieren
• Bronchialkrebs
Metastasierungswege
• Hohlvenen= Kavatyp
• über die Hohlvene zur Lunge, weiter über
den arteriellen Kreislauf :
• Skelett, Lunge, Gehirn, Leber
• Nieren-, Knochen-, Schilddrüsenkrebs
Metastasierungswege
• Pfortader- Typ
• über die Pfortader zur Leber, über die
Hohlvene in den großen Kreislauf :
• Leber
• Krebs des Verdauungstraktes
Metastasierungswege
• Vertebralvenen-Typ
• über Verbindung zum Venensystem:
• Skelett, Wirbelsäule
• Brustkrebs, Prostatakrebs
TNM- System
• ist eine Klassifizierung von bösartigen Tumoren
• eignet sich nicht für Leukämien
•
•
•
•
•
•
•
T
Tis
T1-T4
N
NO
N1-N3
M
Primärtumor
Tumor in situ / Frühform, Basalmembran intakt
zunehmende lokale Ausdehnung
regionärer Lymphknotenbefall
keine Anzeichen für Lymphknotenbefall
zunehmender Lymphknotenbefall
Fernmetastasen
Grading
• Grad der Entartung: G = grading
• G1 = niedriger Malignitätsgrad, Zellen sind recht gut
differenziert
• G2 = mittlerer Malignitätsgrad
• G3 = hoher Malignitätsgrad, Zellen kaum differenziert
• G4 = sehr hoher Malignitätsgrad, vollkommen
entdifferenzierte Zellen
Resttumor
• Resttumor nach Operation
wird mit R bezeichnet
• RO komplett entfernt
• R1 Resttumormasse vorhanden
Tumordiagnostik
• egal ob der Krebsverdacht aufgrund von
Beschwerden oder
• einer Früherkennungsmaßnahme entstanden ist
• die ersten Beweise für das tatsächliche
Vorhandensein
• eines Tumors liefern in der Regel bildgebende
Verfahren:
• Röntgen, Ultraschall, CT, Kernspin
• Endoskopien bzw. Biopsien
Tumordiagnostik
• Programm zur gesetzlichen Früherkennung
von Krebs in Deutschland
für Frauen:
• Gebärmutterhalskrebs, ab dem 20. Lebensjahr
1x jährlich PAP-Abstrich
• Brustkrebs, ab dem 30. Lebensjahr 1x jährlich
Abtastung der Brust incl. Achselhöhle,
• ab dem 50. Lebensjahr Mammographie alle zwei
Jahre
Tumordiagnostik
• für Männer:
• Prostatakrebs, ab dem 45. Lebensjahr
• 1x jährlich Abtastung der Prostata vom
Enddarm aus
Tumordiagnostik
• für Frauen und Männer:
• Hautkrebs, ab dem 35. Lebensjahr
Untersuchung der Haut, einschließlich behaarter
Kopfhaut, alle zwei Jahre
• Dickdarmkrebs, ab dem 50. Lebensjahr 1x
jährlich digitale, rektale Austastung, plus
Testbrief auf okkultes Blut
• ab dem 55. Lebensjahr eine Koloskopie,
einmalige Wiederholung nach 10 Jahren
möglich
Tumordiagnostik
• die Teilnahme ist freiwillig / Beratung
vorgesehen
• für Frauen, die nach dem 31. 03. 1987
• und Männer, die nach dem 31. 03. 1962
geboren sind
• gilt eine Beratungspflicht über Vor-und
Nachteile der Vorsorgeuntersuchungen
Tumordiagnostik
• sollten gesetzlich versicherte Patienten an Krebs
erkranken
• gilt dann die so genannte Chronikerregel=
• maximal 1 % des Bruttoeinkommens müssen für
Arzneimittel
• und andere medizinische Leistungen selbst
getragen werden,
• ohne Beratung müssen 2% Eigenanteil getragen
werden
Tumormarker
• sind Bestandteile oder Stoffwechselprodukte von
Tumorzelle
• weisen unterschiedliche Organspezifitäten auf
• wichtigste Bedeutung liegt in der Therapie- und
Verlaufskontrolle
• Tumormarker, die mit verschiedenen
Untersuchungsmethoden
• erstellt wurden, sind nicht vergleichbar
• vor Bestimmung Konsequenzen bedenken
Tumormarker
• AFP= wird physiologisch im Embryo
gebildet
• primäres Leberzellkarzinom
• Keimzelltumoren von Hoden
• Eierstöcken
• immer parallel ß-hCG bestimmen
• auch erhöht bei Leberzirrhose
Tumormarker
• ß-hCG= Schwangerschaftserhaltendes
Hormon
• außerhalb der Schwangerschaft:
• Chorionkarzinome= Keimzelltumoren zu
100% positiv
Tumormarker
• CA 15-3
• Verlaufskontrolle des metastasierten
Brustkrebses
• auch positiv bei Mastitis, Hepatitis,
Pankreatitis
Tumormarker
• CA 72-4
• Magenkrebs in Kombination mit CEA
• Ovarialkrebs in Kombination mit CA 125
• selten positiv: entzündliche Prozesse
Magen-Darmtrakt, Ovarien
Tumormarker
• CA 125
• Verlaufskontrolle beim Ovarialkarzinom
• auch positiv bei Leberzirrhose
• akute Pankreatitis
• gutartige gynäkologische Entzündungen
Tumormarker
• CEA
• universeller Tumormarker, fast 80 % aller
fortgeschrittenen
• Tumorerkrankungen zeigen erhöhte CEAWerte
• Bestimmung immer zusammen mit einem
Marker höherer
• Spezifität
Tumormarker
• Darm-, Magen-, Pankreas-, Brust-,
Bronchial-, Uterus-, Zervix- ,und
Schilddrüsenkrebs
• auch positiv: bei Rauchern, Leberzirrhose,
Colitis ulcerosa,
• Lungenemphysem
• 2-4 Wochen postoperativ durch
entzündliche Veränderungen
Tumormarker
• PSA, freies PSA = Prostataspezifisches
Antigen
• Prostatakarzinom
• Empfehlung für die Krebsvorsorge bei
Männern ab 50 Jahren
• auch positiv: Prostataadenom
• Prostatitis
Tumormarker
• SCC = (squamous cell-antig)
Plattenepithelkarzinom-Antigen
• der Zervix,
• der Lunge,
• der Speiseröhre,
• des Kopf-Hals-Bereichs
• auch positiv: entzündliche Lungenerkrankungen,
Leberschäden,
• Hautexzeme, Schuppenflechte
Behandlungsverfahren bei
Krebserkrankungen
• Ziel der Krebsbehandlung ist die Heilung=
kurativer Ansatz
• oder das Langzeitüberleben des Patienten
• Prinzip: hit hard and early
• zeigt langfristig bessere Ergebnisse als
weniger aggressives vorgehen
Behandlungsverfahren bei
Krebserkrankungen
• manchmal ergibt sich schon bei der
Diagnosestellung das eine Heilung nicht
mehr möglich ist, hier spricht man
• von palliativer = Lebensverbessernder
Therapie
Behandlungsverfahren bei
Krebserkrankungen
• um einen Tumor komplett entfernen zu
können, muss manchmal vor einer
Operation mittels
• Strahlen - oder Chemotherapie
• eine Verkleinerung des Tumorgewebes
versucht werden
• = neoadjuvante Therapie
Behandlungsverfahren bei
Krebserkrankungen
• häufiger soll eine Nachbehandlung z.B.
Resttumorzellen zerstören =
• adjuvante Therapie
• besteht die Möglichkeit den Tumor
komplett zu entfernen,
• so erfolgt zunächst eine möglichst
frühzeitige Operation
Behandlungsverfahren bei
Krebserkrankungen
• benachbarte Lymphknoten werden
entfernt, der so genannte
• Sentinel- Lymphknoten =
• Wächterlymphknoten = 1. Lymphknoten
• im Lymphabflussgebiet eines malignen
Tumors
• wird insbesondere zu prognostischen
Zwecken bei Brust- und
• Prostatakrebs gesucht
Behandlungsverfahren bei
Krebserkrankungen
• auch wenn nur eine Verkleinerung des
Tumorgewebes erreicht
• werden kann, kann die Operation im Sinne
einer Palliation
• die Lebensqualität verbessern, z.B. bei
einem Darmverschluss durch
Tumorgewebe
Behandlungsverfahren bei
Krebserkrankungen
• Strahlentherapie
• Ziel der Strahlentherapie ist, Tumorzellen zum
Absterben zu bringen, meist soll das Risiko
eines Lokalrezidivs vermindert werden,
• bei einigen Tumoren ist die Strahlentherapie
alleinige Therapie,
• etwa bei Gehirntumoren die nicht entfernt
werden können,
• hier werden höhere Dosen eingesetzt
Behandlungsverfahren bei
Krebserkrankungen
• Strahlentherapie wird insbesondere auch
in der Palliation
• bei Knochenmetastasen eingesetzt
Chemotherapie mit Zytostatika
• Zytostatika sind Zellgifte
• die Zellwachstum- und Vermehrung
hemmen
• werden nur selten als alleinige Therapie
eingesetzt
• häufig als adjuvante Therapie um
Mikrometastasen zu behandeln
Chemotherapie mit Zytostatika
• seltener werden Zytostatika direkt in
Körperhöhlen eingebracht,
• z. B. beim Blasentumor
• die Nebenwirkungen auf den
Gesamtorganismus sind viel geringer
Chemotherapie mit Zytostatika
• meistens werden Zytostatika in
mehrtägigen Chemotherapiezyklen
verabreicht
• etwa alle 3 Wochen wiederholt
• gesunde Zellen erholen sich zwischen
zwei Zyklen rascher als
• Tumorzellen, so dass Zytostatika stärker
auf Tumorzellen,
• als auf gesunde Zellen wirken
Chemotherapie mit Zytostatika
• bei chronischen Leukämien werden niedrig
dosierte Zytostatika als Dauerbehandlung
verabreicht
• bei einer Hochdosis-Chemotherapie werden
Zytostatika
• bis zu 30-mal höher dosiert, um möglichst alle
bösartigen
• Zellen abzutöten, z.B. bei Leukämien vor einer
• Blutstamm-Zell-Transplantation
Chemotherapie mit Zytostatika
• diese Therapie ist recht riskant
• wegen der Schleimhautschädigung
muss der Patient künstlich ernährt werden,
bis sich die Zellen des Magen-DarmTrakts erholt haben
Chemotherapie mit Zytostatika
• Allgemeine Nebenwirkungen der
Chemotherapie
• Übelkeit, Erbrechen Ondansetron z.B Zofran
• Schleimhautenzündungen , Mundhöhle, Darm
• Venenreizungen bis hin zum
Venenverschluss
• hier Portsystem sinnvoll, über
Schlüsselbeinvene direkt in die Hohlvene, hier
große Verdünnung
Chemotherapie mit Zytostatika
• Haarausfall
• Mangel an Blutkörperchen, im Sinne
einer Panzytopenie
• Infektionsgefahr!
• leichtere Leukopenien können mit G-CSF
( Neupogen ) stimuliert werden
• Anämien werden mit
Erythrozytenkonzentraten behandelt
Chemotherapie mit Zytostatika
• Dauerfolgen der Chemotherapie
• Unfruchtbarkeit , je nach Dauer und
Aggressivität der Chemo-Therapie
• bei Männern : Samenspenden,
• bei Frauen: Tiefkühllagerung von
Eierstockgewebe
• Männer und Frauen müssen während und nach
der Therapie für mindestens 2 Jahre sicher
verhüten
Chemotherapie mit Zytostatika
• Organschäden:
• dauerhafte Schädigungen des Herzmuskels
durch Anthrazykline z.B. Epirubicin
• Polyneuropathien durch Alkaloide wie z. B.
Taxol
• Zweittumoren
• durch ihre mögliche erbgutverändernden
Eigenschaften,
• vor allem akute Leukämien,
• in der Kombination mit Strahlentherapie steigt
das Risiko
Komplementärmedizin
• Hyperthermie: hier wird künstlich Fieber
erzeugt mittels
• Ultraschall, Radio- oder Mikrowellen
• Hypertherme Perfusion: hier werden
erwärmte Infusionen
• verabreicht, z.B. Zytostatika
Komplementärmedizin
• Therapeutische Ansatz:
• Tumorzellen sollen bei Temperaturen
über 42 Grad direkt geschädigt werden
• Tumorzellen sollen wieder
strahlensensibler werden,
• über eine Erweiterung der zuführenden
Venen sollen Chemotherapeutika
Krebszellen besser erreichen
Komplementärmedizin
• Misteltherapie
• verringert die Nebenwirkungen der
Standarttherapie, Immunmodulierende
Wirkung
• Thymustherapie
• Regulation des Immunsystems,
insbesondere nach Chemotherapie,
aktiviert T-Lymphozyten Reifung
Komplementärmedizin
• Falktor AF 2
• Immunstimulierende Wirkung,
Verbesserung der subjektiven
Tumorbeschwerden
• auch während der Chemotherapie
Molekularer NK-Test
• NK Zellen können durch den Einsatz von
Immunmodulatoren aktiviert werden
• auf die Stimulation schütten Zellen
Zytokine wie
• Interleukine oder
• Tumor-Nekrose-Faktoren ( TNF ) aus
• welche wiederum NK-Zellen stimulieren
Molekularer NK-Test
• beim molekularen NK-Test isolieren wir
NK-Zellen aus dem peripheren Blut, und
• inkubieren diese mit Interleukin 2
• danach wird die Expression von
Aktivierungsfaktoren
• wie z. B.TNF
• in den stimulierten,
• und nicht stimulierten NK-Zellen
verglichen
Molekularer NK-Test
• ist die NK-Zelle grundsätzlich aktivierbar
• können verschiedene Immunstimulatien
getestet werden
• Pflanzen: Mistelextrakten, Extrakten aus
Echinacea oder Thuja
• Thymusextrakte: Thymosin, Thymojekt
• Peptide: AF 2
Zellulärer Immunstatus
•
•
•
•
•
gibt Auskunft über
die numerischen Verhältnisse und
den Aktivierungszustand
der Immunzellen
im Blut
Zellulärer Immunstatus
• Die Bewertung erfolgt unter
Berücksichtigung
• des Alters
• der Klinik ( Erkrankung, Therapie )
• dem Verlauf , da geringe Veränderungen
auch beim Gesunden auftreten
Zellulärer Immunstatus
• für eine funktionierende Immunabwehr
sind eine Mindestmenge an Immunzellen
notwendig
• Granulozyten
• Monozyten
• T- Lymphozyten
• B- Lymphozyten
• NK-Zellen
Zellulärer Immunstatus
• Verschiebungen der
•
•
•
•
•
T- Helferzellen und
T- Suppressorzellen = CD 4 / CD 8 - Ratio
oder der NK-Zellen
sind ein wichtiger Beitrag zur Diagnose /
zur Verlaufskontrolle
Zellulärer Immunstatus
• Der zelluläre Aktivierungsgrad gibt
Hinweise auf die Reaktionsfähigkeit
der T-Zellen
• Aktivierte T-Zellen (prämitotisch, früh)
• = CD3 / CD 25+
• Aktivierte T-Zellen (postmitotisch, spät)
• = CD3 / HLADR+
Zellulärer Immunstatus
Zellulärer Immunstatus
Zytostatikagruppen
•
•
•
•
•
•
•
Geschichte:
während des 1. Weltkriegs stellten Ärzte
fest, dass der Kampfstoff
Schwefel-Lost ( Senfgas )
wachstumshemmende Wirkung hat
1942 erstmals als das weniger giftige
Stickstoff-Lost eingesetzt
Zytostatikagruppen
•
•
•
•
•
•
•
•
Zytostatische Wirkung der
Platinkomplexe wurde 1965 zufällig
bei einem Versuch mit Zellkulturen
und einer Platinelektrode entdeckt
andere Substanzen wurden in der
Pharmaindustrie für völlig andere Bereiche
entwickelt, fielen jedoch beim Tierversuch
durch Wachstumshemmung auf
Zytostatikagruppen
•
•
•
•
Alkylantien
Übertragen Alkylgruppen auf die DNA
zwei Stränge werden vernetzt
= Hemmung der DNA Replikation
• Z.B. Cyclophosphamid, Ifofamid,
Melphalan
Zytostatikagruppen
•
•
•
•
•
Alkylantien sind
terratogen, mutagen, karzinogen
Übelkeit, Erbrechen
Anämie
Immunschwäche
• Lymphome, Leukämie, Brust-,
Lungenkrebs, Hirntumore
Zytostatikagruppen
•
•
•
•
Antimetaboliten
werden als falsche Bausteine in die
DNA oder RNA eingebaut
stören Teilung und Stoffwechsel
• z.B. 5-Fluorouracil, Methotrexat
Zytostatikagruppen
• Antimetaboliten
• werden niedrig dosiert bei Warzen oder
Rheuma eingesetzt
• haben vergleichsweise geringe NW
• Übelkeit, Erbrechen
• Hand-Fuß-Syndrom
• Anämie
• Nierenschäden
• solide Tumoren, Radiochemotherapie
Zytostatikagruppen
• Platinanaloga
verursachen Quervernetzungen der
DNA durch Bindung des Platinatoms
an zwei Nukleinbasen
z.B. Cisplatin, Carboplatin
Zytostatikagruppen
•
•
•
•
•
Platine verursachen
Übelkeit, Erbrechen
Anämien
Nierenschäden
Nervenschäden
• Hoden-, Eierstockkrebs
Zytostatikagruppen
•
•
•
•
Anthracycline sind Antibiotika
verhindern die Nucleinsäuresynthese
verursachen Doppelstrangbrüche der DNA
verändern die Permeabilität der
Zellmembran
• z.B. Epirubicin, Doxarubicin
Zytostatikagruppen
• Anthracycline verursachen
schwere, teilweise irreversible Schäden
• Knochenmark
• Herz
• Brust-, Lungen-, Hoden-, Blasenkrebs
• AML, ALL
Zytostatikagruppen
• Mitosehemmstoffe
• sind Pflanzenstoffe
• Spindelgifte hemmen die Mitose
• z.B. Vinca- Alkaloide aus Madagaskaimmergrün wie Vincristin
Taxane aus der Eibe
Zytostatikagruppen
• Mitosehemmstoffe (Vincristin)
verursachen:
• Übelkeit, Erbrechen
• Anämien
• Neurotoxisch
• Ovarial-, Brust-, Bronchialkrebs Lymphome, ALL
Zytostatikagruppen
•
•
•
•
•
•
•
•
Taxane verursachen vielfältige NW:
Übelkeit, Erbrechen
fiebrige Neutropenie
Verschluss des Tränenkanals
neurotoxisch
Hand -Fuß- Syndrom
Fingernägel fallen ab
Brust-, Ovarialkrebs
Zytostatikagruppen
• Topoisomerase – Hemmer
• Tpoisomerasen sind Enzyme, die an der
Zellteilung direkt beteiligt sind und
gehören chemisch verschiedenen Gruppen an
werden alle aus giftigen Pflanzen gewonnen
die Grundsubstanz stört die Topoisomerase I
z.B. Etoposid, Teniposid
Zytostatikagruppen
Topoisomerase – Hemmer verursachen
starke Anämien
Herzrasen
Nieren- und Leberschäden
sind neurotoxisch
Lungen-, Hoden-, Ovarial-, Darmkrebs
Lymphdrüsenkrebs
Zytostatikagruppen
• Monoklonale Antikörper
• bindet von der Zellaußenseite an den
Wachstumsfaktor –Rezeptor HER 2
• Antikörper-abhängige Zerstörung
durch das Immunsystem
• wird nur bei Pat. mit nachgewiesener
• HER 2- Überexpression eingesetzt
• Herceptin
Immunstimulanzien
• Interferon alpha
antiproliferierend und immunstärkend
sind Zellhormone = Zytokine
verursachen grippeähnliche Symptome,
Übelkeit, Erbrechen
Depressionen
Melanom, CML
Hormonantagonisten
•
•
•
•
•
•
•
•
blockieren Östrogenrezeptoren
z.B. Tamoxifen
häufig meno- und postpausal
bei jungen Frauen GNR- Analoga
z.B Zoladex
aktuell Aromatasehemmer
z.B. Letrozol
Brustkrebs
Hormonantagonisten
• Voraussetzung ist ein
• positiver Rezeptorstatus
• wird in der Histologie festgelegt
Tamoxifen:
das Risiko von aggressiven, hormonunempfindlichen
Zweittumoren ist deutlich erhöht
ER+ = Östrogen Rezeptor positiv
PR+ = Progesteron Rezeptor positiv
Angiogenesehemmer
•
•
•
•
Sorafenib = Nexavar
neuer Ansatz in der Krebstherapie
unterbindet die Neubildung von
Blutgefäßen
• Nierenzellkarzinom, Studien
Chemotherapien
•
•
•
•
werden meistens als Kombinationen
eingesetzt
z.B. CMF, EC,
Standards festgelegt / Tumorkonferenz
• Tumorzellisolierung / Chemoaustestung!
• second- / thirdline Therapien
Herunterladen

Beispiel: unser Gehirn besitzt 20 Milliarden Nervenzellen