Die Rolle von Chromosom 8p-Deletionen und Verlust
der SFRP1-Expression beim Urothelkarzinom der
Harnblase
Der Naturwissenschaftlichen Fakultät
der Friedrich-Alexander-Universität Erlangen-Nürnberg
zur
Erlangung des Doktorgrades Dr. rer.nat.
vorgelegt von
Anja Paola Rogler
aus Nürnberg
Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander Universität
Erlangen-Nürnberg
Tag der mündlichen Prüfung:
19. Oktober 2012
Vorsitzender der
Promotionskommission:
Prof. Dr. Rainer Fink
Erstberichterstatter:
Prof. Dr. Johann-Helmut Brandstätter
Zweitberichterstatter:
Prof. Dr. Arndt Hartmann
Inhaltsverzeichnis
INHALTSVERZEICHNIS
1
Einleitung
9
1.1
1.2
1.3
1.4
1.5
1.6
Das Harnblasenkarzinom
Der Wnt-Signalweg
SFRP1 - secreted frizzled related protein 1
Chromosomale Verluste auf 8p bei Krebs
Single nucleotide polymorphisms (SNPs) in SFRP1
Ziele der Arbeit
9
19
23
25
27
29
2
Material und Methoden
31
2.1
Material
31
2.1.1
2.1.2
2.1.3
2.1.4
2.1.5
2.1.6
2.1.7
2.1.8
2.1.9
2.1.10
2.2
Patientenmaterial
Zelllinien
Bakterien-Stamm
Chemikalien und Reagenzien
Lösungen und Puffer
Kommerzielle Reagenziensätze (Kits)
Nukleinsäuren
Proteine
Geräte und Laborausstattung
Softwares und Webtools
Methoden
31
37
38
38
41
43
44
47
49
51
52
2.2.1
2.2.1.1
2.2.1.2
2.2.1.3
2.2.1.4
2.2.1.5
2.2.1.6
2.2.1.7
2.2.1.8
2.2.1.9
Zellbiologische Methoden
Auftauen und Einfrieren von Zellen
Kultivieren und Splitten von adhärenten Zellen
Zählen von Zellen mit der Neubauer-Zählkammer
Transfektion von Nukleinsäuren
Bestimmung der Viabilität mittels CellTiter Glo Assay
Bestimmung der Proliferation mittels BrdU Assay
Bestimmung der Migration mittels Wound Scratch Assay
Bestimmung der Wnt-Aktivität mittels TOP flash/FOP flash Assay
Behandlung der Zellen mit 5-Aza, SAHA und Trichostatin
52
52
52
53
54
57
58
59
60
62
2.2.2
2.2.2.1
2.2.2.2
2.2.2.3
2.2.2.4
2.2.2.5
2.2.2.6
2.2.2.7
2.2.2.8
2.2.2.9
2.2.2.10
Molekularbiologische Methoden
Mikrodissektion von gefrorenen Gewebedünnschnitten
Isolierung von Ribonukleinsäure (RNA)
Isolierung von Desoxy-Ribonukleinsäure (DNA)
Quantitäts- und Qualitätskontrolle von Nukleinsäuren
Synthese von komplementärer DNA (cDNA)
Konventionelle Polymerase-Kettenreaktion (PCR)
Bisulfitbehandlung und methylierungsspezifische PCR (MSP)
Agarose-Gelelektrophorese
Quantitative Real-Time PCR (qRT-PCR)
RFLP-Analyse der SNPs
64
64
64
65
65
65
66
68
70
71
75
Inhaltsverzeichnis
2.2.2.11
2.2.2.12
2.2.2.13
2.2.2.14
2.2.2.15
Amplifikation von Plasmiden mittels Transformation in E. coli
Restriktionsenzymverdau von Plasmiden
Mutations-Analyse mittels SNaPshot-Assay
Sanger-Sequenzierung von DNA
Vergleichende Genomische Hybridisierung (aCGH)
77
78
80
83
85
2.2.3
2.2.3.1
2.2.3.2
2.2.3.3
2.2.3.4
2.2.3.5
2.2.3.6
2.2.3.7
2.2.3.8
Proteinbiochemische Methoden
Isolierung von Proteinen aus Zellen und Gewebe
Protein-Konzentrationsbestimmung mittels BCA-Assay
SDS-Polyacrylamid-Gelelektrophorese
Westernblot
Herstellung eines Tissue Micro Arrays (TMA)
Anfertigung einer HE-Färbung
Immunhistochemie (IHC)
Immunfluoreszenz (IF)
87
87
87
88
89
91
91
92
93
2.2.4 Statistische Methoden
94
3
96
Ergebnisse
3.1
Untersuchung der SFRP1-Expression bei Blasenkrebs
3.1.1
3.1.3
Funktionelle Charakterisierung der SFRP1-Expression in
Harnblasenkarzinom-Zelllinien
96
Screening der SFRP1-Expression in HarnblasenkarzinomZelllininen
96
Analyse der Wnt-Zielgene in SFRP1-exprimierenden und SFRP1–
defizienten RT112 und BFTC905 Zellen mittels qRT-PCR
102
Analyse der Wnt-Zielgene in SFRP1-exprimierenden und SFRP1–
defizienten RT112 und BFTC905 Zellen mittels Westernblot
105
Wnt-Aktivität mittels TOP/FOP Assay
110
Bestimmung der SFRP1-abhängigen Viabilität (Viability Assay)
111
Bestimmung der SFRP1-abhängigen Proliferation (BrdU Assay) 112
Untersuchung des SFRP1-abhängigen Migrationsverhaltens mit
dem Wound Scratch Assay
113
Prospektive Untersuchung der Bedeutung der SFRP1-Expression
in papillären Blasentumoren
115
SFRP1-Expression in fortgeschrittenen Blasentumoren
126
3.2
rs3242 und rs921142 SNP-Analysen in SFRP1
3.2.1
3.2.3
3.2.4
Genotypisierung von humanen Blasentumoren mittels RFLP und
Sequenzierung
Auswirkung des rs3242 SNP auf die SFRP1-mRNA-SekundärStruktur
Expressionsanalyse von hsa-miR-603 und hsa-miR-3646
Überexpression von hsa-miR-603 in RT112, RT4 und J82
3.3
Deletionsmapping von Chromosom 8p mittels aCGH
141
3.3.1
Vergleichende genomische Hybridisierung
141
3.1.1.1
3.1.1.2
3.1.1.3
3.1.1.4
3.1.1.5
3.1.1.6
3.1.1.7
3.1.2
3.2.2
96
128
128
132
132
136
Inhaltsverzeichnis
3.3.2
3.3.3
Cluster-Analyse
Mutations-Analyse in FGFR3 und PIK3CA
148
149
3.4
Untersuchung der MTUS1-Expression bei Blasenkrebs
153
3.4.1
3.4.2
3.4.3
3.4.3.1
3.4.3.2
3.4.3.3
3.4.3.4
MTUS1-Expression in Harnblasenkarzinom-Zelllininen
MTUS1-Expression in Tumorgewebe
Funktionelle Untersuchung der MTUS1-Überexpression in RT112
Kontrolle des Transfektionserfolges mittels qRT-PCR
Bestimmung der MTUS1-abhängigen Viabilität (Viability Assay)
Bestimmung der MTUS1-abhängigen Proliferation (BrdU Assay)
Untersuchung des MTUS1-abhängigen Migrationsverhaltens mit
dem Wound Scratch Assay
Immunhistochemische Untersuchung der MTUS1-Expression
an zwei TMA-Studien
TMA mit papillären Harnblasenkarzinomen
TMA mit fortgeschrittenen Harnblasenkarzinomen
153
155
157
157
159
159
3.4.4
3.4.4.1
3.4.4.2
160
161
162
169
4
Diskussion
171
5
Zusammenfassung
195
6
Literaturverzeichnis
197
7
Abbildungsverzeichnis
205
8
Publikationen, Kongressbeiträge und Fortbildungen
206
9
Anhang
210
9.1
9.2
9.3
210
212
9.4
9.5
9.6
9.7
10
Abkürzungsverzeichnis
Hersteller-Angaben
Schmelzkurven und Eichgeraden der Primeroptimierung und
Primereffizienzbestimmung der qRT-PCR
Karyogramme der 19 Tumoren der aCGH
Chromosomale Aberrationen der aCGH zur Generierung von
Pseudomarkern für die Cluster-Analyse
Genotypen und Risikoallelverteilung beim rs3242 SNP in SFRP1
Genotypenverteilung beim rs921142 SNP in SFRP1
Danksagung
213
220
223
227
228
229
Einleitung
1
Einleitung
1.1
Das Harnblasenkarzinom
Definition, Epidemiologie, Ätiologie
Der ableitende Harntrakt (siehe Abbildung 1-1) erstreckt sich vom Nierenbecken über
den Urether (Harnleiter), die Harnblase bis hin zur proximalen Urethra (Harnröhre)
und
ist
mit
einem
5-7-schichtigen
epithelialen
Zellverbund,
dem
Urothel,
ausgekleidet. Das Urothel fungiert als dehnbare, osmotische Barriere zwischen Urin
und interstitieller Flüssigkeit, kann sich den verschiedenen Füllungszuständen
anpassen und ist durch den ständigen Kontakt mit Urin häufig potenziellen
Kanzerogenen ausgesetzt. Urothelkarzinome (UC – urothelial carcinoma) sind
maligne Veränderungen des Urothels und können im gesamten Harntrakt auftreten.
In 90% der Fälle tritt das Urothelkarzinom jedoch in der Harnblase auf, in der zudem
90% des gesamten Urothels lokalisiert ist. Histologisch werden neben dem
Urothelkarzinom, was in 90% der Blasenkrebspatienten präsent ist, noch andere,
seltenere Entitäten unterschieden: in <10% der Fälle treten beispielsweise auch
Plattenepithelkarzinome, sehr selten Adenokarzinome, neuroendokrine Tumore,
maligne Melanome und mesenchymale Tumore in der Harnblase auf. Das
Harnblasenkarzinom ist zudem eine oft multifokale (gleichzeitig an verschiedenen
Stellen des Organs vorkommend), Alters- und Geschlechts-abhängige Erkrankung,
die bevorzugt in höherem Lebensalter (mittleres Erkrankungsalter: Männer 72 Jahre;
Frauen 74 Jahre) und bei Männern auftritt (Männer: 1/23, Frauen: 1/64) [1].
Mit 19.360 bzw. 8.090 Neuerkrankungen im Jahre 2006 ist das Harnblasenkarzinom
die viert-häufigste bzw. die siebt-häufigste maligne Erkrankung des Mannes bzw. der
Frau in Deutschland. Im gleichen Jahr konnten 3.549 (Männer) bzw. 1.893 (Frauen)
Blasenkrebs-assoziierte
Sterbefälle
in
Deutschland
verzeichnet
werden
[1].
Europaweit wurden im Jahre 2008 139.500 Neuerkrankungen (109.700 Männer und
51.300 Frauen) und 51.000 Harnblasenkarzinom-assoziierte Sterbefälle gemeldet,
was das Harnblasenkarzinom damit zur 6.häufigsten malignen Tumorerkrankung in
Europa macht [2].
9
Einleitung
A
B
Abbildung 1-1: Darstellung des Urogenitaltraktes des Mannes (A) und der Frau (B); der gesamte ableitenende
Harntrakt, also Nierenbecken, Urether, Harnblase (Cystis) und Urethra sind vom Urothel ausgekleidet; zu 90%
tritt das Urothelkarzinom aber in der Harnblase auf.
Für das Harnblasenkarzinom werden viele verschiedene Ursachen diskutiert, wobei
aber Rauchen mit Abstand den wichtigsten Risikofaktor darstellt. So konnte in einer
kürzlich durchgeführten Studie von Boström et al gezeigt werden, dass 64% aller
Blasenkrebspatienten Raucher, hingegen nur 36% Nicht-Raucher sind [3]. Auch
andere Studien belegen, dass Raucher ein 2-6 mal so hohes Risiko haben an
Blasenkrebs zu erkranken [4, 5], wie Nicht-Raucher und es wird angenommen, dass
66% (bei Männern) bzw. 30% (bei Frauen) aller Harnblasenkarzinome mit
Tabakkonsum assoziiert sind [6, 7]. In einer groß angelegten Studie von Freedman et
al (2011), die 281.394 Männer und 186.134 Frauen umfasste und deren
Rauchverhalten und damit assoziierte Harnblasenkrebs-Erkrankungen von 1995 bis
2006 untersuchte, konnte bestätigt werden, dass Raucher und ehemalige Raucher
ein signifikant höheres Erkrankungsrisiko haben (177,2 bzw. 119,8 pro 100.000), als
Nichtraucher (39,8 pro 100.000) [8].
Neben dem Rauchen erhöht aber auch der berufsbedingte Kontakt zu bestimmten
kanzerogenen Substanzen das Blasenkrebsrisiko. Der erste Zusammenhang wurde
hierbei schon 1895 von Rehn beobachtet, als er von einem erhöhten Auftreten von
Blasenkrebs bei Mitarbeitern der Anilin-Farbstoffindustrie berichtete [9]. Aromatische
Amine, wie etwa Benzidin oder 2-Naphtylamin sind dabei die wichtigsten Noxen.
Aber auch andere Industriezweige, wie etwa die Leder-, Papier-, Teppich-, Gummiund Metallindustrie, sowie Maler, Kraftfahrer, Mienen- und Zementarbeiter aber auch
Frisöre haben ein höheres Erkrankungsrisiko, das sich aber auch immer nach der
Dauer des Kontakts zu kanzerogenen Stoffen richtet [10, 11].
10
Einleitung
Weitere Ursachen der Blasenkrebsentstehung sind die Einnahme bestimmter
Medikamente, wie Cyclophosphamid, Chlornaphazin oder der chronische Abusus
von Analgetika, die Phenacetin enthalten [12, 13]. Chronische Infektionen mit dem
Bilharzioseerreger Schistosoma haematobium, wie sie in bestimmten afrikanischen
Ländern (z.B. Ägypten), im Mittleren Osten und in Süd-West Asien vorkommen,
sowie
andere
Noxen,
die
zu
chronische
Zystitis
führen,
können
zum
plattenepithelialen Subtyp des Harnblasenkarzinoms führen [14, 15].
Symptome, Diagnose und Therapie
In den meisten Fällen wird die Anwesenheit eines Harnblasenkarzinoms durch das
Auftreten einer schmerzfreien, makroskopisch-sichtbaren Hämaturie während der
Miktion angezeigt (bei 80% der Harnblasenkarzinome) [16, 17]. Begleitende
Symptome, die auch von der Lage und Größe des Tumors abhängen, können
Dysurie sowie häufigeres oder dringenderes Wasserlassen sein.
Flanken-, Knochen-, Kopf- und suprapubische Schmerzen, sowie Gewichtsverlust,
Müdigkeit und Anorexie können Zeichen einer bereits weiter fortgeschrittenen oder
metastasierenden Erkrankung sein [18].
Goldstandard für die Detektion von Blasenkarzinomen ist die manuelle oder kamerabasierte Zystoskopie, die mit Hilfe eines flexiblen Zystoskops durch einen Urologen
durchgeführt wird. Dabei wird sowohl die Weißlicht-basierte Zystoskopie, als auch die
Fluoreszenz-Zystoskopie mittels 5’-Aminolävulinsäure (5-ALA) oder deren Ester
(Hexvix®) angewendet. Diese Methode macht malignes Blasengewebe noch besser
sichtbar und ist insbesondere für die Detektion von flachen Urothelveränderungen
wie dem Carcinoma in situ besser geeignet als die Weißlicht-Blasenspiegelung [19].
Zusätzlich zur Zystoskopie wird unterstützend die Urin- bzw. Blasenspül-Zytologie
hinzugezogen, um maligne Zellen zu identifizieren. Dabei werden die zellulären
Bestandteile des Urins zytomorphologisch untersucht und so veränderte Zellen
detektiert. Ausschlaggeben ist dabei zum Beispiel die Kerngröße der vorliegenden
Zellen, das Vorhandensein von Chromatinkondensationen, die Anfärbbarkeit des
Kerns, das Größenverhältnis zwischen Zytoplasma und Kern und die Anzahl von
sichtbaren Mitosen [20]. Mit einer Spezifität von 98%, aber einer geringen Sensitivität
11
Einleitung
von nur 30-40%, insbesondere bei gut differenzierten low-grade Tumoren, sollte die
Zytologie nur in Kombination mit der Zystoskopie durchgeführt werden [21].
Alternativ zur Urin-Zytologie können heute auch Assays zur Detektion bestimmter
molekularer Tumormarker durchgeführt werden [22]. Der UroVysion Test weist
beispielsweise Veränderungen auf den Chromosomen 3, 7, 17 und 9p21 nach [23].
Dabei handelt es sich um genetische Aberrationen, die häufig beim Blasenkarzinom
anzutreffen sind. Außerdem können bestimmte Tumorzell-spezifische Antigene oder
Proteine wie das BTA-stat-BTA-TRAK [24], NMP22 [25], NMP52 oder bestimmte
Cytokeratine, die in Blasenkrebszellen überexprimiert werden (wie 8, 18, 19, 20)
detektiert werden. Auch PCR-basierte diagnostische Tests, wie MikrosatellitenInstabilität oder der TRAP (Telomerase)-Assay werden immer mehr in der Diagnostik
eingesetzt [26, 27]. Allerdings sprechen hier die oft noch zu geringe Sensitivität
und/oder Spezifität, das Fehlen von großen, validierenden Studien und der
vergleichsweise hohe finanzielle Aufwand gegen eine breite Anwendung in der
Routinediagnostik [28].
Zur Erstellung der Diagnose, die die Grundlage für die Auswahl der richtigen
Thearpieform sowie die Abschätzung der Prognose des Patienten darstellt, bedient
sich der Pathologe der sogenannte TNM-Klassifikation. Dabei handelt es sich um ein
international gültiges Codesystem aus Buchstaben und Zahlen, das die anatomische
Ausbreitung und Invasionstiefe des Primärtumors (Stadium bzw. staging, T=Tumor),
sowie
das
Vorhandensein
von
Lymphknotenmetastasen
(N=Node)
oder
Fernmetastasen (M=Metastasis) beschreibt (TNM) [29]. Bei papillären pTa-Tumoren
und dem soliden Carcinoma in situ (pTis/CIS) handelt es sich um nicht-invasive
Tumoren, die nur das Urothel betreffen. Das flach wachsende Carcinoma in situ hat
eine besondere Bedeutung bei der Diagnose und Prognosestellung, da es häufig mit
einer malignen Progression assoziiert ist.
pT1 Tumoren hingegen, dringen bereits in die Lamina propria, eine subepitheliale
Bindegewebsschicht, vor und werden deshalb als frühes invasives Stadium
bezeichnet. pT2 Tumoren dringen bereits in die umliegende Muskulatur vor, pT2a
Tumoren bis in die innere Hälfte der Muskulatur, pT2b-Tumoren bis in die äußere
Hälfte. Beim pT3-Tumor handelt es sich um ein invasives Stadium, das über die
Mukelschicht hinaus bis in das umliegende Fettgewebe vordringt. pT4 Tumoren
12
Einleitung
stellen den höchst möglichen Invasionsgrad dar und wachsen bis in benachbarte
Organe ein (pT4a: Prostata, Gebärmutter, Scheide, pT4b: Becken- oder Bauchwand)
(siehe Abbildung 1-2).
Die Zusätze der N-Kategorie (N0 bis N3) richten sich nach der Anzahl und Lage der
regionär befallenen Lymphknoten. M0 oder M1 bezeichnet die Abwesenheit bzw. das
Vorhandensein
von
Fernmetastasen
[http://www.krebsgesellschaft.de/download
/ll_f_04.pdf].
Abbildung 1-2: Veranschaulichung der verschiedenen
Tumorstadien beim Urothelkarzinom der Harnblase;
bei pTa und pTis handelt es sich um nicht-invasive
Läsionen, bei allen anderen Stadien um invasivwachsende Tumoren; ab einem Stadium von pT2
wächst der Tumor muskelinvasiv.
Zusätzlich zum Staging bestimmt der Pathologe das Grading (G) oder den
Differenzierungsgrad des Tumors. Dabei handelt es sich um die Beschreibung der
strukturellen Veränderungen des Tumorgewebes im Vergleich zu Normalgewebe.
Das Grading liefert wichtige Informationen über die biologischen Eigenschaften und
die Aggressivität des Tumors. Für das Grading von Harnblasenkarzinomen (siehe
Abbildung 1-3) gibt es seit dem Jahre 2004 eine neue WHO-Klassifikation (low-grade
und high-grade Tumoren) [30]. Das 3-stufige System von 1973 (G1, G2 und G3) [31]
wurde aufgehoben und durch das 2-stufige System ersetzt. Bei lg (low-grade, früher
G1 und teils G2)-Tumoren handelt es sich um malignes Gewebe, das aber noch ein
geordnetes Erscheinungsbild aufweist; man spricht dabei auch von hochgradig- oder
gut-differenzierten Tumoren. Im Vergleich dazu spricht man bei high-grade (hg,
früher z.T. G2 und G3) Tumoren von geringgradig- oder schlecht-differenziertem,
malignem Gewebe, dessen Architektur in hohem Maße von der des Normalgewebes
13
Einleitung
abweicht. High-grade Tumoren sind mit einer höheren Progressionsrate und einer
schlechteren Prognose assoziiert, als low-grade Tumoren und sie wachsen meist
invasiv, erfordern oft eine aggressivere und zeitnahe Behandlung, da sonst schnell
Metastasierung eintreten kann [32]. Zusätzlich zu lg und hg-Tumoren wird im neuen
WHO Grading auch die Entität des PUNLMP (papillary urothelial neoplasia with low
malignant potential) eingeführt. Dabei handelt es sich um eine papilläre Veränderung
mit geringem malignem Potential, die kein invasives Wachstum zeigt und ein
niedriges Progressions- und Metastasierungsrisiko aufweist. Deshalb wird das
PUNLMP auch nicht als Karzinom, sondern nur als Neoplasie bezeichnet [33].
Es gibt jedoch bereits Studien, die belegen, dass die dreistufige Grading-Einteilung
der WHO 1973 in invasiven Tumoren besser für die Vorhersage der Progression
geeignet ist, als das aktuelle zweistufige Tumor-Grading [34].
WHO 2004 PUNLMP
WHO 1973
Grade G1
low grade
high grade
Grade G2
Grade G3
Abbildung 1-3: Gegenüberstellung des alten und neuen Grading-Systems der WHO; im System von 1973
wurden noch drei Differenzierungsgrade unterschieden, im aktuellen Grading-System werden die low-grade von
den high-grade Tumoren abgegrenzt; das PUNLMP wurde als neue Entität eingeführt [35].
In 60-70% der Fälle des nicht-muskel-invasiven Harnblasenkarzinoms (<pT2) treten
Rezidive, also wiederkehrende Tumoren auf und in 20-30% kommt es zur
Progression zum muskel-invasiven Karzinom [36]. Die Dauer und Art der Behandlung
hängt dabei meist vom individuellen Risikofaktor des Patienten ab, also von der
Kombination aus Tumorstadium, histologischem Grading, Anzahl und Größe der
Läsionen, dem Intervall der Tumor-Rekurrenz und der körperlichen Konstitution. Bei
„Niedrig-Risiko-Patienten“ treffen dabei die folgenden Parameter zu: pTa, lg, ≤3
kleine (< 3cm) und papilläre Läsionen, das Nichtvorhandensein von CIS und ein
großes Intervall zwischen einem Wiederauftreten der Erkrankung. Alle anderen
Patienten werden der „Hoch-Risiko-Gruppe“ zugeordnet [18]. Die Therapie erfolgt
interdisziplinär und unterscheidet zwischen Niedrig- und Hoch-Risiko-Patienten. Als
initiale Behandlung eines nicht-muskel-invasiven Tumors wird das Tumorareal einer
transurothelialen Resektion (TUR) unterzogen. Bei verdächtigen Läsionen (z.B. pTa
14
Einleitung
hg oder pT1) sollte eine kurzfristige Wiederholung der TUR durchgeführt werden [37].
Zusätzlich kann die Anwendung eines lokalen Chemotherapeutikums (z.B.
Mitomycin) circa sechs Stunden postoperativ zur Anwendung kommen [38]. Diese
Methode senkt die Rezidivwahrscheinlichkeit signifikant (12% bei unifokalen, 20% bei
multifokalen Tumoren). Bei nicht-muskel-invasiven, hoch-Risiko Tumoren (z.B. pT1,
hg) kommt meist auch die Anwendung einer stärkeren, lokalen Therapie zur
Anwendung. Dabei handelt es sich um den abgeschwächten Stamm des Bakteriums
Mycobakterium bovis, der auch als BCG (Bacillus Calmette-Guérin) bezeichnet wird
[39]. Die Bakteriensuspension wird mittels Katheter in die Blase appliziert, wo sie
dann die lokale Immunantwort, sowie bestimmte Zytokine aktiviert und somit einen
Anti-Tumor-Effekt induziert. Auch bei wiederkehrenden Tumoren (Rezidiven), bei
denen initial eine TUR durchgeführt wurde, wird BCG mit Erfolg eingesetzt. Die
Überlebensrate bei nicht-muskel-invasiven Tumoren liegt bei 70-85%. Der Patient
sollte durch eine 3-6-monatige Zystoskopie-Frequenz eventuelle Rekurrenzen,
Persistenz oder Progression abklären lassen. Alle 1-2 Jahre sollte der UrogenitalTrakt auch mittels bildgebender Methoden (wie CT, MRT) visualisiert werden.
Das empfohlene therapeutische Vorgehen bei Patienten mit muskelinvasiven
Erkrankungen ist die radikale Zystektomie, die Entfernung der gesamten Harnblase
mit zusätzlicher Entfernung regionaler Lymphknoten. Bei dieser Art der Therapie
beträgt die progressionsfreie 5-Jahres-Überlebensrate 60-80%. In einigen Fällen
geht der Operation eine neoadjuvante Chemotherapie, wie z.B. mit MVAC
(Methotrexat, Vinblastin, Doxorubicin, Cisplatin) oder GC (Gemcitabin, Cisplatin)
voraus, welche die Gesamt- Überlebenswahrscheinlichkeit nochmals erhöht [40].
Beim metastasierenden oder lokal fortgeschrittenen Blasenkarzinom hat die
Chemotherapie grundsätzlich palliativen Charakter. Metastasen treten vorwiegend in
Lymphknoten, Lunge, Knochen und Leber auf, das ZNS ist seltener betroffen.
Patienten, die eine radikale Zystektomie ablehnen oder deren körperliche
Konstitution eine solch schwerwiegende Operation nicht erlaubt, können auch mit
Blasen-erhaltenden Therapien (z.B. kombinierte Radio-, Chemotherapie) behandelt
werden.
Das Harnblasenkarzinom ist bei zeitiger Erkennung zwar eine gut behandelbare,
aber dennoch chronische und dadurch sehr kostenintensive Erkrankung, die immer
eine lebenslange Nachsorge mit sich bringt.
15
Einleitung
Histologie, Pathogenese und Molekulargenetik des Urothelkarzinoms
Hinsichtlich der Histologie des Urothelkarzinoms werden zwei große Gruppen
unterschieden: man grenzt die papillären Tumoren von den solide wachsenden
Urothelkarzinomen ab. Zur ersten Gruppe gehören alle Tumoren, die ein papilläres
Wachstumsmuster aufweisen, bzw. aus papillären Tumoren hervorgegangen sind.
Diese sind das PUNLMP, das nicht-invasive und das invasive, papilläre
Urothelkarzinom, das urotheliale Papillom und das invertierte Papillom, wobei das
PUNLMP aufgrund der guten Prognose nicht als maligne Neoplasie bzw. Krebs
bezeichnet wird. Beim Papillom bzw. invertierten Papillom handelt es sich um
benigne urotheliale Läsionen ohne Progress und nur sehr seltenen mit Rezidiven.
Die zweite Gruppe der soliden Karzinome (inklusive CIS) zeichnet sich durch ein
flaches, nicht-invasives Wachstum mit großen, unregelmäßig begrenzten und
hyperchromatischen Kernen aus. CIS-Tumoren treten zudem häufig zusammen mit
papillären Tumoren auf und besitzen ein hohes malignes Potential.
Bei den invasiven Karzinomen finden sich die verschiedensten histologischen Typen,
wobei es sich bei der Mehrzahl der pT1-Tumore noch um papilläre low-grade oder
high-grade-Tumoren handelt. Die hoch malignen pT2-pT4 Neoplasien hingegen, sind
fast alle nicht-papillärer Natur mit schlechtem Differenzierungsgrad. Beispiele für
nicht-papilläre invasive Urothelkarzinome sind Plattenepithelkarzinome, solche mit
drüsiger oder trophoblasischer Differenzierung, die „Nested-Variante“, sowie
mikrozystische, mikropapilläre, plasmozytoide, sarkomatoide oder undifferenzierte
Subtypen [30].
Die papillären und soliden Urothelkarzinome unterscheiden sich nicht nur hinsichtlich
ihrer Histologie und Invasionstiefe, sondern auch aufgrund ihres morphologischen
und molekularpathologischen Entstehungsweges. Ausgehend vom normalen Urothel
können zwei präneoplastischen Vorläuferläsionen entstehen: die Hyperplasie und die
Dysplasie [41]. Bei der Hyperplasie handelt es sich um die Vorläuferläsion mit dem
geringeren malignen Potential. Sie wird als verdickte Schleimhaut ohne zytologische
Atypien definiert. Aus ihr entsteht die Mehrheit der nicht-invasiven papillären
Urothelkarzinome (70-80% aller UC), die mit 70% Wahrscheinlichkeit rezidivieren
und mit 15% einen Progress zum invasiven Tumor zeigen.
16
Einleitung
Die Dysplasie ist eine intraurotheliale low-grade Neoplasie, die sich durch den
Verlust
der
Zellpolarität,
durch
nukleäre
und
zytologische
Atypien
(z.B.
unregelmäßige Zellkerngrenzen, veränderte Chromatinverteilung, wenige Mitosen,
etc.) auszeichnet. Aus der Dysplasie entsteht das flache, nicht-invasive, aber
biologisch sehr aggressive Carcinoma in situ (CIS), aus dem sich oftmals schnell ein
muskel-invasives Karzinom entwickelt.
Diesen
beiden
Hauptentstehungswegen
des
Urothelkarzinoms
liegen
auch
unterschiedliche molekulare Alterationen zugrunde. Unabhängig von Grading oder
Staging sind beide Entstehungswege durch initiierende Deletionen auf Chromosom
9p/q charakterisiert [42]. Diese Veränderungen finden sich sowohl in normalem
Urothel
von
Tumorpatienten,
als
auch
in
den
bereits
beschriebenen
Vorläuferläsionen und in mehr als 50% der Tumoren selbst. Dabei kommt es zu einer
Inaktivierung von CDKN2A auf 9p21, was dazu führt, dass P14 und P16 nicht mehr
funktionsfähig sind. Diese beiden Tumorsuppressorgene spielen eine wichtige Rolle
in der Zellzykluskontrolle durch die Inhibition von Cyclin-abhängigen Kinasen [43].
Normalurothel
Deletion Chromosom 9p/q
FGFR3
Deletion
Chromosom
TP53-Alteration
9p/q
Deletion Chromosom 9p/q
Hyperplasie +
Dysplasie/CIS
Hyperplasie
FGFR3
PIK3CA
Cyclin D
HRAS
FGFR3
FGFR3
Cyclin
Cyclin D
D
HRAS
HRAS
nicht-invasiver, papillärer
low-grade Tumor
??
Dysplasie
??
TP53-Alteration
nicht-invasiver, papillärer
high-grade Tumor
Rezidiv
??
Rezidiv
Deletion Chromosom 8p
Deletion Chromosom 11p
Deletion Chromosom 13q
Deletion Chromosom 14q
TP53-Alteration
Verlust von RB
.....
Carcinoma in situ
Verlust von RB
PTEN
MYC, FHIT,
chromosomale Deletionen und
Amplifikationen .....
invasives Karzinom
Metastasierung
Abbildung 1-4: Darstellung der verschiedene molekularen Entstehungswege des Urothelkarzinoms der
Harnblase: es werden zwei Hauptentstehungswege unterschieden: der hyperplastische/papilläre und der
dysplastische/solide Entstehungsweg. Beiden Entstehungswegen liegen unterschiedliche genetische Alterationen
zu Grunde [35].
17
Einleitung
Ein charakteristisches Merkmal des hyperplastischen Entstehungsweges ist das
Auftreten von gain-of-function-Mutationen in den klassischen Onkogenen FGFR3
(fibroblast growth factor receptor 3) und H-RAS (rat sarcoma), was zu einer
konstitutiven
Aktivierung
des
Rezeptor-Tyrosin-Kinase-Ras-MAPK-Signalweges
führt, sowie die Überexpression von CCND1 (cyclin D1). Diese findet sich häufig in
Hyperplasien, Papillomen, sowie nicht-invasiven, papillären low-grade-Karzinomen
(ca. 60%), jedoch nur selten bzw. gar nicht in Dysplasien, CIS und invasiven
Karzinomen. Das Auftreten von FGFR3-Mutationen ist zudem mit einer guten
Prognose assoziiert und nicht selten von einer zusätzlichen Mutation im PIK3CA-Gen
(phosphoinositide-3-kinase, catalytic, alpha polypeptide) begleitet [44]. Sogar bei
invasiven Tumoren kann bei Vorliegen einer FGFR3-Mutation eine verminderte
Progression beobachtet werden.
Der dysplastische Entstehungsweg weißt im Vergleich zum hyperplastischen eine
viel größere genomische Instabilität auf und ist durch eine Aktivierung des
EGFR/ERBB-Signalwegs gekennzeichnet. Häufige chromosomale Alterationen sind
neben Chromosom 9 auch 13q (RB1), 17p (P53), 8p, 3p, 16q (CDH1), 11p
(CDKN1C/P57), 7p (ERBB1/EGFR) und 8q (CMYC). Ein charakteristisches Merkmal
beim CIS und bei invasiven Tumoren ist vor allem das Auftreten von loss-of-functionMutationen in den Tumorsuppressorgenen P53, RB1 und PTEN [45]. Begleitend
findet sich auch aberrante Expression von CDH1 (Zell-Zell-Kontakte), von MatrixMetalloproteinasen (MMPs) und von angiogenese Faktoren, wie VEGF, die die
Tumorprogression und Metastasierung fördern.
Ein möglicher dritter Tumorentstehungsweg könnte über das gleichzeitige Auftreten
von Dysplasien und Hyperplasien und durch die Überschneidung beider molekularer
Pathogenesen zum nicht-invasiven papillären high-grade Tumor (pTa, hg) führen.
Dies konnte aber experimentell noch nicht bestätigt werden [35].
18
Einleitung
1.2
Der Wnt-Signalweg
Man
unterscheidet den
kanonischen
(WNT/CTNNB1) von
mehreren
nicht-
kanonischen (z.B. WNT/Ca2+, WNT/ROR oder WNT/planar cell polarity) WntSignalwegen, wobei es sich beim kanonischen Signalweg um den am besten
untersuchten und auch geläufigsten Wnt-Signalweg handelt [46]. Der WNT/CTNNB1Signalweg soll deshalb auch im Folgenden genauer erläutert werden.
Der kanonische Wnt-Signalweg ist ein molekularer, hoch-konservierter Signalweg der
Zelle, der eine wichtige Rolle während der Embryonal- und Zellentwicklung, beim
normalen Zellwachstum, bei der Zelldifferenzierung, sowie bei der Proliferation spielt.
Er wurde zum ersten Mal bei der Fruchtfliege Drosophila melanogaster identifiziert.
Bei flügellosen Fliegen konnte eine Mutation im sogenannten Wingless-Gen (Wg)
nachgewiesen werden. Außerdem konnten 15 weitere Genloci (z.B. armadillo
entspricht CTNNB1 in Vertebraten oder zeste white 3/shaggy entspricht GSK3ß in
Vertebraten) identifiziert werden, die in mutiertem Zustand zu einer veränderten
Anzahl an Körpersegmenten sowie zu veränderter Polarität im Larvenstadium führten
[47]. Dem Wingless-Säugetier-Homologon, Int1, konnte ebenfalls eine wichtige Rolle
in der Entwicklung zugeschrieben werden. Bei spontanen loss-of-function-Mutationen
in Int1 kommt es zum Beispiel zu einer fehlenden Ausbildung des Kleinhirns. Bei
Überexpression von Int1 im Brustgewebe von Mäusen kommt es hingegen zur
Ausbildung von Tumoren [48]. Damit konnte ein erster Zusammenhang zwischen
dem Auftreten maligner Erkrankungen und dem Wnt-Signalweg hergestellt werden.
Der Name „Wnt“ entstand aus der Kombination von Wg und Int1.
Als Wnt-Onkogene werden all jene Gene angesehen, die durch ihre (Über-)
Expression zu einer verstärkten Aktivität des Wnt-Signalweges führen können (z.B.
Wnt-Liganden, CTNNB1, TCF/LEF). Als Wnt-Tumorsuppressorgene bezeichnet man
hingegen jene Gene, die durch ihren Expressionsverlust zu einer verstärkten WntAktivität führen können, da sie dann ihre Aufgabe als negative Regulatoren nicht
mehr erfüllen können (z.B. SFRP1, DKK, WIF-1, APC, GSK-3ß).
Das zentrale Signalmolekül des Wnt-Signalweges ist ß-Catenin (CTNNB1), welches
das Wnt-Signal der Zelloberfläche in den Nukleus übermittelt und dort zu einer
Veränderung der Transkription führt. In einem aktiven Wnt-Signalweg bindet der von
19
Einleitung
umgebenden Zellen sezernierte Ligand WNT (es gibt derzeit 19 bekannte WNTLiganden)
an
den
Transmembran-Rezeptor
Frizzled
(FZD)
und
an
die
transmembrane Domäne LRP5/6 (low-density lipoprotein receptor-related protein
5/6). Diese werden im Anschluss durch die Casein-Kinase CK1γ und die GlycogenSynthase-Kinase GSK3ß phosphoryliert, wodurch ein weiteres Signalmolekül,
Dishevelled (DVL), zur Zytoplasmamembran rekrutiert wird, wo es mit FZD
interagiert. Dadurch wird der im Zytoplasma befindliche CTNNB1-DestruktionsKomplex bestehend aus APC (adenomatous polyposis coli protein), AXIN und GSK3,
inaktiviert, CTNNB1 im Zytoplasma stabilisiert und schließlich in den Kern
transportiert. Dort bildet CTNNB1 zusammen mit dem Transkriptionsfaktor TCF/LEF
(t-cell factor/lymphoid enhancer factor) einen Transkriptions-aktivierenden Komplex,
der die Transkription der Zielgene des Wnt-Signalwegs initiiert [49]. Beispiele für
Wnt-Zielgene sind CCND1, CMYC, AXIN2, BMP4, BIRC5 (=Survivin) oder CD44.
Bei Abwesenheit eines Wnt-Liganden oder bei Anwesenheit eines Inhibitors (z.B.
Dickkopf (DKK), Wnt-inhibitory factor 1 (WIF-1) oder secreted frizzled-related protein
1 (SFRP1) [50], wird CTNNB1 im Destruktions-Komplex zunächst phosphoryliert, und
mittels E3 Ubiqutin-Ligase TrCP ubiquitiniert, was schließlich zum proteolytischen
Abbau von CTNNB1 und somit zu verminderter Genexpression führt [51]. In
Abbildung 1-5 sind der kanonische, sowie zwei nicht-kanonische Signalwege
schematisch dargestellt.
Verschiedenste Erkrankungen, wie beispielsweise Osteoarthritis [52], Lungenfibrose
[53], Schizophrenie [54] aber auch die Entstehung von Krebs [55] sind mit einer
aberranten Aktivierung des Wnt-Signalweges assoziiert. Erste Zusammenhänge von
Krebs und dem Wnt-Signalweg konnten beim Kolonkarzinom hergestellt werden.
Beim erbliche Syndrom der „adenomatösen Polyposis coli“ ist das danach benannte
APC-Gen mutiert, was schließlich dazu führt, dass CTNNB1 nicht abgebaut werden
kann und somit der Wnt-Signalweg dauerhaft aktiv ist. So bilden sich bei betroffenen
Patienten hunderte von zunächst benignen, adenomatösen Polypen im gesamten
intestinalen Bereich, die aber mit einer Wahrscheinlichkeit von fast 100% maligne
entarten können [56, 57].
20
Einleitung
Abbildung 1-5: Schematische Darstellung des kanonischen und zweier nicht-kanonischer Wnt-Signalwege;
initialer Schritt einer Aktivierung ist die Bindung eines Wnt-Liganden an den Trans Membranen Rezeptor Frizzled;
durch eine CTNNB1-abhängige (a) oder –unabhängige Signalkaskade (b und c) wird die Transkription von Wntdownstream Zielgenen beeinflusst.
Auch beim hepatozellulären Karzinom ist der Wnt-Signalweg involviert. Mit einer
Frequenz von 25-30% treten beim Leberkrebs Punktmutationen im CTNNB1-Gen
auf, welche dazu führen, dass das Protein nicht mehr phosphoryliert und somit nicht
mehr im Proteasom abgebaut werden kann. Mit geringerer Frequenz treten auch
Mutationen in AXIN1-Gen und die beim Kolonkarzinom bereits erwähnten APCMutationen auf. In einer Subgruppe von HCCs scheint aber auch eine
Überexpression von WNT-1 eine große Rolle zu spielen. Die Blockade dieses
Liganden führte zur Inaktivierung des Wnt-Signalwegs und zu verschiedenen antiTumor-Effekten, wie gesteigerter Apoptose und verminderter Blutgefäßbildung [58,
59].
Weitere
Krebserkrankungen,
bei
denen
eine
Mutation
im
CTNNB1-Gen
nachgewiesen wurde, sind unter anderem das Ovarialkarzinom, das anaplastische
Schilddrüsenkarzinom, das Melanom der Haut und das Medulloblastom [60].
Ein klarer Zusammenhang zwischen dem Wnt-Signalweg und dem Auftreten des
Urothelkarzinoms konnte bisher allerdings noch nicht hergestellt werden. Stöhr et al
konnte in einer ersten Studie zeigen, dass beim Harnblasenkarzinom keine
21
Einleitung
aktivierenden Mutationen im CTNNB1- oder APC-Gen vorliegen [61]. Thievessen et
al postulierten daraufhin, dass eine konstitutive Aktivierung des Wnt-Signalweges
unwahrscheinlich sei, was auch das Fehlen der bereits erwähnten Mutationen
erklären könnte [62]. Diese und andere Studien untersuchten beispielsweise auch
den Zusammenhang zwischen CDH1- bzw. JUP- (Plakoglobin) Expression und einer
Wnt-Aktivierung. Eine Überexpression von CDH1 führte dabei zu keiner Inhibition
von TCF-abhängigen Reportergenen, was dann aber einen aktiven Wnt-Signalweg
voraussetzen würde. Die Plakoglobin-Überexpression führte hingegen zu keiner
Aktivierung des Wnt-Signalweges, was wiederum die ersten Thesen stützt, dass der
Wnt-Signalweg im UCC nicht aktiv ist [63].
Mehrere unabhängige Studien konnten dann aber einen Zusammenhang zwischen
epigenetischer Herunterregulation verschiedener Wnt-Gene und dem Auftreten des
Harnblasenkarzinoms herstellen. Hauptsächlich wurde dabei die methylierungsbedingte Inhibition der Wnt-Antagonisten (WIF-1, DKK und verschiedener SFRPs),
sowie auch der WNT-Liganden selbst untersucht [64-66]. Im Urothelkarzinom konnte
zudem auch eine höhere Methylierungsfrequenz von Wnt-Signalwegs-Antagonisten
detektiert werden, als in normalem Urothel. Dies lässt darauf schließen, dass der
Wnt-Signalweg
im
Karzinom
weniger
inhibiert
wird,
als
in
normaler
Blasenschleimwand und es somit zu gesteigerter Proliferation und Progression
kommen kann. Neben einer Promoterhypermethylierung in den Wnt-Inhibitoren,
konnten auch Promotorhypermethylierungen in CTNNB1, sowie CDH1 und APC
detektiert werden [67].
Neben dem Einfluss von epigenetischen Faktoren, die einen Einfluss auf eine
aberrante Wnt-Expression haben können, wird auch eine Interaktion mit anderen
Signalwegen diskutiert. Ahmad et al konnte erst kürzlich einen signifikanten
Zusammenhang
zwischen
dem
MAPK-
und
dem
Wnt-Signalweg
im
Harnblasenkarzinom nachweisen. Dabei konnte nur in den Mäusen ein urothelialer
Tumor innerhalb von 12 Monaten diagnostiziert werden, die eine Mutation in
CTNNB1 und K-RAS trugen. Das Vorliegen von nur einer der beiden Mutationen
genügte jedoch nicht, um einen Tumor innerhalb eines Jahres hervorzurufen [68].
Shin et al zeigten außerdem, dass die regenerative Proliferation von epithelialen
Stammzellen
in
der
Blase
nach
Reizung
durch
chemische
Noxen
oder
Bakterieninfektionen durch ein negatives Feedback zwischen Shh- und WntSignalweg zustande kommt [69]. Ein möglicher Crosstalk von Wnt-Signalweg und
22
Einleitung
weiteren molekularen Signalwegen wird weitläufig diskutiert und untersucht, bedarf
aber noch tiefgehenderer Analysen.
1.3
SFRP1 – secreted frizzled related protein 1
SFRP1, secreted frizzled related protein 1 (auch bekannt als sFRP, FRP1, FRP-1,
FrzA oder SARP2/secreted-apoptosis related protein 2) ist ein ca. 35 kDa schweres,
sezerniertes Glycoprotein der SFRP-Familie, die neben SFRP1 auch SFRP2-5
beinhaltet. SFRP1 enthält eine Cystein-reiche Domäne, die zu etwa 30-50% eine
Sequenzhomologie zur Cystein-reichen Domäne des Frizzled-Rezeptors (FZD)
aufweist. Aus diesem Grund kann SFRP1, genauso wie FZD, den Wnt-Liganden
binden und somit als löslicher, extrazellulärer Antagonist des Wnt-Signalweges
fungieren. Der Genlokus von SFRP1 liegt auf Chromosom 8p12-11.1 (41.119.48141.167.016) und besteht aus 47,5 Kilobasenpaaren (kbp), die in drei verschiedene
Protein-kodierende
Transkripte
umgeschrieben
werden
können:
SFRP1-001
bestehend aus 4488 bp und 314 Aminosäuren, SFRP1-002 bestehend aus 3873
Basenpaaren und 178 Aminosäuren oder SFRP1-003 bestehend aus 1437
Basenpaaren und ebenfalls 314 Aminosäuren im Protein (siehe Abbildung 1-6).
Abbildung 1-6: Schematische Darstellung der drei verschiedenen Transkriptvarianten von SFRP1 [Ensembl]
SFRP1 spielt eine wichtige Rolle in der Entwicklung und wird in vielen adulten
Geweben, wie z.B. in Speicheldrüsen, der Haut, dem Uterus, der Retina, der Niere,
der Brust und dem Herzen exprimiert.
Doch auch bei der Entstehung und dem Verlauf von verschiedensten benignen und
malignen Erkrankungen ist SFRP1 beteiligt. So konnte beispielsweise im uterinen
Leiomyom, beim Glaukom und auch beim Lungenemphysem eine Überexpression
23
Einleitung
von SFRP1 beobachtet werden. Beim Leiomyom konnte kein Zusammenhang mit
Zellproliferation, aber mit
antiapoptotischen Effekten vor allem bei hohen
Östrogenkonzentrationen hergestellt werden [70]. Beim Lungenemphysem ging die
Heraufregulierung mit einer progressiven Gewebezerstörung, beim Glaukom mit
einem steigenden Augeninnendruck einher [71, 72].
Im Gegensatz zu benignen Erkrankungen, scheint SFRP1 bei Karzinomen
verschiedenster Entitäten fast ausschließlich herunterreguliert zu sein. So konnten
unter anderem beim Mamma-, kolorektalen-, ovarialen-, hepatozellulären-und beim
Nierenzell-Karzinom gezeigt werden, dass die SFRP1-Expression vermindert oder
verloren gegangen war. Als häufigster biologischer Mechanismus wurde hierbei die
Promotermethylierung genannt. Dabei wird die Anlagerung der RNA-Polymerase an
den SFRP1-Promotor durch das Vorhandensein von Methylgruppen an den
Cytosinbasen der DNA, verhindert. So kommt es zu einer Verminderung oder
Inhibition der Genexpression. Eine groß-angelegte Studie aus dem Jahre 2007
untersuchte
die
Expression
von
SFRP1
immunhistochemisch
bei
3448
verschiedenen Tumoren aus 36 Organen (132 Tumorsubtypen) und 26 zugehörigen
Normalgeweben [73]. Während in Tumorvorläuferläsionen von beispielsweise Niere,
Endometrium, Nebenniere, etc. noch eine moderate bis starke SFRP1-Expression
beobachtet wurde, konnte im entsprechenden malignen Tumor häufig ein
Expressionverlust nachgewiesen werden. In neun Tumorentitäten (Niere, Magen,
Dünndarm, Pankreas, Nebenniere, Parathyroidea, Gallenblase, Endometrium und
Hoden) konnte der Expressionsverlust zum ersten Mal beschrieben werden.
Beim Brustkrebs konnten Veeck et al eine 61%ige Hypermethylierung bei primären
Mammatumoren mit einem schlechteren Gesamtüberleben korrelieren. Ugolini et al
zeigten außerdem, dass 80% der invasiven Mamma-Tumoren am SFRP1-Promotor
methyliert
waren
und
dies
in
Zusammenhang
mit
der
Anwesenheit
von
Hormonrezeptoren stand [74, 75]. Ähnliche Ergebnisse fanden sich auch beim
Ovarkarzinom, bei dem ebenfalls die Promotermethylierung zur Inhibition des WntAntagonisten und Tumorsuppressors SFRP1 führte [76]. Tanaka et al konnten beim
Kolonkarzinom sogar eine 100%ige Hypermethylierung im SFRP1-Promotor
nachweisen und zudem zeigen, dass SFRP1 der wichtigste Inhibitor des WntSignalweges in MSI-H-Tumoren ist [77]. Auch andere Studien konnten eine
Promotor-Hypermethylierung in SFRP1 im kolorektalen Karzinom nachweisen [78].
Allerdings spricht gegen eine Beteiligung des kanonischen Wnt-Signalweges, dass
24
Einleitung
CTNNB1 in dieser Entität sowieso konstitutiv aktiv ist und eine veränderte SFRP1Expression somit nicht ins Gewicht fällt. Caldwell et al postulierten dann, dass wohl
veränderte nicht-kanonische Wnt-Signale zur SFRP1-bedingten Tumorprogression
führen könnten [79]. Auch im Leberkrebs spricht hypermethyliertes SFRP1 für die
Beteiligung des nicht-kanonischen Signalweges [80].
Für die Beteiligung des kanonischen Wnt-Signalweges spricht wiederum eine Studie
von Gumz et al aus dem Jahre 2007, in der nach Reexpression von SFRP1 in einer
klarzelligen Nierenkarzinomzelllinie neben vermindertem Wachstum auch eine
verminderte Expression von kanonischen Wnt-Zielgenen, wie VEGF, VIM, HIG2,
FN1, u.a. zu beobachten war [81].
Die Rolle von SFRP1 beim Harnblasenkarzinom wurde bisher in nur wenigen Studien
untersucht. In einer 2004 publizierten Vorarbeit unserer eigenen Arbeitsgruppe
konnten Stöhr et al als erste Gruppe einen Expressionsverlust von SFRP1 in 38%
der Tumoren auf mRNA-Ebene und in 66% auf Proteinebene nachweisen. In 25%
der Tumoren wurde ein LOH in SFRP1, in 29% ein methylierter Promoter gefunden
[82]. Eine brasilianische Forschergruppe fand im Jahre 2005 eine Herunterregulation
der mRNA-Expression von SFRP1 in 90% der Fälle. Die Promotormethylierung
wurde
als
einer
der
Hauptmechanismen
der
Herunterregulation
im
Harnblasenkarzinom untersucht. Sechs verschiedene Studien fanden dabei eine
SFRP1-Promotormethylierung zwischen 36,6 und 55,6% [67, 83-87]. Jedoch lagen
den Studien oft verschiedene ethnische Gruppen, heterogene Methoden und auch
unterschiedlich große Fallzahlen zu Grunde, sodass ein Vergleich schwierig ist.
In der hier vorliegenden Arbeit soll der Zusammenhang zwischen der SFRP1Expression und dem Risiko für das Harnblasenkarzinom weiter analysiert werden.
1.4
Chromosomale Verluste auf 8p bei Krebs
Das Chromosom 8 besteht aus dem kurzen Chromosomenarm 8p und dem langen
Arm 8q, die mit mehr als 145 Millionen Basenpaaren etwa 4,5 bis 5% der gesamten
menschlichen DNA repräsentieren. Der Genkatalog von Chromosom 8 enthält 793
Genloci, die aus 614 bekannten Genen, 109 neuen CDS (coding sequences), 43
neuen Transkripten, 14 putativen und 13 Genfragmenten bestehen. Außerdem sind
bereits mindestens 70 nicht-kodierende RNAs (miRNAs), wie z.B. hsa-miR-30b/25
Einleitung
597/-124-1/-3674, bekannt, die ihren Genlokus auf Chromosom 8 haben (Stand
8.11.11, www.mirbase.org; http://www.mirbase.org/cgibin/chrquery.pl?species=hsa&
chromosome=8&start=&end=). Der kurze Arm 8p enthält 45.2 Millionen Basenpaare
(1,5% des Genoms), deren 484 kodierende Gene vor allem eine wichtige Rolle bei
der Entwicklung und der Signalübertragung des Nervensystems spielen [88]. In ihrem
2009 erschienen Review fassen Tabarés-Seisdedos und Rubenstein verschiedene
molekulargenetische und entwicklungsbiologische Studien zusammen, die insgesamt
21 Gene auf 8p identifizierten, die gleichzeitig mit neuropsychiatrischen und
neurodegenerativen Störungen, sowie malignen Erkrankungen einher gingen.
Beispiele für diese Gene sind ADRA1A, DKK4, EGR3, FGFR1, LDL, NRG1 und eben
auch SFRP1 [89]. Außerdem wurden dabei insgesamt 80 mit Krebs assoziierte Gene
genannt.
Chromosomale Alterationen sind ein häufiges Ereignis bei der Krebsentstehung.
Dazu zählen neben Deletionen oder Insertionen einzelner Gene auch chromosomale
Translokationen und Inversionen, sowie der Zugewinn oder Verlust großer
Chromosomenabschnitten oder ganzer Chromosomen. Während manche Krebsarten
ein nahezu diploides Genom mit wenigen Veränderungen der Chromosomenanzahl
oder –struktur aufweisen, gibt es auch andere maligne Erkrankungen, die durch
aneuploide oder polyploide Chromosomensätze charakterisiert sind. Viele Karzinome
zeigen im Verlauf ihrer Progression ausgehend von einem fast diploiden
Chromosomensatz eine Entwicklung über einen fast-tetraploiden Chromosomensatz
bis hin zu einem metastabilen „pseudo-triploiden“ Zustand mit einer mittleren
Chromosomenanzahl von 70, die der eines triploiden Chromosomensatzes
entspricht.
Chromosom 8p-Deletionen sind die häufigsten chromosomalen Alterationen in der
Tumorgenese
von
humanen
Tumoren.
So
wurden
beispielsweise
beim
Adenokarzinom der Lunge, beim kolorektalen Karzinom, beim Nierenzellkarzinom
und beim hepatozellulären Karzinom Verluste in Chromosom 8p, meist über die
konventionelle Array-basierte vergleichende genomische Hybridisierung (array-based
comparative genomic hybridisation, aCGH), nachgewiesen [90-94]. Bei Blasenkrebs
scheinen Verluste des genetischen Materials auf Chromosom 8p mit einer
gesteigerten Progression des Tumors assoziiert zu sein [95]. Bisher konnten aber
noch keine eindeutigen Kandidatengene identifiziert werden. Ziel der Arbeit war es
26
Einleitung
deshalb unter anderem, neue potentielle Progressionsmarker auf 8p für das papilläre
Urothelkarzinom zu identifizieren, die durch diese Deletionen betroffen sind.
Abbildung
1-7:
Schematische
Darstellung von Chromosom 8 mit
Bänderungsmuster; der kurze Arm wird
auch als Chromosom 8p, der lange Arm
als Chromosom 8q bezeichnet; SFRP1
liegt auf dem kurzen Arm bei 8p12-11.1.
1.5
Single Nucleotide Polymorphisms (SNPs) in SFRP1
Single Nucleotide Polymorphisms (SNPs), also Einzelbasen-Polymorphismen sind
natürlich vorkommende und zufällig über das Genom verteilte Variationen einzelner
DNA-Basenpaare, die von Generation zu Generation vererbt werden. Solche
Variationen werden auch als „erfolgreiche“ Punktmutationen bezeichnet, da sie sich
erfolgreich und stabil in den Genpool einer Population etabliert haben. SNPs treten
bei etwa 1% der Bevölkerung auf und es wird vermutet, dass etwa drei bis sechs
Millionen solche Polymorphismen in unserem Erbgut versteckt sind. Ungefähr alle
1000 Basenpaare findet sich statistisch gesehen ein SNP [96]. Etwa 90% aller
genetischen Variationen sind auf SNPs zurückzuführen; sie bestimmen die
Einzigartigkeit
eines
jeden
Individuums
und
sind
auch
die
Ursache
für
charakteristische Merkmale einer Familie, wie beispielsweise die Vererbung einer
27
Einleitung
familientypischen Nasen- oder Mundform oder die Neigung zu Übergewicht oder
nervöser Unruhe. Je nachdem ob der genetische Code durch das Auftreten des SNP
verändert wird, spricht man von synonymen oder nicht-synonymen SNPs. Beim
synonymen SNP codiert das Basentriplett trotzdem noch für die gleiche Aminosäure,
beim
nicht-synonymen
SNP
hingegen
bewirkt
der
Basenaustausch
einen
Aminosäurewechsel. Liegt der SNP in einer proteincodierenden Region (codingSNP,
cSNP) kann der Basensäureaustausch zu einer veränderten Proteinfunktion führen
und somit physiologische Effekte nach sich ziehen. Doch auch beim Auftreten in
einer
nicht-codierenden
DNA-Region,
kann
der
SNP
die
Genexpression
beeinflussen: regulatory SNPs (rSNPs) und structural RNA SNPs (srSNPs) liegen in
Regionen
die
die
Transkription
(z.B.
über
miRNAs)
und
damit
die
Proteinkonzentration verändern oder auch die RNA-Prozessierung und das Spleißen
beeinflussen. Der häufigste Basenaustausch ist der von Cytosin durch Thymin. Dies
kommt dadurch zustande, dass Cytosin im Wirbeltiergenom häufig methyliert ist.
Durch spontan auftretende Desaminierungen wird aus 5-Methylcytosin Thymin [97,
98].
SNPs machen uns nicht nur einzigartig, sondern sie beeinflussen auch die
Prädisposition gegenüber bestimmten Erkrankungen und die Wirksamkeit und
Verträglichkeit von Medikamenten. Deshalb sind sie auch der Hauptfokus vieler
medizinischer oder pharmakologischer Forschungsgruppen. Das SNP-Konsortium
TSC (The SNP Consortium), eine non-profit Organisation aus den USA hat 1999
begonnen alle im menschlichen Genom vorkommenden SNPs zu kartieren. Das
internationale HapMap Projekt hat sich im Jahre 2002 darauf hin zum Ziel gesetzt,
alle krankheitsrelevanten Gene und Haplotypen (Kombinationen gemeinsam
vererbter SNPs) zu identifizieren; unter anderem also auch krankheitsassoziierte
SNPs
[99].
Ein
bekannter
SNP
ist
beispielsweise
der
SNP
rs333
im
Chemokinrezeptor CCR5, der zur Resistenz bzw. sogar zur Immunität gegenüber HIViren führt [100]. Mehrere SNPs in Apo E4 (z.B. rs7412 und rs429358), einer
Variante des Apolipoprotein E, spielen hingegen eine wichtige Rolle bei der
Entstehung von Morbus Alzheimer [101].
Laut dbSNP (http://www.ncbi.nlm.nih.gov/snp) sind für SFRP1 860 humane SNPs
bekannt (Stand: 29.06.2012), wobei aber bisher nur zwei Studien dazu publiziert
wurden. Anne-Marie Sims und Kollegen untersuchten den Zusammenhang zwischen
Knochendichte (bone mineral density, BMD) und den Genotypen von verschiedenen
28
Einleitung
SNPs in SFRP1: bei rs921142, rs4736965, rs10106678 und rs7832749 konnten
signifikante Assoziationen nachgewiesen werden [102]. Ohnaka et al konnten 2009
einen signifikanten Zusammenhang zwischen zwei SNPs in SFRP1 (rs3242 und
rs16890444) und der Lendenwirbel-Knochendichte Wert finden. Sie konnten dabei
den homozygoten TT-Genotyp in rs3242 als denjenigen mit höherer Knochendichte
identifizieren [103]. Eine Assoziation von SNPs in SFRP1 und malignen
Erkrankungen ist nach unserem Kenntnisstand bisher nicht nachgewiesen worden.
1.6
Ziele der Arbeit
Das papilläre Urothelkarzinom der Harnblase ist bei frühzeitiger Erkennung eine
meist
gut
therapierbare,
aber
dennoch
chronische
Erkrankung,
die
einer
lebenslangen und kostenintensiven Nachsorge bedarf. Um eine Verbesserung der
individuellen Behandlung zu erreichen und eine bessere Risikoabschätzung jedes
einzelnen Patienten zu ermöglichen, ist es notwendig neue molekulare Marker zu
identifizieren, die ein eventuelles Fortschreiten der Erkrankung und die Prognose des
Patienten vorhersagen können.
Ziel der hier vorliegenden Doktorarbeit ist es deshalb, den durch Vorarbeiten unserer
Arbeitsgruppe identifizierten potenziellen Progressionsmarker SFRP1 funktionell
weiter zu charakterisieren und ihn in einer prospektiven Studie zu validieren. Dabei
soll besonders die Rolle der für viele andere Tumorentitäten bereits gut
charakterisierten kanonischen Wnt-Signaltransduktion in Abhängigkeit vom WntInhibitor SFRP1 untersucht werden. Für das Harnblasenkarzinom ist die Bedeutung
dieser Signalkaskade für Entstehung und Progression noch weitgehend unklar und
die publizierten Ergebnisse sind widersprüchlich.
Für die funktionelle Charakterisierung von SFRP1 wurde die Expression des WntAntagonisten in Harnblasenkarzinom-Zelllininen untersucht und der Einfluss von
Überexpression, Knockdown und epigenetischen Faktoren in Hinblick auf Viabilität,
Proliferation, Migration und Wnt-Aktivität analysiert. Die parallel durchgeführte
prospektive Studie sollte die klininsche Relevanz von SFRP1-Veränderungen
aufklären. Gleichzeitig wurde der Einfluss von zwei Einzelnukleotid-Polymorphismen
in SFRP1, rs3242 und rs921142, auf das Erkrankungsrisiko untersucht um auch
populationsgenetische Merkmale zu berücksichtigen und eine mögliche Assoziation
29
Einleitung
mit der Erkrankung abzuklären. Dabei wurde zudem der Einfluss von zwei
mikroRNAs (hsa-miR-603 und hsa-miR-3646) auf den rs3242 SNP und die SFRP1
Expression analysiert.
Ein weiteres Ziel war die Identifizierung von neuen Kandidaten-Genen auf
Chromosom
8p,
die
eine
entscheidende
Bedeutung
für
die
allgemeine
Tumorentwicklung und Progression besitzen. Obwohl Veränderungen auf 8p aus fast
allen Tumorentitäten bekannt sind, fehlen bisher potentielle Kandidatengene, die von
diesen chromosomalen Veränderungen betroffen sind. Mittels einer umfassenden
und hoch-auflösenden Analyse des Chromosomenarms 8p in 19 Harnblasentumoren
wollten wir deletierte Bereiche engmaschig eingrenzen und so mögliche KandidatenGene herausarbeiten.
Ein vielversprechendes identifiziertes Gen, MTUS1, wurde ebenfalls funktionell in
Zellkulturexperimenten
validiert
und
auf
30
klinische
Relevanz
überprüft.
Material und Methoden
2
Material und Methoden
2.1
Material
Standard-Chemikalien, -Reagenziensätze, -Lösungen, -Puffer und -Gerätschaften,
die im Zusammenhang mit Kooperationsprojekten von anderen Laboren genutzt
wurden, tauchen im Materialteil der hier vorliegenden Arbeit nicht auf; an
entsprechender Stelle wird aber darauf hingewiesen.
2.1.1 Patientenmaterial
Für alle verwendeten Erlanger Patientenmaterialien lag ein Ethikvotum (17.1.2011)
für den retrospektiven Gebrauch von Gewebeproben im Rahmen der CCCGewebebank Erlangen (Stellungnahme vom 12.4.11 und 24.01.05) des UK Erlangen
vor. Die Ethik-Kommission der Friedrich-Alexander-Universität Erlangen-Nürnberg
hatte den entsprechenden Antrag überprüft und genehmigt. Die Verwendung von
Patientengewebe aus dem UK Regensburg wurde mit dem Ethik-Antrag Nr. 4157-CH
abgedeckt. Das Grading der Tumoren erfolgte, je nach Alter des Materials, nach der
WHO 1973 (G1-G3) [31]oder nach der neuen WHO Klassifikation von 2004 (lg und
hg) [30].
Tissue Micro Array papillärer Harnblasenkarzinome
Zur Untersuchung papillärer Urothelkarzinome wurden drei tissue micro arrays
(TMAs) aus insgesamt 143 Tumoren von 91 Patienten (67 Männer, 24 Frauen)
erstellt. Es wurden dabei alle geeigneten, im Jahre 2008 in der Erlanger Tumorbank
asservierten, papillären Harnblasentumoren, samt aller zusätzlich aufgetretenen
papillären Tumoren der gleichen Patienten aus anderen Jahren (z.B. bei Rezidiven)
verwendet. Die Patienten waren zwischen 29 und 97 Jahren alt, das DurchschnittsAlter betrug etwa 70 Jahre (Median 72 Jahre, ±11,4 Jahre). Charakteristische
Parameter des Patientenkollektivs sind in Tabelle 2-1 zusammengestellt.
Es handelte sich um 89 nicht-invasive (pTa und PUNLMP) und 54 invasivwachsende (pT1-4) Tumoren, 70 Fälle waren low-grade und 70 Fälle high-grade.
31
Material und Methoden
Parameter
Eigenschaften
Anzahl Patienten
n = 91
Anzahl Tumoren
n = 143
Alter
Mittelwert: 70,3 Jahre
Median: 72 Jahre (± 11,4 Jahre)
Range: 29 – 97 Jahre
Geschlecht
männlich: n= 67 (73,6%)
weiblich: n = 24 (26,4%)
Verhältnis Mann : Frau = 2,8 : 1
Stage
PUNLMP n = 1
pTa n = 88
pT1 n = 43
pT2-4 n = 11
Grade
lg n = 70
hg n = 70
lg + hg n = 1
k.A. n = 2
Tabelle 2-1: Wichtige Eigenschaften und histopathologische Parameter des Patientenkollektivs des papillären
Tissue Micro Arrays; es setze sich aus 143 papillären Tumoren von 91 Patienten zusammen.
Die TMAs der papillären Harnblasentumoren wurden immunhistochemisch mit
Antikörpern gegen die folgenden Proteine gefärbt: SFRP1, MTUS1, TP53, KI67/MIB,
CK20. Die klinischen Follow-up Daten wurden in Zusammenarbeit mit dem
Tumorzentrum Erlangen (TUZ, Fr. Dr. Petsch, Herr Schick) und der Urologischen
Klinik/Waldkrankenhaus des Universitätsklinikums Erlangen erhoben.
Tissue Micro Array fortgeschrittener Harnblasenkarzinome
Neben den papillären TMAs wurden außerdem sechs TMAs mit fortgeschrittenen
Harnblasenkarzinomen (mind. pT2 mit/ohne Metastasen, alle Patienten mit
Zystektomie) immunhistochemisch gefärbt (SFRP1, MTUS1). Die Tumoren dieser
TMAs stammen aus einer Chemotherapie-Studie aus dem Jahr 2005 mit
ursprünglich 327 Patienten [104]. Für die Studie lag ein positives Ethikvotum der
„Arbeitsgemeinschaft Urologische Onkologie“ der Deutschen Krebsgesellschaft,
sowie der lokalen Ethikkommissionen der teilnehmender Zentren und Kliniken vor.
32
Material und Methoden
Die
histopathologischen
Patientendaten
sind
in
eben
dieser
Publikation
zusammengefasst.
Vergleichende genomische Hybridisierung (aCGH) in papillären Harnblasentumoren
Mit Hilfe der aCGH (array-based comparative genomic hybridisation) wurde das
Genom von insgesamt 19 papillären Tumoren (neun nicht-invasive pTa-Tumoren und
zehn invasive pT1-Tumoren) verglichen. Dazu wurde das kryokonservierte
Tumorgewebe zuerst manuell mikrodisseziert und dann daraus die DNA isoliert. Die
Daten aller 19 Tumor-Patienten sind in Tabelle 2-2 zusammengefasst.
Tumor
Geschlecht
Alter
Stage
Grade
pTa_1
männlich
53
pTa
low grade
pTa_2
männlich
57
pTa
high grade
pTa_3
weiblich
71
pTa
low grade
pTa_4
männlich
68
pTa
low grade
pTa_5
männlich
95
pTa
low grade
pTa_6
männlich
76
pTa
high grade
pTa_7
männlich
66
pTa
low grade
pTa_8
weiblich
61
pTa
low grade
pTa_9
weiblich
55
pTa
high grade
pT1_1
weiblich
72
pT1
high grade
pT1_2
weiblich
74
pT1
high grade
pT1_3
männlich
64
pT1
high grade
pT1_4
männlich
79
pT1
high grade
pT1_5
männlich
68
pT1
high grade
pT1_6
männlich
68
pT1
high grade
pT1_7
männlich
62
pT1
high grade
pT1_8
männlich
79
pT1
high grade
pT1_9
männlich
75
pT1
high grade
pT1_10
männlich
73
pT1
high grade
Tabelle 2-2: Zusammenfassung der kliniko- und histopathologischen Parameter der Patienten-Kohorte für die
array-CGH. Der Altersdurchschnitt betrug bei Patienten mit pTa-Tumoren 67 Jahre, bei Patienten mit pT1Tumoren 71 Jahre.
33
Material und Methoden
Untersuchung der MTUS1-Expression in Harnblasenkarzinom-Gewebe
Für die initiale Analyse der Expression von MTUS1 in Harnblasenkarzinom-Gewebe
mittels qRT-PCR und Westernblot wurden in der AG Uropathologie sechs willkürliche
Tumoren
aus
der
Tumorbank
ausgewählt,
deren
Daten
in
Tabelle
2-3
zusammengefasst sind.
Tumor
Geschlecht
Alter
Stage
Grade
Probe 1
männlich
67
pTa
G2
Probe 2
weiblich
61
pT1
G3
Probe 3
männlich
50
pTa
G2
Probe 4
männlich
64
pTa
G2
Probe 5
männlich
66
pT1
G3
Probe 6
männlich
47
pTa
G2
Tabelle 2-3: Zusammenfassung der kliniko- und histopathologischen Parameter der sechs Harnblasen-Tumoren
für die Analyse der MTUS1-Expression.
Analyse der SFRP1 SNPs rs3242 und rs921142 in Harnblasenkarzinom-Gewebe
Die bei der Analyse der SNPs rs3242 und rs921142 verwendeten DNA-Proben
waren in der AG Uropathologie verfügbar und entstammten dem Universitätsklinikum
Regensburg, wo auch die DNA isoliert wurde. Insgesamt wurde für die kaukasische
Fall-Kontroll-Studie die aus Blut und normalem, nicht malignem Blasengewebe
gewonnene DNA von 732 (rs3242) bzw. 618 (rs921142) Patienten untersucht. Davon
waren 332 bzw. 328 Patienten der Kontroll-Gruppe („Kontrollen“; ohne maligne
Tumor-Läsion) zugeordnet. Von den 403 bzw. 290 Tumor-Patienten („Fälle alle“)
handelte es sich in 188 bzw. 184 Fällen um Patienten einer konsekutiven
Harnblasenkarzinom-Studie (konsekutive Studie, „Fälle KS“). Bei den restlichen 215
bzw. 106 Patienten handelte es sich um so genannte Early-Onset Patienten, bei
denen der Tumor vor dem 45. Lebensjahr diagnostiziert wurde (Junge Patienten,
„Fälle JP“). Die unterschiedliche Größe des Studienkollektivs ist jeweils auf die
divergente Verfügbarkeit des DNA-Materials zurückzuführen. Die kliniko- und histopathologischen Parameter des gesamten Patienten-Kollektivs sind in den Tabellen 24 und 2-5 zusammengefasst.
34
Material und Methoden
rs3242
Kontrollen
Fälle alle
Fälle KS
Fälle JP
n = 332
n = 403
n = 188
n = 215
Median
69
55
69
41
Mittelwert
67,65
52,8 (±9,145)
67,06
38,61 (±5,74)
Altersbereich
(±10,75)
17-88
(±12,55)
17-45
unbekannt
24-94
n = 20
27-88
n = 20
Anzahl
Alter
n=0
Geschlecht
Stage
n=0
männlich
n = 313
n = 185
n = 143
n = 42
weiblich
n = 19
n = 64
n = 45
n = 19
unbekannt
n=0
n = 154
n=0
n = 154
pTa
-
n = 147
n = 84
n = 63
pT1
-
n = 57
n = 37
n = 20
pT2 - pT4
-
n = 56
n = 28
n = 28
CIS + pTx)
-
n = 51
n = 39
n = 12
unbekannt
-
n = 92
n=0
n = 92
G1
-
n = 75
n = 42
n = 33
G2
-
n = 112
n = 69
n = 43
G3
-
n = 97
n = 66
n = 31
unbekannt
-
n = 119
n = 11
n = 108
Andere (inkl.
Grade
Tabelle 2-4: Zusammenfassung der kliniko- und histopathologischen Parameter der Patienten, die bezüglich des
SFRP1 SNPs rs3242 analysiert wurden.
rs921142
Kontrollen
Fälle alle
Fälle KS
Fälle JP
n = 328
n = 290
n = 184
n = 106
Median
69
61
70
41
Mittelwert
67,6 (±10,8)
57,8 (±17,6)
67,2 (±12,9)
38,2 (±6,6)
Altersbereich
24-94
17-88
27-88
17-45
unbekannt
n=0
n = 17
n=0
n = 17
männlich
n = 309
n = 200
n = 141
n = 59
weiblich
n = 19
n = 64
n = 43
n = 21
unbekannt
n=0
n = 26
n=0
n = 26
Papillom
-
n=4
n=0
n=4
PUNLMP
-
n=1
n=1
n=0
CIS
-
n = 22
n = 19
n=3
pTa
-
n = 105
n = 82
n = 23
Anzahl
Alter
Geschlecht
Stage
35
Material und Methoden
Grade
pT1
-
n = 41
n = 35
n=6
pT2 - pT4
-
n = 46
n = 29
n = 17
pTx
-
n = 18
n = 18
n=0
unbekannt
-
n = 53
n=0
n = 53
G1
-
n = 55
n = 41
n = 14
G2
-
n = 76
n = 65
n = 11
G3
-
n = 83
n = 67
n = 16
G1-2
-
n=1
n=0
n=1
G1+3
-
n=1
n=0
n=1
unbekannt
-
n = 74
n = 11
n = 63
Tabelle 2-5: Zusammenfassung der kliniko- und histopathologischen Parameter der Patienten, die bezüglich des
SFRP1 SNPs rs921142 analysiert wurden.
Analyse der mikroRNA Expression in Harnblasenkarzinom-Gewebe
Für die Analyse der mikroRNA-Expression, wurden sieben Patienten mit papillärem
Urothelkarzinom ausgewählt. Die entsprechenden Parameter sind in Tabelle 2-6 zu
sehen.
Patient #
Geschlecht
Alter
Stadium
Grad
Patient 1
männlich
66
pTa
G2
Patient 2
weiblich
61
pT1
G3
Patient 3
männlich
50
pTa
G2
Patient 4
männlich
64
pTa
G1
Patient 5
männlich
67
pTa
G1
Patient 6
männlich
66
pT1
G3
Patient 7
männlich
46
pTa
G2
Tabelle 2-6: Zusammenfassung der kliniko- und histopathologischen Parameter der sieben Harnblasen-Tumoren,
die für die Expressionsanalyse der mikroRNA-603 und -3646 ausgewählt wurden.
36
Material und Methoden
2.1.2 Zelllinien
Für die funktionellen Untersuchungen der SFRP1-, der MTUS1- und der miRNAExpression wurden vier verschiedene Blasenkrebszelllinien (RT112, RT4, J82 und
BFTC905) [105-108], sowie die zwei immortalisierte Normal-Urothelzelllinine UROtsa
[109] und HCV29 [110] verwendet. Außerdem stand von der Arbeitsgruppe
Molekulare
Urologie
der
Urologischen
Klinik
(Prof.
Wullich)
eine
primäre
Urothelzelllinie zur Verfügung. Sie wurde aus einem Prostata-Zystektomie-Präparat
gewonnen. Als diverse Kontrollen dienten die Prostatakarzinomzelllinie LNCaP
(Positivkontrolle
MTUS1-Expression)
[111],
die
Melanomzellline
SK-Mel-28
(Positivkontrolle SFRP1-Expression) [112] und die Kolonkarzinomzelllinie SW480
(Positivkontrolle TOP/FOP Assay) [113]. Die androgen-abhängige Zelllinie LNCaP
wurde ebenfalls von der AG Molekulare Urologie bereitgestellt. Die Zellen wurden
alle bei 37°C, 5% CO2-Gehalt in RPMI-Medium kultiviert. Die Eigenschaften der
Zelllinien sind in folgender Tabelle 2-7 zusammen gestellt.
Zelllinie
RT112
Eigenschaften
 Harnblasenkarzinom-Zelllinie;
papillären
primären
etabliert
pTxG2-Tumor
aus
einer
einem
unbehandelten,
kaukasischen
Frau
unbekannten Alters (1973)
 Morphologie: adhärente Epithelzellen (Monolayer), Verdopplungszeit 35
Stunden
RT4
 Harnblasenkarzinom-Zelllinie;
etabliert
aus
papillärem
pT2G1-
Blasenrezidiv eines 63-jährigen Mannes (1968)
 Morphologie: adhärente epithel-ähnliche Zellen (Monolayer)
J82
 Harnblasenkarzinom-Zelllinie; etabliert aus solidem pT3G3-Tumor eines
58-jährigen kaukasischen Mannes (1972)
 Morphologie: adhärente Epithelzellen
BFTC905
 Harnblasenkarzinom-Zelllinie; etabliert aus papillärem G3-Tumor einer
51-jährigen chinesischen Frau (1990)
 Morphologie: adhärente Epithelzellen (Monolayer, große Inseln)
UROtsa
 Normal-Urothel-Zelllinie; immortalisiert mit SV40 T-Antigen-Genkonstrukt
 Morphologie: tropfenförmige Zellen
HCV29
 Normal-Urothel-Zelllinie; transformiertes nicht-malignes Blasenepithel
37
Material und Methoden
SK-Mel-28
 Maligne Melanom-Zelllinie, etabliert aus einem Tumor eines 51-jährigen
Mannes
 Morphologie: adhärente, polygonale Zellen (Monolayer)
SW480
 Kolorektale Adenokarzinom-Zelllinie, etabliert aus einem primären
Dukes’ Typ B-Tumor, etabliert von 50-jährigem kaukasischen Mann
 Morphologie: adhärente Epithelzellen (Monolayer)
LNCaP
 Prostatakarzinom-Zelllinie;
Lymphknoten-Metastase
androgen-abhängig;
eines
50-jährigen
etabliert
aus
Mannes
mit
Prostatakarzinom (1977)
 Morphologie: adhärente Fibroblasten (Aggregate und einzelne Zellen)
Tabelle 2-7: Übersicht über die verwendeten Zelllinien mit Angaben über ihre wichtigsten Eigenschaften,
Herkunft und Morphologie.
2.1.3 Bakterienstamm
Für die Amplifikation von Plasmiden (Midi- oder Maxi-Prep) wurde der im TOPO TA
Cloning Kit for Sequencing enthaltenen Escherichia coli Stamm TOP10 (Genotyp: FmcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697
galU galK rpsL (StrR) endA1 nupG) verwendet. Die Bakterien sind chemisch- sowie
elektrokompetent und werden bei -80°C gelagert
2.1.4 Chemikalien und Reagenzien
Chemikalie/ Reagenz
Hersteller*
1,4-Dithiothreitol (DTT)
Roth
10x NEBuffer 2
New England BioLabs
10x NEBuffer 3
New England BioLabs
10x NEBuffer 4
New England BioLabs
10x NEBuffer EcoRI
New England BioLabs
10x Rotiphorese TBE-Puffer
Roth
10x TG (Tris/Glycine) Buffer
Bio-Rad
10x TGS (Tris/Glycine/SDS) Buffer
Bio-Rad
2-Mercaptoethanol
Roth
2-Propanol
Roth
2x Power SYBR® Green PCR Master-Mix
Applied Biosystems
38
Material und Methoden
2x QIAGEN® Multiplex PCR Master-Mix
Qiagen
40 % Acrylamide/ Bis solution, 29:1
Bio-Rad
50x TAE Electrophoresis Buffer
Fermentas
5-Aza-2‘-deoxycytidin
Sigma-Aldrich
5x Colorless (Green) GoTaq Reaction Buffer
Promega
Aceton ROTIPURAN®
Roth
AEC (3-Amino-9-Ethylcarbazol), 90%
Sigma
Agar-Agar, Kobe I
Roth
Agarose LE
Biozym
Albumin (BSA)
Sigma®
Ampicillin Natriumsalz
Roth
APS
Roth
®
Aquatex
Merck
Biozym LE Agarose
Biozym
Borax
March
Bromphenolblau
Sigma®
BSA für Restriktionsenzym-Verdau
New England Biolabs
BSA-Pulver
Roth
Buffer solutions pH 4 (pH7)
VWR
complete Mini Protease Inhibitor Cocktail Tablets
Roche
DEPC Treated Water (DNase/ RNase Free)
Bioline
Dimethyl Sulphoxide (DMSO)
Sigma®
DMF (Dimethylformamid)
Roth
DPBS
Invitrogen
EDTA (
Roth
Essigsäure (96%)
Roth
®
Ethanol ROTIPURAN
Roth
Ethidiumbromidlösung 0,5 %
Roth
FCS
Pan-Biotech
FuGene HD Transfektions-Reagenz
Roche
G-418 Seletions-Antibiotikum (50mg/ml)
Roche
GeneScanTM -120LIZTM Size Standard
Applied Biosystems
Glycerol
Sigma®
Glycin
Roth
Hämalaun
Roth
39
Material und Methoden
HEPES
Roth
Hi-DiTM Formamide 3500 Dx Series
Applied Biosystems
ImmobilonTM Western Chemiluminescent HRP Substrate
Millipore
Immunoblot Blocking Reagent (non-fat-dry milk)
Millipore
Kaliumchlorid
Roth
LB-Medium (Lennox)
Roth
L-Glutamin, 200mM
Pan-Biotech
Magnesiumchlorid
Fermentas
MegaTran 1.0 Transfektions-Reagenz
OriGene
Methanol
Roth
Methylenblau (Löfflers)
Roth
Milchpulver
Roth
Natriumacetat-Trihydrat (IH, Amanns)
Roth
Natriumchlorid
Roth
Natriumhydroxid
Roth
Natriumpyruvat, 100mM
Pan-Biotech
NHS - LC - Biotin
Thermo Scientific
Opti-MEM
Invitrogen
PerfeCta Sybr Green Super Mix (low ROX)
Quanta Biosciences
Ponceau S
Roth
Puromycin Selektions-Antibiotikum (10mg/ml)
InvivoGen
TM
Restore
Western Blot Stripping Buffer
Thermo Scientific
RNase-free water
Qiagen
Rotiphorese® 10x TBE Puffer
Roth
Rotistock 20 % SDS
Roth
RPMI 1640 Medium
Invitrogen
S-Adenosylmethionin (SAM, 200x)
NEB
SAHA
Biozol
Salzsäure rauchend ROTIPURAN® 37 %
Roth
SNaPshot® Multiplex Ready Reaction Mix
Applied Biosystems
TaqMan Universal Master Mix (2x)
Applied Biosystems
TEMED
Roth
Trichostatin A
TRIS (Ultra Qualität) PUFFERAN
Sigma-Aldrich
®
Roth
Triton X-100
AppliChem
40
Material und Methoden
Trypan Blue Solution 0,4 %
Sigma®
Trypsin 0,25 %ig / 0,02 % EDTA in PBS ohne Ca2+, Mg2+
Pan-Biotech
TurboFectin TM 8.0 Transfektions-Reagenz
OriGene
®
Tween 20
Roth
Tyramin – Hydrochlorid
Sigma®
Wasserstoffperoxid 30 % ROTIPURAN®
Roth
Zitronensäure-Monohydrat
Roth
Tabelle 2-8: Auflistung aller verwendeten Chemikalien und Reagenzien mit Herstellerangaben
*Weitere Angaben zu allen im Material und Methoden-Teil aufgelisteten Herstellern befinden sich in Anhang.
2.1.5
Lösungen und Puffer
Lösung/ Puffer
1x Protein-Lysepuffer (WB)
5x Protein-Ladepuffer (WB)
Trenngel (7,5 %) (WB)
Sammelgel (WB)
Inhalt
Menge
NaCl (5 M)
7,5 ml
Tris/ HCl (1 M; pH 7,2)
12,5 ml
Triton X (100x)
2,5 ml
20% SDS
625 μl
EDTA (0,5 M; pH 8)
2,5 ml
DTT (2 M)
125 μl
Aqua dest.
ad 250 ml
Tris-HCl (pH 6,8)
0,313 M
SDS
10 %
Bromphenolblau
0,05 %
Glycerol
50 %
Tris (1,5 M; pH 8,8)
2,5 ml
10 % SDS
200 μl
40 % Acrylamide/ Bis solution (29:1)
1,9 ml
10 % APS
200 μl
TEMED
20 μl
Aqua dest.
5,4 ml
Tris (1,0 M; pH 6,8)
380 μl
10 % SDS
30 μl
40 % Acrylamide/ Bis solution (29:1)
375 μl
10 % APS
30 μl
TEMED
3 μl
Aqua dest.
2,185 ml
41
Material und Methoden
1x Tris-Glycin-SDS-Laufpuffer (WB)
Towbin-Blotting-Puffer (WB)
10x TBS/Tween Waschpuffer (WB)
10x TGS Puffer
100 ml
Aqua dest.
900 ml
10x TG Puffer
100 ml
Methanol
200 ml
Aqua dest.
700 ml
Tris (Pulver)
24,2 g
NaCl
80 g
HCl
38 ml
Tween-20
5 ml
Aqua dest.
ad 1 l
pH 7,6 einstellen mit HCl
1x TBS/Tween Puffer (WB)
Tris-Waschpuffer (IHC)
10x TBS/Tween Puffer
100 ml
Aqua dest.
900 ml
Tris (Pulver)
6,1 g
NaCl
9g
Aqua dest.
add 1 l
pH 7,4 einstellen mit HCl
Zitronensäure-Puffer (IHC)
Citronensäure Monohydrat
2,1 g
Aqua dest.
ad 1 l
pH 6,0 einstellen mit HCl
Borat-Puffer (IHC)
Stammlösung A (19,007 g Borax +
83,5 ml
1000 ml Aqua dest.)
Stammlösung B (0,1 N HCl)
16,5 ml
pH 9,0 einstellen
BT-Reagenz (IHC)
TSA-Lösung (IHC)
Aceat-Puffer 1M pH 5,5 (20x) (IHC)
AEC-Stock-Solution (1%) (IHC)
Borat-Puffer
40 ml
NHS - LC - Biotin
0,1 g
Tyramin - Hydrochlorid
0,03 g
Tris-Puffer
500 μl
BT-Reagenz
2,5 μl
30% Wasserstoffperoxid
1,5 μl
Natriumacetat-Trihydrat
13,6 g
Aqua dest
100 ml
pH 5,5 einstellen mit Essigsäure 96%
ca. 400 µl
AEC 90%
0,1 g
DMF
10 ml
42
Material und Methoden
AEC-Working-Solution (IHC)
Wasserstoffperoxid 3% (IHC)
Wasserstoffperoxid 0,3% (IHC)
RPMI Arbeitslösung
SAM-Arbeitslösung 40x
TAE-Electrophoresis Buffer (1x)
TBE-Roitphorese Puffer (0,5x)
Ethidiumbromid-Arbeitslösung
Acetatpuffer
1 ml
AEC-Stock
1Tropfen
H2O2 0,3%
1 Tropfen
Wasserstoffperoxid 30%
5 ml
Tris pH7,4
45 ml
Wasserstoffperoxid 30%
100 µl
Aqua dest.
10 ml
RPMI Fertigmedium
500 ml
FCS
50ml (10%)
L-Glutamin
5 ml (1%)
Sodium-Pyruvat
5 ml (1%)
SAM 200x
1µl
Wasser
add 20µl
10x TAE Puffer
20ml
Aqua dest.
980ml
10x Rotiphorese TBE
50ml
Aqua dest.
950ml
0,5x TBE Puffer
500ml
Ethidiumbromid (0,5%, 5mg/ml)
5 Tropfen
Tabelle 2-9: Auflistung aller verwendeten Lösungen und Puffer. Die Bezeichnungen WB (für Westernblot) bzw.
IHC (für Immunhistochemie) geben an, bei welcher Methode die jeweilige Lösung/ der jeweilige Puffer zum
Einsatz kam.
2.1.6 Kommerzielle Reagenziensätze (Kits)
Kit mit Inhalt
Hersteller
AEC Peroxidase Substrate Kit
Vector Laboratories
BigDye® Terminator v1.1 Cycle Sequencing Kit
Applied Biosystems
DyeEx® 2.0 Spin Kit
Qiagen
NucleoBond® Xtra Midi Kit
Machery Nagel
Pierce® BCA Protein Assay Kit
Thermo Scientific
QIA58 BrdU Cell Proliferation Assay
Merck
QIAshredderTM
Qiagen
RNeasy® Mini Kit
Qiagen
RevertAidTM Minus First Strand cDNA Synthesis Kit
Fermentas
VECTASTAIN Elite ABC Kit
Vector Laboratories
TOPO TA Cloning Kit
Invitrogen
43
Material und Methoden
RNase-free DNAse Set
Qiagen, Hilden
QIAamp DNA Mini Kit
Qiagen, Hilden
CellTiter-Glo Luminescent Cell Viability Assay
Promega
BrdU Cell Proliferation Assay
Calbiochem/Merck
Dual-Luciferase Reporter Assay System
Promega
siRNA Reagent System
Santa Cruz
Amaxa Cell Line Nuleofactor Kit V
Lonza
U ultra View DAB (für IHC Färbeautomat)
Ventana
TaqMan MicroRNA Reverse Transcription Kit
Applied Biosystems
High Pure PCR Template Preparation Kit
Roche
TSA TM Indirect (Tyramide Signal Amplification)
Perkin Elmer
qScript microRNA Synthesis Kit
Quanta
Tabelle 2-10: Auflistung aller verwendeten kommerziellen Reagenzien-Sätze mit Angabe des Herstellers.
2.1.7 Nukleinsäuren
Primer
Alle Primer Stock-Lösungen haben eine Konzentration von 100µM.
Sequenz (5’ → 3’)
Primer
Primer für konventionelle RT-PCR:
GAPDH (Metabion)
- forward: TGGTCACCAGGGCTGCTT
- reverse: GTCTTCTGGGTGGCAGTGAT
SFRP1 (Metabion)
- forward: CACAACGTGGGCTACAAGAA
- reverse: GAAGTGGTGGCTGAGGTTGT
Primer für methylierungsspezifische PCR
SFRP1_methyliert (Metabion)
- forward: TGTAGTTTTCGGAGTTAGTGTCGCGC
- reverse: CCTACGATCGAAAACGACGCGAACG
SFRP1_unmethyliert (Metabion)
- forward: GTTTTGTAGTTTTTGGAGTTAGTGTTGTGT
- reverse: CTCAACCTACAATCAAAAACAACACAAACA
Primer für quantitative real-time PCR:
AXIN2 (Metabion)
- forward: CTGGCTCCAGAAGATCACAAAG
- reverse: ATCTCCTCAAACACCGCTCCA
BMP4 (Metabion)
- forward: ACTGGTCCACCACAATGTGACACG
- reverse: GCTGAAGTCCACATAGAGCGAGTG
CD44 (Metabion)
- forward: TTCATCCTCGGGTGTGCTAT
44
Material und Methoden
- reverse: GTACACCCCAACCTCAGTGG
CMYC (Metabion)
- forward: TGAGGAGACACCGCCCAC
- reverse: CAACATCGATTTCTTCCTCATCTTC
CCND1 (Metabion)
- forward: CCGAGAAGCTGTGCATCTACAC
- reverse: AGGTTCCACTTGAGCTTGTTCAC
SFRP1(Metabion)
- forward: CTACTGGCCCGAGATGCTTA
- reverse: GCTGGCACAGAGATGTTCAA
GAPDH (Metabion)
- forward: TGGTCACCAGGGCTGCTT
- reverse: AGCTTCCCGTTCTCAGCC
MTUS1 (Metabion)
- forward: AGCTTCGGGACACTTACATT
- reverse: ATAGGCCTTCTTTAGCAATTC
Primer für SNP-Analyse:
SFRP1_rs3242 (Metabion)
- forward: CCAGATGTTTTGATGTTATCG
- reverse: TCACAGCTCACAGTATCATTG
SFRP1_rs921142 (Metabion)
- forward: TCAGGAGTGCACTGGATTTAG
- reverse: CCCAAGTCAGGAGTAAATCTC
Primer für Mutations-Analyse: (alle von Metabion)

FGFR3 (Multiplex, Exon 7)
- forward: AGTGGCGGTGGTGGTGAGGGAG
- reverse: GCACCGCCGTCTGGTTGG

FGFR3 (Multiplex, Exon 10)
- forward: CAACGCCCATGTCTTTGCAG
- reverse: AGGCGGCAGAGCGTCACAG

FGFR3 (Multiplex, Exon 15)
- forward: GACCGAGGACAACGTGATG
- reverse: GTGTGGGAAGGCGGTGGTG

PIK3CA (Multiplex, Exon 9)
- forward: AGTAACAGACTAGCTAGAGA
- reverse: ATTTTAGCACTTACCTGTGAC

PIK3CA (Multiplex, Exon 15)
- forward: GACCCTAGCCTTAGATAAAAC
- reverse: GTGGAAGATCCAATCCATTT

FGFR3 (SNaPshot, R248C)
T(46) CGTCATCTGCCCCCACAGAG

FGFR3 (SNaPshot, S249C)
T(36) TCTGCCCCCACAGAGCGCT
T(28) TCTGCCCCCACAGAGCGCT

FGFR3 (SNaPshot, G372C)
T(29) GGTGGAGGCTGACGAGGCG

FGFR3 (SNaPshot, Y375C)
T(43) ACGAGGCGGGCAGTGTGT

FGFR3 (SNaPshot, A393E)
T(34) CCTGTTCATCCTGGTGGTGG

FGFR3 (SNaPshot, K652M/T)
T(20) CACAACCTCGACTACTACAAGA

FGFR3 (SNaPshot, K652E/Q)
T(50) GCACAACCTCGACTACTACAAG

FGFR3 (SNaPshot, S373C)
T(19) GAGGATGCCTGCATACACAC
45
Material und Methoden

FGFR3 (SNaPshot, G382R)
T(56) GAACAGGAAGAAGCCCACCC

PIK3CA (SNaPshot, E542K)
T(20) ACACGAGATCCTCTCTCT

PIK3CA (SNaPshot, E545G)
T(30) CCTCTCTCTGAAATCACTG

PIK3CA (SNaPshot, E545K)
T(34) ATCCTCTCTCTGAAATCACT

PIK3CA (SNaPshot, H1047R)
T(47) GAAACAAATGAATGATGCAC
Primer für MicroRNA Assay:

hsa-miR-603 (Quanta)
Target Sequence:
CACACACUGCAAUUACUUUUGC

hsa-miR-3646 (Quanta)
Target Sequence:
AAAAUGAAAUGAGCCCAGCCCA

Target Sequence:
RNU6 (Quanta)
CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU

SNORD44 (Quanta)
Target Sequence:
CCUGGAUGAUGAUAAGCAAUGCUGACUGAACAUGAAGUCUU
AAUUAGCUCUAACUGACU

PerfeCta Universal PCR Primer
Quanta Biosciences
Tabelle 2-11: Auflistung aller verwendeten Primer mit zugehörigen Sequenzen (in 5’→3’-Richtung) der senseund antisense-Primer.
Desoxyribonukleinsäuren (DNAs)
(Plasmid-)DNA
Hersteller
Expressionsplasmid für hu SFRP1 in pCMV6-Neo Vektor
OriGene
Plasmid-DNA Leervektor pCMV6-Neo
OriGene
Expressionsplasmid für hu SFRP1 shRNA in pGFP-V-RS
OriGene
sh RNA Vektor
Plasmid-DNA Leervektor shRNA in pGFP-V-RS sh RNA
OriGene
Expressionsplasmid für hsa-miR-603 in pCMV-MIR Vektor
OriGene
Plasmid-DNA Leervektor pCMV-MIR
OriGene
Expressionsplasmid für MTUS1 in pCMV6-XL5 Vektor
OriGene
Plasmid-DNA Leervektor pCMV6-XL5
OriGene
TOPglow/FOPglow TCF Reporter Kit
Millipore
TCF-Bindestelle, Firefly-Luziferase
pGL4.10 [lus2] Vector, Leervektor
Promega
pGL4.13[luc2/SV40] Vector, Firefly-Luciferase
Promega
pGL4.74[hRluc/TK] Vector, Renilla-Luziferase
Promega
humane Placenta DNA (D4642), 1unit
Sigma
46
Material und Methoden
Tabelle 2-12: Auflistung aller verwendeten Desoxyribonukleinsäuren (DNAs), inklusive aller Plasmide mit
Herstellerangaben.
Desoxyribonukleotid-Triphosphate (dNTPs)
dNTP
Hersteller
dATP, 100mM, 250 μl
Promega
dCTP, 100mM, 250 μl
Promega
dGTP, 100mM, 250 μl
Promega
dTTP, 100mM, 250 μl
Promega
Tabelle 2-13: Auflistung der verwendeten Desoxyribonukleotid-Triphosphate mit Herstellerangaben.
DNA-Standards
DNA-Standard
Hersteller
50bp-DNA-Längenstandard (0,1 μg/μl), Gene Ruler
Fermentas
100bp-DNA-Längenstandard (0,1 μg/μl), Gene Ruler
Fermentas
Hyper ladderTM I (200-10.000 bp)
Bioline
Tabelle 2-14: Auflistung der verwendeten DNA-Standards mit Herstellerangaben.
2.1.8 Proteine
Enzyme
Enzym
Hersteller
QuantiLum Recombinant Luciferase
Promega, Madison/USA
XhoI, 5.000 units
NEB, New England Biolabs, Ipswich/USA
HindIII, 10.000 units
NEB, New England Biolabs, Ipswich/USA
EcoRI, 10.000 units
NEB, New England Biolabs, Ipswich/USA
AflIII, 250 units
NEB, New England Biolabs, Ipswich/USA
BbsI, 300 units
NEB, New England Biolabs, Ipswich/USA
NotI, 10.000 units
NEB, New England Biolabs, Ipswich/USA
SmaI, 2.000 units
NEB, New England Biolabs, Ipswich/USA
GoTaq DNA Polymerase # M3175
Promega, Madison/USA
M. SssI, CpG Methyltransferase, # M0226S
NEB, New England Biolabs, Ipswich/USA
Tabelle 2-15: Auflistung aller verwendeten Enzyme mit Herstellerangaben.
47
Material und Methoden
Antikörper
Antikörper
Hersteller
Primär-Antikörper:
Mouse-anti-ß-AKTIN (WB), monoklonal
Sigma
Rabbit-anti-SDHA (WB), polyklonal
Abcam
Mouse-anti-MTUS1 (WB, IHC, IF)
Abnova
Rabbit-anti-SFRP1 (WB, IF)
Cell Signaling
Rabbit-anti-CCND1 (WB), polyklonal
Abcam
Rabbit-anti-CMYC (WB)
Abcam
Rabbit-anti-CD44 (WB), monoklonal
Abcam
Rabbit-anti-BMP4 (WB), polyklonal
Abcam
Rabbit-anti-AXIN2 (WB), monoklonal
Biolmol/Thermo
Mouse-anti-SURVIVIN (WB), monoklonal
Santa Cruz
Mouse-anti-E-Cadherin (IF)
BD Biosciences
Rabbit-anti-SFRP1 (IHC)
Pineda
Mouse-anti P53 (IHC)
Dako Cytomation
Mouse-anti-Ki67 (IHC)
Dako Cytomation
Mouse-anti-CK20 (IHC)
Dako Cytomation
Sekundär-Antikörper:
Goat-anti-Biotin HRP-konjugiert (WB)
Cell Signaling
Donkey-anti-rabbit, HRP-konjugiert (WB)
Dianova/Jackson
Goat-anti-mouse HRP-konjugiert (WB)
Jackson
Goat-anti-rabbit, biotinyliert (IHC)
Vector
Rabbit-anti-mouse (IHC)
Dako
Goat-anti-rabbit, DyLight™549-konjugiert (IF, SFRP1)
Dianova/Jackson
Sheep-anti-mouse, DyLight™488-konjugiert (IF, E-
Dianova/Jackson
Cadherin)
DAPI (IF)
Invitrogen
Tabelle 2-16: Auflistung aller verwendeten Antikörper mit Herstellerabgaben. Die Bezeichnungen WB
(Westernblot), IH (Immunhistochemie) bzw. IF (Immunfluoreszenz) geben an, bei welcher Methode der jeweilige
Antikörper zum Einsatz kam.
Protein-Standards
Protein-Standard
Precision Plus Protein
TM
Hersteller
Dual Color Standard
Biotinylated Protein Ladder
Bio-Rad
Cell Signaling
Tabelle 2-17: Auflistung der verwendeten Protein-Standards mit Herstellerangaben.
48
Material und Methoden
2.1.9 Geräte und Laborausstattung
Gerät
6-Well-Platte (Transfektion)
Modell
Tissue Culture Plate 6-Well, Flat
Hersteller
Sarstedt
Bottom, Cell+
96-Well-Platte (BCA-Assay)
Rotilabo®-Mikrotest-Platte, U-Profil
Roth
96-Well-Platte (BrdU-Assay)
Cellstar® 96 Well Cell Culture Plate, F-
Greiner Bio-One
bottom
96-Well-Platte (qRT-PCR)
MicroAmp® Fast Optical 96-Well
Applied Biosystems
Reaction Plate with Barcode (0,1 ml)
Abzug
Airflow Controller AC3
Waldner
Agarosegel-Detektion
E-Box VX2
Vilber Lourmat
Agarosegel-Lauf-Apparatur
Wide Mini-Sub Cell GT
Bio-Rad
Blotting-Papier
Extra Thick Blot Paper, Mini blot size
Bio-Rad
Brutschrank (Labor)
APT.lineTM
Binder
Brutschrank (Zellkultur)
CO2-Brutschrank CB210
Binder
Culture Slides
BD FalconTM 8-well Culture Slides
BD Biosciences
Dampfkochtopf
Decloaking Chamber
Biocare Medical
Deckgläschen
24x60 mm #1
Menzel
Drehrad (Protein-Isolation)
PTR-30
Grant-bio
Eismaschine
AF 200
Scotsman
Falcons
15 ml Centrifuge Tube
Roth
Falcons
Cellstar® Tube, 50 ml
Greiner Bio-One
Färbeautomat für IHC
BenchMark ULTRA ICH/ISH Staining
Ventana
Module
Filtertips, steril
0,1 -10 μl (Rack); 1 - 20 μl (Rack);
Starlab
1 - 200 μl (Rack); 100 - 1000 μl (Rack)
Fluoreszenz-Mikroskop
Olympus BX60
Olympus
Freezing Container
Nalgene Cryo1°C Freezing Container
Thermo Scientific
Klebefolie (qRT-PCR)
Optical Adhesive Covers
Applied Biosystems
Kryo-Röhrchen
Mikro-Schraubröhre 2 ml, PP
Sarstedt
Microcentrifuge Tubes
1,5 ml; 2,0 ml (Natural Flat Cap)
Starlab
Mikroskop (Zellkultur)
Olympus CKX31
Olympus
Mikroskop (Zellkultur,
Olympus IX81
Olympus
Migration)
49
Material und Methoden
Mikrowelle
-
Severin
Multipette
Multipette plus
Eppendorf
Multipetten-Aufsatz
Combitips® plus 0,5 ml
Eppendorf
Multiplate Reader
Synergy 2
BioTek
Mithras LB 940 (mit Injektor)
Berthold
(Absorption, Lumineszenz)
Multiplate Reader (TOP/FOP)
Technologies
Neubauer-Zählkammer
Neubauer-improved
Marienfeld
Nitrocellulose-Membran
Amersham Hybond ECL Nitrocellulose
GE Healthcare
Membrane
Nucleofactor II
AAP-1001S
Amaxa biosystems
PCR Tubes, Natural Flat Cap
0,5 ml
Starlab
pH-Meter
pH 210 Microprocessor pH Meter
HANNA
Instruments
Pipetten Research (Plus)
0,1 - 2,5 μl; 0,5 - 10 μl; 2 - 20 μl;
Eppendorf
10 - 100 μl; 20 - 200 μl; 100 - 1000 μl
Pipettierhilfe (Labor)
macro Pipettierhelfer
Brand
Pipettierhilfe (Zellkultur)
Pipetboy
Integra
Power Supply (Agarosegel-
PowerPac Basic
Bio-Rad
PowerPac HC
Bio-Rad
Schüttel-Inkubator
Typ 3031
GFL
Schüttler (Westernblot)
-
VWR
Sequencer
Genetic Analyzer 3500 Dx
Applied Biosystems
Serologische Pipetten, steril
2 ml; 5 ml; 10 ml; 25 ml
Sarstedt
Sicherheitswerkbank
Infinity® Class II Microbiological Safety
Esco
Lauf-Apparatur)
Power Supply (Western BlotApparatur)
Cabinet
Sterilfilter
Acrodisc PSF Syringe Filters
PALL Life Sciences
Thermocycler (PCR)
DNA Engine® Peltier Thermal Cycler
Bio-Rad
Thermocycler (qRT-PCR)
7500 Fast (96 Well) Real-time PCR
Applied Biosystems
System
Thermocycler (Seq-PCR)
Mastercycler proS
Eppendorf
Thermomixer
Thermomixer comfort
Eppendorf
Tisch-Zentrifuge
Galaxy Mini
VWR
Ultraschall-Sonifikator
HTU SONI130
G.Heinemann
50
Material und Methoden
Vortexer (Post-PCR)
Reax top
Heidolph
Vortexer (Prä-PCR)
MS1 Minishaker
IKA
Waage
Präzisionswaage PCB
Kern
Wasserbad
-
Memmert
®
Westernblot-Apparatur
Mini Protean Tetra System
Bio-Rad
Western Blot-Detektion
Fusion FX7
Vilber Lourmat
Zellkultur-Inserts
Culture-Inserts for Live Cell Analysis
Ibidi

Zellkultur-Flaschen
Cellstar T75
Greiner Bio-One
Zentrifuge (Post-PCR)
Centrifuge 5424
Eppendorf
Zentrifuge (Prä-PCR)
Centrifuge 5415 R
Eppendorf
Zentrifuge (Zellkultur)
Centrifuge 5810 R
Eppendorf
Tabelle 2-18: Auflistung der verwendeten Geräte und sonstigen Labor-Ausstattung mit Angabe des jeweiligen
Modells (wenn vorhanden bzw. bekannt) und des Herstellers.
2.1.10 Softwares und Webtools
Software
Hersteller
7500 Software v2.0.5 (qRT-PCR)
Applied Biosystems
Bio1D (WB, Agarosebilder)
Vilber Lourmat
cell^P (Fluoreszenz-Mikroskop)
Olympus
E-Capt (Agarose-Gele)
Vilber Lourmat
Fusion-Capt (WB)
Vilber Lourmat
Gen5 (Synergy 2)
Biotek
Genotyping Console (aCGH)
Affymetrix
Axio Vision Rel. 4.8.2
Olympus
NEBCutter V2.0 [http://tools.neb.com/NEBcutter2/index.php]
New England BioLabs
PASW Statistics 19
SPSS
Sequencing Analysis v5.4 (Sequenzierung)
Applied Biosystems
Test auf Abweichung vom Hardy-Weinberg-Gleichgewicht und auf
Helmholtz-Zentrum
Assoziation [http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl]
München
PubMed, BLAST, etc.
NCBI
Ensembl
Wellcome Trust,
Sanger Institute, EBI,
EMBL
miRbase
University of
Manchester
Tabelle 2-19: Auflistung der verwendeten Softwares und Webtools mit Herstellerangaben.
51
Material und Methoden
2.2
Methoden
2.2.1 Zellbiologische Methoden
Alle Zellkultur-Versuche wurden an einer sterilen Sicherheitswerkbank mit sterilen
Einmal-Pipetten durchgeführt.
2.2.1.1
Auftauen und Einfrieren von Zellen
Die in flüssigem Stickstoff kryokonservierten Zelllinien wurden bei Raumtemperatur
ca. 10min aufgetaut und kurz in 37°C warmem Wasser geschwenkt. Anschließend
wurden die Zellen in 10ml kaltem RPMI Komplett-Medium resuspendiert und einmal
8min bei 900rpm zentrifugiert. Der Medienüberstand wurde verworfen. Hierbei sollte
insbesondere das zellschädigende DMSO des Einfriermediums entfernt werden. Es
folgte ein Waschschritt mit RPMI-Medium, wobei das Zellpellett erneut in 10ml
Medium resuspendiert und zentrifugiert wurde. Das Zellpellet wurde dann in 15ml
37°C-warmem RPMI-Medium resuspendiert, in eine T75 Flasche ausgesät und bei
37ºC und 5% CO2-Konzentration in einem Zell-Inkubator kultiviert.
Zum Einfrieren wurden drei mittlere, maximal 80% konfluente Zellkulturflaschen (T75)
abtrypsiniert, mit Medium gewaschen und bei 900rpm 8min zentrifugiert. Die Pellets
wurden vereinigt und dann in 10ml Einfriermedium (9,5ml FCS + 5% DMSO (500µl))
resuspendiert, in 1ml-Fraktionen aliquotiert und zunächst bei -80ºC in einem auf 20°C vorgekühlten Nalgene-1°C Freezing Container weggefroren. Nach 2-3 Tagen
wurden die Röhrchen zur dauerhaften Lagerung in flüssigen Stickstoff bei -196°C
überführt.
2.2.1.2
Kultivieren und Splitten adherenter Zellen
Das Zellkulturmedium wurde alle 2-3 Tage gewechselt (5ml in den T25, 15ml in den
T75 Kulturflaschen). Bei einem Konfluierungsgrad von ca. 80% mussten die Zellen
gesplittet, das heißt verdünnt werden. Der Überstand, inklusive der abgestorbenen
Zellen, wurde abgesaugt, die Zellen einmal mit PBS gewaschen und anschließend
ca. 5 min mit Trypsin versetzt (2ml pro T75-Flasche). Das Enzym bewirkte, dass sich
die Zellen innerhalb von 2-10min vom Flaschenboden lösten, so dass sie, in 8ml
52
Material und Methoden
Medium resuspendiert, abgesaugt werden konnten. Durch Zugabe von FCS-haltigem
Medium wurde das Enzym verdünnt und gleichzeitig mit Substrat abgesättigt, womit
eine Zerstörung der Zellen verhindert wurde. Die Zellen wurden nach Zentrifugation
(je 900rpm, 8min) resuspendiert und in der gewünschten Verdünnung (z.B. 1:10)
ausgesäht.
2.2.1.3
Zählen von Zellen mit der Neubauer-Zählkammer
Die gewünschten Zellen wurden in 1ml Medium aufgenommen und um den Faktor
1:10 mit PBS verdünnt. 10µl dieser Verdünnung wurden wiederum mit 10 µl
Trypanblau vermischt (1:2-Verdünnung). Anschließend wurde die NeubauerZählkammer (Abb. 2-1) mit Ethanol gereinigt und das Deckgläschen aufgelegt, so
dass Newton’schen Ringe zu sehen waren. Daraufhin wurden ca. je 10µl der 1:2Verdünnug auf jede Seite der Zählkammer unter das Deckgläschen pipettiert. Durch
die Kapillarkräfte wird die Suspension unter das Deckgläschen gesaugt. Jedes
einzelne der vier äußeren Eckquadrate (Fläche von 1mm 2 unterteilt in 16
Kleinquadrate) wurde ausgezählt und ein Mittelwert (MW) gebildet. Dieser Wert
wurde noch auf die Verdünnung und das Volumen rückgerechnet: MW x 10 x 2 x
10.000 (Kammerfaktor) = n. n entspricht der Anzahl der Zellen in einem Milliliter der
Ausgangskonzentration.
Abbildung 2-1: Neubauer Zählkammer mit zugehörigem Glasraster.
Abgestorbene Zellen wurden durch das Trypanblau angefärbt und durften nicht
mitgezählt werden.
53
Material und Methoden
Aus der Zellkonzentration in einem Milliliter (Zellstock) konnte sodann das benötigte
Volumen bzw. die Anzahl an Zellen für weitere Versuche mit folgender Formel
errechnet werden: c1 x V1 = c2 x V2 (c1 = Ausgangskonzentration, c2 =
Endkonzentration, V1 = Volumen aus der Stocklösung, V2 = Volumen der benötigten
Endlösung).
2.2.1.4
Transfektion von Nukleinsäuren
Um den Einfluss bestimmter Gene oder non-coding-RNAs auf das Zellverhalten und funktion zu untersuchen, kann man die gewünschten Nukleinsäuren (siRNA, miRNA,
Plasmid-DNA) mit verschiedenen Methoden in die Zelle bringen. Die geläufigste
Form ist die transiente oder stabile Lipid-basierte Transfektion. Dabei wird das
Überexpressionsplasmid oder die siRNA in serumfreiem Medium mit einem
Lipidreagenz inkubiert, sodass sich ein Transfektionskomplex aus Nukleinsäure und
umgebenden Lipidtröpfchen formen kann. Diese „Bio-Mizellen“ können dann leicht
die Zytoplasmamembran der Zielzellen durchdringen und somit die Nukleinsäure in
die Zelle bringen. Je nach Nukleinsäuretypus können dann die kodierenden Gene in
mRNA transkribiert und anschließend in Proteine translatiert werden oder die nichtkodierenden Gene beispielsweise zu miRNA transkribiert werden und als
Regulatoren der Genexpression wirken. siRNAs, hingegen wirken direkt in der Zelle,
indem sie die mRNA des untersuchten Genes binden und somit deren Translation
unterbinden.
In der hier vorliegenden Arbeit wurde die Expression des Gens SFRP1 in RT112
durch stabile Transfektion von anti-SFRP1-shRNA herunterreguliert, in BFTC905
durch
stabile
Transfektion
mit
einem
SFRP1-Überexpressionsplasmides
heraufreguliert. Außerdem wurde in RT112 das potentielle Kandidatengen MTUS1
transient überexprimiert, um einen möglichen funktionellen Hinweis auf den
Zusammenhang mit der malignen Progression zu erhalten.
Für die Untersuchung des Einflusses der mikroRNA hsa-miR-603 auf die Expression
von SFRP1, in Abhängigkeit des rs3242-Genotyps, wurde hsa-miR-603 in den drei
humanen Blasenkrebszelllinine RT112, RT4 und J82 überexprimiert. Für die
Überexpression von hsa-miR-3646 war noch kein kommerziell erwerbliches Plasmid
verfügbar.
54
Material und Methoden
Für den TOP flash/FOP flash Assay wurden die stabil transfizierten Zellen RT112
und BFTC905 mit den TOP, FOP und Renilla Plasmiden transfiziert. Diese Methodik
ist jedoch im Punkt 2.2.1.8 (TOP flash/FOP flash Assay) beschrieben.
Für die jeweilige Transfektion wurden die Zellen zunächst in der geeigneten
Verdünnung in eine 6Well-Patte ausgesäht. Nach der Zelladhäsion am Kulturgefäß,
wurde das Kulturmedium von den Zellen abgenommen und durch 900µl frisches
Kulturmedium (RPMI) ersetzt. Dann wurde der Transfektionsmix bestehend aus
OptiMEM, Plasmid-DNA und Transfektionsreagenz hergestellt und 10 bis 30min bei
Raumtemperatur inkubiert. Im Anschluss wurden 100µl des Transfektionsmixes pro
6Well auf die Zellen pipettiert, gemischt und dann bei 5% CO2 und 37°C im
Brutschrank inkubiert. Zur Reduzierung zytotoxischer Effekte wurde nach ca. 5
Stunden, jeweils 2ml Kulturmedium auf das Transfektionsmedium gegeben. Bei der
stabilen Transfektion erfolgte jeweils nach 3 bis 4 Tagen ein Mediumwechsel mit
Selektionsmedium. Die unterschiedlichen Versuchsparameter der verschiedenen
Transfektionen sind in den folgenden Tabellen 2-20 bis 2-23 zusammengefasst.
Parameter
Eigenschaft
Zelllinie
RT112, SFRP1-knockdown
Plattenformat
6-Well-Platte
Zellzahl
100.000 Zellen
Pro 6-Well
Dauer der Zelladhäsion
Ca. 37 Stunden
Dann 50% Konfluenz
Transfektionsmedium
OptiMEM
100µl
Transfektionsreagenz
Turbofectin (Origene)
3µl
Nukleinsäure(n)
Menge/Volumen

Anti-SFRP1-shRNA-Überexpressionsplasmid (A)

Nonsense-Plasmid (B)

Leervektor
Je 1µg
Ratio
shRNA:Turbofectin
1:3
Kulturmedium
Selektionsmedium (RPMI + Die Zellen waren erst bei
Puromycin 0.5, 1 bzw. 3 3µg/ml abgestorben
µg/ml)
Inkubationszeit
30min, RT
Transfektionsmix
Inkubationszeit
der 4 Wochen nach Puromycinzugabe, dann klonale Selektion
Nukleinsäure in der Zelle
55
Material und Methoden
Sonstiges
Selektionsmedium mit AB wurde bei erster Passagierung
nach Transfektion hinzugegeben
Tabelle 2-20: Parameter der stabile Transfektion der anti-SFRP1-shRNA in RT112 nach Optimierung.
Parameter
Eigenschaft
Zelllinie
BFTC905, SFRP1-Überexpression
Plattenformat
6-Well-Platte
Zellzahl
300.000 Zellen
Dauer der Zelladhäsion
24h
Transfektionsmedium
OptiMEM
100µl
Transfektionsreagenz
FuGene HD (Roche)
6µl
Nukleinsäure(n)
Menge/Volumen
Pro 6-Well

SFRP1-Überexpressionsplasmid (A)

Nonsense-SFRP1-Überexpressionsplasmid (B)

Leervektor pVMC6-Neo (mock)
je 2µg
Ratio
DNA:FuGene
2:6
Kulturmedium
Selektionsmedium (RPMI mit 250µg/µl
Neomycin/G-418)
Inkubationszeit
15min, RT
Transfektionsmix
Inkubationszeit
Nukleinsäure in der Zelle
der Ca. 1 Woche, dann klonale
Selektion
Tabelle 2-21: Parameter der stabile Transfektion des SFRP1-Überexpressionsplasmids in BFTC905 nach
Optimierung.
Parameter
Eigenschaft
Menge/Volumen
RT112
MTUS1-Überexpression
Plattenformat
6-Well-Platte
Zellzahl
300.000 Zellen
Dauer der Zelladhäsion
24h
Transfektionsmedium
OptiMEM
100µl
Transfektionsreagenz
Megatran
3µl
Nukleinsäure(n)
MTUS1-
1µg
Pro 6Well
Überexpressionsplasmid
Ratio
DNA:Megatran
1:3
Kulturmedium
RPMI
3ml
56
Material und Methoden
Inkubationszeit
10min
Transfektionsmix
Inkubationszeit
der 48h
Nukleinsäure in der Zelle
Tabelle 2-22: Parameter der transienten Transfektion des MTUS1-Überexpressionsplasmids in RT112 nach
Optimierung.
Parameter
Eigenschaft
Zelllininen
RT112, RT4, J82, hsa-miR-603-Überexpression
Plattenformat
6-Well-Platte
Zellzahl
200.000 Zellen
Dauer der Zelladhäsion
24h
Transfektionsmedium
OptiMEM
100µl
Transfektionsreagenz
Megatran (Origene)
3µl
Nukleinsäure
hsa-miR-603 Origene
Ratio
DNA:Megatran
Kulturmedium
RPMI
Inkubationszeit
Nukleinsäure in der Zelle
Pro 6Well
1µg
(10µl
aus
0.1µg/µl
Stock)
1:3
Vor Transfektion: 3ml pro
Well, für Transfektion: 900µl
10min, RT
Transfektionsmix
Inkubationszeit
Menge/Volumen
der
24 und 48h
Tabelle 2-23: Parameter der transienten Transfektion der hsa-miR-603 in RT112, RT4 und J82 nach
Optimierung.
2.2.1.5
Bestimmung der Viabilität mittels Cell Titer Glo Assay
Der Viabilitätsassay ist ein Lumineszenz-basierter Assay um die Anzahl an lebenden,
das heißt metabolischen aktiven Zellen zu bestimmen. Der Cell Titer Glo Assay
bedient sich dabei des im Zytoplasma lebendiger Zellen befindlichen ATPs um die
chemische Umsetzung des Substrates Beetle Luziferin zum Oxyluziferin zu
katalysieren. Die Menge an ATP bzw. die Intensität des Lumineszenzsignals ist dabei
direkt proportional zur Zellzahl. Das bei der chemischen Reaktion entstandene
Lichtsignal kann mittels Lumineszenz-Messgerät detektiert werden und ist ein Maß
der „Zelllebendigkeit“. Ein starkes Lichtsignal weist somit viele, ein schwaches
57
Material und Methoden
Lichtsignal
hingegen
wenige
lebende
Zellen
nach.
Folgende
Gleichung
veranschaulicht schematisch die ablaufende Reaktion:
Ultra-Glo-Luziferase
Mg2+
Beetle Luciferin + ATP + O2 --> Oxyluciferin + AMP + PPi + Licht + CO2
In eine weiße 96Well-Platte mit durchsichtigem Boden wurden 15.000 Zellen in 100µl
Medium ausgesäht. Nach 24stündigem Adherieren bei 37°C und 5% CO 2 und
30minütigem Abkühlen auf Raumtemperatur wurden 100µl Substrat pro Well
zugegeben und 2min orbital im Synergy 2 geschüttelt. Im Anschluss folgte eine
10minütige Inkubation, bei der sich das Lumineszenzsignal stabilisieren konnte.
Dann wurde die Lumineszenz bei einer Sensitivität von 135 im Synergy 2 von BioTek
gemessen.
2.2.1.6
Bestimmung der Proliferation mittels BrdU Assay
Der BrdU Assay ist ein kolorimetrischer Immuno-Assay der den Einbau von
Bromodesoxyuridine (BrdU), einem interkalierenden Agenz, in neu-synthetisierte
DNA von aktiv-proliferierende Zellen quantifizieren kann. Dabei detektiert und bindet
ein Primärantikörper zunächst das eingebaute BrdU. Ein zweiter HRP-konjugierter
sekundär-Antikörper
bindet
im
nächsten
Schritt
den
Primärantikörper.
Die
Meerrettich-Peroxidase katalysiert dann die Reaktion des chromogenen Substrates
Tetra-Methylbenzidin (TMB) von einer farblosen zu einer blauen (bzw. nach Zugabe
des Stopp-Substrates gelben) Lösung. Die im Folgenden gemessene optische Dichte
der gelben Lösung ist direkt proportional zur Menge der neu-synthetisierten DNA und
damit ein Maß für die Proliferation. In Abbildung 2-2 ist dieser Farbumschlag
veranschaulicht.
58
Material und Methoden
Abbildung 2-2: Veranschaulichung der
Plattenbelegung beim BrdU Assay; A
und D 1-3: Medium, B und E 1-3 Mock
Zellen, C und F 1-3 A-Klone; A bis C
ohne BrdU-Zugabe, D bis F: mit BrdU
Zugabe. Nach Zugabe des ELISASubstrates
entsteht
ein
blauer
Farbkomplex, nach Zugabe der ELISAStopp-Lösung schlägt dieser in eine
gelbe Färbung um; von dieser Lösung
wird dann die Absorption gemessen.
Es wurden 15.000 Zellen pro Well einer 96-Well-Platte in 100µl RPMI Medium
ausgesäht. 24, 48 und 72 Stunden nach dem Adhärieren der Zellen wurden 20µl der
5x Working Solution (500µl RPMI + 0,25µl der 10.000x BrdU-Stock-Lösung) für vier
Stunden hinzugegeben. Danach folgte die Versuchsdurchführung gemäß den
Herstellerangaben. Die Messung der Absorption erfolgte sofort nach Zugabe der
ELISA-Stopp-Lösung bei 450 und 540nm Wellenlänge am Synergy 2.
2.2.1.7
Bestimmung der Migration mittels Wound Scratch Assay
Für den Wundheilungs-Assay (Wound Scratch Assay) wurden die Inserts von IBIDI
gemäß der Herstellerangaben benutzt. Pro Well wurden 70µl der Zellsuspension
zugegeben; Die Konzentration der Zellsuspension betrug 300.000 Zellen/ml bei
RT112 (SFRP1) und 700.000 Zellen/ml bei BFTC905 (SFRP1) und der Assay wurde
jeweils dreimal durchgeführt. Bei der Überexpression von MTUS1 in RT112 Zellen
wurden zwei verschiedene Zellkonzentrationen verwendet: 500.000 Zellen/ml und ca.
750.000 Zellen/ml. Der Assay wurde für jede Zellkonzentration zweimal durchgeführt.
Nachdem die Zellen zu einem dichten Rasen zugewachsen waren, wurden die
Inserts vorsichtig mit einer sterilen Pinzette entfernt. Im Anschluss wurden innerhalb
von 24 Stunden Fotos vom Zellspalt gemacht um so das Migrationsverhalten der
Zellen zu dokumentieren. Die Flächenberechnungen erfolgten mit der Olympus
Software Axio Vision Rel 4.8.2.
59
Material und Methoden
2.2.1.8
Bestimmung der Wnt-Aktivität mittels TOP flash/FOP flash Assay
Alle Versuche zur Bestimmung der Wnt-Aktivität wurden an der Universitätsmedizin
Göttingen in der Klinischen Forschergruppe 176 in Zusammenarbeit mit Emil
Kendziorra und Dr. Melanie Spitzner durchgeführt.
Um die Aktivität des Wnt-Signalweges in den Zelllinien RT112 und BFTC905 in
Abhängigkeit von der SFRP1-Expression nachzuweisen, wurde der Lumineszenzbasierte TOP flash/FOP flash Assay angewendet. Dabei wurde mittels transienter
Transfektion ein Plasmid in die Zellen eingebracht, welches neben einem Gen für die
Firefly-Luziferase, eine funktionsfähige (TOP-Plasmid) oder mutierte (FOP-Plasmid)
Promotor-Bindestelle für den Transkriptionsfaktor TCF/LEF besitzt. Ist der WntSignalweg aktiv, wird der Transkriptionsfaktor in der Zelle exprimiert und kann so an
den Firefly-TOP-Promotor binden. Dies bewirkt dann die Transkription und folglich
Expression des Luziferase-Gens. Die Luziferase-Aktivität konnte dann nach Zugabe
eines Substrates und durch die dabei entstandene Lichtemission (Biolumineszenz) in
einem
Multiplatten-Lesegerät
gemessen
werden.
Als
Kontrolle
wurde
die
Kolonkarzinomzellinie SW480 mitgeführt, die durch eine Mutation im APC-Gen, einen
konstitutiv aktiven Wnt-Signalweg besitzt. Um die Transfektionseffizienz der
jeweiligen Zelllinie zu bestimmen, wurde neben dem TOP oder FOP-Plasmid
zusätzlich ein Plasmid mit einem Renilla-Luziferasegen transfiziert, welches bei
erfolgreicher Transfektion immer exprimiert wurde. Nach Zugabe des FireflyLuziferase-Substrates wurde in einem zweiten Schritt das Renilla-Substrat
zugegeben und erneut die ausgesendete Lumineszenz gemessen. Um die
Funktionalität
des
Lumineszenzsignale
Assays
von
zu
überprüfen,
reiner
wurden
Firefly-Luciferase,
im
Vorfeld
sowie
auch
des
die
Firefly-
Expressionsplasmides und des zugehörigen Leervektors gemessen.
Die Zelllinien RT112 A, RT112 Mock, BFTC905 A, BFTC905 Mock, sowie SW480
wurde in T75 Flaschen mit normalem oder Selektions-RPMI-Medium kultiviert,
gezählt und je 1 Million Zellen in einem 50ml Falcon abzentrifugiert. Der Überstand
wurde verworfen und das Pellet mit 200µl Solution V von Lonza versetzt. Je 100µl
dieser Lösung wurden mit 500ng TOP oder FOP-Plasmid (5µl aus 100ng/µl StockLösung) und 50ng Renilla-Plasmid (5µl aus 10ng/µl Stock-Lösung) versetzt und
luftblasenfrei in eine Lonza-Einmalküvette überführt. Nach 2-maligem Aufklopfen
60
Material und Methoden
wurde die Küvette in den Nucleofector II von Amaxa Biosystems eingeführt und die
Transfektion mit dem Programm T-30 gestartet. Die Nucleofactor Technologie ist
eine Transfektionsmethode, die sich einer Kombination aus Zell-spezifischen
Transfektionsreagenzien und elektrischen Parametern bedient und somit auch für
schwierig zu transfizierende Zellen geeignet ist.
Nach der Transfektion wurde die Zell-Lösung in normales RPMI- oder SelektionsMedium aufgenommen und auf je drei Wells einer 6Well-Platte mit je 3ml Medium
aufgeteilt. Pro Well wurden somit ca. 333.333 transfizierte Zellen ausgesäht. Die
Zellen wurden 31 Stunden im Brutschrank kultiviert und anschließend einmal mit
PBS gewaschen und dann mit 100µl Lysepuffer versetzt. Nach dem Ablösen der
Zellen vom Well-Boden mittels CellScraper und mehrmaligem Auf- und Abpipettieren
(aktive Lyse), wurden die Lysate 2x in flüssigem Stickstoff Schock-gefroren und dann
wieder aufgetaut. Eine vollständige Zelllyse konnte so noch besser unterstützt
werden. Die Lumineszenzmessung erfolgte in Triplikaten in einer weißen 96WellPlatte nach folgendem Schema:
BFTC
BFTC
BFTC
BFTC
BFTC
BFTC
905
905
905
905 A
905 A
905 A
A TOP
A TOP
A TOP
FOP
FOP
FOP
BFTC9
BFTC9
BFTC9
BFTC9
BFTC9
BFTC9
05
05
05
Mock
Mock
Mock
UB
UB
UB
A FOP
RT112
A FOP
RT112
A FOP
RT112
Mock
UB
SW480
RT112
Mock
UB
SW480
FOP
FOP
05 A
05 A
05 A
UB
UB
UB
RT112
A TOP
RT112
RT112
A TOP
RT112
A TOP
RT112
A UB
RT112
A UB
RT112
A UB
SW480
SW480
SW480
RT112
Mock
UB
SW480
TOP
TOP
TOP
FOP
BFTC9
BFTC9
BFTC9
BFTC9
BFTC9
BFTC9
05
05
05
05
05
05
Mock
Mock
Mock
Mock
Mock
Mock
TOP
TOP
TOP
FOP
FOP
FOP
RT112
RT112
RT112
RT112
RT112
RT112
Mock
Mock
Mock
Mock
Mock
Mock
TOP
TOP
TOP
FOP
FOP
FOP
LP
LP
LP
leer
leer
leer
Als Kontrolle wurden untransfizierte RT112 A/Mock bzw. BFTC905 A/Mock Zelllinien,
sowie Lysepuffer, leere Wells und die SW480 TOP und FOP-Zellen gemessen.
Pro Well wurden zunächst 100µl LAR II Promega Puffer (Substrat für die FireflyLuciferase) vorgelegt, dann entweder 20µl Lysat oder Lysepuffer hinzu pipettiert. Der
61
Material und Methoden
Stop&Glo
Promega
Puffer
wurde
nach
dem
Waschen
und
Primen
der
Injektorschläuche mit dem Injektor aufgezogen. Nach der ersten Messung der FireflyLuziferase-Aktivität, wurde je 100µl des Stop&Glo-Substrats pro Wells zugegeben
und dann die Renilla-Luziferase-Aktivität bestimmt. Die Lumineszenz wurde über die
RLU (relative light units) gemessen. Die Messung erfolgte für 10 Sekunden mit 2
Sekunden „delay“ im Multiplate-Reader Mithras LB 940 von Berthold Technologies.
Die Auswertung des TOP/FOP flash Assays erfolgte mit Excel und die Wnt-Aktivität
wurde mit folgenden Formeln berechnet:
TOPnormalisiert = TOP/Renilla (für Behandlung und Kontrolle)
FOPnormalisiert = FOP/Renilla (für Behandlung und Kontrolle)
Ratio= TOPnormalisiert/FOPnormalisiert (für Behandlung und Kontrolle)
Ein Ratio ab dem Wert 2 wurde als aktiver Wnt-Signalweg gewertet. Die Differenz
der Ratien von Behandlung und Kontrolle zeigt dann schließlich den sogenannten
fold-change bzw. die Änderung der Wnt-Aktivität in Assoziation mit der SFRP1Expression in den beiden Zelllinien auf.
2.2.1.9
Behandlung der Zellen mit 5-Aza, SAHA und Trichostatin
Eine Möglichkeit der epigenetischen Regulation ist die Stillegung von Genen mittels
Methylierung. Dabei werden bestimmte Cytosinbasen des DNA-Stranges mit
Methylgruppen versehen, die dann die Anlagerung der RNA-Polymerase verhindern
und so die Transkription hemmen. Um DNA-Methylierungen nachzuweisen bedient
man sich der Bisulfitbehandlung und der methylierungs-spezifischen PCR. Um
solche
Hypermethylierungen
der
DNA
aber
wieder
aufzuheben
und
eine
nachfolgende Reexpression nachzuweisen, inkubiert man die DNA, bzw. die Zellen
mit dem demethylierenden Agens 5-Aza-2‘-deoxyzytidin (auch bekannt als
Decitabine oder Dacogen, kurz: 5-Aza). Um die Methylierung des SFRP1-Promotors
aufzuheben und wieder normale Genexpression zu erreichen wurden 200.000 Zellen
zusammen mit 3ml Kulturmedium in einer 6-Well-Schale ausgesäht. Nach der
Zelladhäsion wurden 2µM 5-Aza zu den Zellen pipettiert und für drei Tage inkubiert.
Alle 24 Stunden erfolgte ein Mediumwechsel mit jeweils erneuter Zugabe von 2µM 5Aza. Eine weitere Möglichkeit der epigenetischen Regulation ist das gene silencing
62
Material und Methoden
mittels Acetylierung. Um sicher zu stellen, dass die fehlenden SFRP1-Expression
nicht durch eine Acetylierung bedingt war, wurden die Zellen mit SAHA
(suberoylanilide hydoxamic acid, auch bekannt als Vorinostat oder Zolinza) und
Trichostatin inkubiert – zwei Histon-Deacetylase-Inhibitoren. Diese verhindern die
Funktion des Enzyms Histon Deacetylase. Somit kann ausgeschlossen werden, dass
Deacetylierungen am SFRP1 Promotor spontan durch die Histon-Deacetylasen
auftreten und damit die Reexpression nur auf die Wirkung von 5-Aza zurück zu
führen ist. 200.000 Zellen von BFTC905 wurden mit 3ml Medium und je 2µM SAHA
oder 1,65µM Trichostatin versetzt. Die Inkubation erfolgte ebenfalls über drei Tage
mit Mediumwechsel nach 24 Stunden. Im Anschluss wurde die RNA isoliert, cDNA
synthetisiert und eine Reexpression mittels nested PCR überprüft.
63
Material und Methoden
2.2.2
Molekularbiologische Methoden
2.2.2.1
Mikrodissektion von gefrorenen Gewebedünnschnitten
Um intakte DNA aus humanen Blasentumoren und gegebenfalls zugehörigem
Normalurothel zu erhalten, wurden die kryokonservierten Gewebeproben zunächst in
ca. 5µm dicke Scheiben geschnitten und dann auf einen Glasobjektträger
aufgezogen. Ein Dünnschnitt wurde anschließend mit Hämalaun-Eosin-gefärbt und
das entsprechenden Tumor- bzw. Normalgewebsareal vom Pathologen (AH)
angezeichnet. Dieser Schnitt diente dann als Referenz für die Mikrodissektion. Die
restlichen Schnitte wurden in Ethanol fixiert, mit Methylenblau angefärbt und unter
dem Binokular mit dem Referenzschnitt verglichen. Die entsprechenden Tumor- oder
Normalgewebsareale wurden dann mit einer sterilen Einmalkanüle abgekratzt und
anschließend in den Lysepuffer des DNA-Isolationskits aufgenommen. Im Anschluss
erfolgte eine Proteinase K-Behandlung und dann die DNA-Isolation mit dem
entsprechenhden Kit (siehe unten). Auf diese Weise wurde eine Reinheit der
Tumorzellen von mindestens 85% gewährleistet.
2.2.2.2
Isolierung von Ribonukleinsäure (RNA)
Zur Untersuchung der Expression verschiedener Gene und miRNAs wurde RNA aus
Zelllininen und aus humanem Tumorgewebe isoliert. Zur Isolation der mRNA aus
Zelllininen wurde der RNeasy® Mini Kit von Qiagen gemäß den Herstellerangaben
verwendet. Für 6Well-Platten und kleinere Gefäßformate wurden 350µl Puffer RLT,
bei größeren Formaten (z.B. T25 Flaschen) 600µl eingesetzt. Dem Puffer wurde
jedes Mal frisches ß-Mercaptoethanol zugegeben (10µl pro 1ml Puffer). Die RNA
wurde in 40µl Wasser eluiert. Zur Isolation der gesamten RNA samt miRNAs aus
Zelllininen und humanem Gewebe wurde die Trizol-Chlorophorm-Isolation (Invitrogen
by life technologies) gemäß den Herstellerangaben durchgeführt. Pro Zellpellet oder
Gewebestück wurde 1ml Trizol zur Homogenisierung eingesetzt. Die RNA wurde aus
der wässrigen Phase isoliert. Im Anschluß erfolgte eine DNase-Behandlung mit dem
RNase-free DNase Set von Qiagen (30min 37°C, 5 min 65°C). Die PhenolChlorophorm-Phase wurde zur Isolation von DNA und Proteinen gesammelt. Isolierte
RNA wurde bei -80°C gelagert.
64
Material und Methoden
2.2.2.3
Isolierung von Desoxy-Ribonukleinsäure (DNA)
Zur Untersuchung der SNPs in SFRP1 und der SFRP1-Promotor-Methylierung sowie
für die aCGH wurde die DNA aus Zelllininen bzw. humanem Gewebe isoliert. Dies
erfolgte mit dem High Pure PCR Template Preparation Kit von Roche und mit dem
QIAamp DNA Mini Kit (bei der aCGH) gemäß den Herstellerangaben. Wenn, wie
oben beschrieben, RNA-Isolation mit Trizol erfolgte, wurde anschließend auch die
DNA aus der Phenol-Chlorophorm-Phase gemäß den Herstellerangeben isoliert. Die
DNA wurde in 8mM NaOH mit 1m EDTA eluiert und der pH-Wert zur dauerhaften
Lagerung mit HEPES auf 7-8 eingestellt.
2.2.2.4
Quantitäts- und Qualitätskontrolle von Nukleinsäuren
Die Messung der RNA- bzw. DNA-Konzentration und die Bestimmung der Reinheit
erfolgte am Multiplate Reader Synergy 2 von BioTek. Dazu wurde jeweils die
Absorption bei einer Licht-Wellenlänge von λ = 260nm (Absorptionsmaximum von
Nukleinsäuren) und λ = 280nm (Absorptionsmaximum von Proteinen) gemessen. Mit
Hilfe des Lambert-Beer’schen Gesetzes konnte daraus die Konzentration der
Nukleinsäure berechnet werden: A = ε x c x d → c = A / ε x d [mit A = Absorption bei der
Wellenlänge λ; ε = molarer (dekadischer) Extinktionskoeffizient bei der Wellenlänge λ; c =
Konzentration der zu vermessenden Lösung; d = Schichtdicke (meist 1 cm)].
Für die Messung der Konzentration wurden jeweils 3μl RNA bzw. DNA eingesetzt, für
die
Bestimmung
eines
Blank-Wertes
wurde
RNase-freies
Wasser,
bzw.
Elutionspuffer verwendet. Eine Absorption von 1,0 bei λ = 260nm entspricht einer
RNA-Konzentration von 40 μg/ml bzw. einer DNA-Konzentration von 50 μg/ml. Um
von einer proteinfreien Nukleinsäure sprechen zu können, sollte der Quotient aus
A260/A280 > 2,0 sein [28]. Zusätzlich wurde das Absorptionsspektrum graphisch
ermittelt um aus dem Kurvenverlauf die DNA-Qualität zu ersehen.
2.2.2.5
Synthese von komplementärer DNA (cDNA)
Um mRNA für die konventionelle RT-PCR oder für die SybrGreen-basierte qRT-PCR
in cDNA umzuschreiben, wurde der RevertAidTM H Minus First Strand cDNA
Synthesis Kit (Fermentas Life Sciences) nach den Herstellerangeben verwendet. Es
65
Material und Methoden
wurde jeweils 1µg RNA für die cDNA-Synthese eingesetzt. Um die Expression der
miRNAs hsa-miR-603 und hsa-miR-3646 in Zelllinien und humanem Gewebe zu
bestimmen, wurde eine Polyadenylierung und eine cDNA-Synthese mit dem qScript
microRNA cDNA Synthesis Kit nach den Herstellerangeben durchgeführt. Die
synthetisierte
cDNA
wurden
zunächst
auf
2
ng/µl
mit Wasser
verdünnt
(Gesamtvolumen dabei immer 200µl). In der RT-Reaktion wurden dann 5µl dieser
Lösung (also 10ng) eingesetzt. Für den mikroRNA Assay wurde 1ng cDNA
eingesetzt.
2.2.2.6
Konventionelle Polymerase Kettenreaktion
Zur Amplifikation von DNA oder cDNA wurde eine konventionelle PCR bzw. eine
spezielle Form davon – die nested-PCR – durchgeführt. Das DNA-Template, also die
DNA-Vorlage wurde dabei nach initiierender Denaturierung bei 95°C, der Anlagerung
der Primer (Annealing bei Primer-spezifischer Temperatur) und der darauf folgenden
Verlängerung des komplementären DNA-Stranges mittels DNA-Polymerase (bei
72°C) vervielfältigt. Der Reaktionsansatz wurde nach folgendem Basis-Schema
pipettiert.
Reagenz
Volumen im Einfach-Ansatz (µl)
5x Puffer
5
dNTPs (10mM)
0,5
Primer (15µM)
0,3
Taq-Polymerase
0,125
Wasser
17,075
DNA-Template
add 25ml (je 100ng)
Gesamt
25
Tabelle 2-24: Allgemeiner PCR-Ansatz.
Der PCR-Reaktionsmix wurde in sterile Einmal-Tubes pipettiert und dann folgendem
Thermocycler-Grundprogramm unterzogen:
66
Material und Methoden
Schritt
Zeit
Temperatur
Step 1
3min
95°C
Step 2 (Denaturierung)
1min
95°C
Step 3 (Annealing)
1min
je nach Primer
Step 4 (Elongation)
1min
72°C
Step 5
go to Step 2
34x
Step 6
10min
72°C
Step 7
forever
8°C
Step 8
end
Tabelle 2-25: Thermocycler Bedingungen einer allgemeinen PCR.
Je nach PCR konnte das Pipettierschema und das Thermocyclerprogramm an die
jeweiligen Bedingungen angepasst werden. Beipielsweise benötigten manche PCRs
die Anwesenheit von Dimethylsulfoxid (DMSO) im Reaktionsmix um die die
Primerspezifität für das Template zu erhöhen und somit unspezifische Banden zu
vermeiden. Änderungen zum Basis-Protokoll werden an entsprechender Stelle
angemerkt. Die PCR-Produkte wurden bis zur weiteren Aufarbeitung bei 4-8°C im
Post-PCR-Kühlschrank gelagert.
Bei der nested- oder „verschachtelten“ PCR wurde das (c)DNA-Template mittels
zweier aufeinanderfolgender PCRs amplifiziert. Dazu wurden zwei Primerpaare
verwendet: ein äußeres, welches ein größeres PCR-Produkt erzeugte und ein
inneres, welches nur das erste Amplikon weiter amplifizierte. Vorteil dieser Methode
ist
eine
erhöhte
Spezifität
und
Sensitivität
der
Gesamtreaktion,
wodurch
Nebenprodukte der ersten PCR entfallen.
Die nested-PCR wurde zum Screening der Harnblasenkarzinomzelllinine für die
SFRP1-Expression verwendet. Als House-Keeping-Gen wurde GAPDH mitgeführt.
Als äußere Primer dienten jene als RT-Primer bezeichneten, als innere Primer die
der qRT-PCR (siehe Tabelle 2-11). Bei GAPDH war die PCR mit den äußeren
Primern ausreichend, um gut detektierbare PCR-Produkte zu erhalten. Es wurde
dehalb auf eine zweite PCR verzichtet.
Es wurden jeweils 15µl vom SFRP1-Produkt (168bp) bzw. 5µl vom GAPDH-Produkt
(600bp)
auf
ein
2,5%iges
Agarosegel
67
aufgetragen.
Nach
einer
Stunde
Material und Methoden
Elektrophorese bei 110V, wurde das Gel 20min in einem Ethidiumbromid-Gel gefärbt
und anschließend unter UV-Licht visualisiert.
2.2.2.7
Bisulfitbehandlung und methylierungsspezifische PCR (MSP)
Die DNA-Methylierung ist ein epigenetischer Mechanismus, der ohne Veränderung
der Basenpaar-Sequenz trotzdem zu einer Alteration der Genexpression führt. DNAMethylierung erfolgt nur an Cytosinbasen und hauptsächlich in CpG-Inseln, also
kleinen DNA-Bereiche mit einem CG-Gehalt von 55% und mehr. Für die Analyse der
Promotormethylierung in SFRP1 wurde eine Methylierungs-spezifische PCR (MSP)
mit
einerseits
methylierungsspezifischen-
und
andererseits
mit
nicht-
methylierungsspezifischen Primern durchgeführt. Dazu wurde isolierte DNA zunächst
einer Bisulfit-Behandlung unterzogen. Dafür wurde der EpiTect® Bisulfite Kit von
Qiagen gemäß den Herstellerangaben verwendet. Bei der Bisulfitbehandlung werden
nur unmethylierte Cytosinbasen in Uracil umgeschrieben, methyliertes Cytosin bleibt
unverändert. So entstehen nach der Bisulfit-Behandlung zwei unterschiedliche
Basensequenzen für die methylierte und die unmethylierte DNA. Diese können dann
mittels ausgewählter Primer in einer PCR detektiert werden. Die Primer, die
unmethylierte DNA nachweisen sollen, enthalten in der 5‘-3‘ Sequenz kein Cytosin
und in der komplementären Sequenz kein Guanin. Die methylierungsspezifischen
Primer hingegen, enthalten dann folglich aber Cytosin bzw. Guanin. Als
unmethylierte Positivkontrolle wurde Placenta-DNA, als methylierte Positivkontrolle
SssI-behandelte
Placenta-DNA
verwendet.
SssI
ist
eine
Methylase,
die
unmethylierten Cytosinen Methylgruppen anhängen kann. Die Placenta-DNA wurde
nach folgendem Ansatz mit SssI inkubiert:
Reagenz
Volumen im Einfach-Ansatz (µl)
Puffer NEB 2 (10x)
2
S-adenosylmethionin (SAM, 200x)
1 (40x)
Enzym SssI
1
Placenta DNA (1µg)
5
Wasser
11
Gesamt
20
Tabelle 2-26: Ansatz zur Methylierung von Placenta-DNA, zur Herstellung einer Positivkontrolle für die MSP.
68
Material und Methoden
Der Ansatz wurde insgesamt vier Stunden bei 37°C inkubiert. Nach drei Stunden
wurde erneut 1µl SAM (200x) zugegeben um die Bereitstellung einer ausreichenden
Menge an Methylgruppen zu gewährleisten.
Nach erfolgter Bisulfitbehandlung und der Aufreinigung der DNA-Produkte wurden
diese
in
der
methylierungsspezifischen
(M-PCR)
und
der
nicht-
methylierungsspezifischen (UM-PCR) nach folgendem Schema amplifiziert:
Reagenz (M-PCR)
Volumen im Einfach-Ansatz (µl)
Green Go Taq Reaction Buffer (5x)
5,0
dNTPs (10mM)
0,4
Primermix (M)
2,0
DMSO
1,25
Wasser
14,225
Go Taq DNA Polymerase (5u/µl)
0,125
Bis. DNA
2,0
Gesamt
25,0
Tabelle 2-27: Ansatz einer methylierungsspezifischen PCR mit Primern, die einen methylierten Promotor
nachweisen (M-MSP).
Schritt (M-PCR)
Zeit
Temperatur
Step 1
5 min
95°C
Step 2 (Denaturierung)
30 sec
94°C
Step 3 (Annealing)
30 sec
66,5°C
Step 4 (Elongation)
30 sec
72°C
Step 5
go to Step 2
36x
Step 6
10 min
72°C
Step 7
forever
8°C
Step 8
end
Tabelle 2-28: Thermocycler-Bedingungen der methylierungsspezifischen PCR mit Primern, die einen
methylierten Promotor nachweisen(M-MSP).
Reagenz (UM-PCR)
Volumen im Einfach-Ansatz (µl)
Green Go Taq Reaction Buffer (5x)
5,0
dNTPs (10mM)
0,4
Primermix (UM)
2,0
69
Material und Methoden
MgCl2 (25mM)
1,0
DMSO
1,25
Wasser
8,35
Bis. DNA
2,0
Gesamt
25,0
Tabelle 2-29: Ansatz einer methylierungsspezifischen PCR mit Primern, die einen unmethylierten Promotor
nachweisen(UM-MSP).
Schritt (UM-PCR)
Zeit
Temperatur
Step 1
5min
95°C
Step 2: Pause drücken, je 5µl Taq/Wasser (0,3µl Go Taq + 4,7µl Wasser) pro Tube
hinzugeben, dann Pause aufheben, Programm fortfahren
Step 3 (Denaturierung)
30sec
94°C
Step 4 (Annealing)
30sec
63,8°C
Step 5 (Elongation)
45sec
72°C
Step 6
go to Step 3
36x
Step 7
10min
72°C
Step 8
Forever
8°C
Step 9
end
Tabelle 2-30: Thermocycler-Bedingungen der methylierungsspezifischen PCR mit Primern, die einen
unmethylierten Promotor nachweisen (UM-MSP).
Es wurden jeweils 5µl der M-(126bp) oder der UM-(135bp) Produkte auf ein
2,5%iges Agarosegel aufgetragen. Nach einer Stunde Elektrophorese bei 110V,
wurde das Gel 20 min in einem Ethidiumbromid-Gel gefärbt und anschließend unter
UV-Licht visualisiert.
2.2.2.8
Agarose-Gelelektrophorese
Die Agarose-Gelelektrophorese diente dazu DNA-Fragmente der Größe nach
aufzutrennen und sie dann mit dem interkalierenden Phenanthridin-Farbstoff
Ethidiumbromid unter UV-Licht sichtbar zu machen. Es wurden jeweils 100ml 1xTAE
Puffer (Fermentas) und, je nach Porengröße, die entsprechende Menge pulverisierte
Agarose (Biozyme) gemischt (für ein 2,5%iges Gel zum Beispiel 2,5g Agarose +
100ml 1x TAE-Puffer) und 5min in der Mikrowelle aufgekocht. Die nicht mehr
kochende, aber noch warme Agaroselösung wurde dann in den Gelschlitten
70
Material und Methoden
ausgegossen. Nach 20 Minuten wurde der Kamm aus dem erkalteten und
ausgehärteten Agarosegel gezogen. Der Gelschlitten wurde in die mit Puffer befüllte
Elektrophorese-Kammer eingelegt. Nach dem Beladen der Taschen mit PCRProdukten und geeignetem Längenmarker wurde für eine Stunde eine Spannung von
110V angelegt. Aufgrund ihrer negativen Ladung kann die DNA im elektrischen Feld
von der Kathode zur Anode wandern. Hierbei wandern kleine Moleküle schneller als
große, da die Laufgeschwindigkeit der einzelnen DNA-Fragmente umgekehrt
proportional mit der Größe der Moleküle korreliert. Die DNA-Fragmente werden somit
nach ihrer Größe aufgetrennt.
Im Anschluss wurde das Gel 20 min in einem 0,05%igem Ethidiumbromidbad (500ml
0,5x TBE + 5 Tropfen Ethidiumbromid aus der Tropfflasche) gefärbt und dann in der
E-Box VX2 von Vilber Lourmat visualisiert.
2.2.2.9
Quantitative Real-Time PCR (qRT-PCR)
Die quantitative Real-Time PCR dient, wie auch die konventionelle PCR dazu, DNAFragmente zu vervielfältigen. Zusätzlich kann aber auch die Menge der DNA mittels
Fluoreszenzmessung während der exponentiellen Phase eines PCR-Laufes ermittelt
werden. Dazu werden dem Reaktionsgemisch interkalierende Fluoreszenzfarbstoffe,
wie SybrGreen oder aber TaqMan-Sonden (z.B. gequenchte, FAM-gekoppelte
genspezifische Sonden) beigemischt, die dann in neusynthetisierte DNA eingebaut
werden, bzw. an komplementäre DNA-Fragmente binden und vom Gerät detektiert
werden können. Die Zunahme der Fluoreszenz ist dabei proportional der Zunahme
der DNA. Die Anzahl der Zyklen, die notwendig ist, um ein konstant definiertes
Fluoreszenzniveau zu erreichen, wird als C T- oder auch CP-Wert (Crossing Point)
bezeichnet. Dieser Wert wird schließlich auch als Maß für die Quantifizierung der
Startmenge herangezogen: je höher der CT-Wert, desto mehr Zyklen werden benötigt
um ein adäquates Fluoreszenzsignal zu erhalten und desto weniger DNA war zu
Beginn der PCR im Ansatz enthalten [114].
In der vorliegenden Arbeit wurde ausschließlich mit der relative Quantifizierung
gearbeitet um die Veränderung der Genexpression bzw. die Expression von miRNAs
zu untersuchen. Als Referenzgen wurde GAPDH bei der Genexpressionsanalyse
und RNU6 und SNORD44 bei der miRNA-Expressionsanalyse mitgemessen. Die
Berechnung der Genexpression erfolgte dann mit der ΔΔCT-Methode. Die
71
Material und Methoden
Messungen erfolgten mit dem Thermocycler Applied Biosystems 7500 Fast RealTime PCR System.
Genexpressionsanalyse (SYBRGreen-basiert)
Vor den eigentlichen Messungen wurde für jeden Primer die optimale Konzentration
im PCR-Ansatz ausgetestet und die Effizienz bestimmt. Die Primeroptimierung
erfolgte anhand der Schmelzkurven und sollte das Auftreten von Primerdimeren
ausschließen. Dazu wurden die Primer mit unterschiedlichen Konzentrationen (100,
150, 200, 250, 300, 350 und 400nM) in der PCR eingesetzt und die jeweilige
Schmelzkurve untersucht. Die Bestimmung der Primereffizienz war nötig um zu
gewährleisten,
dass
bei
jedem
PCR-Zyklus
von
einer
Verdoppelung
der
Nukleinsäuren ausgegangen werden kann. Um eventuelle Abweichungen vom
Faktor 2, der einer Primereffizienz von 100% entspricht, zu detektieren wurde
anhand einer Verdünnungsreihe (1:4, 1:16, 1:64, 1:256, 1:1024, 1: 4096,
Gesamtvolumen 200µl, 30min Schütteln bei RT) eines definierten DNA-Pools eine
Eichgerade erstellt, aus deren Steigung die jeweilige Effizienz berechnet wurde.
Diese wurde dann bei der Auswertung berücksichtigt.
Die ermittelten optimalen Primerkonzentrationen und die dazu gehörigen Volumina
im einfachen Gesamtansatz von 12,5µl, sowie die Effizienzen sind in folgender
Tabelle zusammen gefasst. Die zugehörigen Schmelzkurven und Eichgeraden sind
im Anhang zu sehen.
Gen
Konzentration
Volumen
Volumen
Effizienz
(nM)
Primermix (µl)
Wasser (µl)
AXIN2
150
0,25
3,5
98,6%
BMP4
100
1,166
3,584
96,7%
CD44
200
0,34
3,41
94,5%
CMYC
200
0,34
3,41
86,3%
CCND1
150
0,25
3,5
81,3%
SFRP1
100
0,166
3,584
94,3%
GAPDH
250
0,4166
3,33
99,2%
MTUS1
200
0,34
3,41
95,1%
Tabelle 2-31: Auflistung der optimierten Primerkonzentrationen, der zugehörigen Volumina und Effizienzen bei
der qRT-PCR.
72
Material und Methoden
Die PCR wurde nach folgendem Schema pipettiert:
Reagenz
Volumen im Einfach-Ansatz (µl)
SYBR Green Mix (2x)
6,26
Primermix (15µM)
Je nach Optimierung
Wasser
Je nach Primervolumina (add 12,5)
cDNA (10ng/µl)
2,5
Gesamt
12,5
Tabelle 2-32: Pipettieransatz der Standard-qRT-PCR.
Pro Well wurden 25ng cDNA eingesetzt. Dazu wurde die umgeschriebene RNA 1:5,
die SFRP1-Positivkontrolle SK-Mel-28 1:20 mit Wasser verdünnt. Die Reaktion
erfolgte im Triplikatansatz. Die Ansätze wurden in sterile Einmal-96Well-Platten von
Applied Biosystems pipettiert und mit Adhesive Covers zugeklebt.
Das PCR-Programm am Thermocycler erfolgte nach folgendem Schema:
Schritt
Art
Zeit
Temperatur
Step 1
Holding
2min
50°C
Step 2
Holding
10min
95°C
15sec
95°C
30sec
60°C
Step 3
Cycling 40x
Step 4
Melt Curve
15sec
95°C
Step 5
Melt Curve
1min
60°C
Step 6
Melt Curve
30sec
95°C
Step 7
Melt Curve
15sec
60°C
Step 8
end
Tabelle 2-33: Thermocycler-Konditionen der Standard-qRT-PCR.
Die Auswertung erfolgte mit der 7500 Software v2.0.5 von Applied Biosystems. Die
ΔΔCT-Methode
berechnete
die
Genexpression
zwischen
„Kontrolle“ mit folgenden Formeln:
ΔCT = CT Zielgen – CT Referenzgen (=Normalisierung)
73
„Behandlung“
und
Material und Methoden
ΔΔCT = ΔCT Behandlung – ΔCT Kontrolle
Ratio = 2(-ΔΔCT)
Das Ratio entspricht der relativen Genexpression, bzw. der Expressionsdifferenz
zwischen zwei untersuchten Proben (z.B. Behandlung und Kontrolle). Das Ratio
einer untersuchten Probe wurde auf 100% (Referenz) gesetzt und die anderen
Proben wurden damit verglichen.
MicroRNA Assay (SYBR-Green-basiert)
Um die relative Expression der SFRP1 SNP rs3242-assoziierten mikroRNAs hsamiR-603
und
hsa-miR-3646
in
Harnblasenkarzinom-Zelllinien
und
Blasentumorgewebe, sowie in Normalurothel zu ermitteln, wurde ein PerfeCta
microRNA Assay von Quanta Biosciences nach den Herstellerangaben durchgeführt.
Zunächst wurde jeweils 1µg RNA mit dem qScript microRNA cDNA Synthesis Kit
polyadenyliert und anschließend in cDNA konvertiert. Im Folgenden wurde die
quantitative Real-time PCR am 7500 Fast Real-time PCR System von Applied
Biosystems nach folgendem Schema durchgeführt:
Reagenz
Volumen im Einfach-Ansatz (µl)
PerfeCta Universal PCR Primer
0,5
miRNA spezifische Primer
0,5
cDNA
2µl von 0,5ng/µl Konz. (1ng)
TaqMan Universal Master Mix
12,5
Wasser
9,5
Gesamt
25
Tabelle 2-34: Pipettierschema der qRT-PCR für den Nachweis der hsa-miR-603.
Die Messungen wurden im Triplett-Ansatz durchgeführt. Der Mastermix wurde pro
Probe 3,5x angesetzt und dann je 25µl pro Well pipettiert.
Das PCR-Programm erfolgte gemäß Hersteller-Empfehlungen nach folgendem
Schema (2-step cycling protocol):
74
Material und Methoden
Schritt
Art
Zeit
Temperatur
Step 1
Holding
2min
95°C
5sec
95°C
30sec
60°C
Step 2
Cycling 40x
Step 3
end
Tabelle 2-35: Thermocycler-Konditionen der qRT-PCR für den Nachweis der hsa-miR-603 (2-step cycling
protocol).
Die Auswertung erfolgte, wie auch bei der Genexpressionsanalyse, mit der ΔΔCTMethode (siehe oben).
2.2.2.10
RFLP-Analyse der SNPs
Zur Untersuchung des Genotyps eines Single Nucleotid Polymorphisms (SNPs)
wurde die Restriktionsfragmentlängenpolymorphismus-Technik (restriction fragment
length polymorphism, RFLP) angewendet. Dabei wurde das den SNP enthaltende
DNA-Fragment
zunächst
mittels
PCR
amplifiziert
und
dann
einem
Restriktionsenzym-Verdau unterzogen. Das Restriktionsenzym wurde mit dem NEB
cutter 2.0 so ausgewählt, dass es die DNA beim Vorliegen des einen Genotyps
schnitt und beim Vorliegen des anderen möglichen Genotyps nicht schnitt (single
cutter). Im Folgenden sind DNA-Sequenz-Ausschnitte von SFRP1 mit den
beinhalteten SNPs und den Bindestellen des jeweiligen Restriktionsenzyms
abgebildet.
rs3242:
GTGTTGTTTT TTTAACTGCA TTTTACCAGA TGTTTTGATG TTATCGCTTA TGTTAATAGT
Rsa I C/TGTGTTCATTT TATTTTCATG CTTTTTCAGC CATGTATCAA TATTCACTTG
AATTCCCGTA
ACTAAAATCA CTCAATTAAT CAATGATACT GTGAGCTGTG ACTTTTTTTT CCCACTCAGT
CATACACTTC
rs921142:
GGGTCTGGGA GGAGTCAGGA GTGCACTGGA TTTAGGATTT GGGGTCTTCT CCCATCACTC
CCTGTTCCAC GGAGAGACAA CTGTGTTCCC AGCAGGGGTC AGTAAAGCAG TAGGACCAC
TA/GGGGGTGAG TGGGGGAGGT GGTGACTGGA GGTGATCAAA GTCTACTCGG AGTGACCAGA
CATAGGCGAG GTCTTCCCCT GAATGGATTT GTGAGATTTA CTCCTGACTT GGGACTTCCA GG
Nachfolgend wurden die DNA-Fragmente auf einem 2,5%igem Agarose-Gel sichtbar
gemacht. Die Genotypen konnte jetzt anhand unterschiedlicher Bandenanzahl und
75
Material und Methoden
Bandengröße auf dem Agarosegel unterschieden werden. Lag ein heterozygoter
Genotyp vor, so konnte sowohl das ungeschnittene, als auch das geschnittene
Fragment auf dem Gel visualisiert werden.
Mit der RFLP-Technik wurden 2 SNPs untersucht: rs3242 (in der 3’UTR von SFRP1)
und rs921142 (5‘-upstream von SFRP1). Die DNAs der Zelllininen und der
Patientenproben wurde mit dem High Pure PCR Template Preparation Kit oder
Trizol-Methode isoliert, bzw. lagen schon isoliert in der Arbeitsgruppe vor und wurde
dann in einer konventionellen PCR (Protokoll siehe 2.2.2.6) primerspezifisch
amplifiziert. Nachfolgend wurden die PCR-Produkte mit RsaI bzw. BmrI nach
folgendem Schema verdaut:
SNP
rs3242
rs921142
Lokalisation
8p: 3’UTR SFRP1
8p: 5’upstream SFRP1
Annealing-Temp.
57°C
57,8°C
Restriktionsenzym RsaI
BmrI
Genotyp I
Homozygot CC (44bp + 93 bp)
Homozygot AA (218 bp)
Genotyp II
Homozygot TT (137bp)
Homozygot GG (114bp + 104bp)
Genotyp III
Heterozygot CT (44bp + 93bp + Heterozygot AG (104bp + 114 bp +
137bp)
218bp)
Verdau
4h, 37°C
10h, 37°C
PCR-Produkt
20µl
10µl
Puffer
NEB 4: 3µl
NEB 2: 1,5µl
Enzym
0,5µl
1µl
Wasser
6,5µl
2,5
Gesamt
30µl
15µl
Tabelle 2-36: Übersicht über die wichtigsten Parameter der RFLP-Analyse der beiden SNPs in SFRP1 rs3242
und rs921142.
Pro PCR-Produkt wurden 15µl auf ein 2,5%iges Agarosegel aufgetragen. Nach einer
Stunde Elektrophorese bei 110V, wurde das Gel 20min in einem Ethidiumbromid-Gel
gefärbt und anschließend unter UV-Licht visualisiert.
76
Material und Methoden
2.2.2.11
Amplifikation von Plasmiden mittels Transformation in E. coli
Um die für Transfektionen benötigten Plasmide in ausreichender Menge vorrätig zu
haben, wurden sie zunächst in E.coli Bakterien transformiert, darin amplifiziert und
dann mit dem NucleoBond® Xtra Midi Kit von Machery-Nagel isoliert und
aufgereinigt. Eine solche Amplifikation wurde durchgeführt für „SFRP1 in pCMV6Neo Vektor“, „scrumbled SFRP1 in pCMV6-Neo“, „Leervektor pCMV6-Neo“, „hsamiR-603 in pCMV-MIR“, „Leervektor pCMV-MIR“, „MTUS1 in pCMV6-XL5V“,
„Leervektor pCMV-XL5V“, sowie für das TOP, FOP und das pGL4.74[hRluc/TK]
Renilla-Plasmid. Das Plasmid „hu SFRP1 shRNA in pGFP-V-RS sh Vetor“ und der
zugehörige Leervektor wurden nicht amplifiziert. Die Transformation der Plasmide
erfolgte in chemisch kompetenten Escherichia coli Bakterien (TOP 10) aus dem
TOPO TA Cloning Kit for Sequencing von Invitrogen gemäß den Herstellerangaben
(One Shot® Chemical Transformation Protocol). Zur Selektion der transformierten
Bakterien wurde Ampicillin in einer Konzentration von 50µg/ml im LB-Medium
eingesetzt. Zur Herstellung des LB-Mediums wurde, je nach benötigtem Volumen,
die entsprechende Menge Fertig-LB-Pulver (von Lennox) mit Aqua bidest. versetzt
(z.B. 2g LB-Pulver + 100ml Aqua bidest) und autoklaviert. Zur Herstellung von
Agarplatten wurde dem LB-Medium zusätzlich noch 1,5g Agar pro 100ml zugefügt
(100ml sind ausreichend für 4 Agarplatten). Die Zugabe von Ampicillin erfolgte nach
dem Autoklavieren. Pro Bakterienröhrchen wurden 0,5µg Plasmid-DNA für die
Transformation eingesetzt. Nach dem Ausplattieren der transformierten Zellen und
Übernacht-Inkubation bei 37°C wurden die farblosen Bakterienkolonien mit einer
sterilen Pipettenspitze gepickt und in 5ml LB-Medium als Vorkultur überführt. Nach
ca. 6-stündigem Schütteln bei 350rpm wurden 100 µl der Vorkultur in 100-300ml
Übernachtkultur überführt (Volumen je nach Midi oder Maxi-Prep) und unter
Schütteln inkubiert. Die Übernachtkultur wurde dann am nächsten Tag mit dem
NucleoBond® Xtra Midi Kit aufgereinigt. Bei der Aufreinigung wurde zwischen dem
Protokoll für high (FOP, Renilla, SFRP1, scrumbled SFRP1, LV SFRP1)- und low
(TOP, MTUS1, LV MTUS1)-copy Plasmide unterschieden. Am Ende der Aufreinigung
wurde das DNA-Pellet in 50µl Wasser aufgenommen und die Konzentration
photometrisch bestimmt.
77
Material und Methoden
2.2.2.12
Restriktionsverdau von Plasmiden
Zur Qualitätskontrolle wurden je 1µg der amplifizierten Plasmide TOP (5200bp), FOP
(5200bp), pGL4.74 [hRluc/TK] (4237bp) und MTUS1 in pCMV6-XL5 (8282, davon
3800bp MTUS1 und 4482bp Vektorplasmid) einem Restriktionsverdau unterzogen.
Dabei
konnten
durch
die
Kombination
mehrerer
Restriktionsendonukleasen
unterschiedlich große DNA-Fragmente erzeugt werden, die auf die richtige Größe
und Qualität des Plasmides rückschließen ließen. Es wurde je 1 unit eines jeden
Restriktionsenzyms eingesetzt. Die Pipettierschemata aller eingesetzten Enzyme
sind in folgender Tabelle 2-37 zusammengefasst.
Enzym
1 unit
Puffer (je 3µl)
BSA
Wasser
HindIII
0,25µl
NEB2
-
add 30µl
XhoI
0,25µl
NEB4
3µl (10x)
add 30µl
BbsI
1,0µl
NEB2
-
add 30µl
AflIII
1,0µl
NEB3
3µl (10x)
add 30µl
EcoRI
0,25µl
NEB EcoRI
-
add 30µl
NotI
0,5µl
NEB3
0,3µl (100x)
add 30µl
SmaI
0,25µl
NEB4
-
add 30µl
BbsI+HindIII
1,0+0,25µl
NEB2
-
add 30µl
BbsI+XhoI
1,0+0,25µl
NEB2
-
add 30µl
HindIII+EcoRI
0,25+0,25µl
NEB2
-
add 30µl
Tabelle 2-37: Pipettierschema der verwendeten Restriktionsenzyme; zu beachten war vor allem, dass bei Not I,
Afl III und Xho I BSA im Ansatz benötigt wurde.
Eine Übersicht über die durchgeführten Restriktionsverdaus ist in folgender Tabelle
dargestellt:
Plasmid
Enzyme
Verdau [1x]
Erwartete Produkte
TOP
HindIII
4h, 37°C
1 (5200bp)
XhoI
4h, 37°C
1 (5200bp)
BbsI
4h, 37°C
3 (116bp, 614bp, 4470bp)
HindIII + EcoRI
4h, 37°C
2 (2767bp, 2433bp)
HindIII
4h, 37°C
1 (5200bp)
XhoI
4h, 37°C
1 (5200bp)
FOP
78
Material und Methoden
BbsI
4h, 37°C
0 (ccc-Form)
HindIII + EcoRI
4h, 37°C
2 (2759bp, 2441bp)
AflIII
4h, 37°C
2 (2700bp, 1537bp)
HindIII
4h, 37°C
1 (4273bp)
BbsI+ HindIII
4h, 37°C
3 (754bp, 1319bp, 2164bp)
7,5h, 37°C
3 (1630bp, 2010bp, 4640bp)
NotI
7,5h, 37°C
2 (3820bp, 4460bp)
SmaI
7,5h, 25°C
1 (8282bp)
4h, 37°C
2 (5800bp, 950bp)
4h, 37°C
2 (5800bp, 950bp)
EcoRI
4h, 37°C
1 (5800bp)
in HindIII
4h, 37°C
1 Fragment (linear)
XhoI
4h, 37°C
1 Fragment (linear)
HindIII + XhoI
4h, 37°C
3 Fragmente (1 davon nicht
pGL4.74[hRluc/TK]
MTUS1
in
pCMV6- EcoRI
XL5
SFRP1 in in pCMV6- EcoRI
Neo
Scrumbled SFRP1 in EcoRI
pCMV6-Neo
LV pCMV6-Neo
hsa-miR-603
pCMV-MIR
sichtbar, da sehr klein)
Tabelle 2-38: Übersicht über die Restriktionsverdaue der verwendeten Plasmide.
Die Verdauprodukte wurden auf 1%igen Agarose-Gelen visualisiert. Die erhaltenen
DNA-Fragmente aller einzelnen Restriktionsverdaus stimmten mit den erwarteten
Produktgrößen überein. Die so erhaltene Bestätigung unserer Datenintegrität
erlaubte
uns
das
Einsetzten
der
Plasmid-DNA
in
den
entsprechenden
Transfektionen.
In
Abbildung
exemplarisch
Verdauprodukte
2-3
ist
das
dargestellt
Agarose-Gelbild
und
entsprechend
des
veranschaulicht
dem
MTUS1-Restriktionsverdaus
die
verwendeten
verschieden
großen
Restriktionsenzym.
Die
schematische Plasmidkarte hebt farbig die Schnittstellen der eingesetzten Enzyme
hervor. Alle Fragmente hatten die erwartete Größe.
79
Material und Methoden
Abbildung 2-3: Bild A zeigt das Gelbild des Restriktions-Enzym-Verdaus der Plasmid-DNA mit den RestriktionsEndonukleasen EcoRI, NotI und SmaI. Bild B zeigt eine schematische Plasmid-Karte, das MTUS1-Insert ist durch
die beiden dicken Striche markiert. Die Schnittstellen der Restriktions-Enzyme sind farbig markiert, EcoRI (grün)
schneidet dreimal, NotI (orange) zweimal und SmaI (pink) besitzt nur eine einzige Schnittstelle im gesamten
Plasmid.
2.2.2.13
Mutationsanalyse mittels SNaPshot-Assay
Die Mutationsanalyse in den Genen FGFR3 und PIK3CA wurde mit den 19 papillären
Tumoren durchgeführt, die auch für die vergleichende genomische Hybridisierung
untersucht wurden. Die FGFR3 Mutationsanalyse wurde außerdem mit allen
verfügbaren DNAs der papillären Tumoren (n=81) der prospektiven Studie
durchgeführt. Mit Hilfe der Mutations-Analyse können Gen-Mutationen ausfindig
gemacht werden. Dabei können in dem hier verwendeten Ansatz bis zu zehn
Einzelbasen-Austausche in bis zu zehn PCR-Produkten detektiert werden [115].
Im ersten Schritt wurde eine so genannte Multiplex-PCR durchgeführt. Dabei werden
mit Hilfe der entsprechenden Primer die Exons 7, 10 und 15 des FGFR3-Gens bzw.
die Exons 9 und 15 des PIK3CA-Gens in einem PCR-Ansatz pro Gen amplifiziert. Ein
Multiplex-PCR-Ansatz setzte sich dabei aus folgenden Komponenten zusammen:
Reagenz
Volumen im Einfach-Ansatz
2x Qia Multiplex Mix
12,5μl
Primer-Mix (jew. 10μM)
2,5μl
80
Material und Methoden
Tumor-DNA
100ng
RNase-freies Wasser
ad 25μl
Tabelle 2-39: Zusammensetzung eines Multiplex-PCR-Ansatzes für die Mutations-Analyse. Von der Tumor-DNA
wurde pro Ansatz 100ng eingesetzt, das zu pipettierende Volumen richtete sich nach der jeweiligen Konzentration
der DNA. Mit RNase-freiem Wasser wurde jeder Ansatzes auf ein Gesamt-Volumen von 25μl aufgefüllt.
Die PCR lief im Thermocycler unter folgenden Bedingungen ab:
Schritt
Zeit
Temperatur
Step 1
5min
95°C
Step 2 (Denaturierung)
45sec
95°C
Step 3 (Annealing)
45sec
60°C
Step 4 (Elongation)
45sec
72°C
Step 5
go to Step 2
39x
Step 6
10min
72°C
Step 7
forever
8°C
Step 8
end
Tabelle 2-40: Thermocycler-Konditionen der Multiplex PCR.
Im Anschluss daran wurden die entstandenen PCR-Produkte mit den zwei Enzymen
SAP (= shrimp alkaline phosphatase) und ExoI (= Exonuklease I) behandelt. Das aus
Eismeer-Garnelen isolierte Enzym SAP sorgt über die Dephosphorylierung des 5’Phosphats für den Abbau der nicht-eingebauten Nukleotide. Die Behandlung mit der
Exonuklease dient der Beseitigung der verbliebenen Primer, da diese in 3’→5’Richtung abgebaut werden. Der Verdau lief im Thermocycler (37°C für 60min,
anschließend 72°C für 15min); dabei setzte sich ein Ansatz wie folgt zusammen:
Reagenz
Volumen im Einfach-Ansatz
Multiplex-PCR-Produkt
15μl
SAP (1.000 U/ml)
3μl
ExoI (1.000 U/ml)
2μl
Tabelle 2-41: Zusammensetzung eines Ansatzes für den Verdau der Multiplex-PCR-Produkte mit SAP und ExoI.
Das Gesamtvolumen betrug 20 μl.
Im dritten Schritt wurde das mit SAP und ExoI behandelte Multiplex-PCR-Produkt ein
weiteres Mal amplifiziert. Bei dieser so genannten SNaPshot-PCR enden die Primer
81
Material und Methoden
direkt vor der zu untersuchenden Base. Sie sind so designt, dass sie vor der
eigentlichen Erkennungs-Sequenz eine unterschiedliche Anzahl von Thyminen
tragen. Aufgrund der im Reaktions-Ansatz enthaltenen Fluoreszenz-markierten
Didesoxynukleotide (ddNTPs) erfolgt nach dem ersten Einbau einer Base jeweils
sofort ein Amplifikations-Stop. Die entstandenen Produkte weisen dann die Länge
des Primers (unterschiedlich lange T-Schwänze) plus eine Base auf. Die
verwendeten ddNTPs sind wie bei der Sequenzierung mit vier unterschiedlichen
Fluoreszenz-Farbstoffen gelabelt, so dass eine anschließende elektrophoretische
Auftrennung und Analyse im ABI-Sequencer möglich ist. Die SNaPshot PCR wurde
nach folgendem Schema pipettiert:
Reagenz
Volumen im Einfach-Ansatz (µl)
SNaPshot Ready-Reaktions-Mix
2,5μl
5x Sequenzierungs-Puffer
2,0μl
SNaPshot Multiplex Primer-Mix
1,0μl
RNase-freies Wasser
2,5μl
verdautes Multiplex PCR-Produkt
2,0μl
Tabelle 2-42: Pipettieransatz der SNaPshot PCR.
Die SNaPshot-PCR lief im Thermocycler unter folgenden Bedingungen ab:
Schritt
Zeit
Temperatur
Step 1 (Denaturierung)
10sec
96°C
Step
2
(Annealing
und 40sec
58,5°C
Elongation)
Step 3
go to step 1
Step 4
end
34x
Tabelle 2-43: Thermocyclerkonditionen der SNaPshot PCR.
Anschließend wurde das SNaPshot PCR-Produkt ein weiteres Mal mit SAP
behandelt, indem der Ansatz nach Zugabe von 1 μl SAP (1.000 U/ml) erneut 60
Minuten bei 37°C und 15 Minuten bei 72°C im Thermocycler inkubiert wurde.
Für die Sequenzierung wurde das verdaute SNaPshot-PCR-Produkt denaturiert. Es
wurde zunächst 1:50 in RNase-freiem Wasser verdünnt und dann 0,5μl dieser
82
Material und Methoden
Verdünnung mit 19μl HiDi Formamid sowie 0,1μl LIZ-Standard versetzt. Nach
zweiminütigem Erhitzen des Ansatzes auf 95°C wurden die Proben auf Eis abgekühlt
und dann bei 4°C gelagert. Die Beladung des Genetic Analyzer 3500 Dx erfolgte
durch Mitarbeiterinnen der AG Molekulare Diagnostik.
2.2.2.14
Sanger-Sequenzierung von DNA
Um die Integrität unserer SNP-Daten zu bestätigen wurde zusätzlich zur RFLPAnalyse eine Sequenzierung von stichprobenartig-ausgewählten DNA-Proben
durchgeführt. Für rs3242 wurden 10 und für rs921142 15 DNA-Proben randomisiert
ausgewählt. Zunächst wurden die Patienten-DNAs in einer konventionellen PCR mit
SNP-spezifischen Primern amplifiziert (siehe Protokoll „konventionelle PCR“). Zu
beachten war nur, dass an Stelle des grünen Puffers, der weiße PCR-Puffer
verwendet
werden
musste,
damit
die
grüne
Farbe
bei
der
späteren
Kapillarelektrophorese nicht stören würde. Im Anschluss erfolgte dann die
Aufreinigung der PCR-Produkte mit dem Dye Ex 2.0 TM Spin Kit von Qiagen gemäß
Herstellerangaben.
Davon
wurden
5µl,
zusammen
mit
dem
50bp-DNA-
Längenstandard, auf ein 2,5%iges Agarose-Gel aufgetragen und etwa 25 Minuten
bei
110V
elektrophoretisch
aufgetrennt.
Anhand
der
Bandenstärke
wurde
enschieden, wieviel PCR-Produkt in der nachfolgenden Sequenzierungs-PCR
eingesetzt werden würde (1-4µl). Im folgenden Schritt wurden die aufgereinigten
PCR-Produkte dann in der eigentlichen Sanger-Sequenzierungs-PCR amplifiziert.
Die Sanger-Sequenzierung ist eine Kettenabbruch-Methode, bei der neben den
normalen
dNTPs
auch
ddNTPs
(ddATP,
ddCTP,
ddGTP,
ddTTP)
im
Reaktionsgemisch anwesend sind. Die Fluoreszenz-markierten ddNTPs führen, bei
Einbau
in
den
neu-synthetisierten
DNA-Strang,
zum
Abbruch
der
DNA-
Polymerisation, da ihnen die 3’-OH-Gruppe für die Verknüpfung mit der
Phosphatgruppe des nächsten Nukleotides fehlt. Somit entstehen unterschiedlich
große DNA-Fragmente, die dann elektrophoretisch aufgetrennt werden können. Die
ddNTPs sind mit vier verschiedenen Fluoreszenzfarbstoffen gekoppelt, was dann
eine Farb-basierte Unterscheidung der eingebauten Nukleotide möglich macht. So
kann der „Sequencer“ durch Koppelung der Fragmentlänge und des jeweiligen
Lichtsignals die Basensequenz errechnen und dann in einem Chromatogramm
darstellen.
83
Material und Methoden
Das Schema der Sequenzierungs-PCR ist in folgender Tabelle dargestellt:
Reagenz
Volumen im Einfach-Ansatz (µl)
Terminator Ready Reaction Mix
4µl
5x Sequenzierungspuffer
4µl
Primer (sense oder antisense, je 3,2µM)
2µ
PCR-Produkt
1-4µl
Wasser
ad 20µl
Gesamt
20µl
Tabelle 2-44: Pipettieransatz der Sequenzierungs-PCR.
Die Sequenzierungs-PCR erfolgte im Thermocycler unter folgenden Bedingungen:
Schritt
Zeit
Temperatur
Step 1 (Denaturierung)
15sec
96°C
Step 2 (Annealing)
15sec
57°C (rs3242)
57,8°C (rs921142)
Step 3 (Elongation)
4min
60°C
Step 4
go to step 1
24x
Step 5
forever
8°C
Step 6
end
Tabelle 2-45: Thermocycler-Konditionen der SNP-PCRs.
Nachfolgend wurden die PCR-Produkte erneut mit dem Dye Ex 2.0 TM Spin Kit von
Qiagen aufgereinigt und dann für die Kapillarelektrophorese denaturiert. Dazu
wurden 2µl des aufgereinigten PCR-Produktes mit 18µl HiDi (Formamid) versetzt und
dann für 2 Minuten bei 95°C aufgekocht. Im Anschluss wurden die Proben auf Eis
abgekühlt und dan bis zu Beladung bei 4°C im Kühlschrank gelagert. Die Beladung
des Genetic Analyzer 3500 Dx erfolgte durch Mitarbeiterinnen der AG Molekulare
Diagnostik.
84
Material und Methoden
2.2.2.15
Vergleichende genomische Hybridisierung (aCGH)
19 papilläre Urotheltumoren (9 pTa und 10 pT1, siehe Tabelle 2-2) wurden mittels
aCGH (array-based comparative genomic hybridisation) auf die Veränderung der
Kopienzahl bestimmter chromosomaler Abschnitte bzw. ganzer Chromosomen
untersucht. Die Untersuchung erfolgte in Zusammenarbeit mit dem IZKF Core Unit
Z3 „Affymetrix-Chip-Analysen“ am Institut für Humangenetik (Ansprechpartner Dr.
Arif Ekici). Die Tumor-DNAs wurden, zusammen mit „gesunden“ Referenz-DNAs auf
den Genome-Wide SNP Array 6.0 von Affymetrix mit 1.8 Millionen genetischen
Markern (946.000 Sonden zur Detektion von Kopiezahlvarianten und 906.000 SNPSonden)
hybridisiert.
Die
Referenz-DNAs
stammten
von
einer
gesunden
Patientenkohorte (167 Kinder, Frauen und Männer) aus einer Studie zur mentalen
Retardierung von Kindern. Die Kontroll-DNAs wurden freundlicherweise vom Institut
für
Humangeneitk
bereitgestellt.
Eine
Übersicht
über
die
verschiedenen
Arbeitsschritte der aCGH sind in Abbildung 2-4 dargestellt.
Abbildung 2-4: Übersicht über alle wichtigen Arbeitsschritte bei der aCGH: Restriktionsverdau, Adaptor Ligation,
PCR, Aufreinigung, Fragmentierung, Labeling und im Anschluss die eigentliche Hybridisierung auf dem Affymetrix
Chip.
Die 19 Tumorproben wurden zunächst mikrodisseziert und anschließend daraus die
DNA mit dem QIAamp DNA Mini Kit nach dem Protokoll DNA Purification from
Tissues
isoliert.
Nach
der
DNA-Qualitätsuntersuchung
mittels
Agarose-
Gelelktrophorese, wurden 500ng genomischer DNA zunächst mit den beiden
85
Material und Methoden
Restriktionsenzymen NspI und StyI verdaut. Die entstandenen DNA-Fragmente
wurden dann mit Adaptoren ligiert und in einer PCR amplifiziert. Die PCR-Produkte
wurden aufgereinigt, gepoolt und quantifiziert. Daran schlossen sich die DNAFragmentierung, das Labeling mit dem entsprechenden Fluoreszenzfarbstoff und
schließlich die eigentliche Hybridisierung an. Diese erfolgte 16-18 Stunden lang bei
50°C. Danach wurden die Array-Chips erneut gewaschen, gefärbt und dann mit dem
GeneChip Scanner 3000 7G gescannt. Die Daten-Analyse erfolgte mit der kostenlos
zugänglichen Software Genotyping Console von Affymetrix. Eine detaillierte
Anleitung zur Versuchsdurchführung ist im Affymetrix® Genome-Wide Human SNP
Nsp/Sty 6.0 User Guide zu finden.
86
Material und Methoden
2.2.3 Proteinbiochemische Methoden
2.2.3.1
Es
wurden
Isolierung von Proteinen aus Zellen und Gewebe
sowohl
aus
Zelllininen,
als
auch
aus
humanem
Gewebe
Gesamtproteinlysate hergestellt. Dazu wurden zwei unterschiedliche Methoden
verwendet. Die Gewebeproben wurden mittels Trizol aufgearbeitet und die
kultivierten Zellen mit Hilfe eines speziellen Lysepuffers und Ultraschall-Behandlung
aufgeschlossen.
Die Zellen wurden in einem geeigneten Kulturgefäß (T75, T175 oder 10cmPetrischale) bis zu einer Konfluenz von 80% kultiviert. Zu Beginn der Proteinisolation
wurden die Zellen auf Eis gestellt, dort das Medium abgesaugt und 1x mit eiskaltem
PBS gewaschen. Durch die Kälte wurden die Zellen in eine Art Schockzustand
versetzt, was verhindern sollte, dass sie als Reaktion auf die Stresssituation,
bestimmte
Signalwege
an-
oder
ausschalten,
die
unter
normalen
Wachstumsbedingungen nicht aktiv gewesen wären. Nach dem Waschen wurden
300µl Lysepuffer (T75-Flasche) auf die Zellen pipettiert und 15 Minuten auf Eis
inkubiert. Dann wurden die angedauten Zellen mit einem Cell Scraper vom
Flaschenboden gelöst und in ein eisgekühltes 1,5ml Eppi überführt. Es erfolgte eine
45minütige Inkubation auf Eis oder im Drehrad im Kühlschrank. Im Anschluss wurde
das Lysat mit einem Ultraschallstab auf Eis sonifiziert (20 Sekunden mit Puls 1sec
on/1sec off, bei einer Amplitude von 30%), um die Wirkung des Lysepuffers zu
unterstützen. Dann wurde das Lysat für 30 Minuten bei 4°C und 13.200xg
zentrifugiert um die unlöslichen Zelltrümmer vom Proteinlysat abzutrennen. Der
Überstand wurde abgenommen und zur Langzeitlagerung bei -80°C eingefroren.
Die Proteinisolation der Gewebeproben mittels Trizol erfolgte gemäß den
Herstellerangaben.
2.2.3.2
Protein-Konzentrationsbestimmung mittels BCA-Assay
Die Konzentrationsbestimmung erfolgte mit dem BCA Protein Assay Kit von Thermo
Scientific gemäß den Herstellerangaben. Zur Erstellung einer Eichgeraden wurde ein
BSA (bovine serum albumin)-Standard mit folgenden Verdünnungen hergestellt:
2000, 1500, 1000, 750, 500, 250, 125, 62,5 mg/ml. Es wurden jeweils 25µl der
87
Material und Methoden
Standards, der Proteinlysate (1:5 mit Lysepuffer verdünnt) und des Blanks
(Lysepuffer) in Dupletts in eine 96Well-Platte pipettiert. Nachfolgend wurden 200µl
der zuvor hergestellt Working-Solution (Lsg. A : Lsg. B = 50:1) pro Well
hinzugegeben. Nach kurzem Schütteln der Platte wurde diese 30min bei 37°C
inkubiert. Im Anschluss erfolgte die Messung der Absorption am Synergy 2 mit einer
Wellenlänge von 595nm.
Bei der hier ablaufenden Biuret-Reaktion macht man sich die Eigenschaften von
Kupfer zunutze, sich an Proteine anzulagern. Bei der Komplexbildung wird das Cu 2+Ion der Kupfer-2-Sulfats zu Cu+ reduziert. Das wasserlösliche Natriumsalz der 2,2′Bichinolin-4,4′-dicarbonsäure-Säure (kurz Bicinchoninsäure oder BCA) bildet einen
spezifischen Komplex mit Cu+-Ionen, der sich konzentrationsabhängig in alkalischem
Milieu purpur färbt.
2.2.3.3
SDS-Polyacrylamid-Gelelektrophorese
Bei der diskontinuierlichen Sodium-Dodecyl-Sulfat-Polyacrylamid-Gelelektrophorese
(SDS-PAGE) nach Laemmli werden die Eiweißmoleküle des Gesamtproteinlysates
zunächst denaturiert und dann ihrer Größe nach auf einem Polyacrylamidgel
aufgetrennt.
Das
zugegebene
Natrium-Dodecylsulfat
überdeckt
dabei
die
Eigenladung der Proteine und führt so zu einer einheitlichen negativen Ladung.
Während
die
Proteinlysate
auf
Eis
auftauten,
wurden
die
Acrylamidgele
ausgegossen. Zuerst wurde ein 7,5 (MTUS1) oder 10%iges Trenngel-Gemisch (pH
8.8, siehe Tabelle 2-9) zwischen die Glasplatten der Biorad-Gießstation gegossen,
welches dann ca. 30 Minuten polymerisierte. Um eine Austrocknung zu verhindern
wurde es mit einer dünnen Schicht Isopropanol überschichtet. Nach dem Aushärten
wurde das Isopropanol entfernt und das Trenngel mit dem Sammelgel-Gemisch (pH
6.8) überschichtet und der Kamm luftblasenfrei eingesetzt. Nach 30-45minütiger
Polymerisation wurde das fertige Gel in die Elektrophorese-Apparatur eingespannt
und die Kammern bis zur Markierung mit dem Elektrolyten (1x TBS-Puffer) befüllt.
Nun wurden 30µg der aufgetauten Proteinlysate mit 5x Ladepuffer und 2M DTT
versetzt und auf 60µl mit Lysepuffer aufgefüllt. Der Ladepuffer enthielt neben dem
Negativ-Ladungs-Donor auch Bromphemolblau, was eine bessere Visualisierung der
Proben im Gel garantierte. Die Proben wurden 5 Minuten bei 95°C denaturiert. Durch
die hohe Temperatur wurde die Sekundär- und die Tertiär-Struktur der Proteine
88
Material und Methoden
durch die Trennung von Wasserstoffbrücken aufgebrochen. Das zugegebene Thiol
DTT bewirkte außerdem eine Spaltung der Disufidbrücken durch Reduktion. Der
sichtbare Marker wurde 1 Minute bei 40°C, der biotinylierte, lumineszierende Marker
2 Minuten bei 95°C inkubiert. Im Anschluss wurden die Protein-Proben, der Blank
(nur Lysepuffer), sowie die Längenmarker mit einer Hamilton-Pipette in die
Geltaschen gefüllt. Bei der nachfolgenden Elektrophorese wurde für 15 bis 20
Minuten zunächst eine Spannung von 100 Volt angelegt (Sammeln der Proteine im
Sammelgel) und dann für 45 bis 60 Minuten auf 150 Volt erhöht (Trenngel). Zur
Kontrolle einer erfolgreichen Elektrophorese wurde das Gel mit Ponceau-Rot gefärbt.
2.2.3.4
Westernblot
Beim Westernblot werden die vorher mittels SDS-PAGE aufgetrennten Proteine auf
eine Nitrozellulose-Trägermembran übertragen um diese später mit entsprechenden
Antikörpern auf die Anwesenheit eines bestimmten Proteins zu untersuchen. Die
Übertragung der Proteine vom Polyacrylamidgel auf die Nitrozellulosemembran
erfolgte durch die Wet-Blot-Methode. Dabei wurden Gel und Membran aufeinanderliegend zwischen, in Puffer getränkte, Blottingpapiere und Glasfaserkissen
eingespannt und in Anwesenheit eines elektrolytischen Puffers (Towbinpuffer) für 2
Stunden und 11 Minuten bei 100Volt oder über Nacht bei 25Volt geblottet. Das
senkrecht zum Gel ausgerichtet elektrische Feld bewirkte dabei das Wandern der
Proteine aus dem Gel auf die Nitrozellulosemembran, wo sie aufgrund der
hydrophoben Wechselwirkungen hängen blieben. Nach dem Blotten wurde die
Membran 3mal 5 Minuten in TBST gewaschen, um Methanolrückstände des
Blottingpuffers zu entfernen. Danach wurde die Membran ca. 40 min mit BSA,
Milchpulver oder der synthetischen Blockingreagenz Immunoblot Blocking Reagent
geblockt um mögliche, unspezifische Antikörperbindestellen abzusättigen. Nach
erneutem Waschen wurde der Primärantikörper auf der Membran inkubiert. Die
jeweiligen Bedingungen (z.B. Konzentration, Inkubationszeit, Temperatur, etc. sind in
Tabelle 2-46 zusammen gefasst). Nach der Inkubation des Primärantikörpers
erfolgten
ein
weiterer
Waschschritt
und
dann
die
Inkubation
des
Sekundärantikörpers. Dieser war gegen ein Epitop der Primärantikörperspezies
gerichtet
gekoppelt,
und
die
mit
HRP
dann
(horse-raddish-peroxidase
später
das
zugegebene
89
=
Meerrettichperoxidase)
Substrat
unter
Lichtabgabe
Material und Methoden
(Lumineszenz) umsetzen konnte. Der Sekundärantikörper wurde für 40 Minuten bei
Raumtemperatur inkubiert. Danach wurde nicht-gebundener Antikörper durch
3maliges Waschen entfernt. Als HRP-Substrat diente das Immobilion Western
Chemiluminescent HRP Substrat von Millipore. Es wurden je 1ml der HRP Substrate
Peroxide Solution und 1ml des HRP Substrate Luminol Reagent gemischt und für
5min auf der Membran bei Raumtemperatur inkubiert. Im Anschluss erfolgte die
Detektion des Lumineszenzsignals im Fusion FX7 von Vilber Lourmat. Nach der
Antikörperbehandlung gegen das jeweilige Zielprotein wurden die Membranen mit
einem Antikörper gegen das ubiquitär exprimierte House-Keeping-Protein ß-Aktin
behandelt und gefärbt. Dies diente dazu eine gleichmäßige Gel-Beladung mit
identischer Proteinmenge nachzuweisen und die Datenintegrität zu garantieren.
Beim initiierenden Screening der Zelllininen nach SFRP1-Expression wurde SDHA
als House-Keeping-Protein verwendet. Die Auswertung der Blots, einschließlich der
Quantifizierung erfolgte mit der Bio1D-Software von Vilber Lourmat.
pAK Name
Positiv-Ko.
AXIN2
SW480
BMP4
SK-MEL-28
CD44
HCV29
CMYC
HeLa
CCND1
SW480
SURVIVIN
SW480
SFRP1
Spezies
rabbit
monoklonal
gewicht
Reagenz
pAK
Temperatur
95-98 kDa
BSA
1:133
1h, RT
BSA
1:1000
1h, RT
82 kDa
BSA
1:5000
1h, RT
49-60 kDa
BSA
1:1000
1h, RT
34 kDa
Künstl
1:8000
1h, RT
16,5 kDa
MP
1:75
1h, RT
37 kDa
BSA
1:250
1h, RT
42 kDa
MP
1:10.000
1h, RT
73kDa
BSA
1:300
1h, 4°C
DB: 100 kDa
rabbit
monoklonal
rabbit
rabbit
polyklonal
mouse
monoklonal
-
-
Zeit und
polyklonal
rek. Protein
SDHA
Verdünnung
47 kDa
rabbit
-
Blocking-
rabbit
SK-MEL-28,
ß-AKTIN
Molekular-
mouse
monoklonal
rabbit
polyklonal
Tabelle 2-46: Übersicht über die im Westernblot verwendeten Antikörper.
90
Material und Methoden
2.2.3.5
Herstellung eines Tissue Micro Arrays
Für die immunhistochemische Untersuchung von Patientenmaterial wurde ein Tissue
Micro Array (TMA) bestehend aus 143 papillären Urothelkarzinomen aus der
Erlanger
Tumorbank
Paraffinblöcken
hergestellt.
zunächst
ein
Dazu
HE-Schnitt
wurde
aus
angefertigt,
den
der
entsprechenden
vom
Pathologen
angezeichnet wurde. Geeignete Tumorblöcke wurden zuerst am Mikrotom
„angeschnitten“ um die Paraffinschicht auf dem Gewebe zu entfernen. Dann wurde
das entsprechende Tumorareal mit einem dunklen Stift markiert, das Gewebe an der
markierten Stelle ausgestanzt und in eine TMA-Schablone (leerer Paraffinblock mit
60 Stanzlöchern) eingepasst. Zur Orientierung wurde auch eine Markierstanze am
Anfang oder Ende einer TMA-Reihe eingepasst (hier: Lebergewebe). Nachdem die
einzelnen Stanzen eingesetzt und gleichmäßig angedrückt worden waren, wurden
sie etwa 4 Minuten bei ca 60°C in flüssigem Paraffin mit dem Leerblock
verschmolzen. Im Anschluss wurden 1-4µm dünne Gewebeschnitte angefertigt, die
dann histo- und immunhistochemisch gefärbt werden konnten. Dies Repräsentativität
des Materials in den Stanzen wurde wiederum durch einen Pathologen bestätigt.
2.2.3.6
Anfertigung einer HE-Färbung
Die Hämatoxilin-Eosin- oder auch HE-Färbung ist die Standardfärbung in der
Histologie, die einen Überblick über die Struktur des Gewebes liefert und dabei die
Unterscheidung der untersuchten Strukturen in normal, entzündlich- oder z.B.
maligne ermöglicht. Die Paraffinschnitte wurden dazu 20-30 Minuten in einem 60°CSchrank stehen gelassen um Großteile des Paraffinmaterials abzuschmelzen. Im
Anschluss wurden die verbliebenen Paraffinreste in einer absteigenden XylolIsopropanol-Reihe (3x 10min Xylol, 1 x 5min 100% Isoprop, 1 x 5min 96% Isoprop, 1
x 5min 70% Isoprop) entfernt. Nach kurzem Abspülen in Aqua dest. wurde der
Schnitt zur Kernfärbung für 90sec in Hämatoxilin getaucht und dann mit
Leitungswasser abgespült. Daraufhin folgte die 10sekündige Gegenfärbung mit
Eosin, die das Zytoplasma sichtbar machte. Abschließend wurden die Schnitte 2 x für
10 Sekunden in Xylol getaucht. Dann wurden die gefärbten Gewebedünnschnitte mit
Eukitt eingedeckelt.
91
Material und Methoden
2.2.3.7
pAK Name
Anti-
Immunhistochemie (IHC)
Spezies
Hersteller
Hase
custom-
Konzentration
Zeit und
sAK
Temperatur
Bedingungen
Pineda,
SFRP1
1:200
MTUS1
P53
CK20
Ki67
monoklonal
Abnova
Detektionssystem
1:600
ÜN, RT
1:20
ÜN, RT
1:50
32‘, 37°C
U ultra View DAB am Färbeautomat
30‘, RT
made
Maus
Besonderheit
1:100
30‘, RT
TSA
AEC
TSA
AEC
Maus
Dako
monoklonal
Cytomation
Maus
Dako
Cytomation
1:50
32‘, 37°C
U ultra View DAB am Färbeautomat
Dako
Cytomation
1:100
32‘, 37°C
U ultra View DAB am Färbeautomat
monoklonal
Maus
monoklonal
Tabelle 2-47: Übersicht über die in der Immunhistochemie verwendeten Antikörper.
Die Immunhistochemie wird dazu verwendet, Proteine in hauchdünn geschnittenem
Gewebe
mittels
Antikörperfärbung
sichtbar
zu
machen.
Entwässertes,
mit
Formaldehyd fixiertes und in Paraffin eingebettetes Gewebe oder Zellmaterial wurde
am Mikrotom in 1-4µm dünne Schichten geschnitten und auf einen Glasobjektträger
aufgezogen. Die Färbungen gegen SFRP1 und MTUS1 wurden manuell nach
folgendem Protokoll durchgeführt. Zur Entfernung des Paraffins wurden die
jeweiligen Schnitte in einer absteigenden Xylol-Alkoholreihe entparaffiniert (3x 10min
in Xylol, dann je 2min in 100% (2x) Ethanol, 96% (2x) Ethanol und abschließend 1x
in
70%igem
Ethanol).
Im
Anschluss
wurden
die
Schnitte
in
3%igem
Wasserstoffperoxid 10 Minuten inkubiert, um die endogene Peroxidase zu blockieren
und somit später störende unspezifische Färbung zu verhindern. Daraufhin wurden
die
Schnitte
in einer Plastikküvette
in Zitronensäurepuffer bei 120°C im
Dampfkochtopf gekocht (1min für SFRP1 und 4min für MTUS1), um die durch die
Paraffinfixierung entstandenen Quervernetzungen der Proteine zu brechen. Dann
wurden die Schnitte einmal mit Tris+Tween gewaschen und anschließend mit dem
Primärantikörper über Nacht inkubiert (je 100µl pro Schnitt oder TMA, SFRP1/Tier1
1:600 bzw. 1:400 für die Nierengewebskontrolle; MTUS1 1:20, immer in
Albuminpuffer
verdünnt).
Das
Waschen
mit
Tris+Tween
sollte
die
Oberflächenspannung des jeweiligen Puffers herabsetzen und die Proteine so
besser zugänglich für die Antikörper und Folgereagenzien machen. Alle weiteren
92
Material und Methoden
Schritte erfolgten bei Raumtemperatur. Nach jedem Inkubationsschritt erfolgte ein
Waschschritt mit Tris-Tween-Puffer.
Am nächsten Morgen wurden die Schnitte mit Tris+Tween gespült und dann mit dem
biotinylierten Sekundärantikörper (sAK) für 30 Minuten bei Raumtemperatur inkubiert
(SFRP1 sAK antiRabbit 1:200; MTUS1 sAK anti-mouse 1:100, gelöst in Trispuffer pH
7.4). Der Sekundärantikörper erkennt bestimmte Epitope des Primärantikörpers und
bindet daran. Im nächsten Schritt wurden die Schnitte mit einer ABC-Lösung
(Antikörper-Biotin-Komplex, Vectastain, 1 Tropfen A + 1 Tropfen B in TRIS Puffer pH
7.4) für 20 min bei RT inkubiert. Diese Lösung enthielt unter anderem das Enzym
Meerrettich-Peroxidase, welche an das am sAK gebundene Biotin binden und später
das zugegeben Substrat umsetzen kann. Um das Signal zu verstärken wurde eine
Signal-Amplifikations-Lösung für 10 Minuten auf die Schnitte pipettiert. Diese
sogenannte Tyramide-Signal-Amplification (TSA) amplifiziert das chromogene Signal
vielfach und führt so zu einem intensiveren Farbsignal und einer leichteren Detektion
der immunhistochemischen Reaktion.
Dann wurde erneut die ABC-Lösung für 20 Minuten und im Anschluss die frisch
angesetzte AEC-Lösung (3-Amino-9-Ethylcarbazol) hinzugegeben. Die MeerrettichPeroxidase konnte nun das zugegebene Substrat umsetzen, was durch einen rötlichbraunen Farbumschlag an den Stellen der gesuchten Proteine sichtbar wurde. Nach
10 Minuten wurde die Reaktion gestoppt und die Schnitte erst in Leitungswasser und
dann kurz in VE-Wasser geschwenkt. Ein darauffolgender 2minütiger Färbeschritt in
Hämalaun machte durch eine Gegenfärbung auch die Zellgrenzen und die Zellkerne
sichtbar, was eine genauere Lokalisation des angefärbten Proteins möglich machte.
Die Färbungen gegen P53, KI67 und CK20 erfolgten automatisiert mit dem
BenchMark ULTRA IHC/ISH Staining Module von Ventana mit dem U ultra View DAB
KIT gemäß den Herstellerangaben. Die Primärantikörper wurden jeweils für 32min
bei 37°C inkubiert. Die so angefärbten Gewebedünnschnitte konnten nun unter dem
Mikroskop vom Pathologen (AH) ausgewertet werden.
2.2.3.8
Immunfluoreszenz (IF)
Für den Nachweis der SFRP1-Expression auf Proteinebene in den Zelllinien wurde
neben dem Westernblot und der Immunhistochemie auch die Immunfluoreszenz
angewendet. Dazu wurden die Zellen auf sterilen 8-Kammer Glasobjektträgern (BD
93
Material und Methoden
Falcon™ 8-well culture slides von BD Biosciences) kultiviert. Nach Erreichen der
gewünschten Konfluenz (ca. 70-80%) wurden die Zellen mit je 500µl eiskaltem
Aceton fixiert (20min, -20°C). Das Aceton wurde abgekippt und die Objektträger
konnten dauerhaft bei -20°C gelagert werden. Für die Immunfluoreszenzfärbung
wurden die Objektträger ca. 2min aufgetaut und dann mit 0,1%igem PBS+TritonX
versetzt. Das Detergens diente dazu, die Zellmembran permeabel zu machen und so
das Eindringen der immunreaktiven Reagenzien in die Zelle zu erleichtern. Im
Anschluss wurde der erste Primärantikörper (rabbit-anti-SFRP1 1:100 oder mouseanti-CDH1 1:100, je 100µl pro Chamber Slide Well) für 1h bei Raumtemperatur
inkubiert. Zwischen dem nächsten und allen folgenden Inkubationsschritten erfolgten
drei 5minütige Waschschritte mit PBS+Tween20 (0,1%). Im nächsten Schritt wurde
der entsprechende fluoreszenz-gekoppelte Sekundärantikörper auf die Zellen
pipettiert (Goat-anti-Rabbit, DyLight™549-konjugiert (rot) oder Sheep-anti-mouse,
DyLight™488-konjuiert (grün), beide 1:250, je 100µl pro Well). Ab diesem Schritt
erfolgte die Inkubation im Dunkeln. Für die Doppelimmunfluoreszenz wurden die
Zellen mit dem zweiten Primärantikörper (1h, RT, 100µl) und dann mit dem zweiten
Sekundärantikörper (30min, RT, 100µl) versetzt. Um die Zellkerne sichtbar zu
machen wurden die Zellen mit einer 1:1000 mit PBS verdünnten DAPI-Lösung
inkubiert (5min, RT). Nach einem letzten Waschschritt wurde das Plastikgehäuse
gemäß den Herstellerangaben abgenommen und die gefärbten Zellen mit Mowiol
eingedeckelt. Die Begutachtung der Fluoreszenzfärbung erfolgte mit dem Zeiss
Analysis Mikroskop.
2.2.4
Statistische Methoden
Um bei der SNP Analyse zu testen, ob die Genotypenverteilung dem HardyWeinberg-Equilibrium
folgte,
wurde
http://ihg.gsf.de/cgi-bin/hw/hwa1.pl
die
verwendet.
öffentlich
Für
alle
zugängliche
weiteren
Software
statistischen
Berechnungen wurde PASW/SPSS 19.0 benutzt. Signifikanzwerte, die eine
unterschiedliche Genotypenverteilung zwischen Fällen und Kontrollen, sowie eine
Assoziationen zwischen Genotypen und Alter bzw. histopathologischen Parametern
anzeigen, wurden mit dem Chi-Quadrat-Test (2-seitige Signifikanz) berechnet. Für
die Bestimmung der Risk-Allel-Verteilung wurde Fisher’s exact test (2-seitige exakte
Signifikanz) angewendet.
94
Material und Methoden
Für die Berechnung des Signifikanznineaus der Unterschiede bei den funktionellen
Experimenten zwischen Behandlung und Kontrolle (Viability-, BrdU- und WoundScratch-Assay) wurden der nicht-parametrische Kruskal-Wallis-Test für unabhängige
Stichproben (einfaktorielle ANOVA für k-Stichproben, paarweise Mehrfachvergleiche)
verwendet.
Für die Berechnungen des SFRP1-, MTUS1-, P53-, Ki67 und CK20-assoziierten
Überlebens wurden Kaplan-Meier Kurven mit dem Log-Rang-Test erstellt. Die
Überlebenswahrscheinlichkeiten und das zugehörige Risiko (95% Konfidenzintervall)
wurden mit der univariaten bzw. der multivariaten Cox-Regression berechnet.
Um alle Patientendaten untereinander zu korrelieren und Hinweise auf signifikante
Assoziationen zu erhalten wurde eine bivariate Korrelation mit dem Spearman-Test
durchgeführt. Signifikante Unterschiede wurden dann mit dem Chi-Quadrat-Test
(bzw. Fisher’s exact test) überprüft. P-Werte <0,05 wurden als statisisch signifikant
angesehen.
Die Überlebenskurven wurden in Zusammenarbeit mit der AG Molekulare Urologie
der Urologischen Klinik des Universitätsklinikums Erlangen (Prof. Wullich, Prof.
Taubert,
Dr.
Sven
95
Wach)
erstellt.
Ergebnisse
3. Ergebnisse
3.1
Untersuchung der SFRP1-Expression bei Blasenkrebs
In der vorliegenden Arbeit wurde eine mögliche Assoziation der SFRP1-Expression
mit dem Urothelkarzinom der Harnblase untersucht. Dazu wurden einerseits
Harnblasenkarzinom-Zelllininen funktionell und andererseits Auswirkungen auf den
Wnt-Signalweg untersucht. Außerdem wurden zwei Kollektive mit papillären und
fortgeschrittenen Blasentumoren auf einen möglichen Zusammenhang der SFRP1Expression mit Entstehung oder Fortschreiten der Erkrankung analysiert.
3.1.1 Funktionelle
Charakterisierung
der
SFRP1-Expression
in
Harnblasenkarzinom-Zelllinien
Für die funktionelle Charakterisierung von SFRP1 wurden zunächst verschiedene
Harnblasenkarzinomzelllininen auf die Expression von SFRP1 gescreent. Schließlich
wurden zwei papilläre Zelllinine mit und ohne SFRP1 Expression ausgewählt und
funktionelle Auswirkungen auf Viabilität, Proliferation, Migration, Wnt-Signalweg,
sowie verschiedene Wnt-Zielgene untersucht.
3.1.1.1
Screening
der
SFRP1-Expression
in
Harnblasenkarzinom-
Zelllininen
Die vier Harnblasenkarzinom-Zelllinien RT112, RT4, J82 und BFTC905, sowie die
immortalisierte Urothelzelllinine UROtsa wurden mittels konventioneller RT-PCR auf
die Expression von SFRP1 untersucht. Gleichzeitig wurden die Zellen mit dem
demethylierenden
Agenz
5-Aza-2‘-deoxyzytidin
(kurz:
5-Aza)
behandelt
um
eventuelle Promotormethylierungen nachzuweisen. Eine SFRP1-Expression konnte
in RT112, RT4, J82 und UROtsa nachgewiesen werden. Lediglich bei BFTC905
konnte keine SFRP1-Expression detektiert werden. Nach der 5-Aza-Behandlung
konnte allerding auch hier eine starke SFRP1-Expression nachgewiesen werden. Die
gleichzeitige Untersuchung der GAPDH-Expression in allen Proben zeigte eine
gleichmäßige Expression (siehe Abb. 3-1).
96
Ergebnisse
Abbildung 3-1: Untersuchung der SFRP1 und GAPDH Expression in unbehandelten (1) und 5-Aza-behandelten
(2) Zelllininen mittels PCR und Agarose Gelelektrophorese; RT112, RT4, J82 und UROtsa zeigten, BFTC905
zeigte hingegen keine konstitutive Expression von SFRP1; nach 5-Aza-Behandlung konnte wieder SFRP1 in
BFTC905 exprimiert werden.
Um zu bestätigen, dass es sich bei BFTC905 um eine Hypermethylierung des
SFRP1-Promotors handelte, wurden die Zelllinien mittels methylierungsspezifischer
PCR (MSP) untersucht. Dabei wurden pro Zelllinie jeweils zwei PolymeraseKettenreaktionen mit verschiedenen Primern durchgeführt: einerseits mit Primern, die
einen methylierten Promoter nachweisen und andererseits mit Primern, die einen
unmethylierten Promotor nachweisen. Als Negativkontrolle wurde immer eine
Wasserkontrolle mitgeführt, als Positivkontrolle in beiden Ansätzen jeweils
unmethylierte bzw. mittels SssI methylierte Placenta-DNA. In Abbildung 3-2 ist das
Agarosegel der MSP dargestellt.
methyliert: 126bp
unmethyliert: 135bp
Abbildung 3-2: Ergebnisse der methylierungsspezifischen PCR des SFRP1 Promotors; nur BFTC905 weist eine
Hypermethylierung am Promotor auf, alle anderen Zelllinine waren unmethyliert; 1 RT112, 2 J82, 3 BFTC905, 4
RT4, 5 UROtsa, 6 methylierte Placenta DNA, 7 unmethylierte Placenta DNA, 8 Negativkontrolle (Wasser).
Bei der PCR mit den methylierungsspezifischen Primern konnten eindeutige 126bpgroße PCR-Produkte bei BFTC905 und bei der Positivkontrolle detektiert werden.
Andersherum konnte bei der PCR mit den „unmethylierten“ Primern in allen Proben
ein PCR-Produkt nachgewiesen werden, außer bei BFTC905 und der methylierten
97
Ergebnisse
Placenta-DNA. Bei RT112, J82, RT4 und UROtsa ist eine charakteristische 135bpgroße Bande zu sehen. Die Wasserkontrolle war in beiden Fällen negativ.
Die MSP wurde bei BFTC905 dann erneut nach 5-Aza-Behandlung durchgeführt. In
Abbildung 3-3 ist zu erkennen, dass SFRP1 ohne 5-Aza-Behandlung einen stark
methylierten Promotor aufwies. Nach Zugabe des demethylierenden Agens war die
Promotermethylierung nahezu verschwunden. Bei der PCR, die einen unmethylierten
Promotor nachweisen sollte, war lediglich die unmethylierte Kontrollbande positiv.
Die Wasserkontrolle war in beiden Fällen negativ.
Unmethyliert: 135bp
methyliert: 126bp
Abbildung 3-3: Die MSP des SFRP1 Promotors in BFTC905 konnte eine eindeutige Hypermethylierung
nachweisen; linke Seite: Nachweis des unmethylierten Promotors (UM-PCR), rechts: Nachweis des methylierten
Promotors (M-PCR), nach 5-Aza Behandlungwar die Methylierungsbande nur noch ganz schwach zu sehen; die
unmethylierte Bande konnte aber nicht detektiert werden; 1 unbehandelte BFTC905 Zellen, 2 5-Aza-behandelte
BFTC905 Zellen, 3 methylierte Plazenta DNA, 4 unmethylierte Plazenta DNA, 5 Negativkontrolle (Wasser).
Um eine Genstilllegung mittels Acetylierung auszuschließen, wurden die BFTC905
Zellen mit den Histon-Deacetylase-Inhibitoren SAHA (subeoylanilide hydroxamic
acid, auch bekannt als Vorinostat) und Trichostatin A behandelt. Abbildung 3-4 zeigt
die Ergebnisse der PCR von SFRP1 und GAPDH in BFTC905 nach verschiedenen
Behandlungszuständen. Eine Reexpression von SFRP1 kam nur nach 5-Aza-Zugabe
zu Stande. Eine Inkubation mit Trichostatin A und SAHA brachte keine
Reexpression.
Abbildung 3-4: Darstellung des Agarosegels nach
SFRP1-PCR der unterschiedlich behandelten BFTC905
Zellen zum Nachweis der SFRP1 Expression; eine
Reexpression konnte nur nach 5-Aza-Gabe erreicht
werden. Die Genstilllegung scheint somit nicht durch
Acetylierung
sondern
lediglich
durch
eine
Hypermethylierung zu Stande gekommen zu sein;
unbeh = unbehandelt, 5-Aza = 5‘-Aza-2‘-deoxyzytidin,
Tricho = Trichostatin A, SAHA = suberoylanilide
hydroxamic acid; GAPDH wurde in allen Spuren
gleichmäßig exprimiert.
98
Ergebnisse
Um relative Expressionsunterschiede in den Zelllinien aufzuzeigen, wurden die
unbehandelten, bzw. die 5-Aza-behandelten Zellen mit der quantitativen Real-TimePCR (qRT-PCR) untersucht.
In Abbildung 3-5 ist die relative Quantifizierung der Zelllinien nach qRT-PCR zu
sehen. RT112 wurde willkürlich als 100% definiert. Die unbehandelten und 5-Azabehandelten Proben sind jeweils nebeneinander aufgetragen. Die höchste
Expression von SFRP1 auf mRNA-Niveau zeigte RT112, gefolgt von J82 (50,8%),
RT4 (1,4%) und UROtsa (0,2%), wobei die beiden letztgenannten nur basale
Expressionswerte aufwiesen. Unbehandelte BFTC905 Zellen zeigten, wie auch in der
konventionellen PCR, keine Expression von SFRP1. Nach 5-Aza-Behandlung konnte
auch in der qRT-PCR wieder eine Expression verzeichnet werden (27,8%). Doch
auch bei den anderen Zelllininen scheint die SFRP1-mRNA-Expression von 5-Aza
beeinflusst zu werden. Bei RT112 (126,9%), RT4 (16,1%) und UROtsa (8,1%)
stiegen die Expressionswerte an. Nur bei J82 beeinflusste 5-Aza die Zellen negativ,
so dass weniger SFRP1 exprimiert wurde (35,6%). Nach 5-Aza Behandlung wurden
15,2% weniger SFRP1 exprimiert, als ohne Behandlung.
Abbildung 3-5: Darstellung der relativen Quantifizierung der SFRP1 Expression in den untersuchten Zelllinien
mittels qRT-PCR mit und ohne 5-Aza Behandlung; RT112 zeigte die höchste, BFTC905 die niedrigste
Expression, nach 5-Aza-Behandlung konnte eine SFRP1 Reexpression in BFTC905 detektiert werden.
Um die SFRP1-Expression auch auf Proteinebene zu analysieren, wurden die
Gesamtprotein-Zelllysate
mittels
SDS-PAGE
99
aufgetrennt
und
die
Proteine
Ergebnisse
nachfolgend über Westernblot und Antikörper-Behandlung visualisiert. SK-Mel-28
und rekombinantes SFRP1-Protein dienten als Positivkontrolle für SFRP1, SDHA als
House Keeping Protein. Es zeigte sich, dass die vier Harnblasenkarzinomzelllininen
RT112, RT4, J82, BFTC905 und die Urothelzelllinine UROtsa keine detektierbare
Expression von SFRP1 zeigten. Die beiden Positivkontrollen zeigten eine prägnante
Bande bei ca. 37 kDa (siehe Abb. 3-6).
1
2
3
4
5
6
7
8
SFRP1
SDHA
Abbildung 3-6: Westernblot-Analyse der Zelllinien nach Behandlung mit anti-SFRP1 und SDHA-Antikörper; nur
in den beiden Positivkontrollen (bei SK-Mel-28 und beim rekombinanten Protein) konnten Banden für das 37kDa
große SFRP1 detektiert werden; 1 Blank (nur Lysepuffer), 2 RT112, 3 RT4, 4 J82, 5 BFTC905, 6 UROtsa, 7 SKMel-28, 8 rekombinantes SFRP1 Protein.
Um die Proteinexpression dennoch in den Zelllinien nachweisen zu können wurde
zusätzlich eine Immunfluoreszenzfärbung mit anti-SFRP1 Antikörper durchgeführt
(siehe Abbildung 3-7). Um die Zellgrenzen besser sichtbar zu machen wurde
gleichzeitig E-Cadherin angefärbt (grün). Man erkennt eine deutliche „Kappen“-artige
Rotfärbung über dem Kern in RT112, J82, UROtsa und SK-Mel-28, wobei sich die
Färbung bei SK-Mel-28 bis ins Zytoplasma ausdehnt. Bei BFTC905 konnte keine, bei
RT4 eine nur sehr schwache SFRP1-Färbung detektiert werden. Diese Ergebnisse
passen auch zu den Resultaten der qRT-PCR (siehe oben, Abbidung 3-5). J82 und
SK-Mel-28 hatten die E-Cadherin-Expression verloren, was für einen Verlust der
Zelladhäsion und damit für einen maligneren Phänotyp spricht. Die Lokalisation von
SFRP1 um den Nukleus herum spricht für eine Proteinexpression am Golgi Apparat.
100
Ergebnisse
Abbildung 3-7: Immunfluoreszenz der Zelllinine RT112, RT4, J82, BFTC905, UROtsa und SK-Mel-28 mit
Antikörpern gegen SFRP1 (rot) und E-Cadherin (grün); BFTC905 zeigt keine, RT4 nur schwache SFRP1Expression. SK-Mel-28 und J82 haben hingegen die E-Cadherin-Expression verloren.
Für die weiteren funktionellen Versuche wurde je eine papilläre Zellline mit SFRP1mRNA-Expression (RT112) und eine papilläre Zellinine mit SFRP1-mRNAExpressionsverlust (BFTC905) ausgewählt.
In BFTC905 wurde SFRP1 mit Hilfe eines Expressionsplasmides überexprimiert und
in RT112 mittels shRNA herunterreguliert. Funktionelle und morphologische
Veränderungen wurden im Anschluss untersucht. Dabei wurde mit dem BRdU Assay
die Proliferationsrate, mit dem Cell Titer Glo Assay die Viabilität, mit dem Wound
Scratch Assay die Migrationsrate und mit dem TOP flash/FOP flash Assay die Wnt101
Ergebnisse
Signalwegs-Aktivität bestimmt. Außerdem wurde die Auswirkung der veränderten
SFRP1-Expression auf Wnt-Zielgene über qRT-PCR und Westernblot analysiert.
3.1.1.2
Analyse der Wnt-Zielgene in SFRP1-exprimierenden und SFRP1–
defizienten RT112 und BFTC905 Zellen mittels qRT-PCR
Nach der jeweiligen Transfektion und der Zugabe des Selektionsmediums konnten,
nach ein- bis vierwöchiger Inkubationszeit, Klone isoliert werden, die das Plasmid
aufgenommen hatten und im Selektionsmedium wuchsen. Von jeder Zelllinie wurden
mindestens 10 Klone gepickt, die dann weiter kultiviert wurden, bis eine
ausreichende Zellmenge zur RNA-Isolation vorhanden war. Nach RNA-Isolation und
cDNA-Synthese wurde zunächst die SFRP1-Expression in der quantitativen RealTime PCR überprüft. Die Klone Mock4 und A1 bei RT112, sowie Mock2 und A2 bei
BFTC905 wurden für die weiteren Versuche ausgewählt. Bei ihnen wurde der größte
Effekt festgestellt. Mit Mock ist jene Zellline gemeint, die mit dem Kontrollplasmid
transfiziert wurde: also bei RT112 mit einem Vektor ohne funktionsfähige shRNA und
bei BFTC905 ein Kontrollplasmid ohne funktionsfähige SFRP1-DNA-Sequenz, was
dem Wildtyp (wt) entspricht. Der „A-Klon“ ist der gewählte Klon mit dem
funktionierenden Plasmid. Demnach exprimieren RT112 Mock (wt) und BFTC905 A
SFRP1, bei RT112 A und BFTC905 Mock (wt) ist die Expression herunterreguliert
bzw. verloren gegangen. In Abbildung 3-8 ist der SFRP1-Expressionsunterschied
zwischen transfizierten Zellen und den jeweilige Mock-Kontrollen in der relativen
Quantifizierung dargestellt.
Man erkennt einen deutlichen Unterschied zwischen A- und Mock-Klonen. Die
shRNA
konnte
SFRP1
in
RT112
um
über
95%
herunterregulieren.
Die
Überexpression in BFTC905 bewirkte hingegen eine fast 120.000fach stärkere
Expression von SFRP1. Nach Auswahl und Validierung der geeigneten Klone
wurden die transfizierten Zellen bezüglich der Expression der Wnt-Zielgene AXIN2,
BMP4, CD44, CMYC und CCND1 gescreent. Als House Keeping Gen diente
GAPDH, als Kontrollzelllinie wurde SK-Mel-28 mitgeführt. Jedes Zielgen wurde 3mal
pro Zelllinie in unabhängingen Messungen analysiert. Die „Mess-Schwelle“
(threshold) konnte für alle Gene auf den Wert 0,1 festgelegt werden. Die Baseline
wurde für jedes Gen einzeln festgelegt und ist in nachfolgender Tabelle 3-1
abgebildet.
102
Ergebnisse
A
B
Abbildung 3-8: Relative Quantifizierung der SFRP1 Expression vor und nach Knockdown mittels shRNA in
RT112 (A) bzw. vor und nach Überexpression in BFTC905 (B).
Die Baseline repräsentiert die initialen PCR-Zyklen, die durch einen kaum merklichen
Anstieg des Fluoreszenzsignals gekennzeichnet sind und die als Hintergrundrauschen von den eigentlichen Fluoreszenzsignalen abgezogen werden müssen.
Gen
AXIN2
BMP4
CD44
CMYC
CCND1
GAPDH
SFRP1
Baseline
3-25
3-24
3-15
4-15
3-16
3-10
3-15
Tabelle 3-1: Auflistung der Baselines der verschiedenen Gene, deren relative Expression in der qRT-PCR
gemessen wurden.
Im Anhang 9.3 sind die Schmelzkurven der Primeroptimierung, sowie die
Eichgeraden der Primereffizienz-Bestimmung zu sehen. Abbildung 3-9 zeigt die
Ergebnisse der qRT-PCR. Die Zelllinien mit SFRP1-Expression, also RT112 Mock4
und BFTC905 A2, wurden je auf einen Expressionswert von 100% bzw. 1 festgelegt.
Die Zelllinine mit Expressionsverlust und die SFRP1-Positivzelllinie SK-Mel-28
wurden dann damit verglichen. Es zeigte sich, dass RT112 im Grundzustand im
Vergleich zu SK-Mel-28 nur sehr wenig SFRP1 exprimierte. Die Melanomzelllinie
zeigte eine ca. 75fach höhere Expression als RT112. BFTC905 A2 zeigte allerdings
nach Überexpression von SFRP1 annähernd so hohe Expressions-Werte wie SKMel-28. Die Expression von SFRP1 in SK-Mel-28 war dabei nur noch 1,7fach erhöht.
Betrachtet man RT112 fällt auf, dass eine verminderte SFRP1-Expression auch zu
einer verminderten Expression der Zielgene führte, wobei der Knockdown bei BMP4
103
Ergebnisse
am stärksten (ca. 92% weniger) und bei CD44 am schwächsten (ca. 34% weniger)
ausgeprägt war. Bei BFTC905 war genau der gegenteilige Effekt zu beobachten:
eine Überexpression von SFRP1 bewirkte eine Herunterregulation von BMP4 um das
ca. 3,1fache. Bei CD44 war allerdings der gleiche Effekt zu beobachten, wie bei
RT112. Bei einer SFRP1-Überexpression stieg auch die Expression von CD44 leicht
an (um 29%). Bei AXIN2, CMYC und CCND1 waren nur minimale Veränderungen
der SFRP1-abhängigen Genexpression zu erkennen, die aber im Rahmen der
Standardabweichung vernachlässigt werden können. Bei AXIN2 konnte zudem eine
starke
Dimerbildung
der
Primer
nachgewiesen
werden,
die
die
relative
Quantifizierung beeinflusste und die eine scheinbar vorhandene Genexpression
anzeigte. Da die primerfreien Amplification Plots aber sehr hohe CT-Werte aufwiesen,
ist von einer fehlenden oder nur sehr basalen AXIN2-Expression auszugehen. Die
Werte der relativen Quantifizierung sind in Tabelle 3-2 zu sehen.
A
B
C
D
Abbildung 3-9: Expressionsunterschiede der Wnt-Zielgene AXIN2, BMP4, CD44, CMYC und CCND1 zwischen
SFRP1-exprimierenden (RT112 Mock und BFTC905 A-Klone) und SFRP1-defizienten (RT112 A und BFTC905
Mock-Klonen) Zellen. SK-Mel-28 wurde als Positivkontrolle mitgeführt; A und C Übersicht, B und D Darstellung
mit kleinerer Skala der y-Achse, um die Unterscheide besser zu verdeutlichen; die SFRP1-positiven Zellen
wurden auf 100% bzw. den Wert 1 festgelegt.
104
Ergebnisse
RT112
Mock4 (SFRP1+)
A1 (SFRP1-)
SK-Mel-28
BFTC905
1 A2 (SFRP1+)
1
1
1
1
1
0,24999306 Mock2 (SFRP1-)
0,08327829
0,66206605
0,37781218
0,52062854
0,17029892
3,33145761 SK-Mel-28
0,01514537
0,87131162
0,45100482
2,25292357
75,5479406
RQ Mean
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
RQ Mean
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
AXIN2
BMP4
CD44
CMYC
CCND1
SFRP1
1
1
1
1
1
1
1,05416898
3,11785913
0,71239044
1,30010676
0,98841045
0,00120289
37,8542576
0,0449189
1,48845859
0,59434581
2,48667359
1,6957374
Tabelle 3-2: Auflistung der relativen Expressionswerte der RT112 und BFTC905 Zellen mit und ohne SFRP1Expression, sowie der SFRP1-Positivkontrolle-Zelllinie SK-Mel 28.
3.1.1.3
Analyse der Wnt-Zielgene in SFRP1-exprimierenden und SFRP1–
defizienten RT112 und BFTC905 Zellen mittels Westernblot
Um eine veränderte Genexpression auch auf Proteineben nachweisen zu können,
wurden die SFRP1- und Wnt-Zielgen-Expression auch mittels Westernblot
untersucht.
Exemplarische
und
repräsentative
Ausschnitte
der
gefärbten
Westernblot-Membranen sind in Abbildung 3-12 zu sehen. Die mitgeführten
Positivkontrollen zeigten in allen Blots positive Banden. Im Anschluss an die
Zielprotein-Färbung, wurden die Membranen mit einem anti-ß-AKTIN-Antikörper
(House Keeping Protein) angefärbt, um so eine gleichbleibende Proteinqualität und –
quantität für alle Spuren nachzuweisen. Die ß-AKTIN Blots sind jeweils unter dem
entsprechenden Zielprotein abgebildet. Für die relative Quantifizierung wurde jeweils
der Expressionswert der Wildtypzelllinie (Mock) auf 100% gesetzt. Die Expression
der Proteine in den transfizierten Zelllinien wurde dann damit verglichen. Jeder
Westernblot wurde dreimal durchgeführt und die Banden separat quantifiziert. Aus
den einzelnen Werten wurden dann der Mittelwert und die Standardabweichung
gebildet.
Eine
graphische
Zusammenfassung
105
der
relevantesten
Ergebnisse
Bandenquantifizierungen ist in Abbildung 3-10 und 3-11, sowie in Tabelle 3-3
dargestellt.
Protein
RT112
Mock4 (wt)
RT112 A1 (SFRP1)
RT112 pWert
BFTC905
Mock2 (wt)
BFTC905 A1
+SFRP1
BFTC905 pWert
BMP4
CMYC
CCND1
BIRC5
SFRP1
100%
100%
100%
100%
100%
77,6%
76,8%
126,2%
123,7
95,1%
0,102
0,487
*0,037
*0,037
0,487
100%
100%
100%
100%
100%
104%
80%
101%
62,7%
1136,2%
1,0
*0,037
0,487
*0,037
*0,037
Tabelle 3-3: Auflistung der relativen Quantifizierungswerte der Westernblot-Analyse der Wnt-Zielgene in RT112
und BFTC905; es ergaben sich signifikante Werte für CCND1 und BIRC5 bei RT112 und für CMYC und BIRC5
bei BFTC905 in Abhängigkeit der SFRP1-Expression.
SFRP1 ließ sich anhand zweier dominanter Banden sowohl in der Positivkontrolle
(hier: rekombinantes Protein) als auch in der transfizierten Zelllinie BFTC905 A2
nachweisen. In den RT112 Wildtyp-Zellen und in den transfizierten RT112-Zellen,
konnte hingegen keine eindeutige Bande detektiert werden. Die Expression des
SFRP1-Proteins in RT112 konnte also mit der Westernblot-Methode nicht eindeutig
nachgewiesen werden. Die relative Quantifizierung konnte in der SFRP1überexprimierenden BFTC905-Zelllinie eine 11,3fach signifkant erhöhte Expression
im Vergleich zur Wildtypzellline nachweisen (BFTC905 A2: 1136,2%, p=0,037).
Die beiden Wnt-Zielproteine AXIN2 und CD44 konnten in keiner der untersuchten
Zelllinien nachgewiesen werden. Auf den Westernblot-Membranen waren hier keine
Banden zu sehen, sie wurden deshalb auch nicht quantifiziert.
BMP4 wurde von allen Zelllinien exprimiert, wobei jene mit positiver SFRP1Expression eine etwas höhere, wenn auch nicht signifikante Proteinkonzentration
zeigten. Die relative Quantifizierung der Banden konnte bei RT112 Mock eine um
22,4% höhere (p=0,102), bei BFTC905 A eine um 4% höhere Expression feststellen
(p=1,0).
106
Ergebnisse
Die Expression des CMYC Genproduktes konnte durch die Anwesenheit von zwei
knapp übereinander liegenden Banden nachgewiesen werden. Laut Datenblatt des
Antikörpers handelt es sich hierbei um eine spezifische (kleinere Bande bei ca.
47kDa) und um eine unspezifische Bande bei etwa 60kDa. Für die relative
Quantifizierung wurden beide Banden, für die endgültige Bestimmung der
Expression, jedoch nur die spezifische Bande ausgewertet. Dabei zeigte die SFRP1defiziente RT112 Zelllinine eine 23,2% niedrigere Expression, als die Wildtyplinie.
Die detektierten Banden waren aber eher schwach ausgeprägt und der Unterschied
nicht signifikant (p=0,487), was auf eine insgesamt niedrige CMYC-Expression
hindeutet. Bei BFTC905 konnten in beiden Zelllinien starke CMYC-Banden bei
47kDa nachgewiesen werden. Bei BFTC905 A2 war die Expression um 20%
geringer, als im Wildtyp (p=0,037).
CCND1
wurde
in
beiden
BFTC905
Zelllininen
stark
exprimiert.
Die
Expressionsunterschiede waren hierbei minimal (A2: 101%, p=0,487). Beide RT112
Zelllininen zeigten im Vergleich zu BFTC905 viel schwächere Banden, was wiederum
auf eine viel geringere Expression hindeutet. Die SFRP1-defiziente RT112-Zelllinine
hatte eine signifikant höhere Expression (126,2%) als die Wildtyplinie (p=0,037).
Die Expression von BIRC5 in RT112 ähnelte der von CCND1. Auch hier zeigte die
SFRP1-defiziente
A1-Zellinine
signifikant
höhere
Wert
(123,7%,
p=0,037).
Umgekehrt hatte die SFRP1-exprimierende BFTC905 A2 Zellen eine um 37,3%
niedrigere BIRC5-Expression als die Mock-Zellen (p=0,037).
107
Ergebnisse
A
B
C
D
E
Abbildung
3-10:
Quantifizierung
der
Proteinexpression von BMP4 (A), CMYC (B),
CCND1 (C), BIRC5 (D) und SFRP1 (E) mittels
Westernblot in RT112 nach knockdown von
SFRP11; A1 = RT112 mit verminderter
SFRP1-Expression durch shRNA Knockdown,
Mock4: RT112 +SFRP1 (wt).
A
B
C
D
Abbildung
3-11:
Quantifizierung
der
Proteinexpression von BMP4 (A), CMYC (B),
CCND1 (C), BIRC5 (D) und SFRP1 (E) mittels
Westernblot in BFTC905 nach Überexpression
von SFRP1; A2 BFTC905 +SFRP1, Mock2
BFTC905 ohne SFRP1-Expression (wt).
E
108
Ergebnisse
Abbildung
3-12:
Exemplarische
Darstellung
der Expression von SFRP1
(A) und den Wnt-Zielgenen
AXIN2 (B), BMP4 (C), CD44
(D), CMYC (E), CCND1 (F)
und
BIRC5
(G)
im
Westernblot nach SFRP1
Knockdown
bzw.
Überexpression in RT112 bzw.
BFTC905; in der jeweiligen
letzten Spur des Blots ist die
jeweilige Positivkontrolle zu
sehen. Unter der Membran
des Zielproteins ist die
Expression von ß-AKTIN in
derselben
Membran
dargestellt.
A
B
C
D
E
F
G
109
Ergebnisse
3.1.1.4
Wnt-Aktivität mittels TOP/FOP Assay
Alle vier Zelllinien zeigten im Vergleich zur Positivkontrolle SW480 nur minimale WntAktivitäten. Die Kolonkarzinomzelllinie wies sehr hohe Lumineszenzwerte und damit
korrelierend einen hohen Wnt-Aktivitätswert von 798 auf. RT112 A1 mit SFRP1Expressionsverlust hatte eine Wnt-Aktivität von ca. 0,8, die Wildtypzelllinie Mock4
hingegen von ca. 1,2. Bei BFTC905 konnten ähnliche Ergebnisse detektiert werden:
die SFRP1-defiziente Zelllinie BFTC905 Mock2 hat mit etwa 0,6 einen etwas
niedrigeren Wert, als BFTC905 A2 (1,12). Bei den beiden Zelllinien konnte, sowohl
mit als auch ohne SFRP1-Expression, kein aktiver Wnt-Signalweg nachgewiesen
werden, da die Ratien alle <2 waren. Die Ergebnisse sind in Abb. 3-13 verdeutlicht.
Die Werte der Wnt-Aktivitäten sind in Tabelle 3-4 aufgelistet.
A
B
C
Abbildung 3-13: Veranschaulichung der WntAktivität in RT112 und BFTC905 Zellen mit und
ohne SFRP1-Expression, sowie in SW480
(Positivkontrolle); A Übersicht, B y-Skala 0-40, C
y-Achse mit Skala 0-1,8; die SFRP1-Expression
schein keinen nennenswerten Einfluss auf die
Wnt-Aktivität zu haben; in allen Fällen liegt sie
unter dem Wert 2, was auf eine fehlende WntAktivität hindeutet.
Zelllinie
BFTC905 A2 +SFRP1
BFTC905 Mock2 (Wt) -SFRP1
RT112 A1 -SFRP1
RT112 Mock4 Wt +SFRP1
SW480 Positivkontrolle
Wnt-Aktivität
Stabw
1,12382959
0,57118385
0,7665509
1,16125146
798,747242
Tabelle 3-4: Auflistung der Werte der Wnt-Aktivitäten in RT112, BFTC905 und SW480.
110
0,58710281
0,35149333
0,0116619
0,25773132
178,069857
Ergebnisse
3.1.1.5
Bestimmung der SFRP1-abhängigen Viabilität (Viability Assay)
Die Zellviabilität wurde über einen Zeitraum von 72 Stunden untersucht. Nach 24, 48
und 72 Stunden wurde die Viabilität mit dem Cell Titer Glo Assay bestimmt. Die
Wildtyp BFTC905 Zellen ohne SFRP1-Expression zeigten dabei zu jedem Zeitpunkt
eine signifikant höhere Viabilität, als die SFRP1-exprimierenden BFTC905 Zellen
(24h p=0,005, 48h p=0,002, 72h p=0,009). Die Lumineszenzwerte stiegen über den
3-Tages-Zeitraum gesamt etwas an, das Verhältnis der transfizierten und der
untransfizierten Zellen veränderte sich aber kaum (siehe Abb. 3-14A).
Bei RT112 war keine signifikante Änderung der Viabilität zu beobachten. Nach 24
und 48 Stunden konnte noch eine geringfügig gesteigerte Viabilität der SFRP1defizienten Zellen beobachtet werden. Nach 72 Stunden Inkubation kehrte sich
dieser Trend um, blieb aber zu jedem Zeitpunkt im Rahmen der Standardabweichung
(24h p=0,402, 48h p=0,566, 72h p=0,233, Abb. 14B).
A
Abbildung
3-14:
Graphische
Darstellung der Ergebnisse des
Viabilitäts-Assays in BFTC905 (A)
und RT112 (B) in Abhängigkeit der
SFRP1-Expression.
B
Es kann also davon ausgegangen werden, dass der SFRP1 Knockdown in RT112
nicht zu einer Veränderung der Zell-Viabilität und des ATP-Stoffwechsels führte. In
Tabelle 3-5 sind die „geblankten“ Lumineszenz-Werte aufgelistet.
111
Ergebnisse
BFTC905
Viabilität
RT112
Lumineszenzwerte
A2
Mock2
A1
Mock4
24h
78748
104523
72112
63869
48h
149859
199441
103494
99347
72h
191134
243151
141134
154134
Tabelle 3-5: Auflistung der geblankten Lumineszenzwerte des Viabilitäts-Assays in RT112 und BFTC905.
3.1.1.6
Bestimmung der SFRP1-abhängigen Proliferation (BrdU Assay)
Der BRdU Assay diente dazu, eine SFRP1-vermittelte Änderung der Zellproliferation
nachzuweisen. Bei BFTC905 zeigte sich kein signifikanter Unterschied zwischen der
Proliferation der Wildtyp- und der transgenen Klone (24h, p=0,453, 48h p=0,156, 72h
p=0,691). Mit fortschreitender Zeit, konnten lediglich abnehmende Absorptionswerte
beobachtet werden (von ca. 1,3 bis 0,9). Bei RT112 war ebenfalls kein signifikanter
Unterschied in der SFRP1-abhängigen Proliferation zu erkennen (24h p=0,896, 48h
p=0,825, 72h p=0,27).
A
Abbildung
3-15:
Graphische
Darstellung der Ergebnisse des
BrdU-Proliferations-Assays
in
BFTC905 (A) und RT112 (B) in
Abhängigkeit der SFRP1-Expression.
B
112
Ergebnisse
Die Absorptionswerte blieben über die Zeit relativ konstant und schwankten zwischen
etwa 1,7 und 2,1. In Abbildung 3-15 sind die Ergebnisse des Proliferations-Assays
graphisch dargestellt. In Tabelle 3-6 sind die „geblankten“ Absorptionswerte
aufgelistet.
BFTC905
Proliferation
RT112
Absorptionswerte
A2
Mock2
A1
Mock4
24h
1,264
1,281
1,753
1,739
48h
1,108
1,085
2,051
1,994
72h
0,916
0,867
1,879
2,054
Tabelle 3-6: Auflistung der geblankten Absorptionswerte des BrdU Assays in RT112 und BFTC905.
3.1.1.7
Untersuchung des SFRP1-abhängigen Migrationsverhaltens mit
dem Wound Scratch Assay
Der Wound Scratch Assay wurde über 24 Stunden im Triplett-Ansatz durchgeführt.
Es hat sich gezeigt, dass die SFRP1-defizienten RT112 Zellen um 20,5% schneller
zugewachsen sind, als die RT112 Wildtyp Zellen mit SFRP1-Expression. Nach 24
Stunden waren bei RT112 Mock4 erst 41,6% des Spaltes zugewachsen, wobei es
bei RT112 A1 bereits 62,1% waren. Das Ergebnis war allerdings nicht signifikant
(p=0,127).
Bei
BFTC905
zeigte
sich
ein
signifikanter
Unterschied
im
Migrationsverhalten (p=0,021). Es konnte beobachtet werden, dass die SFRP1defizienten Zellen nahezu doppelt so schnell zu einander migrierten, wie die SFRP1exprimierenden Zellen. Dabei waren im Mittel nach 24 Stunden bei BFTC905 A2 erst
47,8% der Spaltfläche von einem Zellrasen bedeckt, wobei die Mock2 Zellen den
Spalt nahezu komplett bedeckten (ca. 98% zugewachsenen Fläche). In Abbildung 316 ist jeweils ein exemplarisches Foto der Wundheilung von SFRP1-exprimierenden
und SFRP1-defiziente Zellen zum Zeitpunkt 0 und nach 24 Stunden dargestellt. Die
zugehörigen Balkendiagramme finden sich in Abbildung 3-17.
113
Ergebnisse
A
B
Abbildung 3-16: Exemplarische Dokumentation des Wound Scratch Assays in RT112 (A) und BFTC905 (B) in
Abhängigkeit der SFRP1-Expression; bei BFTC905 ist ein deutlicher Unterschied im Wundheilungsverhalten
innerhalb von 24 Stunden zu erkennen, Zellen mit SFRP1-Expression wachsen langsamer zusammen.
A
B
Abbildung 3-17: Graphische Darstellung der Unterschiede im Migrationsverhalten von RT112 (A) und BFTC905
(B) mit und ohne SFRP1-Expression, in beiden Zelllininen konnte ein schnelleres Wachstum für SFRP1-defiziente
Zellen beobachtet werden.
114
Ergebnisse
3.1.2 Prospektive Untersuchung der Bedeutung der SFRP1 Expression in
papillären Blasentumoren
Um die Expression von SFRP1 in humanen Blasentumoren zu überprüfen, wurden 3
TMAs bestehend aus 143 papillären Urothelkarzinomen von 91 Patienten mit einem
Antikörper gegen SFRP1 immunhistochemisch gefärbt. Um die Integrität der Daten
zu überprüfen wurden die TMAs außerdem mit den krankheitsassoziierten Markern
der Routine-Immunhistochemie P53, Ki67 und CK20 gefärbt. In Zusammenarbeit mit
dem Tumorzentrum Erlangen wurden die Follow-up Daten der Patienten ermittelt. 17
der 91 Patienten sind während des Beobachtungszeitraumes verstorben, 9 davon
direkt in Folge der Erkrankung. 40 Patienten wiesen ein oder mehrere Redizive auf,
14 zeigten eine Progression des Tumors und bei 8 Patienten sind Metastasen
aufgetreten. Zur Auswertung der Progression wurden zunächst alle Patienten
ausgewählt, bei denen mindestens ein Rezidiv zusätzlich zum Primärtumor
aufgetreten war. Eine Erhöhung des Stadiums um mindesten eine „Stufe“ bei
mindestens einem der aufgetretenen Rezidive wurde als Progression gewertet. Eine
kurze Zusammenfassung der Follow-up-Daten ist in Tabelle 3-7 abgebildet.
91 Patienten
Rezidiv
Progression
Metastase
Tod
Ja
40
14
8
17
Nein
44
18
78
69
Gesamt
84
32
86
86
Fehlend (k.A.)
7
59
5
5
Dod
-
-
-
9
Tabelle 3-7: Zusammenfassung der Follow-up Daten des papillären Tumorkollektivs, k.A. =keine Angaben, Dod =
death of disease.
Für die Auswertung der immunhistochemischen Färbungen wurden verschiedene
Auswerteschemata angewendet. Bei P53, Ki67 und CK20 wurde die Prozentzahl der
angefärbten Tumorzellen vom Pathologen (AH) angegeben. Bei SFRP1 wurde
hingegen ein immunreaktiver Score (IRS) – ähnlich dem Remmele Score bei der
Brustkrebs-Diagnostik – gebildet. Dabei wurde einerseits die Intensität der Färbung
beurteilt (0=negativ, 1=schwach, 2=moderat, 3=stark) und gleichzeitig die Anzahl der
angefärbten Tumorzellen in Prozent bestimmt. Aus den beiden Zahlenwerten wurde
dann der Score berechnet. Dazu wurde den Prozentangaben nach folgendem
115
Ergebnisse
Schema ein Zahlenwert zugeordnet: 0=0, 1=1-25%, 2=26-50%, 3=51-75%, 4=76100%. Dieser Zahlenwert wurde dann mit dem Wert der Intensität multipliziert, so
dass sich Werte von 0 bis 12 ergeben konnten; diese Werte entsprachen dem
immunreaktiven Score (IRS). Bei unserem papillären TMA konnten 128 SFRP1Färbungen ausgewertet werden. Bei 15 Stanzen war entweder kein Gewebe oder
kein Tumor mehr vorhanden. 26 Stanzen hatten einen IRS von 0, 28 von 1, 40 von 2,
5 von 3, 19 von 4, 8 von 6, einer von 8 und einer von 9. Um die
immunhistochemischen Daten mit den histopathologischen, sowie den Follow-up
Daten zu korrelieren, wurde jeweils immer nur der Primärtumor des Patienten ohne
zusätzliche Rezidive ausgewählt, sodass sich folgende Verteilung für die SFRP1Färbung ergab: 86 der 91 Primärtumoren konnten ausgewertet werden. 19 Stanzen
hatten einen IRS von 0, 20 von 1, 26 von 2, vier von 3, 13 von 4, drei von 6 und eine
von 8. Fünf Stanzen enthielten entwender kein Gewebe oder keinen Tumor und
konnte nicht analysiert werden.
Für die Überlebenskurven und die statistischen Berechungen wurden geeignete
Gruppen für jede immunhistochemische Färbung definiert. Bei SFRP1 wurden
folgende Gruppen, angelehnt an den Median (2 ±1,7) gebildet: Gruppe 1 = IRS 0 und
1, Gruppe 2 = 2 bis 12. Für die Marker P53, Ki67 und CK20 wurden
Gruppeneinteilungen gewählt, die bereits in der Literatur beschrieben wurden [116,
117]. Dabei wurde jeweils zwischen
normaler und
aberranter Expression
unterschieden. Die Expression wurde als normal gewertet, wenn bei P53 weniger als
10%, bei Ki67 weniger als 15% und bei CK20 ≤ 10% der Zellen gefärbt waren
(entsprichet jeweils IHC-Gruppe 1). Gruppe 2 (aberrante Expression) setzte sich vice
versa aus den Fällen zusammen, bei denen eine P53-Expression von ≥10%, eine
Ki67-Expression von ≥15% oder eine CK20-Expression von >10% vorlag. Die
Verteilung der verschiedenen IHC-Gruppen innerhalb der Primärtumore ist in
folgender Tabelle 3-8 zusammengefasst
.
SFRP1 IRS
0
1
2
3
4
5
6
7
8
9
10
11
12
k.A.
n=
19
20
26
4
13
-
3
-
1
-
-
-
-
5
Gruppen
Gruppe 1
Gruppe 2
n=
39
47
5
P53%
0
<5
5
10
20
30
40
50
60
70
80
90
100
k.A
n=
58
-
2
5
6
3
-
6
1
1
2
2
-
5
116
Ergebnisse
Gruppen
Gruppe 1
Gruppe 2
n=
60
26
5
Ki67%
0
<5
5
10
20
30
40
50
60
70
80
90
100
k.A
n=
-
11
17
14
16
13
8
3
2
1
-
-
-
6
Gruppen
Gruppe 1
Gruppe 2
n=
42
43
6
CK20%
0
<10
10
20
30
40
50
60
70
80
90
100
k.A
n=
-
42
-
2
5
-
4
4
6
10
13
-
4
Gruppen
Gruppe 1
Gruppe 2
n=
42
44
4
Tabelle 3-8: Ergebnisse der immunhistochemischen Begutachtung (IRS oder Prozentsatz der gefärbten Zellen)
und Gruppeneinteilung des papillären Tumorkollektivs nach Färbung mit Antikörpern gegen SFRP1, P53, Ki67,
CK20
Exemplarische Färbungen für jeden Marker sind in Abbildung 3-18 zu sehen. Auf der
linken Seite sind jeweils die normalen bzw. schwachen Färbungen, auf der rechten
Seite aberrante bzw. starke Färbungen dargestellt. Ki67 und P53 sind im Nukleus,
CK20 und SFRP1 im Zytoplasma lokalisiert.
Zum Nachweis der Datenintegrität wurden die Marker P53, Ki67 und CK20 mit dem
jeweiligen Stadium und Tumorgrad korreliert (Chi-Quadrat-Test). Es zeigte sich in
allen Fällen ein signifikanter Zusammenhang. So gingen ein höheres Stadium und
ein höherer Grad auch mit einer aberranten Expression des Tumorsuppressors P53
(Stadium p=0,049, Grad p=0,012) und der Proliferationsmarker Ki67 (Stadium
p=0,007, Grad p=0,00036) und CK20 (Stadium p=0,034, Grad p=0,004) einher. Die
Integrität unserer Daten war somit gewährleistet und erlaubte eine tiefgreifendere
Analyse.
117
Ergebnisse
Abbildung 3-18: Exemplarische immunhisto-chemische Färbungen von Tumorarealen des papillären TMA mit
Antikörpern gegen CK20, Ki67, P53 und SFRP1; in der linken Spalte sind die normalen bzw. schwachen
Färbungen abgebildet, auf der rechten Seite sind Tumoren mit starker bzw. aberranter Proteinexpression
dargestellt.
118
Ergebnisse
Dazu wurden die immunhistochemischen Färbungen mit dem Überleben korreliert.
Dabei wurde unterschieden zwischen Gesamtüberleben, rezidivfreiem Überleben,
metastasefreiem Überleben und progressionsfreiem Überleben. Für jeden Marker
wurde eine Kaplan-Meier-Analyse (Log-Rang-Test) und eine univariate CoxRegression durchgeführt.
Für SFRP1 konnte kein signifikanter Unterschied zwischen den beiden Gruppen
„IRS 0+1“ und „IRS 2 bis 12“ gefunden werden. Für das Gesamtüberleben konnte
dennoch ein Trend erkannt werden. So zeigten die Patienten mit SFRP1 positven
Tumoren besseres Überleben (p=0,069), als die Patienten mit Tumoren mit
Expressionsverlust. Letztere Gruppe hatte ein 2,7fach erhöhtes Risiko an dem Tumor
zu versterben, als die „IRS 2bis12“-Gruppe. Auch die Überlebenszeit unterschied
sich sehr stark bei den beiden Gruppen. Die SFRP1-defiziente Gruppe lebte 97,8
Monate,
wobei
die
SFRP1-exprimierende
Gruppe
212,9
Monate
mittlere
Überlebenszeit aufwies. Hinsichtlich der Progression konnte kein signifikanter
Unterschied zwischen den beiden Gruppen festgestellt werden (p=0,509). Doch auch
hier lässt sich festhalten, dass die SFRP1-defiziente Gruppe eine geringere
progressionsfreie-Überlebenszeit
aufwies
(58,5Monate),
als
die
SFRP1-
exprimierenden Tumoren (154,1 Monate). Mittels Cox-Regression konnte ein
1,5faches Risiko für die SFRP1-defiziente Gruppe ermittelt werden.
Bezüglich der anderen immunhistochemischen Marker konnten drei signifikante
Unterschiede festgestellt werden. So zeigte sich, dass Tumoren mit aberranter Ki67Überexpression kürzer Metastasen- (p=0,035) und progressionsfrei (p=0,047)
blieben als Patienten mit normaler Expression. Auch Patienten mit CK20Überexpression im Tumor zeigten eine signifikant höhere Progressionsneigung als
die normale Gruppe (p=0,035). Die Graphen der Kaplan-Meier-Analysen und der
Cox-Regression für SFRP1, P53, Ki67 und CK20 bezüglich Gesamtüberleben,
rezidivfreiem
Überleben,
metastasefreiem
Überleben
und
progressionfreiem
Überleben sind in den Abbildungen 3-19 bis 3-22 zusammen gestellt.
___________________________________________________________________
Abbildungen 3-19 bis 3-22 (S. 119-122): Kaplan-Meier-Analysen (A-D) und univariate Cox-Regression(E bis H)
des papillären Tumorkollektivs für Gesamt- (A und E), Rezivivfreies- (B und F), Metastasefreies- (C und G) und
Progressionsfreies (D und H) Überleben in Monaten in Korrelation mit der Expression von SFRP1 (3-18), P53 (319), Ki67 (3-20) und CK20 (3-21).
119
Abbildung 3-19: SFRP1
Ergebnisse
A
E
B
F
C
G
D
H
120
Abbildung 3-20: P53
A
Ergebnisse
E
B
C
D
F
G
H
121
Abbildung 3-21: Ki67
A
Ergebnisse
E
B
F
C
G
D
H
122
Abbildung 3-22: CK20
A
B
C
D
Ergebnisse
E
F
G
H
123
Ergebnisse
In folgender Tabelle 3-9 sind die mittleren Überlebenszeiten, sowie die Risikowerte
der verschiedenen Analysen dargestellt.
Monate
SFRP1
P53
Ki67
CK20
Gesamtüberleben
Gruppe 1
97,8
186,2
233,6
112,6
Gruppe 2
212,9
161,4
132,6
192,1
Risiko
2,697
0,709
0,705
0,402
Rezidivfreies Überleben
Gruppe 1
48,3
37,5
38,6
44,5
Gruppe 2
32,6
46,1
35,2
35,2
Risiko
0,65
1,424
1,48
1,118
Metastasefreies Überleben
Gruppe 1
116,2
252,5
125,3
261,2
Gruppe 2
232,8
176,4
217,4
160
Risiko
1,96
0,341
0,137
0,366
Progressionsfreies Überleben
Gruppe 1
58,5
152,9
94,2
227,6
Gruppe 2
154,1
101,7
118,2
78,1
Risiko
1,531
0,543
0,236
0,274
Tabelle 3-9: Auflistung der mittleren Überlebenszeiten in Monaten, sowie -Risikowerte des papillären
Tumorkollektivs für die jeweils zwei Gruppen der SFRP1, P53, Ki67 und CK20-Färbungen.
Im Anschluss wurde die SFRP1-Färbung mit Patientencharakteristika (wie Alter,
Geschlecht), anderen immunhistochemischen Färbungen, sowie histopathologischen
Parametern korreliert. Dabei zeigte sich lediglich mit dem Tumorgrad eine
signifikante Assoziation (p=0,047, exakter Test nach Fisher, 2-seitige Signifikanz).
Bei der Einteilung in die zwei immunhistochemischen Gruppen „IRS0+1“ und
„IRS2bis12“, sowie in die beiden Gradierungen „lg“ und „hg““ zeigte sich eine
konträre Verteilung. Zeigten in der IRS0+1-Gruppe nur 13 Tumoren (33,3%) eine
low-grade, aber 26 Tumoren (66,6%) eine high-grade-Differenzierung, so drehte sich
diese Verteilung in der „IRS2bis12“-Gruppe um. 25 Tumoren (56,8%) waren hier gut
differenziert, wohingegen nur 19 Tumoren (43,2%) schlecht differenziert waren. Die
Verteilung in den beiden Gruppen ist auch in Abbildung 3-23 dargestellt.
124
Ergebnisse
Abbildung 3-23: Signifikante Korrelation
der SFRP1 Expression und des
Differenzierungsgrades beim papillären
Tumorkollektiv: die Gruppe der Tumoren
mit wenig oder nur ganz schwacher
SFRP1-Expression wies mehr highgrade als low-grade Tumoren auf. Bei
der Gruppe mit moderater oder starker
SFRP1-Expression, wurden hingegen
mehr
low-grade-Differenzierungen
befundet.
Um den Verlust der Expression mit einer Promotermethylierung zu korrelieren,
wurden geeignete Tumorschnitte mikrodisseziert, daraus DNA isoliert und dann einer
methylierungsspezifischen PCR unterzogen (exemplarisches Agarosegel in Abb. 324). Da für die DNA-Isolation ausreichend Gewebematerial vorhanden sein musste,
reduzierte sich die Anzahl geeigneter Tumoren auf 99. Da die DNA-Qualität aus
Paraffinmaterial nicht immer optimal ist und die Ergebnisse der MSP stark davon
anhängen, wurden Qualitätskriterien definiert, die eine eindeutige Auswertung
zuließen. Waren sowohl die methylierte, als auch die unmethylierte PCR negativ, das
heißt, waren also keine Banden auf dem Gel zu sehen, wurde dieser Tumor von der
Analyse ausgeschlossen. Waren beide PC-Reaktionen oder nur die „methylierte
MSP“ positiv, so wurde dies als Promoter-Methylierung gewertet. War nur die
„unmethylierte PCR“ positv, wurde der SFRP1 Promoter als nicht-methyliert
gewertet. Von den 99 geeigneten Tumoren, wiesen lediglich 38 eine hinreichend
gute Qualität auf, so dass der Methylierungsstatus analysiert werden konnte. 44,7%
(17/38) der Tumoren zeigten eine Methylierung des SFRP1-Promoter, 55,3% (25/38)
waren nicht-methyliert.
Abbildung 3-24: Repräsentatives Gelbild der MSP-Analyse der papillären Tumoren; 44,7% der Tumoren zeigten
eine Methylierung des SFRP1-Promotors (obere Reihe, M), bei 55,3% war der Promotor nicht methyliert (untere
Reihe, UM).
125
Ergebnisse
3.1.3 SFRP1-Expression in fortgeschrittenen Blasentumoren
Um den SFRP1-Expressionsverlust auch in forgeschrittenen Harnblasentumoren zu
untersuchen, wurden die TMAs eines Kollektivs mit lokal fortgeschrittenen
Harnblasen-Karzinomen nach adjuvanter Chemotherapie angefärbt. Es konnten 242
Stanzen ausgewertet werden. Die Verteilung des IRS war wie folgt: 101 negative
Tumoren, 68 mit IRS1, 51 mit IRS2, 17 mit IRS4, 3 mit IRS 6 und jeweils ein Tumor
mit IRS 9 und 12. Zur Berechnung des SFRP1-bedingten Gesamtüberlebens und
des progressionsfreien Überlebens wurden Gruppen bezüglich des IRS gebildet. Der
Median der IRS-Werte lag bei 1 (±1,6). Um die fortgeschrittenen Tumoren besser mit
den papillären vergleichen zu können, wurden allerdings die gleichen Gruppen
gewählt, wie bei den papillären Tumoren(„IRS 0 und 1“, sowie „IRS 2 bis 12“). Zur
Erstellung der Kaplan-Meier-Kurven (Abbildung 3-25) für das Gesamtüberleben und
das progressionsfreie Überleben standen 202 auswertbare Tumoren zur Verfügung.
Es konnte kein signifikanter Unterschied im Gesamtüberleben (p=0,579) und im
progressionfreien Überleben (p=0,162) zwischen den immunhistochemischen
Gruppen festgestellt werden. Von den 141 Patienten, die eine negative oder
schwache SFRP1-Färbung aufwiesen zeigten 55 eine Progression der Erkrankung
und 46 starben an ihren Folgen. Von den 61 Patienten, die hingegen eine moderate
oder starke Färbung im Tumor aufwiesen, schritt die Erkrankung in 25 Fällen fort. 20
Patienten verstarben am Tumor.
A
B
Abbildung 3-25: Bei der Kaplan-Meier-Analyse für das Gesamt- (A) und das progressionsfreie (B) Überleben bei
den fortgeschrittenen Blasentumoren konnte kein signifikanter Unterschied zwischen Tumoren mit fehlender und
schwacher bzw. mit moderater und starker Expression gefunden werden.
126
Ergebnisse
Die
bivariate
Korrelation
histopathologischen
ergab
auch
Parametern
keine
und
127
signifikante
Assoziation
mit
Patientencharakteristika.
Ergebnisse
3.2
rs3242 und rs921142 SNP-Analysen in SFRP1
3.2.1 Genotypisierung von humanen Blasentumoren mittels RFLP und
Sequenzierung
Für den SNP rs 3242 in SFRP1 wurden insgesamt 403 Tumorpatienten (188 aus
einer konsekutiven Studie und 215 Patienten mit Krankheitsbeginn ≤ 45 Jahre) und
332
gesunde
Kontrollen
untersucht.
Aufgrund
der
unterschiedlichen
DNA-
Verfügbarkeit konnte für den rs921142 SNP nur noch 184 Patienten der
konsekutiven Studie und 106 Early-Onset Patienten analysiert werden.
Die stichprobenartige Verifizierung der RFLP-Analyse durch Sequenzierung zeigte
100%ige Übereinstimmung zwischen den beiden Methoden. Die Sequenzierungen
konnten die Ergebnisse der RFLP-Analyse bestätigen. Repräsentative Ergebnisse
der RFLP-Anayse sind in Abbildung 3-26 für rs3242 und 3-29 für rs921142,
dazugehörige Sequenzen in Abbildung 3-27 für rs3242 und 3-30 für rs921142
dargestellt.
Die Genotypenverteilung in unserer Kohorte folgte dem Hardy-Weinberg-Equilibrium
bei allen Blasenkrebsfällen (rs3242: p=0.3; rs921142: p=0.26), sowie bei allen
individuellen Gruppen der konsekutiven Blasenkrebsfälle (rs3242: p=1.0; rs921142:
p=0.17), der Early-Onset-Patienten (rs3242: p=0.21; rs921142: p=1.0) und der
Kontrollen (rs3242: p=0.12; rs921142: p=0.42). Bei rs3242 zeigte sich ein auffälliger
Unterschied in der Genotypenverteilung zwischen allen Blasenkrebsfällen und der
Kontrollgruppe (p=0,05). Die Blasenkrebspatienten zeigten dabei ein erhöhtes
Auftreten des heterozygoten Genotyps CT und ein vermindertes Auftreten des
homozygoten Genotyps CC im Vergleich zur Kontrollgruppe (siehe Abbildung 3-28A).
Das T-Allel trat signifikant häufiger bei den Krebspatienten auf, als bei der gesunden
Gruppe (p=0.028, OR: 0.715, 95% CI: 0.531-0.962). Beim Vergleich der
Einzelgruppen (konsekutive Fälle gegen Early-Onset-Patienten gegen Kontrollen)
konnte ebenfalls ein signifikanter Unterschied der Genotypenverteilung festgestellt
werden (p=0,032), die mit einer gesteigerten Frequenz des T-Allels bei der EarlyOnset-Gruppe einher ging (p=0.002, OR: 0.570 95% CI: 0.397-0.817). Beim
Vergleich von jeweils zwei individuellen Gruppen wurde der größte Unterschied
zwischen den jungen Patienten und der Kontrollgruppe gefunden (p=0,007, siehe
Abbildung 3-28B). Die Unterschiede zwischen Kontrollgruppe und der konsekutiven
128
Ergebnisse
Studienkohorte (p=0,559), sowie zwischen Early-Onset- und konsekutiven Patienten
(p=0,095) waren hingegen nicht signifikant. Ebenfalls nicht signifikant war die
Assoziation der Allel-Verteilung zwischen rs3242 und dem Patientengeschlecht
(p=0,211), sowie dem histopathologischen Stadium (p=0,776).
Abbildung 3-26: Repräsentatives Gelbild der RFLP-Analyse des rs3242 SNP in SFRP1; je nach Genotyp
können drei verscheidene Produkte auf dem Gel detektiert werden: CC = 44 + 93 bp, TT = 137 bp, CT = 44 + 93
+ 137 bp (siehe Pfeile), Positivkontrolle: RT112 (CC), Negativkontrolle: Wasser.
Abbildung
3-27:
Repräsentative
Sequenzen der rs3242
SNP-Analysen
zur
Verifizierung
der
mit
Pfeilen markierten Proben
aus Abb.3-40; es zeigte
sich eine 100%ige Übereinstimmung
beider
Methoden.
129
Ergebnisse
A
B
Abbildung 3-28: Verteilung der Genotypen des rs3242 SNP in Kontrollen und Tumorpatienten (A), sowie
Verteilung des Risikoallels T in Kontrollen und Early-Onset-Patienten (B): es zeigte sich ein vermindertes
Auftreten des CC-Genotyps bzw. ein erhöhtes Auftreten des CT+TT Genotyps in jungen Patienten in Vergleich
zur gesunden Kontrollgruppe.
Für rs921142 wurde kein signifikanter Unterschied in der Genotypenverteilung
zwischen Tumorpatienten und gesunden Kontrollen gefunden (p=0,306, siehe
Abbildung 3-31). Auch beim Vergleich aller drei Gruppen untereinander (p=0,432)
und bei Korrelation mit dem histopathologischen Stadium (p=0,317) konnte keine
signifikante Assoziation mit einem erhöhten Risiko für Blasenkrebs nachgewiesen
werden. Die Genotypenverteilung der beiden SNPs sind in den entsprechenden
Tabellen im Anhang 9.6 und 9.7 zu sehen.
130
Ergebnisse
Abbildung 3-29: Repräsentatives Gelbild der RFLP-Analyse des rs921142 SNP in SFRP1; je nach Genotyp
können drei verscheidene Produkte auf dem Gel detektiert werden: AA = 218 bp, GG = 114+104 bp, AG =
104+114+218 bp (siehe Pfeile), Positivkontrolle: BFTC905 (GG), Negativkontrolle: Wasser, aufgrund der
ähnlichen Größe sind die beiden 104 und 114bp-großen DNA-Fragmente in einer Bande zu sehen.
Abbildung 3-30: Repräsentative Sequenzen der rs921142 SNP-Analysen zur Verifizierung der mit Pfeilen
markierten Proben aus Abb.3-43; es zeigte sich eine 100%ige Übereinstimmung beider Methoden
Abbildung 3-31: Verteilung der
Genotypen des rs921142 SNP in
Kontrollen und Tumorpatienten; es
konnte kein signifikanter Unterschied
festgestellt werden.
131
Ergebnisse
3.2.2 Auswirkung des rs3242 SNP auf die SFRP1-mRNA-Sekundärstruktur
Die
Analyse
einer
möglichen
Genotyp-bedingten
Änderung
der
mRNA
Sekundärstruktur mittels CONTRAfold Software konnte keine Unterschiede für die
beiden Allel-Varianten von rs3242 feststellen. Die Ergebnisse können unter
http://ai.stanford.edu/~chuongdo/cgi-bin/get_job_results.cgi?37544213 für das T-Allel
und unter http://ai.stanford.edu/~chuongdo/cgi-bin/get_job_results.cgi?118032467 für
das
C-Allel
eingesehen
werden.
3.2.3 Expressionsanalyse von hsa-miR-603 und hsa-miR-3646
Um eine Erklärung für das gesteigerte Krankheitsauftreten bei jungen Patienten mit
T-Allel in rs3242 zu finden, wurde die Bindefähigkeit von mikroRNAs an SFRP1mRNA in Abhängigkeit des Genotyps analysiert. Mit Hilfe von miRbase konnten zwei
mikroRNAs identifiziert werden, die nur bei Anwesenheit eines T-Allels bindefähig
waren: hsa-miR-603 (Chromosom 10p12.1: 24564614-24564710) und hsa-miR-3646
(Chromosom 20q13.12: 43036760-43036843). Die Ergebnisse können für miR-603
auf http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0003616 und für miR-3646
auf
http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0016046
abgerufen
werden. In Abbildung 3-32 sind die Bindemöglichkeiten der beiden miRNAs der
jeweiligen T-Variante des SNPs rs3242 im Vergleich zum C-Genotyp dargestellt.
Nach der in silico Analyse wurde die Expression der beiden mikroRNAs mittels
Quanta microRNA Assay in den Blasenkrebszelllinien RT112, RT4, J82, BFTC905,
sowie in UROtsa (normale Urothelzelllinie), einer primären urothelialen Zelllinie und
außerdem in sieben Tumorproben untersucht. Um die mikroRNA Expression zu
normalisieren wurden die beiden endogenen Kontrollen RNU6 und SNORD44
verwendet. Die mikroRNA-Expression in RT112 und in Patient 1 wurde als 100%
definiert.
132
Ergebnisse
Abbildung 3-32: Veranschaulichung der möglichen Bindefähigkeiten von hsa-miR-603 und hsa-miR-3646 an der
mRNA von SFRP1 in Abhängigkeit des rs3242 Genotyps: in beiden Fällen scheint nur eine Bindung bei
Anwesenheit des T-Allels möglich zu sein.
Es zeigte sich, dass hsa-miR-3646 (CT-Werte 23,42 bis 27,62) im Vergleich zu hsamiR-603 (CT-Werte>30) sowohl in den Zelllininen, als auch in den Tumorproben
relativ hoch exprimiert wurde. Die Normalisierung mit zwei verschiedenen „HouseKeeping-non-coding RNAs“ brachte in einigen Fällen heterogene Ergebnisse, was
darauf schließen lässt, dass mindestens eine Kontrolle genetisch reguliert wurde.
Die höchste Expression von hsa-miR-3646 konnte jedoch trotzdem für beide
Normalisierungen in BFTC905 beobachtet werden (6,7fach und 22,08fach höher als
in RT112). Die zweithöchste Expression konnte, nach Normalisierung mit SNORD44
in normalem Urothel (Primärzelllinie) gemessen werden (20,59fach). Normalisierung
mit RNU6 brachte hierfür eine nur 2fach erhöhte Expression, jedoch eine 6,13fach
erhöhte Expression in UROtsa. RT112, RT4 und J82 wiesen sehr ähnliche aber auch
die niedrigsten Expressionswerte um 100% (=1) auf. Die Patientenproben zeigten
durchgehend eine ähnlich starke Expression mit Werten zwischen 0,324 (Patient 2)
und 1,496 (Patient 4).
133
Ergebnisse
A
B
C
D
Abbildung 3-33: Relative Quantifizierung der Expression von hsa-miR-3646 (A und B) und hsa-miR-603 (C und
D) in den Zelllinine RT112, RT4, J82, BFTC905, UROtsa und in primärem Urothel; A und C Normalisierung mit
RNU6, B und D Normalisierung mit SNORD44, hsa-miR-3646 wird am stärksten in BFTC905 exprimiert, hsa-miR603 wurde nur sehr wenig exprimiert, am meisten jedoch in UROtsa bzw RT4.
Nach Normalisierung mit RNU6 konnte die stärkste hsa-miR-603 Expression in
UROtsa gefolgt von RT4, RT112 und J82 nachgewiesen werden. In BFTC905 und
primären Urothelzellen konnte hingegen eine nur sehr geringe Expression detektiert
werden. Die Amplifikationsplots waren zudem sehr heterogen und die CT-Werte sehr
hoch (>34), was eher auf einen Expressionverlust hindeutet.
Nach Normalisierung mit SNORD44 konnte die höchste hsa-miR-603 Expression in
RT4 Zellen (1,748fach höher als in RT112) und in BFTC905 (1,2fach höher)
nachgewiesen werden. In den Patientengeweben konnte eine Expression nicht vor
35 PCR-Zyklen nachgewiesen werden, was ebenfalls auf eine sehr geringe
134
Ergebnisse
Expression oder sogar Expressionsverlust hindeutet. Die höchste Expression war
dennoch in Patient 3 (2,253fach bzw 1,499fach für RNU6 bzw. SNORD44) und
Patient 2 (1,495fach für RNU6 und 1,106fach für SNORD44) zu beobachten. Die C TWerte und Expressions-Ratios beider mikroRNAs, die sowohl mit RNU6 als auch mit
SNORD44 normalisiert wurden sind in Tabelle 3-10 zu sehen. Eine graphische
Darstellung der hsa-miR-3646 und hsa-miR-603 Expression in Zelllinien ist in
Abbildung 3-33 und in Tumoren in Abbildung 3-34 dargestellt (jeweils normalisiert mit
RNU6 und SNORD44).
A
B
C
D
Abbildung 3-34: Relative Quantifizierung der Expression von hsa-miR-3646 (A und B) und hsa-miR-603 (C und
D) in sieben willkürlich ausgewählten Blasentumoren; A und C Normalisierung mit RNU6, B und D Normalisierung
mit SNORD44, hsa-miR-3646 wird in allen Tumoren exprimiert, hsa-miR-603 zeigt auch in den Tumoren nur eine
sehr schwache Expression.
135
Ergebnisse
Ct_3646
Ratio_3646
Ratio_3646
_RNU6
_SNORD44
Ct_603
Ratio_603_
Ratio_603_
RNU6
SNORD44
RT112
24,95
1
1
31,34
1
1
RT4
24,96
0,77
0,96
30,75
1,508
1,748
J82
24,7
0,868
1,12
31,28
0,95
0,846
BFTC905
23,42
6,717
22,08
34,32
0,365
1,201
UROtsa
23,87
6,129
1,21
31,58
2,953
0,563
Urothel
25,47
2,146
20,59
37,15
0,064
0,755
Patient 1
26,01
1
1
36,95
1
1
Patient 2
27,62
0,324
0,271
36,71
1,459
1,106
Patient 3
25,85
0,961
0,637
36,04
2,253
1,499
Patient 4
25,6
1,496
0,514
-
-
0
Patient 5
24,97
1,347
0,266
35,63
0,911
0,449
Patient 6
24,7
1,325
1,038
37,01
0,324
0,308
Patient 7
23,785
1,107
1,148
36,34
0,366
0,498
Tabelle 3-10: CT-Werte und Expressionsratien der beiden mikroRNAs hsa-miR-3646 und hsa-miR-603 in
Zelllinien und Tumorproben.
3.2.4 Überexpression von hsa-miR-603 in RT112, RT4 und J82
Für die Zelllinien wurden im Anschluss die Genotypen von rs3242 bestimmt. RT112,
BFTC905 und UROtsa zeigten einen homozygoten CC-Genotyp, J82 und normales
Primärurothel einen homozygoten TT-Genotyp und RT4 eine heterozygote
Allelverteilung. Ergebnisse der Genotypisierung sind in Abbildung 3-35 dargestellt.
136
Ergebnisse
1 2 3 4 5
6 7
Abbildung 3-35: Genotypisierung der
Zelllininen im rs3242 SNP; RT112,
BFTC905 und UROtsa: CC, J82 und
Urothel: TT, RT4: CT; 1=RT112, 2=RT4,
3=J82,
4=BFTC905,
5=UROtsa,
6=Urothel.
Als repräsentative Zelllinie für jeden Genotyp wurden RT112, J82 und RT4 für die
Überexpression
von
hsa-miR-603
ausgewählt.
Das
hsa-miR-603
Überexpressionsplasmid wurde in die Zellen transfiziert und Effekte auf die SFRP1Expression wurden 24 und 48 Stunden nach Transfektion bestimmt. Es war zunächst
auffällig, dass sich alle transfizierten RT4 Zellen nach 24 Stunden vom Flaschboden
gelöst hatten und offensichtlich abgestorben waren. Untransfizierte und nur mit dem
Transfektionsreagenz behandelten Zellen waren hingegen noch adhäriert und in
gutem morphologischem Zustand. Um die Überexpression zu kontrollieren, wurde im
Anschluss ein qRT-PCR basierter Quanta microRNA Assay durchgeführt. Es zeigten
sich wieder nicht ganz einheitliche Ergebnisse bei der Normalisierung mit RNU6 und
SNORD44. Die deutlichste Heraufregulierung zeigte sich in beiden Fällen bei RT4,
gefolgt von J82. Bei RT112 konnten eine nur sehr geringe Überexpression
nachgewiesen werden (siehe Abbildungen 3-36 und 3-37).
137
Ergebnisse
A
B
C
D
Abbildung 3-36: Kontrolle der Überexpression von hsa-miR-603 in RT112, RT4 und J82 mittels qRT-PCR; A
Übersicht, B RT112, C RT4, D J82; Normalisierung mit RNU6.
138
Ergebnisse
A
B
C
D
Abbildung 3-37: Kontrolle der Überexpression von hsa-miR-603 in RT112, RT4 und J82 mittels qRT-PCR; A
Übersicht, B RT112, C RT4, D J82; Normalisierung mit SNORD44.
In Abbildung 3-38 ist die relative Expression von SFRP1 in den drei Zelllinien RT112,
RT4 und J82 nach hsa-miR-603 Expression zu sehen. In 3-52 D ist die SFRP1Expression im Vergleich zur Positivkontrolle SK-Mel 28 abgebildet. Bei RT112 und
J82 konnte keine hsa-miR-603 bedingte Änderung der
SFRP1-Expression
beobachtet werden. Lediglich bei RT4 kam es 24 Stunden nach der Überexpression
zu einer erhöhten Expression von SFRP1.
139
Ergebnisse
A
B
C
D
Abbildung 3-38: Untersuchung der Auswirkung der hsa-miR-603 Überexpression auf die SFRP1-Expression in
RT112, RT4 und J82; A J82, B RT4, C RT112, D Übersicht mit Positivkontrolle SK-Mel-28
140
Ergebnisse
3.3
Deletionsmapping von Chromosom 8p mittels aCGH
3.3.1 Vergleichende genomische Hybrisisierung
Um neue Progressions-assoziierte Gene auf Chromosom 8p zu finden, wurden 19
papillären Blasentumoren mittels Genome-Wide SNP Array 6.0 von Affymetrix
analysiert und die Daten mit der Software Genotyping Console von Affymetrix
ausgewertet. Die Software kann gesamtgenomische Veränderungen, wie Deletionen
(rote Dreiecke) und Amplifikationen (blaue Dreiecke), sowie den Kopienzahl-Status
(CNV, copy number variation) aller untersuchten Proben im Vergleich zum
Referenzgenom (167 gesunde Kontrollen) anzeigen. Ein Dreieck entsprach dabei
einem Gewinn oder Verlust genetischen Materials mit einer Größe von mindestens
500kb. Viele untereinander gereihte Dreiecke sprachen für den Zugewinn bzw. den
Verlust
eines
ganzen
Chromosomen-Arms.
In
Abbildung
3-39
ist
je
ein
exemplarisches Karyogramm von einem nicht-invasiven (A) und einem invasiven (B)
papillären Tumor dargestellt. Es fällt auf, dass der pTa-Tumor weniger gesamtgenomische Veränderungen aufwies, als der pT1-Tumor. Der nicht-invasive Tumor
wies lediglich drei größere Veränderungen auf, nämlich zwei Amplifikationen (auf
Chromosom 1q und Chromosom 15q) sowie eine Deletion auf Chromosom 9q. Beim
invasiven
pT1-Tumor
war
hingegen
eine
Chromosomen-Veränderungen zu erkennen:
deutlich
erhöhte
Frequenz
an
12 Chromosomen zeigten den
Zugewinn oder den Verlust von Chromosomen-Abschnitten. Auch im Vergleich aller
Tumoren fiel auf, dass die pTa-Tumoren insgesamt weniger Alterationen zeigten, als
pT1-Tumoren. Vier der invasiven Tumoren konnten auf nahezu jedem Chromosom
eine Veränderung vorweisen. Diese Beobachtung deckt sich mit der allgemein
gültigen Tatsache, dass Tumoren umso aggressiver, also auch invasiver werden, je
mehr chromosomale Veränderungen im Genom des Tumors zu finden sind. Die
einzelnen Karyogramme aller Tumoren finden sich im Anhang 9.4.
Im Vergleich zu aktuellen Literatur-Daten lassen sich viele Übereinstimmungen mit
dort beschriebenen Chromosomen-Aberrationen finden: Eine der häufigsten
Aberrationen in pTa-Tumoren ist der Verlust des kurzen Arms von Chromosom 9 (9p)
[118]. Von den hier untersuchten neun pTa-Tumoren wiesen drei einen kompletten
Verlust des p-Arms auf, bei allen sechs anderen war immer zumindest ein Teil
verloren gegangen.
141
Ergebnisse
A
B
C
D
E
F
Abbildung 3-39 (S.129): Ergebnisse der vergleichenden gesamtgenomischen Hybridisierung (aCGH) von 9 pTa
und 10 pT1 Tumoren; A und B zeigen je ein repräsentatives Karyogramm von einem pTa (A) und einem pT1 (B)
Tumor, chromosomale Deletionen sind in rot, Amplifikationen in blau dargestellt; in C und D ist das Chromosom 8
in horizontaler Ausrichtung von allen pTa (C) und pT1 (D) Tumoren abgebildet, die nicht-invasiven Tumoren
weisen viel weniger genomische Veränderungen auf, als die invasiven Tumoren; auf Chromosom 8p dominieren
Deletionen, auf 8q hingegen Amplifikationen; E unf F zeigen einen Abschnitt auf 8p22, in dem das Gen MTUS1
liegt; nur ein nicht-invasiver, aber schon fünf invasive Tumoren weisen hier eine Deletion auf.
Ebenfalls häufig beschrieben in pTa-Tumoren sind (Teil-) Verluste des langen Arms
von Chromosom 9 (9q) [119]. Auch das kann bei der Betrachtung der neun
analysierten pTa-Tumoren bestätigt werden, in drei von neun Fällen war der
142
Ergebnisse
komplette Verlust des q-Arms zu beobachten; vier weitere Tumoren zeigten einen
Teil-Verlust.
Der von Blaveri et al. beschriebene häufig beobachtete Verlust von Abschnitten auf
dem kurzen Arm von Chromosom 17 (17p) [119] kann ebenfalls in unseren Tumoren
bestätigt werden. In vielen Fällen ist dabei das Tumorsuppressor-Gen P53 betroffen,
dessen Veränderungen beim Harnblasenkarzinom von prognostischer Bedeutung
sind [120]. Nur ein pTa-Tumor zeigte den Verlust von P53, wohingegen das Gen bei
drei der zehn invasiven pT1-Tumoren fehlte. Somit kann die Tatsache, dass
Veränderungen in diesem Tumorsuppressor-Gen mit dem invasiven Phänotyp und
somit einer schlechteren Prognose assoziiert ist, bestätigt werden.
Auch in Bezug auf den Zugewinn von Chromosomen-Abschnitten können unsere
Daten Übereinstimmungen mit in der Literatur beschriebenen Veränderungen
nachweisen: Eine der meist genannten Aberrationen in pT1-Tumoren betrifft den
langen Arm von Chromosom 8 (8q) [118]. Dabei ist oft das Onkogen CMYC
(lokalisiert auf 8q24) betroffen [121], wobei Veränderungen in der Kopienzahl dieses
Gens nicht die Prognose von Harnblasenkrebs-Patienten betreffen. Vielmehr stehen
Zugewinne von CMYC wohl mit genetisch instabilen Tumoren, die durch einen hohen
histologischen Grad und/oder invasives Wachstum gekennzeichnet sind, in
Zusammenhang [122]. Die hier untersuchten zehn pT1-Tumoren wiesen bezüglich
Chromosom 8q in drei Fällen einen Zugewinn des gesamten langen Arms, in drei
weiteren Fällen einen teilweisen Zugewinn, der jeweils als ein blaues Dreieck
dargestellt wird, auf. Auch der in der Literatur beschriebene, Chromosom 17qbetreffende Zugewinn [118], konnte in drei Fällen durch den kompletten, in fünf
weiteren durch den partiellen Zugewinn des Chromosomen-Arms bestätigt werden.
Die gute Übereinstimmung der aCGH-Ergebnisse unserer 19 untersuchten
Harnblasenkarzinome mit den Literatur-Daten bestätigt die Integrität und Validität
unserer Daten und erlaubt somit eine tiefer gehende Analyse und Interpretation.
Da in der Vergangenheit viele Arbeitsgruppen und auch Vorarbeiten in unserer
eigenen Arbeitsgruppe darauf hinwiesen, dass chromosomale Verluste auf
Chromosom 8p mit einer Progression der Blasenkrekserkrankung assoziiert sind, lag
der Fokus unserer Untersuchungen auf 8p. In Abbildung 3-39 C und D ist das
gesamte Chromosom 8 in längs-liegender Ansicht für die 9 pTa (C) und die 10 pT1
(D) Tumoren dargestellt.
143
Ergebnisse
Bei dieser Ansicht ist zu beachten, dass Zugewinne bzw. Verluste von
Chromosomen-Abschnitten bereits ab einer Größe von 100 kb angezeigt werden.
Es fiel auf, dass die invasiven Tumoren deutlich mehr Veränderungen auf
Chromosom 8 zeigten als die nicht-invasiven Tumoren. Während bei den pTaTumoren vereinzelt kleine Chromosomen-Abschnitte fehlten oder amplifiziert waren,
zeigten die pT1-Tumoren teilweise Zugewinne oder Verluste ganzer ChromosomenArme. Beispielsweise schien der kurze Arm bei sechs der zehn pT1-Tumoren nahezu
vollständig deletiert zu sein. Drei Tumoren zeigten einen nahezu kompletten
Zugewinn des q-Arms, bei drei weiteren Fällen lag zumindest ein Teil in erhöhter
Kopienzahl vor.
In Abbildung 3-39 E und F ist ein Bereich auf Chromospm 8p22 (Position 17.310.000
– 17.920.000), dargestellt, bei dem eine Mikrodeletion in einem pTa Tumor (E)
gefunden wurde (1/9 Tumoren, entspricht 11%). Nach unserer Vermutung, könnte
diese Mikrodeletion einen Hinweis auf maligne Progression darstellen. Bei den pT1
Tumoren (F) war der Bereich schon häufiger, nämlich bei fünf von zehn Tumoren
(50%) deletiert.
Um neue potenzielle progressionsrelevante Kandidaten-Gene zu identifizieren,
wurden im Folgenden alle in den pTa-Tumoren auftretenden Mikro-Amplifikationen
und -Deletionen mit den entsprechenden Regionen in den pT1-Tumoren verglichen.
Im Anschluss daran wurde untersucht, welche Gene in den betroffenen Regionen
liegen und ob diese in der Literatur bereits bekannt und mit einer bestimmten KrebsErkrankung assoziiert sind.
Folgende Tabelle 3-11 zeigt alle Refseq-Gene, die durch eine pTa-Mikroaberration
betroffen waren. Nicht erwähnt werden dabei die nicht-kodierenden Bereiche. Die
grau-weiße Abstufung zeigt an, dass es sich um eine zusammenhängende Deletion
oder Amplifikation handelt. Man erkennt, dass manche copy number-Variationen eine
ganze Fülle von Genen betreffen, andere lediglich nur ein Gen (Mikrodeletion), wie
z.B. GFRA2 oder UNC5D.
144
Ergebnisse
Gen (Refseq)
or4f21
defb103a
defb103b
spag11b
defb104a
defb104b
defb106a
defb106b
defb105a
defb105b
defb107a
defb107b
spag11a
defb103a
defb103b
defb4
fam86b1
defb1130
mtmr7
slc7a2
pdgfrl
MTUS1
fgl1
pcm1
gfra2
xpo7
npm2
epb49
fam160b2
nudt18
hr
reep4
lgi3
sftpc
bmp1
phyhip
polr3d
piwil2
slc39a14
ppp3cc
sorbs3
pdlim2
kiaa1967
bin3
egr3
pepb4
rhobtb2
tnfrsf10b
tnfrsf10c
tnfrsf10d
tnfrsf10a
chmp7
loxl2
Region
8p23.3
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p23.1
8p22
8p22
8p22
8p22
8p22
8p22
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
8p21.3
Mikrodeletion/amplifikation
Deletion
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Amplifikation
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
145
Tumor
pTa3
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa4
pTa3
pTa3
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
Ergebnisse
entpd4
slc25a37
nkx3-1
stc1
adam28
adamdec1
adam7
nefm
nefl
dock5
kctd9
cdca2
ebf2
ppp2r2a
bnip3l
pnma2
dpysl2
adra1a
unc5d
8p21.3
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p21.2
8p12
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
pTa7
Tabelle 3-11: Auflistung aller durch Mikroaberrationen betroffenen Gene in pTa-Tumoren, die grau-weißAbstufung zeigt an, dass es sich um eine zusammenhängende Deletion oder Amplifikation handelt; das von uns
für funktionelle Versuche ausgewählte Zielgen, MTUS1, ist in rot markiert.
Die meisten Veränderungen traten bei Tumor pTa_7, gefolgt von pTa_3 auf. Diese
beiden Tumoren waren auch die einzigen nicht-invasiven Tumoren, die überhaupt
eine Deletion aufwiesen. Das auffälligste Merkmal der neun pTa-Tumoren war jedoch
eine Mikroamplifikation auf 8p11.23-11.22, die bei sechs der neun Tumoren auftrat
(pTa1, 3, 5, 6, 7, 8), jedoch aber nur eine nicht-kodierende Region betraf, die
zwischen den beiden Genen ADAM32 und ADAM18 liegt (siehe Abbildung 3-40).
Abbildung 3-40: Darstellung der
auffälligen
Mikroamplifikation
von
sechs pTa-Tumoren auf Chromosom
8p; die Amplifikation liegt zwischen
den beiden Genen ADAM32 und
ADAM18,
betrifft
selbst
jedoch
scheinbar nur einen nicht-kodierenden
Bereich.
146
Ergebnisse
Eine genauere Betrachtung der bereits erwähnten, deletierten Region auf
Chromosom 8p22 (3-25 E und F), konnte folgende Zielgene identifizieren: SLC7A2
(= solute carrier family 7, member 2), PDGFL (= platelet-derived growth factor
receptor-like), MTUS1 (= microtubule associated tumor suppressor 1), FGL1 (=
fibrinogen-like 1) und PCM1 (= pericentriolar material 1). Die Deletionen in dem
Bereich gingen in jedem Fall mit einer Verringerung der Kopienzahl auf nurmehr eine
Kopie einher (CN =1). Ein kompletter Verlust (CN=0) dieser Chromosomenregion war
jedoch nicht zu verzeichnen.
Das vielversprechendste Gen schien uns dabei aber MTUS1 zu sein. MTUS1 wird in
der Literatur als möglicher Tumorsuppressor beim Pankreas- [123], Ovarial- [124],
Kolon- [125] und beim Mammakarzinom [126] beschrieben. Eine Assoziation von
MTUS1 mit dem Harnblasenkarzinom ist nach unserem Kenntnisstand noch nicht
nachgewiesen worden. Basierend auf der bekannten Assoziation des Gens mit
anderen Tumor-Erkrankungen wurde MTUS1 von unserer Arbeitsgrupe als erstes
mögliches Progressions-assoziiertes Zielgen der aCGH-Untersuchung ausgewählt
und im Anschluss eingehend beim Harnblasenkarzinom untersucht.
Bei der Untersuchung des Kandidatengens SFRP1 zeigte sich keine Veränderung
der Kopienzahl des DNA-Abschnittes in den pTa-Tumoren. Bei den pT1 Tumoren
zeigten zwei Fälle eine Deletion und ein Fall eine Amplifikation im entsprechenden
Genlokus (siehe Abbildung 3-41). Die Deletionen gingen jeweils mit einer
Verringerung der Kopienzahl auf eine Genkopie, die Amplifikation mit einer Erhöhung
der Kopienzahl auf drei Genkopien einher. Bei allen anderen Tumoren konnten zwei
SFRP1-Allele (Diploidie) nachgewiesen werden.
147
Ergebnisse
A
B
Abbildung 3-41: Darstellung der genetischen Veränderungen am SFRP1 Lokus auf Chromosom 8p12-11.1 bei
den pTa (A) und den pT1 (B) Tumoren nach aCGH; in pTa Tumoren konnten keine Aberrationen nachgewiesen
werden, bei pT1 Tumoren konnte in zweien eine Deletion und bei einem Tumor eine Amplifikation detektiert
werden.
3.3.2 Cluster-Analyse
Vor der funktionellen Untersuchung des MTUS1-Gens wurde zunächst noch eine
Cluster-Analyse der 19 Tumoren durchgeführt. Es sollte untersucht werden, ob sich
die nicht-invasiven pTa-Tumoren und die invasiven pT1-Tumoren anhand ihrer
chromosomalen Veränderungen in zwei Gruppen einteilen ließen; außerdem war
dies eine weitere Möglichkeit, die Integrität unserer Daten zu prüfen. Zunächst
wurden alle Amplifikationen und Deletionen, die größer als 1.000 kb waren, erfasst
und in eine Liste eingetragen (siehe Anhang). In Zusammenarbeit mit dem Core Unit
Z3 „Affymterix-Chip-Analysen“ konnten dann anhand des Kopienzahl-Status der
einzelnen Amplifikationen und Deletionen so genannte „Pseudo-Marker“ generiert
werden. Für die endgültige Clusterung wurden die 19 besten diskriminierenden
Marker verwendet (siehe Tabelle im Anhang 9.5). Abbildung 3-42 zeigt das Ergebnis
der durchgeführten Analyse in Form einer Heatmap. Die Spalten entsprechen den
einzelnen Tumoren, zeilenweise sind die verwendeten Marker dargestellt. Die
dargestellten Farben stehen für Genom-Amplifikationen (grün) bzw. -Deletionen (rot)
148
Ergebnisse
an der Stelle des entsprechenden Markers; die Farbabstufungen kommen durch die
unterschiedliche Kopienzahl zustande. Es lässt sich beobachten, dass sich die 19
Tumoren sehr gut in zwei Untergruppen einteilen lassen. Nur jeweils ein pTa- und ein
pT1-Tumor fallen aus der Reihe (Pfeile).
Abbildung 3-42 : Heatmap der ClusterAnalyse. Die verwendeten Abkürzungen
„ninv“ (nicht-invasiv, pTa) bzw. „inv“
(invasiv, pT1) bezeichnen die einzelnen
Tumoren. Nur jeweils ein nicht-invasiver
(hellblauer Pfeil), sowie ein invasiver
Tumor (dunkelblauer Pfeil) weicht von
den anderen ab. Die Farben grün und rot
stellen Genom-Amplifikationen bzw. Deletionen der entsprechenden Marker
dar.
3.3.3 Mutations-Analyse in FGFR3 und PIK3CA
Wie in der Einleitung bereits erwähnt, sind pTa-Tumoren (im Gegensatz zu invasiven
pT1-Tumoren)
häufig
mit
Mutationen
im
FGFR3-Gen
assoziiert.
Auch
Veränderungen im PIK3CA-Gen lassen sich nicht selten in nicht-invasiven Tumoren
nachweisen. Im Rahmen der Dissertation wurden die 19 in der aCGH analysierten
149
Ergebnisse
Tumoren auf Mutationen in diesen beiden Genen untersucht, um zu überprüfen, ob
sich die angegebenen Literatur-Daten in unseren Tumoren bestätigen lassen. Zur
Auswertung der erhaltenen Ergebnisse bezüglich FGFR3-Mutationen diente das in
Abbildung 3-43 dargestellte Schema. In dieser Darstellung ist schematisch der Teil
des Gens zu sehen, in dem sich die bekannten Mutationen befinden; die
„ausgefüllten“ Peaks symbolisieren Basen der Wildtyp-Sequenz, nicht-ausgefüllte,
„leere“ Peaks stellen schematisch die möglichen Mutationen dar.
Abbildung 3-43: Schematische Darstellung des partiellen FGFR3-Gens mit allen bekannten Mutationen,
dargestellt als leere Peaks und mit der Bezeichnung der jeweiligen Mutation. Ausgefüllte Peaks symbolisieren die
Basen der Wildtyp-Sequenz. Die Basen werden durch die folgenden Farben dargestellt: A = grün; C = schwarz;
G = blau; T = rot. Abbildung aus.
Die durchgeführten Mutations-Analysen lieferten folgendes Ergebnis: Acht der neun
pTa-Tumoren wiesen eine Veränderung im FGFR3-Gen auf, fünf davon die Mutation
S249C. Jeweils einmal konnten die Mutationen Y375C, A393E und K652E
nachgewiesen werden. Von den pT1-Tumoren zeigten nur drei eine Mutation im
FGFR3-Gen, es handelte sich dabei immer um die S249C Mutation (siehe Abbildung
3-44).
150
Ergebnisse
Abbildung 3-44: Repräsentative Sequenzen von FGFR3 mit den verschiedenen aufgetretenen Mutationen
(Pfiel); A zeigt die am häufigsten (u.a. in Tumor pT1_9) gefundene Mutation S249C. Die Mutationen Y375C (B; in
pTa_8), 393E (C; in pTa_5) und K652E (D; in pTa_6) wurden jeweils einmal beobachtet.
Für die Auswertung der Mutationen im PIK3CA-Gen diente das in Abbildung 3-46
dargestellte Schema der möglichen Sequenzierungs-Ergebnisse als Vorlage [127].
Innerhalb der 19 untersuchten Tumoren wurden bei einem pTa-Tumor sowie bei drei
pT1-Tumoren Mutationen gefunden. Der nicht-invasive Tumor zeigte die Mutation
H1047R (siehe Abbildung 3-45A), während die invasiven Tumoren alle drei die
Mutation E545K aufwiesen (siehe Abbildung 3-45B).
Abbildung 3-45: Repräsentative PIK3CA Sequenzen mit aufgetretenen Mutationen (Pfeile). Bild A zeigt die
Mutation H1947R in einem pTa-Tumor, Bild B die in drei pT1-Tumoren detektierte Mutation E545K.
151
Ergebnisse
Abbildung 3-46: Mögliche Ergebnisse einer Mutations-Analyse im PIK3CA-Gen: Abbildung A zeigt die WildtypSequenz, die orangefarbenen Peaks repräsentieren den internen Genescan-LIZ-Standard. Die Basen werden
durch die folgenden Farben dargestellt: A = grün; C = schwarz; G = blau; T = rot. Bilder B-E zeigen die möglichen
Mutationen E542K (B), E545G (C), E545K (D) und H1047R (E) [127].
152
Ergebnisse
3.4
Untersuchung der MTUS1-Expression bei Blasenkrebs
3.4.1 MTUS1-Expression in Harnblasenkarzinom-Zelllininen
Um den Zusammenhang zwischen einer MTUS1-Expression und Blasenkrebs zu
untersuchen, wurden zunächst die vier Blasenkarzinom-Zelllinine RT112, RT4, J82
und BFTC905, sowie die beiden Urothelzelllinine HCV29 und UROtsa mittels qRTPCR, Immunhistochemie und Westernblot auf die Expression von MTUS1 gescreent.
LNCaP,
eine
Prostatakarzinom-Zelllinie,
in
der
der
mikrotubulus-assoziierte
Tumorsuppressor 1 bereits nachgewiesen wurde [128], wurde als Positivkontrolle
mitgeführt. Als Erstes wurde die MTUS1-Expression auf mRNA-Level untersucht.
Dazu wurde die RNA aus den Zelllinine isoliert, daraus cDNA synthetisiert und dann
mit MTUS1-spezifischen Primern (die alle Isoformen berücksichtigen) in der SYBR
Green-basierten quantitativen Real-Time PCR eingesetzt. Zur Auswertung erfolgte
eine relative Quantifizierung mittels ΔΔCT-Methode und Normalisierung am House
Keeping Gen GAPDH. Als Referenz-Zelllinine wurde RT112 definiert, deren
Expressionsstatus auf 100%, bzw. den Wert 1 festgelegt wurde und mit der alle
anderen Proben verglichen wurden.
Abbildung 3-47 zeigt die Ergebnisse der qRT-PCR. Die Prostatakarzinom-Zelllinie
LNCaP wies insgesamt die höchste und eine etwa 20fach höhere MTUS1Expression auf, als RT112. Die Zelllinien UROtsa, RT4 und BFTC905 zeigten eine
fünf- bis achtfach erhöhte Expression von MTUS1 im Vergleich zu RT112, während
die Expression in J82- und HCV29-Zellen ebenfalls bei etwa 1 lag.
Abbildung
3-47:
Relative
Expression (RQ = relative
quantification) von mtus1 in den
untersuchten
Zelllinien
im
Vergleich zur Positivkontrolle
LNCaP; RT112 wurde als
100% definiert.
153
Ergebnisse
Im Anschluß an die Analyse der MTUS1-mRNA-Expression, wurde die Expression
auch auf Protein-Ebene untersucht. Dazu wurde ein Westernblot mit einem
Antikörper gegen das MTUS1-Protein durchgeführt (siehe Abbildung 3-34). In
Tabelle 3-12 sind die verschiedenen Isoformen von MTUS1, sowie die zugehörigen
Transkriptvarianten
mit
Basenpaar-
und
Aminosäurelänge
aufgelistet.
Das
Molekulargewicht wurde anhand eines mittleren Gewichtes von 112 Dalton pro
Aminosäure errechnet. Aufgrund der Schwankungen des Molekulargewichts der
einzelnen Aminosäuren stellen diese Werte jedoch nur einen Anhaltspunkt dar und
geben das tatsächliche Gewicht wahrscheinlich nicht exakt wider.
MTUS1-Isoform
Protein-Alias
mRNA
Protein
Molekulargewicht
1
ATIP3a
6435bp
1270 aa
142 kDa
2
ATIP3b
6273bp
1216 aa
136 kDa
3
ATIP4
4022bp
517 aa
58 kDa
4
?
2667bp
415 aa
46 kDa
5
ATIP1
3819bp
436 aa
49 kDa
6
ATIP2
2787bp
770 aa
86 kDa
7
?
3160bp
342 aa
38 kDa
8
ATIP3b
6256bp
1216 aa
136 kDa
Tabelle 3-12: Eigenschaften der verschiedenen MTUS1-Isoformen.
Die in fast allen Spuren auf Höhe von etwa 60 kDa sichtbare Bande entspricht der
Isoform 3 von MTUS1, die auch als ATIP4 bezeichnet wird. Die ProstatakarzinomZelllinie LNCaP zeigte die stärkste Expression, gefolgt von HCV29 und UROtsa. Alle
anderen Zelllinien exprimierten diese Isoform schwach (J82, BFTC905, RT4) bis
kaum (RT112). Die für die Harnblase spezifische Isoform ATIP3 [129] besitzt ein
Molekulargewicht von etwa 140 kDa (142 kDa für ATIP3a und 136 kDa für ATIP3b)
und ist als oberste Bande zu erkennen (siehe Pfeil in Abbildung 3-48). Sie wurde
allerdings nur in den Zelllinien LNCaP und BFTC905 und schwach in RT112, J82 und
UROtsa exprimiert. In RT4 und HCV29 fehlte die Expression dieser Isoform.
Zwischen den beiden Banden von ATIP3 und ATIP4, auf Höhe von etwa 80 kDa ist,
besonders in der Zelllinie RT4, eine weitere dominante Bande zu sehen. Dabei
handelte es sich wahrscheinlich um ATIP2 bzw. die Isoform 6 von MTUS1, die aus
154
Ergebnisse
2787 Basenpaaren und 770 Aminosäuren besteht. Die nachfolgende Behandlung der
Membran mit einem Antikörper gegen ß-AKTIN zeigte eine gleichmäßige Expression
des House-Keeping Gens (HKG) (Abbildung 3-48B) und bestätigt so die Integrität
unserer Daten.
Abbildung 3-48: Nachweis
von MTUS1 (A) mittels
Westernblot
in
den
Zelllinine HCV29, RT112,
J82,
BFTC905,
RT4,
UROtsa; LNCaP diente als
Positivkontrolle; es sind
verschiedene Isoformen zu
erkennen; ß-AKTIN diente
als endogene Kontrolle und
konnte in allen Zelllinein
gleichmäßig nachgewiesen
werden
(B);
die
Belichtungszeit betrug drei
Minuten (für MTUS1) bzw.
40 Sekunden (für ßAKTIN), blank= Lysepuffer.
3.4.2 MTUS1-Expression in Tumorgewebe
Um die MTUS1-Expression auch in Patientenmaterial zu überprüfen, wurde zunächst
eine kleine Kohorte von 6 primären Harnblasentumoren mittels qRT-PCR und
Westernblot untersucht. In der quantitativen Realtime-PCR wurden die Proben
wieder mit dem HKG GAPDH normiert, RT112 wurde wieder als Referenzprobe und
LNCaP als Positivkontrolle mitgeführt. Die Tumorproben zeigen alle eine deutlich
höhere MTUS1-Expression, als RT112. Den höchsten Wert erzielte dabei TumorProbe 6 mit einer 50fach erhöhten MTUS1-Expression. Die Proben 1, 2, 3, 5 und 6
zeigen sogar höhere Werte, als die Postivkontrolle LNCaP. Die Ergebnisse der qRTPCR sind graphisch in Abbildung 3-49 dargestellt.
155
Ergebnisse
Abbildung 3-49: Relative Expression
(RQ) von MTUS1 in den untersuchten
Tumoren
im
Vergleich
zur
Positivkontrolle LNCaP, RT112 wurde
als 100% definiert; alle Tumoren haben
MTUS1 auf mRNA-Ebene exprimiert.
In der Westernblotanalyse konnte aufgrund der niedrigen Protein-Konzentrationen
der einzelnen Tumor-Proben nur eine relativ geringe Protein-Menge (15 μg)
eingesetzt werden. Die Positiv-Kontrolle LNCaP zeigte, wie auch im vorherigen Blot,
auf Höhe von 60 kDa die deutlichste Bande und zwei schwache Banden bei ca. 140
und 75 kDa. Bei der Analyse der Tumorproben fiel auf, dass insgesamt nur sehr
schwache MTUS1-Banden zu sehen waren. Die Banden der beiden Isoformen
1/ATIP3 (ca. 140 kDa) und 3/ATIP4 (ca. 60 kDa) fehlten komplett. Nur die Isoform
6/ATIP2 (ca. 80 kDa) schien bei den Proben 1 und 3 präsent zu sein. Bei den
anderen Tumoren ließ sich diese lediglich erahnen. Außerdem fiel auf, dass die
Tumoren 2 bis 6 ein ganz schwaches Signal bei ca. 50 kDa zeigten. Dabei könnte es
sich um die Isoform 5 (ATIP1) handeln, die ein Molekulargewicht von etwa 49 kDa
aufweist (Abbildung 3-50A).
Die Behandlung der Proteinmembran mit dem anti-ß-AKTIN Antikörper lieferte etwas
schwächere Signale für die Tumorproben 2, 3 und 4, was wohl auf eine etwas
geringere oder qualitativ schlechtere Gesamtproteinmenge hinweist (Abbildung 350B).
156
Ergebnisse
Abbildung 3-50: Nachweis
von MTUS1 (A) mittels
Westernblot
in
den
Blasentumorgeweben;
LNCaP
diente
als
Positivkontrolle; es sind
verschiedene Isoformen zu
erkennen; ß-AKTIN diente
als endogene Kontrolle und
wurde in den Tumoren 2, 3
un 4 etwas schwächer
exprimiert
(B);
die
Belichtungszeit betrug 60
Sekunden (für MTUS1)
bzw. 103 Sekunden (für ßAKTIN), blank = Lysepuffer.
3.4.3 Funktionelle Untersuchung der MTUS1-Überexpression in RT112
Um funktionelle Konsequenzen einer MTUS1-Expression untersuchen zu können,
wurde das Gen mittels transienter Transfektion in der Harnblasenkarzinom-Zelllinie
RT112 überexprimiert. Im Anschluss wurden die Auswirkungen auf Proliferation,
Viabilität und Migrationsverhalten analysiert. RT112 wurde ausgewählt, da diese
Zelllinie sowohl auf Protein- als auch auf RNA-Ebene eine relativ geringe Expression
von MTUS1 zeigte. Somit konnte davon ausgegangen werden, dass hier der Effekt
der Transfektion am stärksten zu beobachten sein würde.
3.4.3.1
Kontrolle des Transfektionserfolges mittels qRT-PCR
Um zu kontrollieren, ob die Überexpression des Plasmides erfolgreich verlaufen war,
wurde aus einem Teil der Zellen vor den entsprechenden funktionellen Versuchen
die RNA isoliert, daraus cDNA gewonnen und diese in der quantitativen Real-TimePCR mit MTUS1-spezifischen Primern eingesetzt. Der MTUS1-Expressionsstatus
wurde sowohl 24 als auch 48 Stunden nach der Transfektion durch die PCR
bestimmt. Die Überexpression konnte in allen Fällen über die qRT-PCR
nachgewiesen werden. Die mitgeführte Kontrolle LNCaP zeigte dabei stets die
höchsten Expessionswerte von MTUS1. Im abgebildeten Beispiel wurde MTUS1 von
157
Ergebnisse
LNCaP etwa 25mal so stark exprimiert, wie in RT112 Zellen 24 Stunden nach der
Transfektion. 48 Stunden nach der Transfektion waren die MTUS1-Expressionswerte
jeweils höher als nach 24 Stunden. Im Vergleich zu den nur mit dem
Transfektionsmedium Megatran behandelten RT112 Kontrollzellen, wurde MTUS1 in
den „behandelten“ Zellen etwa 22mal (nach 24 Stunden) bzw. etwa 40mal (48
Stunden) so stark exprimiert (Abbildung 3-51).
A
B
Abbildung 3-51: Nachweis der Überexpression von MTUS1 in RT112 mittels RQ in der qRT-PCR; in A ist die
Expression nach 24 und 48 Stunden im Vergleich zur Positivkontrolle LNCaP zu sehen; in B sind 24- und 48Stunden Werte ohne LNCaP abgebildet, nach 48 Stunden war die Expression höher als nach 24 Stunden.
Neben der Kontroll-PCR wurden außerdem jeweils ein Viability Assay, ein BrdU
Assay und ein Wound Scratch Assay durchgeführt. Die Transfektion erfolgte in
6Well-Platten 24 Stunden nach dem Aussähen und Adhärieren der Zellen. Nach der
Transfektion wurden die Zellen 24 Stunden bei 37°C und 5% CO2 inkubiert. Danach
wurden die Zellen mittels Trypsin geerntet, gezählt und für den entsprechenden
Assay ausgesäht. Nach weiteren 24 Stunden wurde dann der entsprechende Assay
durchgeführt, also entweder das Substrat bzw. die Fixierlösung auf die Zellen
gegeben oder das Insert entfernt und mit der fotografischen Dokumentation
begonnen. Die Ergebnisse sind im Folgenden aufgelistet.
158
Ergebnisse
3.4.3.2
Bestimmung der MTUS1-abhängigen Viabilität (Viability Assay)
Der Viability Assay wurde dreimal durchgeführt. Es zeigte sich, dass bei den RT112
Zellen mit MTUS1-Expression signifikant weniger Zellen metabolisch aktiv waren, als
bei den Kontrollzellen. Das Lumineszenzsignal war für die MTUS1-transfizierten
Zellen signifikant geringer (35733), als bei den Kontrollzellen (50345, p=0,002, Abb.
3-52).
Abbildung
3-52:
Graphische
Darstellung der Ergebnisse des Viability
Assays in RT112 mit und ohne MTUS1Überexpression;
nach
MTUS1Überexpression
zeigt
sich
ein
geringeres Lumineszenzsignal; es sind
weniger Zellen metabolisch aktiv, als in
den untransfizierten Zellen.
3.4.3.3
Bestimmung der MTUS1-abhängigen Proliferation (BrdU Assay)
Der Proliferations-Assay wurde viermal durchgeführt. Es konnte ein kleiner, jedoch
nicht signifikanter Unterschied bei der Proliferation der MTUS1-transfizierten Zellen
(oD=1,48) und der Kontrollzellen (oD=1,6) festgestellt werden (p=0,603). Die
untransfizierten Zellen hatten eine etwas höhere Proliferationsrate als die Zellen mit
MTUS1-Überexpression. Die Absorptionswerte unterschieden sich um 0,12. Die
Differenz lag jedoch innerhalb der Standardabweichung (Abb. 3-53).
159
Ergebnisse
Abbildung
3-53:
Graphische
Darstellung der Ergebnisse des BrdUProliferations-Assay in RT112; es
konnte
kein
MTUS1-abhängiger
Unterschied
in
der
Proliferation
festgestellt werden.
3.4.3.4
Untersuchung des MTUS1-abhängigen Migrationsverhaltens mit
dem Wound Scratch Assay
Der Wound Scratch Assay wurde zweimal mit jeweils zwei unterschiedlichen
Ausgangs-Zellkonzentrationen
durchgeführt:
500.000
Zellen/ml
und
750.000
Zellen/ml. Es war ein deutlicher, jedoch nicht signifikanter Unterschied in der
Migrationsgeschwindigkeit zu beobachten (p=0,121 für beide Konzentrationen).
RT112 Zellen, die mit dem Tumorsuppressor MTUS1 transfiziert wurden, schlossen
den Zellspalt langsamer, als die untransfizierten Kontrollzelle (Abb. 3-54 und 55). Bei
der geringer konzentrierten, MTUS1-transfizierten Zellsuspension waren nach 24
Stunden erst 19,7% der Fläche zugewachsen, wohingegen die untransfizierten
Zellen bereits 37,6% der Fläche bedeckten. Bei den höher konzentrierten Zellen war
insgesamt schon mehr Fläche zugewachsen, die Differenz blieb aber ähnlich. So
waren bei den MTUS1-defizienten RT112 Zellen 65,9% der Fläche bewachsen,
wobei es schon 92,4% bei den Kontrollzellen waren. Der mittlere Unterschied aller 4
Messungen betrug etwa 22,2% (±6,8%) zwischen Behandlung und Kontrolle.
160
Ergebnisse
Abbildung
3-54:
Repräsentative
Ergebnisse
des Wound Scratch Assays in
RT112 mit und ohne MTUS1Überexpression zum Zeitpunkt
0 und nach 24 Stunden; bei
Zellen mit einer MTUS1Überexpression konnte ein
langsameres
Wachstum
beobachtet werden; der Spalt
hat
sich
langsamer
geschlossen.
A
B
Abbildung 3-55: Ergebnisse des Wound Scratch Assays in RT112 nach ektopischer MTUS1-Expression mit zwei
verschiedene Zelldichten, A 500.000Zellen pro ml, B 750.000 Zellen pro ml.
3.4.4 Immunhistochemische Untersuchung der MTUS1-Expression an zwei
TMA-Studien
Um die Expression von MTUS1 auch an einer großen Anzahl humaner Tumoren zu
analysieren und gegebenenfalls eine aberrante Expression zu identifizieren, die eine
Assoziation
zu
der
Erkrankung
darstellt,
wurden
die
zwei
TMA-Studien
immunhistochemisch auf ihre MTUS1-Expression untersucht, die auch schon auf die
Expression von SFRP1 untersucht worden waren (siehe 2.1.1). Dabei handelte es
sich um den TMA, der ausschließlich papilläre Tumoren beinhaltete, und um den
TMA mit ausschließlich fortgeschrittenen Blasentumoren, der aus der bereits
publizierten „Chemotherapiestudie“ entstammte.
161
Ergebnisse
3.4.4.1
TMA mit papillären Harnblasenkarzinomen
Bei der Auswertung der MTUS1-Färbung wurde ähnlich vorgegangen wie bei der
SFRP1-Färbung: Aus der Intensität und der Prozentzahl der angefärbten Zellen
wurde ein immunreaktiver Score (IRS) gebildet. So wurde zunächst jeder
Prozentzahl eine Zahl von 0 bis 4 nach folgendem Schema zugeordnet:
0=0% positive Zellen
1=<10% positive Zellen
2=10-50% positive Zellen
3=51-80% positive Zellen
4=81-100% positive Zellen
Diese Zahl wurde dann mit dem Wert der Intensität multipliziert. Das Ergebnis
(Zahlen von 0 bis 12) stellte den IRS für die MTUS1-Färbung dar.
Von den 143 Tumoren konnten 128 ausgewertet werden. Der IRS zeigte folgende
Verteilung: 65 Tumoren hatten einen IRS von 0, 45 von 2, 18 von 4, 4 von 6, einer
von 8, zwei von 9 und zwei von 12. In Abbildung 3-56 sind exemplarische MTUS1negative (A und B) und positive Färbungen (C und D) dargestellt. Die Lokalisation
von MTUS1 in der Zelle liegt im Zytoplasma und ist durch eine rote Färbung im
Gewebe gekennzeichnet. Besonders stark gefärbte Bereiche sind durch einen Pfeil
markiert.
162
Ergebnisse
A
B
100x
C
400x
D
400x
400x
Abbildung 3-56: Immunhistochemische Färbung von papillären Harnblasentumoren mit einem anti-MTUS1Antikörper; A und B zeigen einen MTUS1-negativen Tumor, C und D zeigen einen Tumor mir positiver,
zytoplasmatischer MTUS1-Färbung (Pfeile), MTUS1 scheint in Form von kleinen punktförmigen Arealen im
Zytoplasma vorzuliegen.
Einige Tumoren zeigten außerdem eine auffällige Färbung der Deckzellen (siehe
Abbildung 3-57).
A
B
100x
100x
Abbildung 3-57: Exemplarische immunhistochemische Färbungen der papillären Harnblasenkarzinome. Die
Pfeile markieren die gefärbten Deckzellen.
Um die immunhistochemischen Daten mit den histopathologischen, sowie den
Follow-up Daten zu korrelieren, wurde, wie auch bei den anderen IHC-Färbungen,
nur der unbehandelte Primärtumor des Patienten ohne zusätzliche Rezidive
ausgewählt, sodass sich folgende Verteilung für die MTUS1-Färbung ergab: 85 der
91 Primärtumor-Stanzen konnten ausgewertet werden. 43 Stanzen hatten einen IRS
163
Ergebnisse
von 0, 29 von 2, 8 von 4, drei von 6, eine von 8 und eine von 9. Sechs Stanzen
konnten mangels Tumor- oder Gewebematerial nicht ausgewertet werden.
Für die Überlebenskurven und die statistischen Berechnungen wurden ebenfalls
wieder geeignete Gruppen definiert. Angelehnt an den Median (=0±1,9) wurden zwei
Gruppen gebildet: Gruppe 1 „IRS 0“ und Gruppe 2 „IRS 1bis12“.
Die Verteilung der verschiedenen IHC-Gruppen innerhalb der Primärtumore ist in
folgender Tabelle 3-13 zusammengefasst.
MTUS1 IRS
0
2
4
6
8
9
k.A.
n=
43
29
8
3
1
1
6
Gruppen
Gruppe 1
Gruppe 2
-
n=
43
42
6
Tabelle 3-13: Verteilung
Harnblasenkarzinome.
der
MTUS1-Expression
innerhalb
der
Gruppe
der
primären,
papillären
Bezüglich des Gesamtüberlebens, des rezidivfreien-, des metastasefreien- und des
progressionsfreien Überlebens ergaben sich keine signifikanten Unterschiede. Die
Kaplan-Meier-Kurven, sowie die Graphen der univariaten Cox-Regression sind in
Abbildung 3-58 dargestellt.
___________________________________________________________________
Abbildung 3-58: Kaplan-Meier-Analysen (A-D) und univariate Cox-Regression (E bis H) des papillären
Tumorkollektivs für Gesamt- (A und E), rezivivfreies- (B und F), metastasefreies- (C und G) und
progressionsfreies (D und H) Überleben in Monaten in Korrelation mit der Expression von MTUS1.
164
Abbildung 3-58: MTUS1
Ergebnisse
A
B
C
E
F
G
D
H
165
Ergebnisse
Die jeweilige Überlebenszeit und das zugehörige Risiko sind in Tabelle 3-14
zusammengestellt.
[Monate]
Überleben Gruppe 1
Überleben Gruppe 2
Risiko
Gesamtüberleben
112,6
192,1
0,402
34,7
49,1
1,56
114,3
255
1,253
67,1
174,4
1,586
Rezidivfreies
Überleben
Metastasefreies
Überleben
Progressionsfreies
Überleben
Tabelle 3-14: Mittlere Überlebenszeiten des papillären Tumorkollektivs in Abhängigkeit der MTUS1-Expression;
Gruppe 1 = IRS 0, Gruppe 2 = IRS 1-12.
Auch wenn kein signifikanter Unterschied festzustellen war, kann man trotzdem
festhalten,
dass
bei
der
Gruppe
mit
MTUS1-Expression
sowohl
das
Gesamtüberleben, als auch das rezidiv-, metastase- und progressions-freie
Überleben länger ist, als bei den Patienten, deren Tumoren MTUS1 verloren haben.
Insbesondere der Zeitraum bis zum Auftreten einer Metastase wird durch die
MTUS1-Expression scheinbar beeinflusst. So tritt bei Patienten mit MTUS1-Defizienz
nach durchschnittlich 114 Monaten und bei Patienten mit MTUS1-Expression erst
nach 255 Monaten eine Metastase auf. Das Gesamtüberleben war bei MTUS1exprimierenden Tumoren etwa sechseinhalb Jahre länger als bei den Tumoren mit
Expressionsverlust.
Im Anschluss wurde auch die MTUS1-Färbung mit den Patientencharakteristika (wie
z.B. Alter und Geschlecht), den anderen immunhistochemischen Färbungen, sowie
den histopathologischen Parametern korreliert. Es zeigten sich signifikante
Korrelationen mit dem Tumorgrad (p=0,004), Stadium (p=0,004), der Ki67 (p=0,004)und CK20-Expression (p=0,005). Dabei war auffällig, dass eine positive MTUS1Expression jeweils mit einer aberranten Ki67 und CK20-Expression, sowie mit
höherem Stadium und Grad einhergingen. Umgekehrt zeigten Tumoren ohne
MTUS1-Expression normale Ki67 und CK20-Expression mit niedrigerem Stadium
und Grad. Die Verteilung der IRS-Gruppen in Abhängigkeit von Stadium, Grad, Ki67
und CK20 ist in Abbildung 3-59 dargestellt.
166
Ergebnisse
B
A
*p=0,005
*p=0,004
C
D
*p=0,004
*p=0,004
Abbildung 3-59: Korrelationen der MTUS1-Expresison mit CK20-Expression (A), Grad (B), Ki67-Expression(C)
und Stadium (D); eine MTUS1-Expression ging mit einer erhöhten Proliferation, sowie höherem Stadium und
Grad, also einem höheren malignen Potential einher.
Um die Datenintegrität zu überprüfen, wurde von allen verfügbaren Tumoren (n=81)
eine FGFR3-Mutations-Analyse durchgeführt, die dann mit dem Tumorstadium
korreliert wurde. Es ist allgemein bekannt, dass eine FGFR3-Mutation in papillären
nicht-muskel-invasiven Karzinomen mit einem weniger malignen Phänotyp, wie z.B.
weniger invasivem Wachstum und weniger Progression, einhergeht. 27 Tumoren
(33,3%) zeigten den Wildtyp-Genotyp, bei 54 Tumoren (66,7%) konnte mindestens
eine Mutation nachgewiesen werden. Die Mehrzahl (66,7%, n=18) der WildtypTumoren zeigte ein invasives Stadium, wohingegen nur 33,3% (n=9) der Tumoren
ein nicht-invasives Stadium aufwiesen. Bei den Tumoren mit mutiertem FGFR3 war
die Anzahl an nicht-invasiven Tumoren hingegen höher (57%, n=31) und die Anzahl
an
invasiven
Neoplasien
geringer (42,6%,
n=23), als
beim Wildtyp.
Die
unterschiedliche Verteilung bezüglich Stadium und FGFR3 Mutationsstatus deckte
sich zwar mit unseren Erwartungen, war jedoch nicht signifikant (p=0,059). Dies
167
Ergebnisse
könnte vor allem daran liegen, dass es sich bei den hier vorliegenden Tumoren nur
um papilläre Wachstumsmuster handelt, die ja bekanntlich generell ein geringeres
malignes Potential in sich tragen als solide Tumoren. So könnte die Unterscheidung
hinsichtlich der FGFR3-Mutationen und des Stadiums nicht so deutlich ausfallen. Bei
einer gemischten Gruppe von soliden und papillären Blasentumoren würde es
sicherlich zu einer deutlicheren stadien-bezogenen Untergliederung in FGFR3mutierte und –Wildtyp Tumoren kommen. Die nachfolgende Korrelation des FGFR3Status mit der MTUS1-Expressison brachte folgende Ergebnisse (Abbildung 3-60):
Abbildung
3-60:
Korrelation
der
MTUS1-Expression in der papillären
Tumorkohorte mit der FGFR3-Mutationsfrequenz.
Es zeigte sich eine inverse Verteilung der MTUS1-Expression bei Tumoren mit
FGFR3-Wildtyp bzw. Mutation. So wiesen 34,8% (n=8) der Wildtyptumoren einen
MTUS1-Expressionsverlust auf, 65,2% (n=15) exprimierten MTUS1. Bei den
mutierten Tumoren konnte in 57,4% der Fälle (n=31)= ein Expressionsverlust und in
42,6% der Fälle (n=23) eine Expression nachgewiesen werden (p=0,085).
Tumoren mit bzw. ohne MTUS1 Expression zeigten eine unterschiedliche, wenn
auch nicht signifikante (p=0,062) Verteilung hinsichtlich der P53-Expression. So
hatten 59,5% der Tumore (n=25) mit MTUS1-Expression („IRS1bis12“) eine normale
P53-Expression (0-9%), aber 40,5% (n=17) eine Überexpression (10-100%). In der
Gruppe mit MTUS1-Expressionsverlust („IRS0“) zeigten hingegen 79,1% (n=34) eine
normale P53-Expression, wobei nur 20,9% (n=9) ein aberrantes Färbemuster
aufwiesen.
168
Ergebnisse
3.4.4.2
TMA mit fortgeschrittenen Harnblasenkarzinomen
Um das Vorhandensein von MTUS1 nicht nur in papillären, sondern auch in
fortgeschrittenen Tumoren zu untersuchen, wurden auch die sechs TMAs der
„Chemotherapiestudie“ immunhistochemisch mit dem Antikörper gegen MTUS1
gefärbt. Auch hier wurde die Intensität der Färbung (0-3) und der Prozentsatz der
gefärbten Zellen beurteilt. Auffällig dabei war, dass plasmozytoide Tumoren (PUCs)
keine Färbung des Zytoplasmas, sondern des Kerns aufwiesen (siehe Abbildung 361A). Von 17 anfärbbaren PUCs zeigten neun keine MTUS1-Färbung (IRS1), acht
aber hingegen eine MTUS1-Expression (IRS2) im Kern. Außerdem zeigten alle
mikropapillären Tumoren (MUCs, n=10) ein Vorhandensein von MTUS1 (siehe
Abbildung 3-61B).
A
B
x400
x400
Abbildung 3-61: Exemplarische immunhistochemische Färbungen der fortgeschrittenen Harnblasenkarzinome:
plasmozytoide Tumoren zeigten häufig eine Färbung des Kerns (A, Pfeil); bei den meisten mikropapillären
Tumoren konnte eine positive zytoplasmatische Expression beobachtet werden (B, Pfeil).
Nach der Berechnung des immunreaktiven Scores (IRS) für jeden Tumor erfolgte die
Auswertung der erhaltenen Daten hinsichtlich des Überlebens. Die Einteilung in
immunreaktive Gruppen erfolgte, wie beim papillären TMA der prospektiven Studie,
in negative (IRS 0, Gruppe 1) und positive (IRS 1 bis 12, Gruppe 2) Tumoren
(Tabelle 3-15). In der Kaplan-Meier-Analyse ergab sich ein signifikant schlechteres
Gesamt (p=0,029)- und Tumor-spezifisches (p=0,027) Überleben für die Patienten
ohne MTUS1-Expression im Tumor (siehe Abbildung 3-62 A und B). Auch in der
multivarianten Cox Regression (adjustiert nach histologischem Subtyp und
adjuvanter Chemotherapie) zeigte die Gruppe 1 (IRS 0) ebenfalls ein signifikant
schlechteres Überleben (p=0,012), als Gruppe 2 (IRS 1bis12) (siehe Abbildung 3169
Ergebnisse
62C). Es konnte keine signifikante Assoziation hinsichtlich der Progression
festgestellt werden.
MTUS1
0
2
3
4
6
8
9
12
k.A.
n=
108
52
2
43
18
5
1
7
108
Gruppen
Gruppe 1
Gruppe 2
-
n=
108
128
108
IRS
Tabelle 3-15: Verteilung
Harnblasenkarzinome.
der
MTUS1-Expression
innerhalb
der
Gruppe
der
fortgeschrittenen
*p=0,027
*p=0,029
A
B
*p=0,012
Abbildung 3-62: Kaplan-Meier-Analysen
für das Gesamt- (A) und das
tumorspezifische (B) Überleben, sowie
multivariate
Cox-Regression
(C)
adjustiert nach histologischem Subtyp
und adjuvanter Chemotherapie in
Abhängigkeit der MTUS1-Expression:,
Tumoren mit MTUS1-Expression (grüne
Kurve) zeigten signifikant bessere
Überlebenskurven.
C
170
Diskussion
4
Diskussion
SFRP1 im Urothelkarzinom der Harnblase:
Secreted frizzled-related protein 1 (SFRP1) ist als Inhibitor des Wnt-Signalweges
bekannt und spielt eine wichtige Rolle bei der Entwicklung und Zelldifferenzierung.
Auch in Zusammenhang mit verschiedenen Krebserkrankungen, unter anderem beim
Kolon- [77], Leber- [80] und Brustkrebs [74] sind Fehlregulationen in SFRP1 und im
gesamten Wnt-Signalweg bekannt. Für die Assoziation von SFRP1 mit Entstehung
und Verlauf des papillären Urothelkarzinoms gibt es allerdings nur sehr wenige
aussagekräftige Daten. In den meisten Studien wurde ein Hypermethylierungsbedingter Verlust der SFRP1-Expression in Zusammenhang mit der malignen
Erkrankung gebracht [71-85]. Um die Rolle von SFRP1 und des kanonischen WntSignalweges beim papillären Urothelkarzinom der Harnblase besser verstehen zu
können, wurden zunächst zwei papilläre Harnblasenkarzinom-Zelllinien, RT112 und
BFTC905, nach Knockdown bzw. Überexpression des Gens funktionell untersucht.
Außerdem wurde die Auswirkung auf verschiedene Wnt-Zielgene auf mRNA und
Protein-Level, sowie auf die Aktivität des Wnt-Signalwegs selbst untersucht. RT112
wies als Wildtypzelllinie eine SFRP1-Expression auf, BFTC905 hatte sie im Wildtyp
hingegen verloren. Nach der Überexpression von SFRP1 in BFTC905 und dem
shRNA-vermittelten Knockdown in RT112 wurde die Auswirkung auf Viabilität, das
heißt
auf
den
ATP-Stoffwechsel,
auf
die
Proliferation
und
auf
die
Wundheilungseigenschaften untersucht. Es zeigte sich für BFTC905, dass Zellen mit
SFRP1-Überexpression eine signifikant niedrigere Viabilität und auch langsamere
Wundheilung aufwiesen, als in der Wildtyplinie. Die Proliferationseigenschaften
änderten sich jedoch nicht. Bei RT112 konnte gar keine signifikante Änderung in
Stoffwechsel, Proliferation und Wundheilung beobachtet werden. Die funktionellen
Versuche
in
BFTC905
lassen
vermuten,
dass
SFRP1
die
Rolle
eines
Tumorsuppressors übernimmt und durch Verlangsamung der Stoffwechselaktivität
bzw. der Migration zu einem weniger malignen Phänotyp führen kann. Dies lässt
annehmen, dass die Tumorzellen mit SFRP1-Expression in vivo folglich auch
langsamer wachsen, und die Erkrankung so weniger schnell fortschreiten würde. In
RT112 kann diese Vermutung aber nicht bestätigt werden. Hier war gar kein
signifikanter, funktioneller Effekt sichtbar. Das könnte eventuell daran liegen, dass
SFRP1 durch die shRNA nicht in ausreichender Menge herunter reguliert wurde, um
171
Diskussion
funktionelle Konsequenzen nach sich zu ziehen. Andererseits ist es auch möglich,
dass die in der Wildtypzelllinine vorhandene Menge an SFRP1 schon so gering war
(siehe nicht nachweisbares Protein im Westernblot), dass ein weiterer Knockdown
ohne Effekt bliebe.
Im Weiteren wurde untersucht, ob die veränderte SFRP1-Expression Einfluss auf die
Wnt-Zielgene AXIN2, BMP4, CD44, CMYC, CCND1 und BIRC5 (Survivin) hatte. In
RT112
wurden
alle
Zielgene
auf
mRNA-Ebene
zusammen
mit
SFRP1
herunterreguliert, am stärksten BMP4. Dies spricht zunächst gegen die Vermutung,
dass verminderte SFRP1-Expression zu einer gesteigerten Aktivität des WntSignalweges und damit auch der Expression seiner Targetgene führt. Bei BFTC905
zeigte
auch
BMP4
die
stärkste
Herunterregulation,
jedoch
nach
SFRP1-
Überexpression, also genau umgekehrt, wie bei RT112. Auf Proteinebene zeigte sich
aber ein anderes Bild. Für RT112 konnte nur für CCND1 und BIRC5 ein signifikanter
Unterschied in der Proteinexpression zwischen Mock und A-Klonen gefunden
werden. Nach Expressionsverlust von SFRP1 wurden die beiden Wnt-Zielgene
signifikant um 26,2 (CCND1) bzw. um 23,7% (BIRC5) hochreguliert. Leider konnte
die Herunterregulation von SFRP1 in RT112 nicht mit dem Westernblot
nachgewiesen werden. Das lag wahrscheinlich daran, dass schon die in
Wildtypzelllinien exprimierte Proteinmenge nicht detektiert werden konnte und somit
eine weitere Herunterregulation nicht nachweisbar war (siehe weiter oben). In
BFTC905 konnte hingegen eine signifikante Überexpression von SFRP1 in den AKlonen um 1136,2% nachgewiesen werden. Diese wurde von einer signifikanten
Herunterregulierung von CMYC und BIRC5 um 20 bzw. 37,3% begleitet. Die Proteine
AXIN2 und CD44 konnten mittels Westernblot in keiner der beiden Zelllininen
detektiert werden, was wiederum dafür spricht, dass der Wnt-Signalweg, nicht oder
nur sehr schwach aktiv ist. Für BMP4 konnte auf Proteinebene, im Gegensatz zur
mRNA-Ebene, kein signifikanter Unterschied festgestellt werden. Die SFRP1abhängige Proteinregulation von CCND1, CMYC und BIRC5 in RT112 und BFTC905
spricht allerdings dafür, dass der Wnt-Signalweg, wie vermutet, von SFRP1 negativ
reguliert wird. Somit würde die Interaktion von SFRP1 mit dem Frizzled-Rezeptor
eine Aktivierung der Signalkaskade verhindern und somit zum proteosomalen Abbau
vom CTNNB1 führen. Dies behindert dann wiederum die Transkription von WntZielgenen und somit auch eine verstärkte Migration, Metabolismus, Proliferation,
sowie eine verminderte Adhäsion.
172
Diskussion
Die Vermutung der fehlenden oder nur sehr geringen Aktivität des kanonischen WntSignalweges konnte auch bei der Untersuchung der SFRP1-abhängigen WntAktivität mittels TOP/FOP flash Assay bestätigt werden. RT112 und BFTC905 wiesen
sowohl mit als auch ohne SFRP1 Expression keine nennenswerte Wnt-Aktivität (<2)
auf. Eine, wie aus anderen Krebsentitäten bekannte Überaktivierung des
kanonischen
Wnt-Signalweges
[130-132],
kann
für
unsere
beiden
Blasenkrebsmodelle somit nicht bestätigt werden. Der Wnt-Inhibitor SFRP1 scheint
somit keine Auswirkung auf die kanonische Wnt-Signalkaskade über TCF/LEF in den
beiden Zelllinien zu haben.
Bei der Untersuchung von papillären Urothelkarzinomen aus Patientengewebe
konnte kein signifikanter Unterschied im Überleben zwischen der IRS1 (keine und
schwache Expression) und IRS2-Gruppe (mittlere und starke Expression) gefunden
werden. Es zeigte sich aber dennoch, dass die SFRP1-exprimierenden Tumoren mit
längerem Überleben verknüpft sind, im Vergleich zu jenen ohne oder mit nur
schwacher Expression. Somit war möglicherweise die Anzahl der gefärbten Tumoren
(n=86) nicht ausreichend, um ein signifikantes Ergebnis zu bekommen. Das Ergebnis
sollte mit einer größeren Kohorte papillärer Tumoren verifiziert werden. Auffällig ist
auch, dass der Anteil der Tumoren mit Expressionsverlust oder nur schwacher
Expression (IRS1), nahezu mit dem Prozentsatz der am SFRP1-Promoter
methylierten Tumoren übereinstimmt. Dies könnte darauf hindeuten und unsere
Vermutung unterstützen, dass der Verlust der SFRP1-Expression in hohem Maße mit
einer Methylierung des Promotors einhergeht. Dies würde auch zu den Befunden aus
anderen Tumorentitäten passen, bei denen die Hypermethylierung des SFRP1Promotos ja bereits mehrfach nachgewiesen und mit der Erkrankung assoziiert
werden konnte. Im Vergleich zum Gesamtüberleben konnte für das progressionsfreie
Überleben aber keine Assoziation mit der SFRP1-Expression detektiert werden. Die
einzige signifikante Assoziation von SFRP1 wurde mit dem Tumorgrad gefunden. Es
zeigte sich, dass, Tumoren mit wenig oder fehlender Expression häufiger eine highgrade Differenzierung aufwiesen, was wiederum für eine prognostische Bedeutung
spräche.
Zusammengefasst betrachtet, scheint SFRP1 aber kein generell gültiger, neuer
molekularer Marker für die Vorhersage einer Progression beim papillären
Urothelkarzinom der Harnblase zu sein, da eine prognostische Bedeutung
173
Diskussion
möglicherweise nur für eine Subgruppe von papillären Tumoren eine Rolle spielt. Es
ließ sich aber auch nicht nachweisen, dass SFRP1 keine wichtige Rolle in der
biologischen Funktion des Urothels bzw. von Blasenkrebszellen einnimmt. Wir
konnten bestätigen, dass es beim Blasenkrebs zu einem Verlust der SFRP1Expression kommt. Diese ist in hohem Maße durch eine Promotorhypermethylierung
und in geringem Maße auch durch Deletionen auf 8p bedingt. Sie beeinflusst den
kanonischen Wnt-Signalweg scheinbar aber nur geringfügig.
In Anbetracht der vorliegenden Ergebnisse der funktionellen Zellkulturversuche und
der immunhistochemischen Expressionsanalyse in Tumorgewebe, ist es schwierig
eine endgültige Aussage über die Rolle von SFRP1 beim papillären Urothelkarzinom
der humanen Harnblase zu treffen. Es konnte nicht eindeutig nachgewiesen werden,
dass SFRP1 die Rolle eines Wnt-Signalwegs-vermittelten Tumorsuppressor innehat.
Unsere Hypothese, dass SFRP1-Verlust zu einer Überaktivierung des kanonischen
Wnt-Signalweges und damit zur gesteigerten Malignität und Progression des Tumors
führt, konnte nicht rückhaltlos bewiesen werden. Einerseits gibt es Hinweise, dass
SFRP1 wirklich die Funktionalität und auch die Malignität von Zellen beeinflusst. Dies
konnte vor allem am Zellkultursystem der BFTC905 Zellen, der Assoziierung mit dem
Tumorgrad, sowie an der Tendenz zu besserem Gesamtüberleben bei SFRP1exprimierenden Tumoren nachgewiesen werden. Andererseits gibt es aber auch
Hinweise, dass SFRP1 keinen Effekt auf die malignen Eigenschaften von
Blasenkrebszellen bzw. auf die Progression derselben hat, was durch die
funktionellen Versuche mit RT112 bestätigt werden konnte.
Bei fortgeschrittenen Blasentumoren konnte keine Assoziation zwischen dem
SFRP1-Expressionsstatus
und
histopathologischen
Parametern,
sowie
dem
Überleben gefunden werden. Diese Tatsache spricht dafür, dass SFRP1 beim
Urothelkarzinom, wenn überhaupt, nur bei papillären Tumoren eine Rolle spielen
könnte.
Die heterogenen Ergebnisse bezüglich SFRP1, könnten darauf zurück zu führen
sein, dass es sich bei SFRP1 nicht nur um einen Antagonisten des Wnt-Signalweges
handelt, sondern, dass das Signalmolekül auch an anderen Funktionen in der Zelle
beteiligt ist. Dies soll im Folgenden diskutiert werden.
174
Diskussion
In der Literatur werden die Aufgaben von SFRP1 und anderen Wnt-Inhibitoren
kontrovers diskutiert. Viele Studien konnten bereits nachweisen, dass SFRP1 nicht
nur eine Rolle bei der Inhibition des Wnt-Signalwegs, sondern auch bei dessen
Aktivierung spielt. Bovolenta et al postulierten, dass sowohl der kanonische als auch
der nicht-kanonische Signalweg über zwei verschiedene Mechanismen inaktiviert
und über zwei andere Mechanismen aktiviert werden kann: durch die „klassische“
Bindung von SFRP1 mit dem WNT-Molekül über die Cystein-reiche (CRD)- und die
Netrin-Domäne (NTR) und der dadurch verhinderten Bindung von WNT mit dem
FZD-Rezeptor, sowie über die Bildung eines inhibitorischen SFRP1-FZD-Komplexes,
der die WNT-Ligand-Bindung verhindert, kann die Wnt-Signalgebung inaktiviert
werden. Andererseits kann aber auch über die gleichzeitige Bindung von WNT und
FZD deren Interaktion und somit auch die Signalgebung unterstützt werden. Des
Weitern besteht die Möglichkeit, dass SFRP1 sich durch Bindung mit anderen
SFRP1-Molekülen selbst hemmt und somit die Inhibition des Wnt-Signalwegs
verhindert wird [133]. Neben der Beeinflussung der Wnt-Signalwegs-Aktivität wurde
beispielsweise auch eine Wnt-unabhängige Beeinflussung des Axon-Wachstums und
der Axon-Reorientierung in retinalen Ganglienzellen beobachtet [134]. Außerdem,
wurde vielfach beschrieben, dass SFRP‘s auch Bindungen mit weiteren Molekülen,
z.B. FN1 (Fibronektin), UNC5H3, RANKL und BMP/Tolloid, eingehen können, die
nicht in den Wnt-Signalweg involviert sind. So bewirkte die Bindung von SFRP2 mit
einem Fibronektin-Integrin-Komplex eine gesteigerte Viabilität und verminderte
Apoptose bei Brustkrebszellen. Eine ähnliche Verbindung wäre somit auch für
SFRP1 denkbar. Durch die Einbindung von SFRP1 im Fibronektin-Integrin-Komplex
würden die Zellen dann besser vor apoptotischen Stimuli geschützt werden [135].
Dies könnte eine vom Wnt-Signalweg unabhängige Beeinflussung der Viabilität
erklären. SFRP1 zeigte zudem auch eine hohe Bindungsaffinität zu dem Peptid-Motiv
L/V-VDGRW-L/V, welches weder ein Bindungsmotiv von FZD noch von WNT
darstellt. Stattdessen wurde dieses Bindungsmotiv aber in beispielsweise zwei
anderen Molekülen nachgewiesen: in UNC5H3 und RANKL [136]. Bei UNC5H3
handelt es sich um einen Netrin1-induzierten Rezeptor, der bei der Axonabstoßung,
Zytoskelett-Remodellierung und bei der Dynamik der Mikrotubuli in neuronalen
Populationen eine Rolle spielt [137]. Auch eine Beeinflussung der Transkription wird
diskutiert. RANKL gehört zur Familie der Tumornekrosefaktoren und ist ein wichtiger
Mediator in der Osteoklasten-Bildung. SFRP1 scheint über die direkte Bindung von
175
Diskussion
RANKL die Osteoklastenbildung zu hemmen [138]. So könnte auch eine RANKLvermittelte Inhibition der Tumorzell-Bildung initiiert werden. Sizzled (kurz für secreted
frizzled), ein Mitglied der SFRP-Familie, das zuerst in Xenopus Embryonen als
putativer WNT8-Antagonist entdeckt wurde [139], konnte zudem auch als negativer
Feedback-Regulator des BMP-Signalwegs nachgewiesen werden [140]. So könnte
es durch eine Interaktion von Sizzled oder auch anderen Mitgliedern der SFRPFamilie, wie z.B. SFRP1, zu einer verringerten Transkription von Targetgenen des
BMP-Signalweges, wie z.B. Id (inhibitor of differentiation oder inhibitor of DNA
binding) kommen. Id ist ein negativer Regulator der Zelldifferenzierung und ein
positiver Regulator der Zellproliferation [141]. Bei verminderter Expression käme es
dann zu verstärkter Zelldifferenzierung und geringerer Proliferation. Letzteres wurde
ja in SFRP1-überexprimierenden BFTC905 Zellen beobachtet.
Ein Crosstalk von BMP/TGF-ß und Wnt-Signalweg ist aber auch aus anderen
Studien bekannt. So wurde beispielsweise beschrieben, dass SMAD3 mit LEF1
interagiert und so die Transkription von TGF-ß- und Wnt-Zielgene synergistisch
aktiviert werden kann [142]. Außerdem scheint auch SMAD4 einen Komplex mit
TCF/LEF und CTNNB1 zu formen und so den Wnt-Signalweg zu beeinflussen [143].
Auch eine BMP-abhängige Aktivierung von MSX2 wird durch die beidseitige Bindung
von SMAD4 und LEF1 an den MSX2-Promotor vermittelt [144]. Ein weiteres Beispiel
der Interaktion von BMP- und Wnt-Signalweg ist TCF7. Dies ist ein DownstreamEffektor beider Signalwege und inhibiert die myogene Differenzierung durch die
Unterdrückung von Myogenin und MyoD-Expression.
SFRPs sollten also eher als multifunktionelle Regulatoren des Wnt-Signalweges,
denn nur als Antagonisten betrachtet werden. Sie haben scheinbar mehr Einfluss auf
andere Signalwege (wie z.B. den Shh- und den BMP-Signalweg) als bisher vermutet
und sind selbst auch Einflüssen eben dieser Signalwege ausgesetzt.
Neben der Beeinflussung durch andere Signalwege, sollte auch die Involvierung der
nicht-kanonischen Wnt-Signalwege beleuchtet werden. Wie bereits in Kapitel 1.2
erwähnt, sind neben dem kanonischen CTNNB1-Signalweg auch noch mehrere
nicht-kanonische Wnt-Signalwege bekannt. Beispiele hierfür sind der WNT/planar
cell polarity (WNT/CPC)-, WNT/Ca2+, WNT/JNK-, WNT/ROR-, WNT/GSK3ßMT-,
WNT/aPKC-, WNT/RYK- und der WNT/mTOR Signalweg. Die bekanntesten nicht176
Diskussion
kanonischen Signalwege sind aber der WNT/Ca2+- und der WNT/CPC-Signalweg.
Der WNT/Ca2+-Signalweg zeichnet sich dadurch aus, dass der WNT-Ligand, z.B.
WNT5a neben dem Hauptrezeptor Frizzled auch den Co-Rezeptor ROR1/2 bindet.
Im Folgenden kommt es in der Zelle zu einer kurzzeitigen Erhöhung der
Konzentration von bestimmten intrazellulären Signalmolekülen, wie IP3, DAG und
Ca2+. Dies führt wiederum zur Aktivierung weiterer Moleküle der Signalkaskade, wie
CN, CAMKII und PKC und schließlich zur Aktivierung von Transkriptionsfaktoren, wie
NFAT, NFκB und CREB, die die Expression von Zielgenen beeinflussen können.
Durch die alleinige Bindung von WNT5A mit dem ROR1/2 Rezeptor kommt es
ebenfalls zu einer Erhöhung der Ca2+-Konzentration, nachfolgend aber zur
Aktivierung von SIAH2, CALPAIN und CDX2. SIAH2 hat die Fähigkeit CTNNB1
herunter zu regulieren und somit negativ auf den kanonischen Wnt-Signalweg zu
wirken. CALPAIN kann die Zytoskelettproteine Filamin und Spectrin spalten. CDX2
ist ein weiterer Transkriptionsfaktor, der ebenfalls die Transkription von Targetgegen
beeinflusst [145].
Der WNT/CPC-Signalweg zeigt zum Teil Überlappungen mit dem WNT/Ca2+Signalweg und ist durch folgende Hauptmerkmale gekennzeichnet: durch die
Bindung des Wnt-Liganden am Transmembran-Rezeptor wird DVL-1 an die
Plasmamembran rekrutiert. Nachfolgend werden Adaptorproteine (STAB und
PRICKLE) aktiviert und die Aktivierung der kleinen GTPasen RHO A, CDC42 und
RAC 1 getriggert. Diese aktivieren im Weiteren ROCK (Rho-assoziierte Kinase) und
JNK (c-jun N-terminale Kinase), die dann wiederum die Transkription von Zielgenen
beeinflussen [146].
Beim Brustkrebs ist bereits bekannt, dass ektopische Expression von SFRP1 in
Brustkrebszelllininen zu einer Inhibition des kanonischen und des nicht-kanonischen
Wnt-Signalweges führte [147]. Es wäre interessant, auch in Blasenkrebszelllinien mit
ektopischer SFRP1-Expression, wie zum Beispiel in BFTC905, eine zusätzliche
Untersuchung der nicht-kanonischen Signalwege vorzunehmen. Wie auch für die
Messung der TCF/LEF-vermittelten Luziferaseaktivität mittels TOP/FOP Reporter
Assay, könnte hierfür ein Luziferase-basierter Reporter-Assay verwendet werden.
Dieser wurde bereits von Yang et al [147] beschrieben und kann die
Transkriptionsrate
eines
Promotors
messen,
der
unter
der
Kontrolle
2+
von
Tandemrepeats einer der beiden Transkriptionsfaktoren NFAT (WNT/Ca ) oder AP1
177
Diskussion
(WNT/CPC) steht. So könnte die Beeinflussung und Aktivität des nicht-kanonischen
Wnt-Signalweges untersucht werden.
SNP-Analyse in SFRP1:
In der vorliegenden Arbeit wurde, nach unserem Kenntnisstand, zum aller ersten Mal
eine Assoziation von SNPs in SFRP1 (rs3242 und rs921142) mit dem
Erkrankungsrisiko für eine maligne Erkrankung untersucht. Die Untersuchung von
403 Blasenkrebspatienten, bestehend aus einer konsekutiven Kohorte und einer
Gruppe mit frühem Erkrankungsalter (≤45 Jahre), sowie 332 Kontrollen ohne
Tumorerkrankung, zeigte einen signifikanten Unterschied in der GenotypenVerteilung des SNP rs3242. Bei den erkrankten Patienten zeigte sich ein
vermindertes Auftreten des homozygoten CC-Genotyps (36%) im Vergleich zur
Kontrollgruppe, bei der noch 44,3% diese Allelvariante aufwiesen. Auch die
Verteilung des heterozygoten CT-Genotyps war bei den Blasenkrebspatienten im
Vergleich zu den Kontrollen verändert und stieg von 41,6 auf 50,1%. Die Verteilung
des homozygoten T-Genotyps blieb bei erkrankten Patienten (13,9%) und gesunden
Kontrollen (14,1%) nahezu konstant. Eine kohortenspezifische Untersuchung der
Allelverteilung im Vergleich zur Kontrollgruppe konnte aufdecken, dass dieser
Unterschied durch die Patientengruppe mit Erkrankungsalter ≤ 45 Jahre (EarlyOnset) bedingt war. So konnte ein um 13,1% verringertes Auftreten des
homozygoten CC-Genotyp und ein um 11,9% erhöhtes Auftreten der heterozygoten
Variante CT beobachtet werden. Auch hier blieb die Verteilung des TT-Genotyps
nahezu unverändert. Beim Vergleich der Kontrollen mit den Patienten der
konsekutiven Studie alleine, konnte kein Unterschied mehr festgestellt werden. Wir
vermuten deshalb, dass die Anwesenheit eines T-Allels bzw. der Verlust des
anzestralen C-Allels das Blasenkrebsrisiko erhöht bzw. das Erkrankungsalter
herabsetzt.
Auch in single nucleotid polymorphisms anderer Gene konnten altersabhängige
Erkrankungsrisiken für die verschiedenen Allelvarianten beobachtet werden. So
konnten beispielsweise Grochola et al einen SNP im PPP2R5E Gen identifizieren (ɛSNP2), der eine signifikante Assoziation mit dem Alter bei Erkrankungsausbruch, mit
dem
Erkrankungsrisiko
im
Allgemeinen
und
dem
Gesamtüberleben
bei
Weichteilsarkomen zeigte. So war bei Patienten unter 51 Jahren ein gehäuftes
Auftreten des TT- und ein vermindertes Auftreten des CC-Genotyps im Vergleich zur
178
Diskussion
Kontrollgruppe zu beobachten [148]. Auch bei anderen Mediatoren der P53Signalkaskade konnten altersabhängige SNPs determiniert werden. So zeigten
Träger von P53-Mutationen (Li-Fraumeni-Syndrom) mit einem G-Allel im MDM2 SNP
309 ein 7, 10 und 16 Jahre früheres Auftreten von Tumoren, als T-Allelträger [149151]. Doch auch bei G-Allelträgern ohne P53-Mutation konnte ein früherer
Krankheitsbeginn bei Weichteilsarkomen [149], Lymphomen [152], Leukämie [153],
Kopf-, Hals- und oralen Plattenepithelkarzinomen [154, 155], bei Neoplasien des
Kolons [156], der Brust [157], des Ovars [158], des Gehirns [159], der Leber [160]
und der Blase [161] beobachtet werden.
Es scheint also durchaus plausibel, dass der Zeitpunkt des Krankheitsausbruchs
maßgeblich von SNPs beeinflusst werden kann. Es ist demnach essentiell, mögliche
biologische Grundlagen und den Mechanismus des frühen Genotyp-bedingten
Erkrankungszeitpunktes in rs3242 aufzudecken.
Wie bereits oben erwähnt liegt der Genlokus des rs3242 SNP in der 3’UTR von
SFRP1. In dieser Region liegen zwar keine kodierenden Gene, jedoch aber
potenzielle Bindestellen für mikroRNAs. Damit ist einerseits zwar ausgeschlossen,
dass der rs3242 SNP die Expression oder Faltung des SFRP1 Proteins direkt und
translational beeinflusst, andererseits ist es aber sehr plausibel, dass die
Bindefähigkeit bestimmter miRNAs derart verändert wird, dass diese nicht mehr so
gut oder aber auch verstärkt an die 3’UTR binden können und es somit trotzdem zu
einer verminderten oder gegebenenfalls auch gesteigerten Genexpression von
SFRP1 kommt. Die in silico Untersuchung der SFRP1-Gensequenz mittels miRbase
in Abhängigkeit des jeweiligen Genotyps konnte zwei miRNAs identifizieren, denen
nur in Anwesenheit des T-Allels des rs3242 SNP eine Bindefähigkeit vorher gesagt
wurde: hsa-miR-603 und hsa-miR-3646. Dies spricht dafür, dass diese beiden
miRNAs nur an jene SFRP1-mRNA-Sequenzen binden, die ein T-Allel in rs3242
aufweisen. Deshalb kommt es nur bei T-Allel Trägern zur mikroRNA-bedingten
Destabilisierung bzw. zum Abbau der SFRP1 mRNA und somit zu einer verminderten
oder fehlenden Genexpression von SFRP1. Das hat dann zur Folge, dass das
Protein seine biologische Funktion als Wnt-Regulator und Tumorsuppressor nicht
mehr erfüllen kann. Ein erhöhtes malignes Potential der Zelle wäre die Folge. Die
bisherigen Ergebnisse warfen aber die Frage auf, warum nur der heterozygote
Genotyp gehäuft bei den jungen Patienten auftritt, die Verteilung der homozygoten
179
Diskussion
TT-Variante sich zwischen Erkrankten und Kontrollen kaum unterscheidet. Wir
würden erwarten, dass ein Vorliegen des homozygoten TT-Genotyp zu einer noch
stärkeren Bindung der hsa-miR-3646 führt, was dann eine noch stärkere
Herunterregulierung von SFRP1 nach sich ziehen und das maligne Potential der
Zelle noch mehr erhöhen würde. So wäre zu erwarten gewesen, dass sich das
Auftreten der TT-Variante zwischen Fällen und Kontrollen noch mehr unterscheiden
und noch mehr Krebspatienten den TT-Genotyp aufweisen würden.
Um den Einfluss von hsa-miR-603 und hsa-miR-3646 bei Entstehung und
Progression des Urothelkarzinoms der Harnblase aufzuklären, wurden zunächst die
Loci der beiden mikroRNAs in unseren 19 aCGH Tumoren auf Deletionen oder
Amplifikationen bzw. auf eine Veränderung der Kopienzahl untersucht. Für hsa-miR603 (Chromosom 10p12.1: 24564614-24564710) konnten keine Veränderungen der
Kopienzahl und auch keine genetischen Verluste oder Zugewinne sowohl in pTa als
auch in pT1 Tumoren verzeichnet werden. Es waren immer zwei Kopien des
entsprechenden DNA-Abschnittes auf Chromosom 10 vorhanden. Für hsa-miR-3646
(Chromosom
20q13.12:
43036760-43036843)
konnten
wir
jedoch
einen
beträchtlichen Unterschied zwischen pTa und pT1 Tumoren feststellen. 1/9 pTa
(11%), jedoch 6/10 (60%) der pT1-Tumoren wiesen eine Amplifikation des hsa-miR3646 Lokus auf. Die Amplifikation ging jeweils mit dem Zugewinn einer Genkopie
einher, sodass die Kopienzahl des für die miRNA kodierenden Abschnittes jeweils
drei Kopien betrug. Diese Ergebnisse bestärken unsere Vermutung, dass es beim
Fortschreiten der Erkrankung zu einer erhöhten Expression von hsa-miR-3646 und
somit zu verstärktem Abbau der SFRP1 mRNA bei T-Allelträgern in rs3242 kommt.
Interessant ist dabei aber auch, dass der hsa-miR-3646 Genlokus in dreifacher
Ausführung vorliegt. Eine noch stärkere Amplifikation mit vier oder mehr Genkopien
konnte nicht beobachtet werden. Das bedeutet auch, dass wahrscheinlich eine
geringfügige Steigerung der miRNA Expression schon gravierende funktionelle und
phänotypische Ausprägungen mit sich bringt. Bisherige Ergebnisse deuten darauf
hin, dass lediglich hsa-miR-3646, nicht aber hsa-miR-603 eine Funktion als Onkogen
bei der urothelialen Karzinogenese spielen könnte.
Eine mikroRNA-induzierte Aktivierung von Progressions- und Tumor-assoziierten
Signalwegen in der Blase ist auch schon aus anderen Signalwegen, wie
beispielsweise dem Sonic Hedgehog (Shh)-Signalweg bekannt. Hier war die
180
Diskussion
Deregulation von hsa-miR-92A, 19A und 20A mit verkürztem Gesamtüberleben und
mit Überexpression von Shh und Gli-induzierbaren Zielgenen beim muskel-invasiven
Blasenkrebs korreliert [162] Es wäre also denkbar, dass auch beim Wnt-Signalweg
mikroRNAs eine wichtige Rolle bei der Entstehung und Progression der Erkrankung
spielen könnten.
Für eine tiefgehendere Analyse wurde im Weiteren eine Expressionsanalyse der
beiden mikroRNAs in Blasenkrebszelllinien und Blasentumoren durchgeführt. HsamiR-603 wurde nur sehr schwach, hsa-miR-3646 hingegen recht stark in
Blasenkrebs-Zelllinien und in Tumorgewebe exprimiert. Möglicherweise repräsentiert
die Expressionsstärke der hsa-miR-603 die normale und nur sehr geringe mikroRNAMenge, die in der Zelle exprimiert wird. Dies wird auch dadurch bestärkt, dass in der
aCGH keine Deletion und keine Verringerung des Kopienzahl-Status für hsa-miR-603
beobachtet werden konnte. Die erhöhte Expression von hsa-miR-3646 könnte durch
eine Überexpression im Rahmen einer Amplifikation bzw. einer Kopienzahl-Erhöhung
begründet sein (siehe oben).
Nach der Überexpression von hsa-miR-603 in RT4 konnte eine erhöhte Expression
von SFRP1 auf mRNA-Ebene, sowie das Absterben der Zellen beobachtet werden.
Bei RT112 und J82 war kein solcher Effekt sichtbar. RT4 wies den heterozygoten
CT-Genotyp des rs3242 SNPs in SFRP1 auf. miRbase konnte eine Bindung von hsamiR-603 bei Vorliegen des T-Allels vorhersagen. Man würde erwarten, dass bei der
Bindung von hsa-miR-603 an die SFRP1-mRNA, diese abgebaut oder „inaktiviert“
wird, es so zur Aktivierung des Wnt-Signalweges und zur Erhöhung des malignen
Potentials (z.B. gesteigerte Proliferation und Migration) der Zelle kommt. Doch das
Gegenteil schien der Fall zu sein. Durch die Anwesenheit von hsa-miR-603 in der
Zelle kam es zur Erhöhung der SFRP1-Expression und zu einem scheinbar dadurch
bedingten Wachstumsstopp bzw. Zelltod der Zellen. Es ist natürlich auch möglich,
dass hsa-miR-603 auch an andere mRNAs, als SFRP1 bindet, die dann wiederum
die Expression von SFRP1 aktivieren könnten. Bei der Analyse der hsa-miR-603
Sequenz mit dem basic local alignement search tool (BLAST) ergaben sich 7797
Treffer für verschiedenste Gene auf unterschiedlichen Chromosomen. Kruepple-likefactor 6, Lysozyme-like protein 1, Frizzled-8 precursor, Rho-GTPase-activating
protein 21, Neuropilin-1, Calmoduline-like protein 3, Ras-related protein Rab-18 und
Homeobox protein Mohawk sind nur einige der möglichen Kandidatengene, die durch
hsa-miR-603
gebunden
und
gegebenenfalls
181
auch
reguliert
werden
(Stand
Diskussion
10.05.2012). Es bleibt also sehr spekulativ zu vermuten, durch welches andere Gen
SFRP1 in RT4 durch die Anwesenheit von hsa-miR-603 heraufreguliert wurde.
Die vorliegenden Untersuchungen lassen vermuten, dass hsa-miR-603 keine, durch
Amplifikation oder anderweitige Überexpression bedingte, herausragende Rolle bei
der SFRP1-Regulation von Blasenkrebs spielt. Die Überexpression scheint dennoch
eine wichtige Funktion auf die biologischen Effekte der Zelle zu haben, was aber
wohl hauptsächlich auf die Funktion eines sozusagen universellen Mediators und
Genregulators zurückzuführen ist. Es wäre aber dennoch interessant abzuklären, ob
es in der Zelle zu einer reellen Bindung von hsa-miR-603 mit der SFRP1-mRNA
kommt.
Leider war ein Überexpressions-Plasmid von hsa-miR-3646 zum Zeitpunkt der
Experimentendurchführung noch nicht verfügbar. Sobald es kommerziell erhältlich
ist,
soll
auch
der
Einfluss
der
Überexpression
von
hsa-miR-3646
in
Blasenkrebszelllinien bzw. in einer normalen Urothelzelllinie untersucht werden.
Alternativ ist geplant, die Vorläuferform der mikroRNA (premature miRNA) in die
Zelle zu schleusen und dann funktionelle Effekte zu analysieren. Ein entsprechendes
Konstrukt ist bereits kommerziell erhältlich.
Es lässt sich aber auch für diese mikroRNA vermuten, dass sie die Funktion eines
universellen Regulators übernimmt und deshalb möglicherweise auch Auswirkungen
auf die SFRP1-mRNA hat. Beim Vergleich der Nukleotidsequenz mit BLAST konnten
2984 Treffer verzeichnet werden, unter anderem mit TATA box-binding protein-like
protein 2, Estrogen receptor beta, DNA repair protein RAD51, Steroid hormone
receptor ERR2, Serine-protein kinase ATM und vielen anderen (Stand 10.05.2012).
In unserer Studie konnte nachgewiesen werden, dass der Genotyp des SFRP1 SNP
rs3242
das
Erkrankungsalter
signifikant
beeinflusst
und
eine
mögliche
Überexpression von hsa-miR-3646 darin involviert ist. Die genauen biologischen
Mechanismen dahinter bedürfen aber noch weiterer Aufklärung und sollen in
folgenden Experimenten und Studien in unserer Arbeitsgruppe weiter analysiert
werden.
Die Genotypenverteilung in rs921142 zeigte keine Assoziation mit einem Risiko für
Blasenkrebs, weder in der gesamten Tumorkohorte, noch in den jungen Patienten
182
Diskussion
mit Erkrankungsalter unter ≤45 Jahren. Sims et al postulierte, dass der SNP in der
3’UTR von SFRP1 liegt und somit potentielle mikroRNA-Bindestellen beeinflussen
könnte. Weitere Nachforschungen ergaben aber, dass der SNP nicht in der 3’UTR,
sondern 5‘-upstream vor dem SFRP1-Gen liegt. Dort liegen bekanntlicherweise keine
mikroRNA-Bindestellen, sondern Enhancer- und Silencer-Strukturen, die die
Anlagerung von Transkriptionskomplexen an den Promotor verändern können. In
unserem Fall scheinen Enhancer- und/oder Silencer-Strukturen aber durch den
rs921142
SNP
nicht
verändert
zu
werden.
Rs921142
spielt
beim
Harnblasenkarzinom keine tragende Rolle.
aCGH-Analyse:
Bei SFRP1 handelt es sich um ein vielversprechendes Kandidatengen auf
Chromosom 8p, das häufig von Deletionen auf diesem Chromosomenabschnitt bei
Blasenkrebs betroffen ist. Um auch andere Gene zu identifizieren, die von solchen
Deletionen betroffen sind, haben wir eine hochauflösende vergleichende genomische
Hybridisierung von 9 nicht-invasiven (pTa) und 10 nicht-muskel-invasiven (pT1)
Tumoren durchgeführt. Wir konnten zahlreiche Gene identifizieren, die durch
Mikrodeletionen in pTa-Tumoren betroffen waren und die somit potenzielle
Progressionsmarker papillärer Blasentumoren darstellen.
Vor der Konzentration auf ein bestimmtes Gen und die damit verbundenen
funktionellen Analysen wurde zunächst eine Cluster-Analyse mit den Daten der
array-CGH durchgeführt. Alle 19 analysierten Tumoren wurden hinsichtlich
Kopienzahl-Veränderungen (= CNVs = copy number variations), d.h. homo- oder
heterozygoten Deletionen bzw. mindestens triploiden Amplifikationen untersucht. Die
zwei Untergruppen entstanden dann durch Clusterung der 19 markantesten Marker,
die aufgrund der CNV-Ergebnisse erhalten worden waren. Gruppe 1 fasst alle nichtinvasiven Tumoren, Gruppe 2 alle invasiven Tumoren zusammen. Lediglich jeweils
ein Tumor weicht von den anderen ab und befindet sich in der jeweils „falschen“
Gruppe. Möglicherweise handelt es sich bei dem pTa-Tumor, der „fälschlicherweise“
in die Gruppe der invasiven Tumoren geclustert wurde, um die Vorstufe eines
Tumors mit erhöhter Invasivität und Malignität, der aus einer Dysplasie (und nicht aus
einer Hyperplasie) hervorgegangen ist und somit bezüglich der genetischen
Veränderungen den pT1-Tumoren ähnlicher ist. Dazu passt die Beobachtung, dass
es sich bei diesem Tumor zwar nicht um den Tumor mit der MTUS1-Deletion handelt,
183
Diskussion
er jedoch als high-grade-Tumor beurteilt wurde. Jedoch könnte auch eine fokale
Invasivität in dem Schnittpräparat, aus dem die DNA für die array-CGH isoliert wurde,
dafür gesorgt haben, dass der Tumor bezüglich der chromosomalen Veränderungen
den invasiven pT1-Tumoren ähnlicher ist.
Bei erneuter Begutachtung des „falsch geclusterten“ pT1-Tumors unter dem
Mikroskop fällt auf, dass der Tumor minimal invasiv ist, vereinzelt Nekrosen aufweist
und deshalb als pT1-Tumor gewertet werden muss. Jedoch scheint aufgrund des
Gesamtbildes des Tumors eine Clusterung zu den genetisch stabileren pTa-Tumoren
nicht außergewöhnlich. Möglicherweise handelt es sich um einen minimal invasiven
pT1-Tumor mit einer besseren Prognose [163].
Insgesamt konnte die Cluster-Analyse aber bestätigen, dass es sich bei den beiden
Tumorkohorten nicht nur hinsichtlich der Invasivität, sondern auch hinsichtlich der
genetischen Veränderungen um zwei unterschiedliche Gruppen handelt. Die aCGHAnalyse und die Betrachtung chromosomaler Veränderungen könnte zukünftig ein
wichtiges Hilfsmittel des Pathologen darstellen, die histologische Diagnose zu
sichern, beispielsweise bei nicht-zweifelsfreiem Grading und fraglicher Invasion.
Doch auch die Analyse von Mutationen in bestimmten Genen spielt eine immer
wichtigere Rolle bei der Erstellung von Diagnosen und Prognosen beim
Harnblasenkarzinom. Die durchgeführten Mutations-Analysen der 19 Tumoren
lieferten folgendes Ergebnis: Acht der neun pTa-Tumoren wiesen eine Veränderung
im FGFR3-Gen auf, fünf davon die Mutation S249C. Diese wird auch in der Literatur
als die häufigsten Mutation beschrieben [164], was erneut die Integrität unserer
Daten bestätigte. Somit scheint es sich bei diesen pTa-Tumoren um „klassische“, gut
differenzierte, nicht-invasive Tumoren zu handeln, die aus einer Hyperplasie
hervorgegangen sind. Ein Vergleich der Mutations-Analyse mit der Clusterung lieferte
allerdings die Erkenntnis, dass es sich bei dem „falsch geclusterten“ pTa-Tumor und
dem pTa-Tumor ohne FGFR3-Mutation nicht um denselben Tumor handelte, was
möglicherweise dessen Zuordnung zur Gruppe der invasiven pT1-Tumoren erklärt
hätte. Bei den pT1-Tumoren waren in drei Fällen Mutationen zu beobachten, wobei
es sich immer um die Mutation S249C handelte. Insgesamt passen diese Ergebnisse
gut zu der in der Literatur beschriebenen Tatsache, dass sich FGFR3-Mutationen
häufiger in gut differenzierten und nicht-invasiven als in schlecht differenzierten und
invasiven Tumoren nachweisen lassen [165]. Doch auch Mutationen im PIK3CA-Gen
werden als relativ häufig in nicht-invasiven papillären Tumoren beschrieben. Von
184
Diskussion
unseren 19 untersuchten Tumoren zeigen jedoch nur ein pTa- sowie drei pT1Tumoren eine Mutation in PIK3CA. Die von Lopez-Knowles et al beschriebene
Assoziation der PIK3CA-Mutationen mit dem Auftreten von Mutationen im FGFR3Gen [166] kann in unseren Tumoren nur teilweise bestätigt werden. Der nichtinvasive Tumor pTa_5, der als einziger pTa-Tumor die H1047R-Mutation im PIK3CAGen besitzt, zeigte auch eine FGFR3-Mutation (nämlich A393E). Bei den pT1Tumoren zeigten jedoch drei Tumoren (pT1_7, pT1_8 und pT1_10) jeweils die
PIK3CA-Mutation E545K, während drei andere Tumoren (pT1_2, pT1_6 und pT1_9)
eine Mutation im FGFR3-Gen (immer S249C) aufwiesen. Bei unseren Tumoren
konnte keine deutliche Korrelation zwischen FGFR3- und der PIK3CA-Mutationen
nachgewiesen werden. Allerdings ist unsere Kohorte zu klein, um von einem Trend
sprechen zu können.
Nachdem die Cluster- und Mutationsanalyse die Integrität unserer Daten bestätigt
hatte, wurden zunächst alle Gene mit aktuellen Literaturdaten verglichen um eine
mögliche bekannte Assoziation mit anderen malignen Erkrankungen abzuklären.
Nach eingehender Prüfung, wurde MTUS1 als ein potenzielles Zielgen ausgewählt
und
seine
Expression
in
Harnblasenkarzinom-Zelllinien,
sowie
in
Blasentumorgewebe analysiert. Im Weiteren wurde MTUS1 ektopisch in RT112
exprimiert und funktionelle Effekte wurden untersucht. Die Rolle von MTUS1 im
Urothelkarzinom der Harnblase
soll anhand der erhaltenen Ergebnisse im
Folgenden diskutiert werden.
MTUS1 im Urothelkarzinom der Harnblase:
Der Genlokus von MTUS1 oder auch MTSG1 (mitochondrial oder microtubulusassociated protein 1) liegt auf Chromosom 8p21.3-22 (17.501.304-17.658.426) in der
Nähe des Markers D8S254, erstreckt sich über 112 kb genomische DNA und besteht
aus 17 kodierenden Exons. Die Verwendung von alternativen Exons führt dazu, dass
30 Transkriptvarianten entstehen können, von denen wiederum neun in Proteine
translatiert werden. Bei 8 Proteinen handelt es sich um funktionsfähige Polypeptide,
ein Protein ist jedoch ein nonsense-Derivat. Informationen dazu liefert beispielsweise
www.ensembl.org (http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG
00000129422;r=8:17501304-17658426). Die Bezeichnung des Genprodukts ATIP
(Angiotensin II AT2 receptor-interacting protein) oder ATBP (AT2-receptor bindingprotein) leitet sich von seiner Funktion als Interaktionspartner des AT2-Rezeptors ab.
185
Diskussion
Das Protein interagiert mit dem C-Terminus des Rezeptors und unterstützt diesen bei
der Hemmung der ERK2-Aktivität des klassischen MAP-Kinase-Weges, bei der
Inhibierung der Wachstumsfaktor-induzierten Autophosphorylierung von RezeptorTyrosin-Kinasen, und der Zellproliferation [167].
Die acht verschiedenen MTUS1-Genprodukte werden fünf verschiedenen ATIPVarianten zugeordnet, nämlich ATIP1, ATIP2, ATIP3a, ATIP3b und ATIP4. Die fünf
Transkripte lassen sich, basierend auf der Verteilung im Gewebe und dem Gebrauch
der 5‘Exons in drei Hauptgruppen einteilen (ATIP1, ATIP3 und ATIP4). ATIP3a,
ATIP3b und ATIP2 verwenden alle die gleichen 5’-Exons (1 und 2) und
unterscheiden sich durch alternatives Splicing der Exons 3 und/oder 4. ATIP4 und
ATIP1 verwenden die Exons 5 und 8, wohingegen ATIP2 das Exon 3 verwendet,
welches ein Stopcodon enthält, das zu verfrühtem Abbruch (truncation) des Proteins
führt [129]. Die verschiedenen Transkripte lassen sich auch den verschiedenen
Isoformen von MTUS1 zuordnen und zeigen eine unterschiedliche Verteilung in
menschlichen Geweben. Isoform 1 entspricht ATIP3a und damit dem Protein, das
fast ubiquitär in allen Körpergeweben, exklusive Gehirn, exprimiert wird. Die
Isoformen 2 und 8 werden dem Transkript ATIP3b zugeordnet, welches ebenfalls in
nahezu allen Körpergeweben exprimiert wird. Auch in der Harnblase ist ATIP3 die
Variante, die bisher am häufigsten nachgewiesen wurde. Isoform 3 entspricht ATIP4,
welches fast ausschließlich im adulten und embryonalen Gehirn, sowie im
Cerebellum exprimiert wird. Isoform 4 ist mit ATIP2 gleichzusetzen, über dessen
Funktion aber noch nicht sehr viel bekannt ist. Isoform 5 ist lässt sich schließlich
ATIP1 zuordnen, welches, wie auch ATIP4 ubiquitär im Gehirn exprimiert wird. Aber
auch eine Expression in anderen Geweben, z.B. in der Mundschleimhaut konnte für
ATIP1 nachgewiesen werden [168]. Den Isoformen 6 und 7 lassen sich, nach
heutigem Kenntnisstand, noch keine Transkriptvarianten zuordnen [129].
MTUS1 wurde zum ersten Mal 2003 von einer Würzburger Forschungsgruppe
beschrieben, wo seine Expression funktionell in Pankreaskarzinomzelllinien und
diversen Normalgeweben untersucht wurde. Es zeigte sich, dass MTUS1 in allen
untersuchten Normalgeweben (z.B. Herz, Gehirn, Placenta, Lunge, Niere) exprimiert
wurde. Es wurde zudem festgestellt, dass MTUS1 in den Mitochondrien der
humanen Pankreaskarzinomzelle MIA PaCa-2 lokalisiert ist. Außerdem konnte
gezeigt werden, dass eine umgekehrte Korrelation zwischen MTUS1-Expression und
der Proliferation bzw. dem Differenzierungsgrad bei Pankreastumoren und Zelllinien
186
Diskussion
bestand. So exprimierten undifferenzierte und schnell proliferierende Zellen und
Tumoren (G3) wenig oder kein MTUS1, gut differenzierte (G1 und G2) und langsam
proliferierende Zellen oder Tumoren hingegen viel MTUS1. Diese Erkenntnisse
führten dann dazu, dass dieses neue potenzielle Tumorsuppressor-Gen den Namen
mitochondrial tumor-supressor-1 erhielt. Neben der Rolle als Tumorsuppressor spielt
MTUS1 auch eine große Rolle bei der Quieszenz und Differenzierung von benignen
Zellen, sowie bei der Gehirnfunktion [123]. Spätere Untersuchungen konnten auch
eine enge Assoziation mit der Bewegung der Mikrotubuli und der Mitose nachweisen,
die dann die zweite Genbezeichnung microtubule-associated tumor suppressor 1
rechtfertigte [169].
Unsere Untersuchungen zeigten, dass MTUS1 sowohl in normalem Urothel als auch
in Blasentumoren exprimiert wurde. In vielen Tumoren war die Expression aber auch
verloren gegangen. Die androgen-abhängige Prostatakarzinom-Zelllinie LNCaP
wurde als Positivkontrolle eingesetzt und zeigte sowohl in der qRT-PCR als auch im
Westernblot die höchste Expression. Im Westernblot konnten Banden bei ca. 60, 80
und 140 kDa nachgewiesen werden, wobei jene bei 60 kDA (wahrscheinlich ATIP4)
die prägnanteste war. Ähnlich wie bei den Pankreaskarzinomzelllinien gab es bei der
Analyse der Blasenkrebszelllinien eine Differenzierungsgrad-assoziierte MTUS1Expression auf mRNA-Level. So hatten die Normalurothelzellline UROtsa und die gut
differenzierte Zelllinie RT4 (G1) die höchsten Expressionslevel, die mittel und
schlecht differenzierten Zelllinien BFTC905, J82 (beide G3) und RT112 (G2)
hingegen geringere Expressionslevel. Nicht ins Bild passte hierbei aber die
Expression in normalen HCV Zellen. Diese Normalurothel-Zelllinie wies die niedrigste
Menge an MTUS1-mRNA auf. Festzuhalten bleibt aber, dass alle Zelllinien MTUS1
exprimierten und es keinen Verlust zu verzeichnen gab. Beim anschließenden
Vergleich der mRNA-Expression mit der Proteinexpression mittels Westernblot war
die Bande bei ca. 80 kDa die dominanteste. Dabei handelt es sich wahrscheinlich um
ATIP2 oder ein Dimer der 38 kDa-Variante. RT4 zeigte hier auf Proteinebene die
stärkste Expression. Die ubiquitär vorkommende ATIP3 Variante fehlte hingegen in
RT4 und war auch bei allen anderen Zelllinien nur als sehr schwache Bande
detektierbar. Auffällig war außerdem auch, dass nur HCV29, J82 und UROtsa eine
Bande bei 60 kDa (ATIP4) zeigten. Die bisherigen Ergebnisse zeigen, dass sowohl in
benignen als auch malignen urothelialen Zelllinien die drei verschiedenen MTUS1-
187
Diskussion
Transkriptvarianten ATIP1, ATIP3 und ATIP4 exprimiert werden und diese somit
möglicherweise bei der Krebsentstehung eine Rolle spielen könnten.
Die initiale Untersuchung der MTUS1-mRNA-Expression in 7 Tumorproben konnte
auch eine Expression nachweisen, die ähnlich der von LNCaP oder höher war. Die
Proteinexpression war aber auch hier wieder sehr schwach. Es bleibt zu vermuten,
dass es während der Proteinbiosynthese zu einem Abbau oder einer Modifikation der
mRNA kommt, sodass diese nicht in ein funktionsfähiges Protein umgeschrieben
werden kann, bzw. nur noch wenig mRNA in das Protein translatiert wird. Eine
Möglichkeit für die Regulierung der Genexpression auf posttranslationaler Ebene
sind mikroRNAs [170]. Diese kleinen nicht-kodierenden RNAs binden an die 3’-UTR
der Zielgen-mRNA, wodurch entweder deren Translation gehemmt oder die mRNA
selbst abgebaut wird [171]. Eine in silico-Untersuchung der Sequenzen aller proteinkodierenden
Ensembl-MTUS1-mRNA-Varianten
nach
potenziellen
mikroRNA-
Bindestellen mittels miRbase konnte tatsächlich mehrere nicht-kodierende RNAs
identifizieren. Als Software-Template wurde die 3’UTR des jeweiligen Transkriptes
mit allen anzestralen SNPs eingesetzt. Die verschiedenen SNP-Varianten wurden
dabei nicht beachtet. miRbase konnte sieben mikroRNAs identifizieren, die an die
3’UTR von nahezu allen MTUS1-Transkripten binden. Lediglich MTUS1-004,
bestehend aus 4089 Basenpaaren und 1216 Aminosäuren (ATIP3b) zeigte eine ganz
andere potenzielle mikroRNA an: hsa-miR-4761-5p. Allen anderen Transkripten
wurden eine hohe Bindewahrscheinlichkeit mit den mikroRNAs hsa-miR-1277-5p (XChromosom), hsa-miR513b (X-Chromosom), hsa-miR-4511 (Chromosom 15), hsamiR-5011-3p (Chromosom 18), hsa-miR-199a-3p (Chromosom 19), hsa-miR-199b3p (Chromosom 9) und hsa-miR-450-3p (X-Chromosom) vorausgesagt. Es bestünde
die Möglichkeit, dass diese mikroRNAs im Zuge der urothelialen Karzinogenese
amplifiziert oder hochreguliert wären, somit verstärkt an die MTUS1-mRNA binden
und somit die Translation inhibieren oder drosseln könnten. Bei bestimmten Entitäten
könnten aber auch Deletionen der mikroRNA Loci zu einer verminderten Expression
der mikroRNAs und somit zu einer verstärkten MTUS1-Expression führen. In
folgenden Experimenten soll deshalb die Expression der genannten mikroRNAs
sowohl in papillären, als auch soliden Blasentumoren untersucht und mit der MTUS1Expression
korreliert
werden.
Außerdem
sollen
die
mikroRNAs
Blasenkarzinomzellen überexprimiert und funktionelle Effekte analysiert werden.
188
in
Diskussion
Doch auch andere epigenetische Veränderungen könnten eine Rolle spielen. So
könnte die Methylierung des MTUS1-Promotors zur (teilweisen) Inaktivierung des
MTUS1-Gens und damit zu einem Expressions-Verlust auf Protein-Ebene führen.
Aber auch ein, durch die (teilweise) Deletion des MTUS1-Lokus verursachter,
Gendosiseffekt wäre denkbar. So könnte eine verminderte, aber nicht gänzlich
fehlende MTUS1-Expression, eine Dosis-abhängige veränderte Wirkungsweise der
ATIPs nach sich ziehen. Interessant wäre auch herauszufinden, ob Mutationen in
MTUS1 vorliegen, die beispielsweise die Halbwertszeit von MTUS1 in der Zelle oder
die Bindefähigkeit am AT2-Rezeptor verändern. In zukünftigen Experimenten soll
deshalb eine Methylierungsanalyse mittels MSP und Promotorsequenzierung, sowie
eine mtus1-Mutationsanalyse bei Blasenkrebszelllinine und in Blasentumoren aller
Varianten durchgeführt werden.
Unsere bereits durchgeführten funktionellen Zellkulturversuche bestätigten die
Vermutung, dass MTUS1 tumorsuppressive Eigenschaften aufweist. Durch die
Überexpression in RT112 wurde die Viabilität, die Migration und in geringem Maße
auch die Proliferation herabgesetzt.
Um die Expressionsanalyse von MTUS1 in Tumorgewebe zu validieren, wurden zwei
große Blasenkrebskohorten auf die Expression von MTUS1 untersucht: ein Kollektiv
bestehend aus lediglich biologisch weniger aggressiven papillären Tumoren und ein
Kollektiv
mit
fortgeschrittenen
und
folglich
biologisch
aggressiveren
Blasenkrebstumoren inklusive seltener Varianten. Bei den analysierten papillären
Tumoren zeigte sich, dass die Hälfte aller Tumoren die Expression von MTUS1
verloren hatte. Eine Assoziation mit Überleben und Progression konnte jedoch nicht
festgestellt werden. Unsere Vermutung, dass es sich bei MTUS1 um einen neuen
Progressionsmarker für das papilläre Harnblasenkarzinom handelt, konnte nicht
bestätigt werden. Stattdessen konnten wir aber ein sehr interessantes Phänomen
aufdecken, was noch für keine weitere Krebsentität in Zusammenhang mit MTUS1Expression beobachtet wurde. Eine MTUS1-Expression ging in den papillären
Tumoren jeweils mit höherem Stage und Grade, sowie mit einer aberranten Ki67 und
CK20 Expression und geringerer Mutationsfrequenz in FGFR3 einher. Das würde
bedeuten, dass Tumoren mit MTUS1-Expression ein höheres malignes Potential
aufweisen, als Tumoren mit MTUS1-Verlust. Dies widerspricht allen bisherigen
Studien zur MTUS1 Expression in menschlichen Zellen. Bisher konnten nur
189
Diskussion
Korrelationen des MTUS1-Verlustes mit gesteigerter Proliferation und schlechterer
Differenzierung beobachtet werden [125, 172].
Interessant war dann der Vergleich zu der Gruppe der fortgeschrittenen und teilweise
seltenen Varianten der Harnblasenkarzinome. Hierbei konnten wir eine eindeutige
Assoziation mit dem Gesamt- und dem tumorspezifischen Überleben nachweisen.
Die Tumoren, die MTUS1 exprimiert hatten, zeigten ein signifikant besseres
Überleben als Tumoren mit Expressionsverlust. Diese Beobachtung passte auch
wieder zu den Ergebnissen aus Studien zum Pankreas-, Kolon-, Brust- und
Prostatakarzinom, in denen eine eindeutige Korrelation zwischen MTUS1-Verlust und
erhöhtem malignen Potenzial beobachtet wurde [123, 125, 126, 128].
Die Ergebnisse geben aber erneute Hinweise auf die immer plausibler scheinende
Vermutung, dass es sich bei der Karzinogenese des Urothelkarzinoms um zwei
verschiedene molekular Entstehungswege mit unterschiedlichen biologischen
Funktionen und unterschiedlichem malignem Potenzial handelt [173]. So scheinen
sich die papillären von den soliden Tumoren auch hinsichtlich der MTUS1Expression und der damit verbundenen Funktionen in der Zelle bzw. der involvierten
Signalkaskaden zu unterscheiden.
Um die Rolle von MTUS1/ATIP bei der Entstehung und Progression des
Urothelkarzinoms der Harnblase besser verstehen zu können, ist es essentiell den
biologischen Wirkmechanismus in der Zelle, sowie alle beteiligten Signalwege zu
charakterisieren.
Eine
Unterscheidung
zwischen
papillärem
und
solidem
Entstehungsweg und eine möglicherweise konträre Funktion von MTUS1/ATIP in
beiden Wegen sollte in Erwägung gezogen werden. In der Literatur wird sowohl die
biologische Funktion von MTUS1/ATIP als auch die des Angiotensin II AT2 Rezeptors
kontrovers diskutiert und ist auch noch nicht gänzlich aufgeklärt. Verschiedene
Studien sind sich aber einig, dass ATIP einen wichtigen und regulierenden
Bindungspartner des AT2, nicht aber des AT1-Rezeptors des Renin-AngiotensinAldosteron-Systems (RAAS) darstellt [174, 175].
Die beiden transmembranen Rezeptoren AT1 und AT2 sind zwei wichtige
Bestandteile des RAAS und fugieren beide als Rezeptoren für den OktapeptidLiganden Angiotensin II. Beim AT1-Rezeptor handelt es sich um einen klassischen GProtein-gekoppelten Rezeptor, der die meisten physiologischen Effekte von
Angiotensin II vermittelt und dessen Wirkungsweise schon sehr gut charakterisiert ist
[176]. Die Aktivierung des AT1-Rezeptors durch die Bindung von Angiotensin II
190
Diskussion
bewirkt vor allem eine Kontraktion von Blutgefäßen, sowie eine, durch eine
Konstriktion der efferenten Blutgefäße bedingte, Konstanthaltung der glomerulären
Filtrationsrate der Niere. In der Nebenniere stimuliert Angiotensin II die Aldosteronund Adrenalin-Freisetzung und in der Hypophyse eine Freisetzung von Vasopressin.
Auch das Durstgefühl wird auf eine akute Stimulation von AT1-Rezeptoren im
Hypothalamus zurückgeführt. Eine chronische Stimulation des AT1-Rezeptors führt
hingegen zu einer Stimulation mitogener Effekte und somit beispielsweise zur
Hypertrophie des Herzes [177]. Neben der Beeinflussung von Blutdruck und
Wasserhaushalt wird dem RAAS aber auch eine wichtige Rolle bei anderen
physiologischen Prozessen, wie der Gehirnfunktion, der Gewebe-Remodellierung
und
eben
auch
Tumor-assoziierten
Prozessen
(wie
Zellzyklus,
Apoptose,
Proliferation, Migration, etc.) zugeordnet [178, 179].
MTUS1 bzw. ATIP fungiert also als Interaktionspartner des Angiotensin II AT2Rezeptors des RAAS. Die Bindung des Liganden, Angiotensin II, an den Angiotensin
AT2 Rezeptor führt einerseits zu einem negativem Feedback der Angiotensin AT1Rezeptor-Aktivierung (siehe oben) und andererseits zu anti-proliferativen, antimigratorischen und anti-inflammatorischen Antworten in der Zelle. Die Bindung von
ATIP an den Rezeptor imitiert den inhibitorschen Effekt des Rezeptors auf
Zellproliferation,
RTK-Aktivierung,
ERK-Phosphorylierung
und
steigert
den
wachstums-inhibitorischen Effekt von AT2 nach Angiotensin II-Stimulation zugleich
noch weiter [180]. Louis et al konnten zeigen, dass eine Herunterregulation von ATIP
in den Prostatakarzinom-Zelllininen LNCaP bzw. PC3 zu einer um 30% höheren
DNA-Syntheserate bzw. gesteigerter Proliferation in den Zellen führte. Nach
Überexpression in PC3 konnte eine verringerte Menge an phosphoryliertem ERK2,
sowie
verlangsamtes Wachstum beobachtet werden. Außerdem führte die
Stimulation der Zellen mit EGF zu einer verminderten Expression von MTUS1/ATIP
mRNA. Dieser Effekt konnte aber durch die Gabe von Angiotensin II wieder inhibiert
werden [128]. Dies lässt vermuten, dass es bei der Angiotensin II-AT2-ATIPInteraktion einen Crosstalk mit dem MAP-Kinase-Signalweg gibt und dieser vor allem
das Zellwachstum über die Komponenten EGF bzw. ERK2 beeinflusst. Auch Nouet
et al konnten zeigen dass murines ATIP1 die Phosphorylierung der extracellular
signal-related kinase 2 (ERK2), des klassischen MAP-Kinase-Weges vermindert, falls
diese durch Insulin und die Wachstumsfaktoren bFGF (basic fibroblast growth factor)
und EGF (epidermal growth factor) stimuliert worden waren. Des Weiteren hemmte
191
Diskussion
das transient transfizierte mATIP1 die Proliferation von CHO-AT2-Klonen und
Gefäßmuskelzellen der Ratte, falls diese vorher mit fetalem Kälberserum, EGF,
PDGF (platelet-derived growth factor) und bFGF induziert wurden. Diese Effekte
setzen lediglich die Expression des Angiotensin II AT2-Rezeptors, nicht aber dessen
Liganden-Aktivierung voraus. Durch Anwesenheit und Bindung von Angiotensin II
wurde die wachstums-inhibitorische Signalkaskade jedoch noch verstärkt [167].
Neben der Fähigkeit von ATIP, durch die Bindung des AT2-Rezeptors diesen zu
aktivieren, könnten die ATIPs aber auch eine wichtige Rolle bei der Rezeptor-Homooder Hetero-Dimerisierung bzw. bei der Liganden-unabhängigen Rezeptoraktivierung
spielen [181].
In zukünftigen Experimenten soll unter anderem überprüft werden, ob es durch das
siRNA-vermittelte Gensilencing von MTUS1 in UROtsa oder RT4 zu einer Steigerung
des malignen Potentials (Proliferation, Migration, Viabilität) kommt. Außerdem sollen
Effekte auf die Apoptose nach Überexpression und nach Knockdown mittels siRNA
untersucht werden. Es scheint auch sehr wichtig zu sein, die verschiedenen
Transkriptvarianten von ATIP mittels spezifischen Antikörpern in normalem Urothel,
sowie
in
Urothelkarzinomzelllininen
und
–gewebe
genau
zu
analysieren.
Möglicherweise spielt die veränderte Expression von einer oder mehreren
Trankskriptvarianten eine entscheidende Rolle bei der Karzinogenese. Es ist auf
jeden Fall wichtig MTUS1 nicht isoliert als ein oder das MTUS1 Protein zu sehen.
Vielmehr müssen alle Transkripte, sowohl einzeln als auch in Hinblick auf eine
mögliche Interaktion oder gemeinsame Wirkungsweise bei der Karzinogenese des
humanen Urothels untersucht werden. Es ist deshalb essentiell sowohl auf mRNAEbene, als auch auf Proteinlevel die Expression aller Transkriptvarianten in
Harnblasentumoren zu überprüfen. Des Weiteren soll untersucht werden, ob der AT2Rezeptor überhaupt in Tumoren exprimiert wird und somit als potenzieller
Bindungspartner in Frage käme. Interessant wäre dabei auch die Einbeziehung von
Protein-Protein-Interaktions-Studien, vor allem zwischen den verschiedenen ATIPVarianten und dem AT2-Rezeptor, in zukünftigen Experimenten.
Neben der weiteren Untersuchung von MTUS1 sollte der Fokus auch auf weitere
durch die aCGH identifizierte potenzielle Progressions-assoziierte Gene gelegt
werden. So sollen beispielsweise auch UNC5D, SLC7A2, PDGFRL, FGL1 oder
192
Diskussion
PCM1 in funktionellen Zellkulturexperimenten sowie in prospektiven Studien
analysiert werden.
Schlußfolgerung und Ausblick:
In der hier vorliegenden Arbeit wurde ein Versuch unternommen, Gene auf
Chromosom
8p
Risikoabschätzung
zu
identifizieren
beim
und
papillären
zu
charakterisieren,
Urothelkarzinom
der
die
bei
Harnblase
der
eine
entscheidende Rolle spielen könnten. Sowohl SFRP1, als auch MTUS1 sind als
Tumorsuppressorgene bekannt und häufig durch Deletionen auf 8p bei Blasenkrebs
betroffen. Doch keines der beiden Gene konnte als verlässlicher prognostischer und
progressions-assoziierter Marker bestätigt werden. Beide Gene scheinen zwar
wichtige Funktionen in den Tumorzellen zu erfüllen und auch für eine Subgruppe von
papillären Tumoren eine Aussagekraft zu besitzen, aber die Aussagekraft ist in
beiden Fällen nicht eindeutig genug, um sie für eine Anwendung in der
Routinediagnostik vorzuschlagen. Dennoch ist es wichtig den biologischen
Wirkungsmechanismus und die involvierten Signalwege der beiden Proteine in der
Zelle restlos aufzuklären.
Möglicherweise liefert der Genotyp des SFRP1 SNP rs3242 wichtige Informationen
über das Erkrankungsalter und damit häufig verknüpften seltenen und aggressiven
Varianten von Blasenkrebs. Um eine Assoziation mit der hsa-miR-3646 zu
bestätigen, soll in geplanten Experimenten die Auswirkung der hsa-miR-3646
Überexpression in Blasenkarzinomzelllinien funktionell untersucht werden. Falls sich
bestätigen sollte, dass die mikroRNA als Onkogen fungiert und die Expression des
Tumorsuppressors SFRP1 reprimiert, könnte die Möglichkeit einer anti-hsa-miR3646-Therapie in Erwägung gezogen werden. Es wäre denkbar, die betreffenden
mikroRNA mittels Sequenz-spezifischer silencerRNAs aus den Urothelzellen zu
eliminieren und so den Krankheitsausbruch zu verhindern oder zu verzögern.
Außerdem sollte weiter hinterfragt werden, welcher Signalweg für die funktionellen
Effekte der SFRP1-Überexpression verantwortlich ist. Es ist unter anderem geplant,
eine
Involvierung
und
Aktivität
des
nicht-kanonischen
Signalweges
mittels
Luziferase-basiertem Assay in papillären Zelllinien zu untersuchen.
Doch auch MTUS1 sollte in zukünftigen Experimenten weiter charakterisiert werden.
Vor allem in Hinblick auf Patientenkohorten mit fortgeschrittenen Blasenkarzinomen
sollte eine Validierung mit großen Studienkollektiven vorgenommen werden um die
193
Diskussion
Funktion als prognostischen Marker zu bestätigen. Möglicherweise kann MTUS1 als
zusätzlicher
prognostischer
Marker
beim
fortgeschrittenen
Urothelkarzinom
Anwendung finden.
Doch auch im papillären Urothelkarzinom sollte abgeklärt werden, warum es hier
durch den Verlust des vermeintlichen Tumorsuppressors zu einer Erhöhung des
malignen Potentials, aber nicht zu einer Beeinflussung des Überlebens und der
Progression kommt. So soll MTUS1 mittels siRNA in papillären und fortgeschrittenen
Harnblasenkarzinomzellen
herunterreguliert
und
funktionelle
Effekte,
sowie
Auswirkungen auf den AT2-Rezeptor-Signalweg des RAS analysiert werden.
Außerdem sollen wie schon weiter oben erwähnt Methylierungsanalysen des
MTUS1-Promotors, sowie Mutationsanalysen im MTUS1-Gen durchgeführt werden.
Ziel unserer zukünftigen Experimente und Studien wird bleiben, die biologischen
Mechanismen der Karzinogenese des Urothelkarzinoms der Harnblase weiter zu
erforschen und zur deren Klärung maßgeblich beizutragen. Außerdem soll weiterhin
nach molekularen Markergenen gesucht werden, die zu einer Erleichterung der
Risikoeinschätzung von Blasenkrebspatienten, vor allem in Hinblick auf Progression
und Prognose, beitragen können. Dabei soll der Schwerpunkt auf genetischen
Veränderungen zwischen nicht-invasiven und minimal-invasiven, aber auch zwischen
nicht-muskelinvasiven und fortgeschrittenen, muskel-invasiven Tumoren liegen.
194
Zusammenfassung
5
Zusammenfassung
Bisher fehlen noch immer verlässliche prognostische und progressions-relevante
Marker für das papilläre Urothelkarzinom der Harnblase, um eine bessere
Risikoabschätzung für den Patienten zu gewährleisten. In der hier vorliegenden
Arbeit wurde deshalb ein vielversprechender Marker auf Chromosom 8p12, SFRP1,
funktionell in papillären Harnblasenkarzinomlinien untersucht, sowie in einer
prospektiven Studie papillärer Tumoren validiert. Außerdem wurde der Einfluss von
SFRP1
auch
in
fortgeschrittenen
Tumoren
untersucht.
Um
auch
evolutionsbiologische Faktoren in die individuelle Risikoabschätzung zu involvieren,
wurden außerdem zwei SNPs in SFRP1, rs3242 und rs921142, in zwei großen
Blasenkrebskohorten analysiert und mit der gesunden Kontrollgruppe verglichen. Es
zeigte sich, dass SFRP1 das maligne Potential (z.B. Migration und Viabilität) in
BFTC905 verringern konnte, der kanonische Wnt-Signalweg aber scheinbar nicht
den biologischen Mechanismus dahinter darstellt. Das Gesamtüberleben der
Patienten mit papillären Tumoren wurde maßgeblich, wenn auch nicht signifikant,
durch SFRP1 beeinflusst. Patienten mit SFRP1-Expression lebten länger. Eine
Assoziation mit der Progression konnte aber nicht nachgewiesen werden. Bei
fortgeschrittenen Blasenkarzinomen spielte SFRP1 keine Rolle.
Der SFRP1-SNP rs3242 beeinflusste das Risiko von Patienten, die im Altern von ≤45
Jahren an Blasenkrebs erkrankten, maßgeblich. Bei der Gruppe der Erkrankten
konnte ein signifikant gehäuftes Auftreten des Risikoallels T beobachtet werden. Eine
Erklärung hierfür könnte die verstärkte Expression der mikroRNA-3646 bei jungen
Blasenkrebspatienten sein. Diese bindet möglicherweise SFRP1 im Bereich des
rs3242-SNPs und beeinflusst so die mRNA-Stabilität. Der SNP rs921142 hatte
keinen Einfluss auf das Erkrankungsrisiko. Diese Studie war, nach unserem
Kenntnisstand die erste, die eine Assoziation von SNPs in SFRP1 bei Krebs
untersuchte.
Neben der Untersuchung von SFRP1, sollten auch andere Kandidatengene auf
Chromosom 8p identifiziert werden, die zu einer individuellen Risikoabschätzung
beim nicht-invasiven, papillären Urothelkarzinom beitragen könnten. Dazu wurden 9
pTa und 10 papilläre pT1-Blasentumoren mittels Array-basierter genomischer
Hybridisierung (aCGH) verglichen. Dieses hochauflösende Deletionsmapping konnte
verschiedenen Zielregionen in pTa-Tumoren identifizieren, in denen Mikrodeletionen
195
Zusammenfassung
auf Chromosom 8p aufgetreten waren und in denen mögliche Kandidatengene
lokalisiert sind. Betroffene Gene waren unter anderem SLC7A2, PDGFL, MTUS1,
FGL1, PCM1, UNC5D und GFRA. MTUS1, der microtubule-associated tumor
suppressor 1, auf 8p22 wurde anschließend für weitere Analysen ausgewählt und
sowohl funktionell in Zelllinien, als auch prospektivisch in den verschiedenen
Blasenkrebskohorten untersucht. Ähnlich wie bei SFRP1 konnte gezeigt werden,
dass MTUS1 das maligne Potential in einer Blasenkrebszelllinien, RT112,
herabsetzte. Bei papillären Tumoren konnte hingegen keine Assoziation mit dem
Überleben und der Progression beobachtet werden. Es bestand aber eine inverse
Korrelation zwischen MTUS1-Expression und den histopathologischen Parametern
Grade, Stage, sowie mit der Ki67 und CK20-Expression. MTUS1 scheint das maligne
Potential in papillären Tumoren zu erhöhen. In fortgeschrittenen Tumoren, hingegen
wirkt MTUS1 scheinbar als klassischer Tumorsuppressor: ein Expressionsverlust
ging mit einem schlechteren Gesamt- und tumorspezifischen Überleben einher.
196
Literaturverzeichnis
6
Literaturverzeichnis
1.
e.V., R.K.I.R.u.G.d.e.K.i.D., Krebs in Deutschland 2005/2006. Häufigkeiten und
Trends. Vol. 7. 2010, Berlin, p. 84-87
Ferlay, J., D.M. Parkin, and E. Steliarova-Foucher, Estimates of cancer incidence and
mortality in Europe in 2008. Eur J Cancer, 2010. 46(4): p. 765-81.
Bostrom, P.J., et al., Sex differences in bladder cancer outcomes among smokers
with advanced bladder cancer. BJU Int, 2011.
Castelao, J.E., et al., Gender- and smoking-related bladder cancer risk. J Natl Cancer
Inst, 2001. 93(7): p. 538-45.
Brennan, P., et al., Cigarette smoking and bladder cancer in men: a pooled analysis
of 11 case-control studies. Int J Cancer, 2000. 86(2): p. 289-94.
(IARC), I.A.f.R.o.C., Monographs on the evaluation of carcinogenic risks on humans.
Tobacco smoke and involutary smoking. Vol. 83. 2004: World Health Organisation.
Hecht, S.S., Cigarette smoking: cancer risks, carcinogens, and mechanisms.
Langenbecks Arch Surg, 2006. 391(6): p. 603-13.
Freedman, N.D., et al., Association between smoking and risk of bladder cancer
among men and women. JAMA, 2011. 306(7): p. 737-45.
Dietrich, H. and B. Dietrich, Ludwig Rehn (1849-1930)--pioneering findings on the
aetiology of bladder tumours. World J Urol, 2001. 19(2): p. 151-3.
Clapp, R.W., M.M. Jacobs, and E.L. Loechler, Environmental and occupational
causes of cancer: new evidence 2005-2007. Rev Environ Health, 2008. 23(1): p. 137.
Jankovic, S. and V. Radosavljevic, Risk factors for bladder cancer. Tumori, 2007.
93(1): p. 4-12.
Tanguay, C., et al., Leiomyosarcoma of urinary bladder following cyclophosphamide
therapy: report of two cases. Mod Pathol, 2003. 16(5): p. 512-4.
Murta-Nascimento, C., et al., Epidemiology of urinary bladder cancer: from tumor
development to patient's death. World J Urol, 2007. 25(3): p. 285-95.
Botelho, M.C., J.C. Machado, and J.M. da Costa, Schistosoma haematobium and
bladder cancer: what lies beneath? Virulence, 2010. 1(2): p. 84-7.
Fried, B., A. Reddy, and D. Mayer, Helminths in human carcinogenesis. Cancer Lett,
2011. 305(2): p. 239-49.
Grossfeld, G.D., et al., Asymptomatic microscopic hematuria in adults: summary of
the AUA best practice policy recommendations. Am Fam Physician, 2001. 63(6): p.
1145-54.
Khadra, M.H., et al., A prospective analysis of 1,930 patients with hematuria to
evaluate current diagnostic practice. J Urol, 2000. 163(2): p. 524-7.
Tanaka, M.F. and G. Sonpavde, Diagnosis and management of urothelial carcinoma
of the bladder. Postgrad Med, 2011. 123(3): p. 43-55.
De Dominicis, C., et al., Role of 5-aminolevulinic acid in the diagnosis and treatment
of superficial bladder cancer: improvement in diagnostic sensitivity. Urology, 2001.
57(6): p. 1059-62.
Bubendorf, L., P. Dalquen, and S. Savic, [Cytology of the urinary tract: Between
uncertainty and clarity]. Pathologe, 2009. 30 Suppl 2: p. 173-8.
Lotan, Y. and C.G. Roehrborn, Sensitivity and specificity of commonly available
bladder tumor markers versus cytology: results of a comprehensive literature review
and meta-analyses. Urology, 2003. 61(1): p. 109-18; discussion 118.
Budman, L.I., W. Kassouf, and J.R. Steinberg, Biomarkers for detection and
surveillance of bladder cancer. Can Urol Assoc J, 2008. 2(3): p. 212-21.
Bubendorf, L., et al., Multiprobe FISH for enhanced detection of bladder cancer in
voided urine specimens and bladder washings. Am J Clin Pathol, 2001. 116(1): p. 7986.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
197
Literaturverzeichnis
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
Irani, J., et al., BTA stat and BTA TRAK: A comparative evaluation of urine testing for
the diagnosis of transitional cell carcinoma of the bladder. Eur Urol, 1999. 35(2): p.
89-92.
Kundal, V.K., et al., Role of NMP22 Bladder Check Test in early detection of bladder
cancer with recurrence. Asian Pac J Cancer Prev, 2010. 11(5): p. 1279-82.
Dey, P., Urinary markers of bladder carcinoma. Clin Chim Acta, 2004. 340(1-2): p. 5765.
Eltz, S., et al., Molecular and histological markers in urothelial carcinomas of the
upper urinary tract. BJU Int, 2008. 102(5): p. 532-5.
Schroeder, G.L., et al., A side by side comparison of cytology and biomarkers for
bladder cancer detection. J Urol, 2004. 172(3): p. 1123-6.
Sobin L.H., Gospodarowicz M., Wittekind C. TNM. Classification of Malignant
Tumors. 2009, New York: UICC, p. 246-249
Eble J.N., Sauter G., Epstein J.I., Sesterhenn I.A., editors, World Health Organisation
Classification of Tumours. Pathology and Genetics: Tumours of the Urinary System
and Male Genital Organs. 2004, Lyon, France: IARC Press, p. 110-123
Mostofi F.K., International Histological Classification of Tumors. Histological Typing of
Urinary Bladder Tumors. Vol. No. 10. 1973, Geneva: Springer.
Tuna, B., et al., Histologic grading of urothelial papillary neoplasms: impact of
combined grading (two-numbered grading system) on reproducibility. Virchows Arch,
2011. 458(6): p. 659-64.
Retz, M., et al., [The latest news on bladder cancer]. Urologe A, 2007. 46(7): p. 7278, 730-2.
Otto, W., et al., The WHO classification of 1973 is more suitable than the WHO
classification of 2004 for predicting survival in pT1 urothelial bladder cancer. BJU Int,
2011. 107(3): p. 404-8.
Stöhr R, H.A., Histopathologie und Molekulargenetik des Harnblasenkarzinoms.
Onkologe, 2007. 13: p. 1058-1066.
Dalbagni, G., The management of superficial bladder cancer. Nat Clin Pract Urol,
2007. 4(5): p. 254-60.
Babjuk, M., et al., EAU guidelines on non-muscle-invasive urothelial carcinoma of the
bladder, the 2011 update. Eur Urol, 2011. 59(6): p. 997-1008.
Volpe, A., et al., Mitomycin C for the treatment of bladder cancer. Minerva Urol Nefrol,
2010. 62(2): p. 133-44.
Manoharan, M., Intravesical therapy for urothelial carcinoma of the bladder. Indian J
Urol, 2011. 27(2): p. 252-61.
Feifer, A.H., et al., Maximizing cure for muscle-invasive bladder cancer: integration of
surgery and chemotherapy. Eur Urol, 2011. 59(6): p. 978-84.
Knuchel, R., et al., [Precancerous lesions of the urothelium. From Feulgen staining to
single cell CGH]. Pathologe, 2008. 29(5): p. 364-70.
Luis, N.M., E. Lopez-Knowles, and F.X. Real, Molecular biology of bladder cancer.
Clin Transl Oncol, 2007. 9(1): p. 5-12.
Devlin, J., A.J. Keen, and M.A. Knowles, Homozygous deletion mapping at 9p21 in
bladder carcinoma defines a critical region within 2cM of IFNA. Oncogene, 1994. 9(9):
p. 2757-60.
van Rhijn, B.W., et al., The fibroblast growth factor receptor 3 (FGFR3) mutation is a
strong indicator of superficial bladder cancer with low recurrence rate. Cancer Res,
2001. 61(4): p. 1265-8.
Cordon-Cardo, C., Molecular alterations associated with bladder cancer initiation and
progression. Scand J Urol Nephrol Suppl, 2008(218): p. 154-65.
De, A., Wnt/Ca2+ signaling pathway: a brief overview. Acta Biochim Biophys Sin
(Shanghai), 2011.
Nusslein-Volhard, C. and E. Wieschaus, Mutations affecting segment number and
polarity in Drosophila. Nature, 1980. 287(5785): p. 795-801.
198
Literaturverzeichnis
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
Nusse, R. and H.E. Varmus, Many tumors induced by the mouse mammary tumor
virus contain a provirus integrated in the same region of the host genome. Cell, 1982.
31(1): p. 99-109.
Nelson, W.J. and R. Nusse, Convergence of Wnt, beta-catenin, and cadherin
pathways. Science, 2004. 303(5663): p. 1483-7.
Kawano, Y. and R. Kypta, Secreted antagonists of the Wnt signalling pathway. J Cell
Sci, 2003. 116(Pt 13): p. 2627-34.
Moon, R.T., et al., WNT and beta-catenin signalling: diseases and therapies. Nat Rev
Genet, 2004. 5(9): p. 691-701.
Loughlin, J., et al., Functional variants within the secreted frizzled-related protein 3
gene are associated with hip osteoarthritis in females. Proc Natl Acad Sci U S A,
2004. 101(26): p. 9757-62.
Konigshoff, M., et al., Functional Wnt signaling is increased in idiopathic pulmonary
fibrosis. PLoS One, 2008. 3(5): p. e2142.
Miyaoka, T., H. Seno, and H. Ishino, Increased expression of Wnt-1 in schizophrenic
brains. Schizophr Res, 1999. 38(1): p. 1-6.
Klaus, A. and W. Birchmeier, Wnt signalling and its impact on development and
cancer. Nat Rev Cancer, 2008. 8(5): p. 387-98.
Bodmer, W.F., et al., Genetic analysis of colorectal cancer. Princess Takamatsu
Symp, 1989. 20: p. 49-59.
Senda, T., A. Shimomura, and A. Iizuka-Kogo, Adenomatous polyposis coli (Apc)
tumor suppressor gene as a multifunctional gene. Anat Sci Int, 2005. 80(3): p. 12131.
Hu, J., et al., Blockade of Wnt signaling inhibits angiogenesis and tumor growth in
hepatocellular carcinoma. Cancer Res, 2009. 69(17): p. 6951-9.
Wei, W., et al., Blockade of Wnt-1 signaling leads to anti-tumor effects in
hepatocellular carcinoma cells. Mol Cancer, 2009. 8: p. 76.
Polakis, P., Wnt signaling and cancer. Genes Dev, 2000. 14(15): p. 1837-51.
Stoehr, R., et al., No evidence for involvement of beta-catenin and APC in urothelial
carcinomas. Int J Oncol, 2002. 20(5): p. 905-11.
Thievessen, I., et al., E-cadherin involved in inactivation of WNT/beta-catenin
signalling in urothelial carcinoma and normal urothelial cells. Br J Cancer, 2003.
88(12): p. 1932-8.
Rieger-Christ, K.M., et al., Restoration of plakoglobin expression in bladder
carcinoma cell lines suppresses cell migration and tumorigenic potential. Br J Cancer,
2005. 92(12): p. 2153-9.
Marsit, C.J., et al., Epigenetic inactivation of SFRP genes and TP53 alteration act
jointly as markers of invasive bladder cancer. Cancer Res, 2005. 65(16): p. 7081-5.
Urakami, S., et al., Epigenetic inactivation of Wnt inhibitory factor-1 plays an
important role in bladder cancer through aberrant canonical Wnt/beta-catenin
signaling pathway. Clin Cancer Res, 2006. 12(2): p. 383-91.
Jensen, T.J., et al., Epigenetic mediated transcriptional activation of WNT5A
participates in arsenical-associated malignant transformation. Toxicol Appl
Pharmacol, 2009. 235(1): p. 39-46.
Costa, V.L., et al., Epigenetic regulation of Wnt signaling pathway in urological
cancer. Epigenetics, 2010. 5(4): p. 343-51.
Ahmad, I., et al., Ras mutation cooperates with beta-catenin activation to drive
bladder tumourigenesis. Cell Death Dis, 2011. 2: p. e124.
Shin, K., et al., Hedgehog/Wnt feedback supports regenerative proliferation of
epithelial stem cells in bladder. Nature, 2011. 472(7341): p. 110-4.
Fukuhara, K., et al., Secreted frizzled related protein 1 is overexpressed in uterine
leiomyomas, associated with a high estrogenic environment and unrelated to
proliferative activity. J Clin Endocrinol Metab, 2002. 87(4): p. 1729-36.
Foronjy, R., et al., The divergent roles of secreted frizzled related protein-1 (SFRP1)
in lung morphogenesis and emphysema. Am J Pathol, 2010. 177(2): p. 598-607.
199
Literaturverzeichnis
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
Wang, W.H., et al., Increased expression of the WNT antagonist sFRP-1 in glaucoma
elevates intraocular pressure. J Clin Invest, 2008. 118(3): p. 1056-64.
Dahl, E., et al., Frequent loss of SFRP1 expression in multiple human solid tumours:
association with aberrant promoter methylation in renal cell carcinoma. Oncogene,
2007. 26(38): p. 5680-91.
Veeck, J., et al., Aberrant methylation of the Wnt antagonist SFRP1 in breast cancer
is associated with unfavourable prognosis. Oncogene, 2006. 25(24): p. 3479-88.
Ugolini, F., et al., WNT pathway and mammary carcinogenesis: loss of expression of
candidate tumor suppressor gene SFRP1 in most invasive carcinomas except of the
medullary type. Oncogene, 2001. 20(41): p. 5810-7.
Takada, T., et al., Methylation-associated silencing of the Wnt antagonist SFRP1
gene in human ovarian cancers. Cancer Sci, 2004. 95(9): p. 741-4.
Tanaka, J., et al., Silencing of secreted frizzled-related protein genes in MSI
colorectal carcinogenesis. Hepatogastroenterology, 2008. 55(85): p. 1265-8.
Suzuki, H., et al., A genomic screen for genes upregulated by demethylation and
histone deacetylase inhibition in human colorectal cancer. Nat Genet, 2002. 31(2): p.
141-9.
Caldwell, G.M., et al., The Wnt antagonist sFRP1 in colorectal tumorigenesis. Cancer
Res, 2004. 64(3): p. 883-8.
Shih, Y.L., et al., SFRP1 suppressed hepatoma cells growth through Wnt canonical
signaling pathway. Int J Cancer, 2007. 121(5): p. 1028-35.
Gumz, M.L., et al., Secreted frizzled-related protein 1 loss contributes to tumor
phenotype of clear cell renal cell carcinoma. Clin Cancer Res, 2007. 13(16): p. 47409.
Stoehr, R., et al., Deletions of chromosome 8p and loss of sFRP1 expression are
progression markers of papillary bladder cancer. Lab Invest, 2004. 84(4): p. 465-78.
Urakami, S., et al., Combination analysis of hypermethylated Wnt-antagonist family
genes as a novel epigenetic biomarker panel for bladder cancer detection. Clin
Cancer Res, 2006. 12(7 Pt 1): p. 2109-16.
Neuhausen, A., et al., DNA methylation alterations in urothelial carcinoma. Cancer
Biol Ther, 2006. 5(8): p. 993-1001.
Sun, J., et al., Hypermethylated SFRP1, but none of other nine genes "informative"
for western countries, is valuable for bladder cancer detection in Mainland China. J
Cancer Res Clin Oncol, 2009. 135(12): p. 1717-27.
Serizawa, R.R., et al., Integrated genetic and epigenetic analysis of bladder cancer
reveals an additive diagnostic value of FGFR3 mutations and hypermethylation
events. Int J Cancer, 2011. 129(1): p. 78-87.
Chen, P.C., et al., Distinct DNA methylation epigenotypes in bladder cancer from
different Chinese sub-populations and its implication in cancer detection using voided
urine. BMC Med Genomics, 2011. 4: p. 45.
Nusbaum, C., et al., DNA sequence and analysis of human chromosome 8. Nature,
2006. 439(7074): p. 331-5.
Tabares-Seisdedos, R. and J.L. Rubenstein, Chromosome 8p as a potential hub for
developmental neuropsychiatric disorders: implications for schizophrenia, autism and
cancer. Mol Psychiatry, 2009. 14(6): p. 563-89.
Yen, C.C., et al., Chromosomal aberrations of malignant pleural effusions of lung
adenocarcinoma: different cytogenetic changes are correlated with genders and
smoking habits. Lung Cancer, 2007. 57(3): p. 292-301.
Shen, H., et al., Genomic alterations in lung adenocarcinomas detected by multicolor
fluorescence in situ hybridization and comparative genomic hybridization. Cancer
Genet Cytogenet, 2008. 181(2): p. 100-7.
Hughes, S., et al., Meta-analysis and pooled re-analysis of copy number changes in
colorectal cancer detected by comparative genomic hybridization. Anticancer Res,
2006. 26(5A): p. 3439-44.
200
Literaturverzeichnis
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
Sanjmyatav, J., J. Schubert, and K. Junker, Comparative study of renal cell
carcinoma by CGH, multicolor-FISH and conventional cytogenic banding analysis.
Oncol Rep, 2005. 14(5): p. 1183-7.
Emi, M., et al., Frequent loss of heterozygosity for loci on chromosome 8p in
hepatocellular carcinoma, colorectal cancer, and lung cancer. Cancer Res, 1992.
52(19): p. 5368-72.
Wolff, E.M., G. Liang, and P.A. Jones, Mechanisms of Disease: genetic and
epigenetic alterations that drive bladder cancer. Nat Clin Pract Urol, 2005. 2(10): p.
502-10.
A haplotype map of the human genome. Nature, 2005. 437(7063): p. 1299-320.
Brookes, A.J., The essence of SNPs. Gene, 1999. 234(2): p. 177-86.
Stephens, J.C., Single-nucleotide polymorphisms, haplotypes, and their relevance to
pharmacogenetics. Mol Diagn, 1999. 4(4): p. 309-17.
Altshuler, D.M., et al., Integrating common and rare genetic variation in diverse
human populations. Nature, 2010. 467(7311): p. 52-8.
Samson, M., et al., Resistance to HIV-1 infection in caucasian individuals bearing
mutant alleles of the CCR-5 chemokine receptor gene. Nature, 1996. 382(6593): p.
722-5.
Rubinsztein, D.C. and D.F. Easton, Apolipoprotein E genetic variation and
Alzheimer's disease. a meta-analysis. Dement Geriatr Cogn Disord, 1999. 10(3): p.
199-209.
Sims, A.M., et al., Genetic analyses in a sample of individuals with high or low BMD
shows association with multiple Wnt pathway genes. J Bone Miner Res, 2008. 23(4):
p. 499-506.
Ohnaka, K., et al., Association of single nucleotide polymorphisms in secreted
frizzled-related protein 1 gene with bone mineral density in Japanese women. Geriatr
Gerontol Int, 2009. 9(3): p. 304-9.
Lehmann, J., et al., Adjuvant cisplatin plus methotrexate versus methotrexate,
vinblastine, epirubicin, and cisplatin in locally advanced bladder cancer: results of a
randomized, multicenter, phase III trial (AUO-AB 05/95). J Clin Oncol, 2005. 23(22):
p. 4963-74.
Masters, J.R., et al., Tissue culture model of transitional cell carcinoma:
characterization of twenty-two human urothelial cell lines. Cancer Res, 1986. 46(7): p.
3630-6.
Tzeng, C.C., et al., Characterization of two urothelium cancer cell lines derived from a
blackfoot disease endemic area in Taiwan. Anticancer Res, 1996. 16(4A): p. 1797804.
Rieger, K.M., et al., Human bladder carcinoma cell lines as indicators of oncogenic
change relevant to urothelial neoplastic progression. Br J Cancer, 1995. 72(3): p.
683-90.
Hatina, J., et al., [Bladder carcinoma cell lines as models of the pathobiology of
bladder cancer. Review of the literature and establishment of a new progression
series]. Urologe A, 2008. 47(6): p. 724-34.
Rossi, M.R., et al., The immortalized UROtsa cell line as a potential cell culture model
of human urothelium. Environ Health Perspect, 2001. 109(8): p. 801-8.
Christensen, B., et al., A classification of human urothelial cells propagated in vitro.
Anticancer Res, 1984. 4(6): p. 319-37.
Horoszewicz, J.S., et al., LNCaP model of human prostatic carcinoma. Cancer Res,
1983. 43(4): p. 1809-18.
Carey, T.E., et al., Cell surface antigens of human malignant melanoma: mixed
hemadsorption assays for humoral immunity to cultured autologous melanoma cells.
Proc Natl Acad Sci U S A, 1976. 73(9): p. 3278-82.
Leibovitz, A., et al., Classification of human colorectal adenocarcinoma cell lines.
Cancer Res, 1976. 36(12): p. 4562-9.
201
Literaturverzeichnis
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
Pfaffl, M.W., A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res, 2001. 29(9): p. e45.
van Oers, J.M., et al., A simple and fast method for the simultaneous detection of
nine fibroblast growth factor receptor 3 mutations in bladder cancer and voided urine.
Clin Cancer Res, 2005. 11(21): p. 7743-8.
Burger, M., et al., Mcm2 predicts recurrence hazard in stage Ta/T1 bladder cancer
more accurately than CK20, Ki67 and histological grade. Br J Cancer, 2007. 96(11):
p. 1711-5.
Stoehr, R., et al., Histologic-genetic mapping by allele-specific PCR reveals
intraurothelial spread of p53 mutant tumor clones. Lab Invest, 2002. 82(11): p. 155361.
Knowles, M.A., Molecular subtypes of bladder cancer: Jekyll and Hyde or chalk and
cheese? Carcinogenesis, 2006. 27(3): p. 361-73.
Blaveri, E., et al., Bladder cancer stage and outcome by array-based comparative
genomic hybridization. Clin Cancer Res, 2005. 11(19 Pt 1): p. 7012-22.
Erill, N., et al., Genetic and immunophenotype analyses of TP53 in bladder cancer:
TP53 alterations are associated with tumor progression. Diagn Mol Pathol, 2004.
13(4): p. 217-23.
Veltman, J.A., et al., Array-based comparative genomic hybridization for genomewide screening of DNA copy number in bladder tumors. Cancer Res, 2003. 63(11): p.
2872-80.
Zaharieva, B., et al., High-throughput tissue microarray analysis of CMYC
amplificationin urinary bladder cancer. Int J Cancer, 2005. 117(6): p. 952-6.
Seibold, S., et al., Identification of a new tumor suppressor gene located at
chromosome 8p21.3-22. FASEB J, 2003. 17(9): p. 1180-2.
Pils, D., et al., Five genes from chromosomal band 8p22 are significantly downregulated in ovarian carcinoma: N33 and EFA6R have a potential impact on overall
survival. Cancer, 2005. 104(11): p. 2417-29.
Zuern, C., et al., Down-regulation of MTUS1 in human colon tumors. Oncol Rep,
2010. 23(1): p. 183-9.
Rodrigues-Ferreira, S., et al., 8p22 MTUS1 gene product ATIP3 is a novel anti-mitotic
protein underexpressed in invasive breast carcinoma of poor prognosis. PLoS One,
2009. 4(10): p. e7239.
Hurst, C.D., et al., A SNaPshot assay for the rapid and simple detection of four
common hotspot codon mutations in the PIK3CA gene. BMC Res Notes, 2009. 2: p.
66.
Louis, S.N., et al., Expression and function of ATIP/MTUS1 in human prostate cancer
cell lines. Prostate, 2010. 70(14): p. 1563-74.
Di Benedetto, M., et al., Structural organization and expression of human MTUS1, a
candidate 8p22 tumor suppressor gene encoding a family of angiotensin II AT2
receptor-interacting proteins, ATIP. Gene, 2006. 380(2): p. 127-36.
Liu, Y.L., et al., The hypomethylation agent bisdemethoxycurcumin acts on the WIF-1
promoter, inhibits the canonical Wnt pathway and induces apoptosis in human nonsmall-cell lung cancer. Curr Cancer Drug Targets, 2011. 11(9): p. 1098-110.
Kariola, R., et al., APC and beta-catenin protein expression patterns in HNPCCrelated endometrial and colorectal cancers. Fam Cancer, 2005. 4(2): p. 187-90.
Liu, C., et al., Wnt/beta-Catenin pathway in human glioma: expression pattern and
clinical/prognostic correlations. Clin Exp Med, 2011. 11(2): p. 105-12.
Bovolenta, P., et al., Beyond Wnt inhibition: new functions of secreted Frizzledrelated proteins in development and disease. J Cell Sci, 2008. 121(Pt 6): p. 737-46.
Rodriguez, J., et al., SFRP1 regulates the growth of retinal ganglion cell axons
through the Fz2 receptor. Nat Neurosci, 2005. 8(10): p. 1301-9.
Lee, J.L., et al., Autocrine/paracrine secreted Frizzled-related protein 2 induces
cellular resistance to apoptosis: a possible mechanism of mammary tumorigenesis. J
Biol Chem, 2004. 279(15): p. 14602-9.
202
Literaturverzeichnis
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
Chuman, Y., et al., Identification of a peptide binding motif for secreted frizzledrelated protein-1. Peptides, 2004. 25(11): p. 1831-8.
Round, J. and E. Stein, Netrin signaling leading to directed growth cone steering.
Curr Opin Neurobiol, 2007. 17(1): p. 15-21.
Hausler, K.D., et al., Secreted frizzled-related protein-1 inhibits RANKL-dependent
osteoclast formation. J Bone Miner Res, 2004. 19(11): p. 1873-81.
Salic, A.N., et al., Sizzled: a secreted Xwnt8 antagonist expressed in the ventral
marginal zone of Xenopus embryos. Development, 1997. 124(23): p. 4739-48.
Yabe, T., et al., Ogon/Secreted Frizzled functions as a negative feedback regulator of
Bmp signaling. Development, 2003. 130(12): p. 2705-16.
Yokota, Y. and S. Mori, Role of Id family proteins in growth control. J Cell Physiol,
2002. 190(1): p. 21-8.
Labbe, E., A. Letamendia, and L. Attisano, Association of Smads with lymphoid
enhancer binding factor 1/T cell-specific factor mediates cooperative signaling by the
transforming growth factor-beta and wnt pathways. Proc Natl Acad Sci U S A, 2000.
97(15): p. 8358-63.
Nishita, M., et al., Interaction between Wnt and TGF-beta signalling pathways during
formation of Spemann's organizer. Nature, 2000. 403(6771): p. 781-5.
Hussein, S.M., E.K. Duff, and C. Sirard, Smad4 and beta-catenin co-activators
functionally interact with lymphoid-enhancing factor to regulate graded expression of
Msx2. J Biol Chem, 2003. 278(49): p. 48805-14.
De, A., Wnt/Ca2+ signaling pathway: a brief overview. Acta Biochim Biophys Sin
(Shanghai), 2011. 43(10): p. 745-56.
Veeman, M.T., J.D. Axelrod, and R.T. Moon, A second canon. Functions and
mechanisms of beta-catenin-independent Wnt signaling. Dev Cell, 2003. 5(3): p. 36777.
Yang, Z.Q., et al., Methylation-associated silencing of SFRP1 with an 8p11-12
amplification inhibits canonical and non-canonical WNT pathways in breast cancers.
Int J Cancer, 2009. 125(7): p. 1613-21.
Grochola, L.F., et al., Recent natural selection identifies a genetic variant in a
regulatory subunit of protein phosphatase 2A that associates with altered cancer risk
and survival. Clin Cancer Res, 2009. 15(19): p. 6301-8.
Bond, G.L., et al., A single nucleotide polymorphism in the MDM2 promoter
attenuates the p53 tumor suppressor pathway and accelerates tumor formation in
humans. Cell, 2004. 119(5): p. 591-602.
Bougeard, G., et al., Impact of the MDM2 SNP309 and p53 Arg72Pro polymorphism
on age of tumour onset in Li-Fraumeni syndrome. J Med Genet, 2006. 43(6): p. 5313.
Ruijs, M.W., et al., The single-nucleotide polymorphism 309 in the MDM2 gene
contributes to the Li-Fraumeni syndrome and related phenotypes. Eur J Hum Genet,
2007. 15(1): p. 110-4.
Bond, G.L., et al., MDM2 SNP309 accelerates tumor formation in a gender-specific
and hormone-dependent manner. Cancer Res, 2006. 66(10): p. 5104-10.
Swinney, R.M., et al., MDM2 promoter variation and age of diagnosis of acute
lymphoblastic leukemia. Leukemia, 2005. 19(11): p. 1996-8.
Huang, S.F., et al., Combined effects of MDM2 SNP 309 and p53 mutation on oral
squamous cell carcinomas associated with areca quid chewing. Oral Oncol, 2009.
45(1): p. 16-22.
Nakashima, M., et al., Impact of MDM2 single nucleotide polymorphism on tumor
onset in head and neck squamous cell carcinoma. Acta Otolaryngol, 2008. 128(7): p.
808-13.
Menin, C., et al., Association between MDM2-SNP309 and age at colorectal cancer
diagnosis according to p53 mutation status. J Natl Cancer Inst, 2006. 98(4): p. 285-8.
203
Literaturverzeichnis
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
173.
174.
175.
176.
177.
178.
Wasielewski, M., et al., MDM2 SNP309 accelerates familial breast carcinogenesis
independently of estrogen signaling. Breast Cancer Res Treat, 2007. 104(2): p. 1537.
Bartel, F., et al., Both germ line and somatic genetics of the p53 pathway affect
ovarian cancer incidence and survival. Clin Cancer Res, 2008. 14(1): p. 89-96.
Khatri, R.G., K. Navaratne, and R.J. Weil, The role of a single nucleotide
polymorphism of MDM2 in glioblastoma multiforme. J Neurosurg, 2008. 109(5): p.
842-8.
Yoon, Y.J., et al., MDM2 and p53 polymorphisms are associated with the
development of hepatocellular carcinoma in patients with chronic hepatitis B virus
infection. Carcinogenesis, 2008. 29(6): p. 1192-6.
Sanchez-Carbayo, M., et al., A polymorphism in HDM2 (SNP309) associates with
early onset in superficial tumors, TP53 mutations, and poor outcome in invasive
bladder cancer. Clin Cancer Res, 2007. 13(11): p. 3215-20.
Pignot, G., et al., Hedgehog pathway activation in human transitional cell carcinoma
of the bladder. Br J Cancer, 2012. 106(6): p. 1177-86.
Bertz, S., et al., Substaging by estimating the size of invasive tumour can improve risk
stratification in pT1 urothelial bladder cancer-evaluation of a large hospital-based
single-centre series. Histopathology, 2011. 59(4): p. 722-32.
Cappellen, D., et al., Frequent activating mutations of FGFR3 in human bladder and
cervix carcinomas. Nat Genet, 1999. 23(1): p. 18-20.
van Oers, J.M., et al., FGFR3 mutations and a normal CK20 staining pattern define
low-grade noninvasive urothelial bladder tumours. Eur Urol, 2007. 52(3): p. 760-8.
Lopez-Knowles, E., et al., PIK3CA mutations are an early genetic alteration
associated with FGFR3 mutations in superficial papillary bladder tumors. Cancer Res,
2006. 66(15): p. 7401-4.
Nouet, S., et al., Trans-inactivation of receptor tyrosine kinases by novel angiotensin
II AT2 receptor-interacting protein, ATIP. J Biol Chem, 2004. 279(28): p. 28989-97.
Ding, X., et al., Down-regulation of tumor suppressor MTUS1/ATIP is associated with
enhanced proliferation, poor differentiation and poor prognosis in oral tongue
squamous cell carcinoma. Mol Oncol, 2012. 6(1): p. 73-80.
Molina, A., et al., [ATIP, a novel superfamily of microtubule-associated proteins]. Med
Sci (Paris), 2011. 27(3): p. 244-6.
He, L. and G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation.
Nat Rev Genet, 2004. 5(7): p. 522-31.
Wienholds, E. and R.H. Plasterk, MicroRNA function in animal development. FEBS
Lett, 2005. 579(26): p. 5911-22.
Zuern, C., et al., Microtubule associated tumor suppressor 1 deficient mice develop
spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. Int J Oncol,
2012. 40(4): p. 1079-88.
Castillo-Martin, M., et al., Molecular pathways of urothelial development and bladder
tumorigenesis. Urol Oncol, 2010. 28(4): p. 401-8.
Horiuchi, M., J. Iwanami, and M. Mogi, Regulation of angiotensin II receptors beyond
the classical pathway. Clin Sci (Lond), 2012. 123(4): p. 193-203.
Reinemund, J., et al., Poly(ADP-ribose) polymerase-1 (PARP-1) transcriptionally
regulates angiotensin AT2 receptor (AT2R) and AT2R binding protein (ATBP) genes.
Biochem Pharmacol, 2009. 77(12): p. 1795-805.
Timmermans, P.B., et al., Angiotensin II receptors and angiotensin II receptor
antagonists. Pharmacol Rev, 1993. 45(2): p. 205-51.
Fyhrquist, F. and O. Saijonmaa, Renin-angiotensin system revisited. J Intern Med,
2008. 264(3): p. 224-36.
Carey, R.M. and H.M. Siragy, Newly recognized components of the renin-angiotensin
system: potential roles in cardiovascular and renal regulation. Endocr Rev, 2003.
24(3): p. 261-71.
204
Literaturverzeichnis
179.
180.
181.
Dinh, D.T., et al., Angiotensin receptors: distribution, signalling and function. Clin Sci
(Lond), 2001. 100(5): p. 481-92.
Rodrigues-Ferreira, S. and C. Nahmias, An ATIPical family of angiotensin II AT2
receptor-interacting proteins. Trends Endocrinol Metab, 2010. 21(11): p. 684-90.
Mogi, M., M. Iwai, and M. Horiuchi, New insights into the regulation of angiotensin
receptors. Curr Opin Nephrol Hypertens, 2009. 18(2): p. 138-43.
205
Abbildungsverzeichnis
7
Abbildungsverzeichnis
1-1
Internet: http://www.jameda.de/gesundheits-lexikon/bilder/266304.jpg (Frau),
http://www.jameda.de/gesundheits-lexikon/bilder/266305.jpg (Mann)
1-2
Internet: http://www.medac.de/medac_images/urologie/indikationen/harnblase
/harn2.jpg
1-3
aus: Stöhr R, H.A., Histopathologie und Molekulargenetik
Harnblasenkarzinoms. Onkologe, 2007. 13 (12): S. 1062
des
1-4
aus: Stöhr R, H.A., Histopathologie und Molekulargenetik
Harnblasenkarzinoms. Onkologe, 2007. 13(12): S. 1064
des
1-5
Internet:
http://www.google.de/imgres?imgurl=http://jbiol.com/content/figures/jbiol22-1l.jpg&imgrefurl=http://jbiol.com/content/4/1/2/figure/F1%3Fhighres%3Dy&usg=
__WoDSq6RFBTHq_nbZ7tpG7ByoYug=&h=774&w=1200&sz=170&hl=de&sta
rt=41&zoom=1&tbnid=zgFRvI3ozYDe1M:&tbnh=97&tbnw=150&ei=HKh4Tvna
MMyK4gS0gc35Cw&prev=/search%3Fq%3Dwntsignalweg%26start%3D21%2
6um%3D1%26hl%3Dde%26sa%3DN%26tbm%3Disch&um=1&itbs=1
1-6
Internet:
http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG
00000 104332;r=8:41119481-41167016
2-1
Internet/Wikipedia: http://de.wikipedia.org/wiki/Neubauer-Z%C3%A4hlkammer
2-44 aus:
http://media.affymetrix.com/support/technical/datasheets/genomewide_snp6_d
atasheet.pdf
206
Publikationen, Kongresse, Fortbildung
8
Publikationen, Kongressbeiträge, Fortbildungen
Publizierte Beiträge:
P53 codon 72 (Arg72Pro) polymorphism and prostate cancer risk: association
between disease onset and proline genotype.
Rogler A, Rogenhofer M, Borchardt A, Lunz JC, Knoell A, Hofstaedter F, Tannapfel
A, Wieland W, Hartmann A, Stoehr R.
Pathobiology. 2011;78(4):193-200. Epub 2011 Jul 19. PMID: 21778786
Plasmacytoid and micropapillary urothelial carcinoma: rare forms of urothelial
carcinoma.
Keck B, Stoehr R, Wach S, Rogler A, Nolte E, Hartmann A, Wullich B.
Urologe A. 2011 Feb;50(2):217-20. German. PMID: 21246348
Mutational activation of FGFR3 is not involved in the development of prostate cancer.
Koufou S, Lunz JC, Borchardt A, Keck B, Kneitz B, Gaisa NT, Hafner C, Giedl C, Rau
TT, Rogler A, Wieland WF, Hartmann A, Stoehr R.
Pathobiology. 2010;77(5):249-52. Epub 2010 Nov 29. PMID: 21116115
The plasmacytoid carcinoma of the bladder--rare variant of aggressive urothelial
carcinoma.
Keck B, Stoehr R, Wach S, Rogler A, Hofstaedter F, Lehmann J, Montironi R,
Sibonye M, Fritsche HM, Lopez-Beltran A, Epstein JI, Wullich B, Hartmann A.
Int J Cancer. 2011 Jul 15;129(2):346-54. doi: 10.1002/ijc.25700. Epub 2010 Dec 1.
PMID: 20878954
207
Publikationen, Kongresse, Fortbildung
Akzeptierte Beiträge:
Methylation dependent activation of CDX1 trough NFκB – a link from inflammation to
intestinal metaplasia in the human stomach.
Rau T, Rogler A, Frischauf M, Jung A, Konturek P, Dimmler A, Faller G, Sehnert B,
El-Rifai W, Hartmann A, Voll R, Schneider-Stock R
Am J Pathol
Beiträge in Vorbereitung (Stand 27.06.2012):
1
Role of rs3242 and rs921142 for the risk of bladder cancer: association
between disease onset and genotype in rs3242. British Journal of Cancer.
2
Functional characterisation of SFRP1 expression loss in papillary urothelial
carcinoma.
3
Deletion mapping of chromosome 8p and the role of MTUS1 in papillary
bladder cancer.
Kongressbeiträge:
3rd International IZKF-Symposium (Molecular Therapies), 14.-16. Mai 2009, Kloster
Banz/Deutschland
Poster: Role of chromosome 8p deletions and loss of SFRP1 in human bladder
cancer.
Bladder Cancer Meeting (the potential for a multidisciplinary integrative approach),
29.-30. Juni 2009, CNIO, Madrid/Spanien
Poster: Histopathological, molecular and clinical characterization of plasmacytoid
urothelial carcinoma of the bladder.
AACR 2010 (American Association for Cancer Research), 101st annual meeting, 17.21.April 2010, Washington/USA
Poster: P53 codon 72 SNP (R72P) and prostate cancer risk. (publiziert in den
Proceedings 2010)
208
Publikationen, Kongresse, Fortbildung
4th Mildred Scheel Cancer Conference, 19.-21. Mai 2010, Königswinter/Deutschland
Poster: Chromosom 8q24 rs6983267 SNP and bladder cancer risk.
94. Jahrestagung der Deutschen Gesellschaft für Pathologie e.V. (DGP 2010), 27.30. Mai 2010, Berlin/Deutschland
Poster: P53 Codon 72 SNP (R72P) und HPV als Risikofaktoren für das ProstataKarzinom.
AACR 2011 (American Association for Cancer Research), 102nd meeting, 2.-6. April
2011, Orlando/USA
Poster: Functional Characterisation of SFRP1 expression loss in human papillary
bladder cancer. (publiziert in Proceedings 2011)
95. Jahrestagung der Deutschen Gesellschaft für Pathologie e.V. (DGP 2011), 16.19. Juni 2011, Leipzig/Deutschland
Poster 1: Role of SFRP1 SNP rs3242 for the risk of prostate and bladder cancer.
Poster 2: Functional characterisation of SFRP1 expression loss in human papillary
bladder cancer. (beides publiziert in Der Urologe)
2. Symposium des Deutschen Forschungsverbundes Blasenkarzinom e.V. 14.-15
Oktober 2011, Erlangen/Deutschland
Kurzvortrag: Progressionsmarker des papillären Urothelkarzinoms.
3. Symposium Urologische Forschung der Deutschen Gesellschaft für Urologie, 17.19. November 2011, Jena/Deutschland
Poster: MTUS1 als neuer Progressionsmarker auf Chromosom 8p beim Harnblasenkarzinom.
AACR 2012 (American Association for Cancer Research), 103rd meeting,31. März-4.
April 2012, Chicago/USA
Poster: MTUS1 as a potential progression marker at chromosome 8p in bladder
cancer. (publiziert in den Proceedings 2012)
209
Publikationen, Kongresse, Fortbildung
Angemeldet und akzeptiert:
64. Kongress der Deutsche Gesellschaft für Urologie 2012 (DGU 2012), 26.-29.
September 2012, Leipzig/Jena
Poster: Die Rolle von Chromosom 8p-Deletionen und Verlust der sFRP1 Expression
beim Urothelkarzinom der Harnblase.
Sonstige Forschungsreisen und Fortbildungen:
Workshop “Protein Analysis of Tissues”, 6. März 2009, TU München
Forschungsaufenthalt (aCGH-Auswertung mit Nexus), 10.-13. August 2009, Erasmus
MC, Rotterdam/Niederlande
Forschungsaufenthalt (TOP/FOP Assays), 17.-20. August 2009, TU München,
Klinikum rechts der Isar, AG Experimentelle Urologie
Werksbesichtigung Roche, 2.9.2009, Penzberg/Deutschland
Forschungsaufenthalt (TOP/FOP Assay), 9.-13. Mai 2011, Universitätsmedizin
Göttingen Klinische Forschergruppe 179
Einführung in NGS und Einarbeitung des GS Junior Systems (Roche, Shotgun), 6.-8.
September 2011
210
Anhang
9
Anhang
9.1
Abkürzungsverzeichnis (wichtigste Abkürzungen):
5-Aza
μ
µl
µm
µM
A
AEC
APS
BCA
BIRC5
BMP4
bp
BrdU
BSA
c
CCND1
CDH1
cDNA
CIS
CMYC
CTNNB1
aCGH
cSNP
d
Da
DAPI
ddNTP
DEPC
DMSO
DNA
dNTP
DPBS
DTT
ε
E.coli
EDTA
ELISA
FCS
FGFR3
FN1
g
GAPDH
HE
Hg
HKG
HRP
5-Aza-2‘-deoxyzytidin
mikro
Mikroliter
Mikrometer
Mikromolar
Absorption
3-Amino-9-Ethylcarbazol
Ammoniumpersulfat
Bicinchoninsäure
baculoviral IAP repeat containing 5, Survivin
bone morphogenetic protein 4
Basenpaare
Bromdesoxyuridin
Bovine Serum Albumin
Konzentration
cyclin D1
E-Cadherin
complementary DNA
Carcinoma in situ
v-myc myelocytomatosis viral oncogene homolog
ß-Catenin
array-based Comparative Genomic Hybridization
codingSNP
Schichtdicke
Dalton
4′,6-Diamidin-2-phenylindol
Didesoxyribonucleosid Triphosphate
Diethylpyrocarbonat
Dimethylsulfoxid
Desoxyribonucleic Acid
Desoxyribonucleosid Triphosphate
Dulbecco's Phosphate Buffered Saline
1,4-Dithiothreitol
molarer (dekadischer) Extinktionskoeffizient
Escherichia coli
Ethylendiamintetraacetat
Enzyme Linked Immunosorbent Assay
Fetal Calf Serum
fibroblast growth factor receptor 3
Fibronectin
Gramm
glyceraldehyde-3-phosphate dehydrogenase
Hämalaun-Eosin
high-grade
House-Keeping-Gen
Horseradish Peroxidase
211
Anhang
hsa-miRIBR
IF
IHC
JUP
k
l
LB
lg
m
M
min
ml
M-MuLV
mRNA
MSP
MTUS1
MW
n
n
Opti-MEM
PCR
PIK3CA
qRT-PCR
RFLP
RNA
rpm
RPMI 1640
rSNP
RT
SAHA
SDS-PAGE
sec
SFRP1
SNP
TAE
TBE
TCC
TEMED
TG(S)
TMA
Tris
TSA
TUR
UC
UTR
UV
V
WB
WHO
WT/wt
Homo sapiens micro Ribonucleic Acid
Immunblot Blocking Reagent
Immunfluoreszenz
Immunhistochemie
junction plakoglobin
Kilo
Liter
Lysogeny Broth (Nähr-Medium)
low-grade
milli
Molar
Minuten
Milliliter
Moloney Murine Leukemia Virus
messenger RNA
Methylierung-spezifische PCR
microtubule associated tumor suppressor 1
Mittelwert
Anzahl
nano
modifiziertes Minimum Essential Medium
Polymerase Chain Reaction
phosphoinositide-3-kinase
quantitative real-time PCR
Restriction-Fragment-Length Polymorphism
Ribonucleic Acid
rounds per minute
Roswell Park Memorial Institute (Zellkultur-Medium)
regulatorySNP
Raumtemperatur
Suberoylanilide Hydoxamic Acid
Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
Sekunden
secreted frizzled-related protein 1
Single Nucleotide Polymorphism
Tris-Acetat-EDTA
Tris-Borat-EDTA
Transitional Cell Carcinoma
Tetramethylethylendiamin
Tris/Glycin (SDS)
Tissue-Microarray
Tris-(hydroxymethyl)-aminomethan
Tyramid Signal Amplification
Transurethrale Resektion
Urothelial Carcinoma
untranslated region
ultraviolet
Volumen
Westernblot
World Health Organization
Wildtyp
212
Anhang
9.2
Hersteller-Angaben
Abkürzung
Hersteller
Abcam
Abcam plc, Camebridge/UK
Abnova
Abnova GmbH c/o EMBLEM, Heidelberg
Affymetrix
Affymetrix GmbH, München
Amaxa Biosystems
Amaxa Biosystem, Gaithersbirg/USA bzw. Lonza Group Ltd, Basel/Schweiz
Amersham Biosciences
Amersham Biosciences Europe GmbH, Freiburg
AppliChem
AppliChem GmbH, Darmstadt
Applied Biosystems
Applied Biosystems by Life Technologies GmbH, Darmstadt
BD Biosciences
Becton Dickinson GmbH, Heidelberg
Binder
BINDER GmbH, Tuttlingen
Biocare Medical
Biocare Medical, Concord/USA
Bioline
Bioline GmbH, Luckenwalde
Biomol
Biomol GmbH, Hamburg
Bio-Rad
Bio-Rad Laboratories GmbH, München
Biozym
Biozym Scientific GmbH, Hessisch Oldendorf
BioTek
BioTek Instruments GmbH, Bad Friedrichshall
Brand
Brand GmbH & Co. KG, Wertheim
Cell Signaling
Cell Signaling Technology Inc., Danvers/USA
Dako
DakoCytomation, Glostrup/Dänemark
Eppendorf
Eppendorf AG, Hamburg
Esco
Esco Technologies Inc., Hatboro/USA
Fermentas
Fermentas Life Sciences GmbH, St. Leon-Rot
GE Healthcare
GE Healthcare, München
GFL
Gesellschaft für Labortechnik GmbH, Burgwedel
G. Heinemann
G. Heinemann Medizintechnik GmbH, Hamburg
Grant-bio
Grant Instruments (Cambridge) Ltd, Cambridgeshire/UK
Greiner Bio-One
Greiner Bio-One GmbH, Frickenhausen
HANNA Instruments
HANNA Instruments Deutschland GmbH, Kehl am Rhein
Hartmann
IVF HARTMANN AG, Neuhausen am Rheinfall
Heidolph
Heidolph Instruments GmbH & Co. KG, Schwabach
Ibidi
Ibidi Gmbh, Martinsried
IKA
IKA-Werke GmbH & Co. KG, Staufen
Integra
INTEGRA Biosciences GmbH, Fernwald
Invitrogen
Invitrogen by life technologies, Karlsruhe
InvivoGen
InvivoGen, San Diego, California
Jackson
Jackson ImmunoResearch Laboratories, Inc., Baltimore/ USA
Kern
Kern & Sohn GmbH, Balingen-Frommern
Lonza
Lonza Group Ltd, Basel/Schweiz
Machery Nagel
MACHERY-NAGEL GmbH & Co. KG, Düren
Marienfeld
Paul Marienfeld GmbH und Co. KG, Lauda-Königshofen
Memmert
Memmert GmbH & Co. KG, Schwabach
Menzel
Menzel Glasbearbeitungswerk GmbH & Co. KG, Braunschweig
Metabion
metabion international AG, Martinsried
Merck
Merck KGaA, Darmstadt
Millipore
Millipore, Billerica/ USA
MoBiTec
MoBiTec GmbH, Göttingen
213
Anhang
New England BioLabs
New England BioLabs GmbH, Frankfurt
Olympus
Olympus Europa Holding GmbH, Hamburg
OriGene
Origene Technologies, Inc., Rockville/ USA
PALL Life Sciences
Pall GmbH, Dreieich
Pan-Biotech
PAN-BIOTECH GmbH, Aidenbach
Promega
Promega GmbH, Mannheim
Quanta
Quanta BioSciences, Inc., Gaithersburg/USA
Qiagen
Qiagen GmbH, Hilden
Roche
Roche Deutschland Holding GmbH, Penzberg
Roth
Carl Roth GmbH & Co. KG, Karlsruhe
Santa Cruz
Santa Cruz Biotechnology, Inc., Santa Cruz, California/USA
Sarstedt
Sarstedt AG & Co., Nümbrecht
Scotsman
Scotsman Ice Systems, Vernon Hills/USA
Severin
A. Severin GmbH & Co. KG, Bünde
Sigma-Aldrich
Sigma-Aldrich Chemie GmbH, Taufkirchen
SPSS
SPSS, Chicago/ USA
Starlab
Starlab GmbH, Ahrensburg
Thermo Scientific
Thermo Fischer Scientific, Bonn
Vector laboratories
Vector Laboratories, Inc., Burlingame/ USA
Vilber Lourmat
Vilber Lourmat Deutschland GmbH, Eberhardzell
VWR
VWR International GmbH, Ismaning
9.3
Schmelzkurven
und
Eichgeraden
der
Primeroptimierung
Primereffizienzbestimmung der qRT-PCR
Primer
AXIN2
Slope
Threshold
Baseline
Effizienz [%]
BMP4
Slope
Threshold
Baseline
Effizienz [%]
CD44
Slope
Threshold
Baseline
Effizienz [%]
CMYC
Slope
Threshold
Baseline
Run 1
Run 2
Run 3
Run4
Gesamt [%]
-3,179
0,177
3 bis 15
106,3
-3,664
0,339
3 bis 20
87,467
-3,2733
0,257
3 bis 20
102,09
98,62
-3,267
0,03
3 bis 15
102,34
-3,447
0,367
3 bis 15
95,04
-3,508
0,239
3 bis 15
92,77
96,72
-3,44
0,366
3 bis 15
95,294
-3,47
0,258
3 bis 15
94,19
-3,474
0,297
3 bis 15
94,023
94,5
-3,614
0,258
3 bis 15
-3,694
0,251
3 bis 15
-3,799
0,257
3 bis 15
214
und
Anhang
Effizienz [%]
CCND1
Slope
Threshold
Baseline
Effizienz [%]
GAPDH
Slope
Threshold
Baseline
Effizienz [%]
SFRP1
Slope
Threshold
Baseline
Effizienz [%]
MTUS1
Slope
Threshold
Baseline
Effizienz [%]
89,098
86,513
83,339
86,32
-3,776
0,389
3 bis 15
83,993
-3,875
0,474
3 bis 15
81,161
-3,962
0,223
3 bis 15
78,81
81,32
-3,27
0,252
3 bis 15
102,074
-3,31
0,417
3 bis 15
99,635
-3,426
0,297
3 bis 15
95,84
99,18
-3,246
0,514
3 bis 15
103,251
-3,57
0,382
3 bis 15
90,599
-3,447
0,368
3 bis 15
95,025
-3,304
0,1
3 bis 18
100,771
-3,412
0,1
3 bis 18
96,378
-3,645
0,1
3 bis 18
88,083
Standardkurven AXIN2:
Standardkurven BMP4:
215
-3,636
0,562
3 bis 15
88,36
94,3088
95,1
Anhang
Standardkurven CD44:
Standardkurven CMYC:
Standardkurven CCND1:
Standardkurven SFRP1:
216
Anhang
Standardkurven GAPDH:
Standardkurven MTUS1:
Schmelzkurven AXIN2:
217
Anhang
Schmelzkurven BMP4:
Schmelzkurve CD44:
218
Anhang
Schmelzkurven CMYC:
Schmelzkurven CCND1:
219
Anhang
Schmelzkurven SFRP1:
Schmelzkurven GAPDH:
220
Anhang
Schmelzkurve MTUS1:
9.4
Karyogramme der 19 Tumoren der aCGH
pTa_1
pTa_3
221
Anhang
pTa_4
pTa_5
pTa_6
pTa_7
pTa_8
pTa_9
pT1_1
pT1_2
222
Anhang
pT1_3
pT1_4
pT1_5
pT1_6
pT1_7
pT1_8
pT1_10
223
Anhang
9.5
Chromosomale Aberrationen der aCGH-Analyse zur Generierung von
Pseudomarkern für die Cluster-Analyse
FID
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
ninv
IID
pTa_1
pTa_2
pTa_2
pTa_2
pTa_3
pTa_3
pTa_3
pTa_3
pTa_3
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_4
pTa_5
pTa_5
pTa_5
pTa_5
pTa_5
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_6
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
pTa_7
Chr
Start
9
1
9
15
5
12
12
12
19
4
9
11
11
11
11
11
12
18
18
21
3
5
9
16
X
4
5
5
6
9
9
10
11
15
15
17
17
20
20
20
X
4
8
9
10
10
13
15
19
19
X
X
X
45928837
144117716
65336138
18525980
46282258
27116119
61076339
127955955
24374405
30044112
2901368
3328263
63554694
77439496
101529721
102712692
65109953
1543
11053515
14947483
13761514
11786442
45928837
32088275
388364
23289034
26380021
173976849
68242805
5843445
65412415
39064576
762982
18276329
26199879
514
43024887
10370353
22301623
29298698
757418
328851
20570442
36587
42943818
91540524
19415342
20307305
15046596
50556329
109805
1415800
3424710
224
Stop
47006984
246755211
140211203
100222647
49561772
30439641
118040733
129253072
32602503
31179040
140114022
63550368
77438821
100464936
102592130
132234120
68394182
11044325
76116029
39695357
192006886
12802695
67050495
33388649
2329943
26972863
27598176
180147459
168855222
44409312
88609667
135356682
51213809
20089383
28173691
22141807
78643088
11850764
23615287
62371180
2018584
189213530
26788085
139308477
55212459
121350967
114126487
100192945
16148220
51579407
1146863
2704240
154582680
CN-state
2
3
2
3
2
3
3
2
2
2
2
2
3
2
3
2
4
3
2
3
3
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
3
3
3
3
2
3
2
2
2
2
3
3
3
3
2
4
2
Anhang
ninv
ninv
ninv
ninv
ninv
ninv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
pTa_7
pTa_7
pTa_8
pTa_9
pTa_9
pTa_9
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_1
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_2
pT1_3
pT1_3
Y
Y
9
7
9
9
1
1
1
2
2
2
3
3
3
4
4
5
5
6
7
7
8
8
8
9
10
11
12
13
16
16
16
17
17
17
18
18
18
18
18
18
19
20
21
X
X
5
7
9
9
9
12
14
17
17
20
X
1
1
2712722
19596560
45361389
3115426
70139836
93560370
758644
113577284
144144298
165265564
190550665
206531016
1858753
30573589
174294252
3530785
188551758
11388373
44731035
122929254
16516617
45894202
36386
64463167
130853902
270074
3161043
49912486
45490990
104878746
3151309
22618231
82672780
23361589
56424977
70905054
18256114
19541351
22107688
29116715
49141096
54019824
38630893
6080525
10106540
109805
120379049
46307675
1282765
21248474
40498668
65412415
129238121
101230886
514
22306220
7888199
98934275
826564
114577250
225
12615097
27022266
65412415
156344327
90859787
138516038
64951035
115839917
171379181
168378699
206529937
21523542
3318193
32688368
192845984
6319914
189669289
35324194
176311522
124041002
20912613
47138013
39349804
66446258
135942786
134719022
17150601
51131923
47046581
110889772
22336134
82344568
83897511
24550100
57575219
72255349
19537053
21079584
28291673
32134581
51961120
76116029
44705783
38866453
13488230
54624371
154582680
49578594
158049821
22387329
41599763
139678325
131126910
102479856
22298491
78643088
22559699
100496203
10177831
180160754
3
3
2
3
3
2
3
3
3
3
3
2
2
3
3
2
2
3
2
3
3
3
2
3
3
2
3
2
3
4
2
3
2
3
3
3
3
2
4
2
3
2
3
3
2
2
3
2
3
2
2
2
2
2
2
3
3
2
3
3
Anhang
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_3
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_4
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_5
pT1_6
pT1_6
pT1_6
pT1_6
2
2
2
3
4
5
5
6
8
9
10
10
11
12
12
13
13
13
13
14
15
16
17
18
18
19
20
21
X
X
X
Y
6
6
8
9
10
15
16
20
20
X
3
4
8
10
11
11
15
15
16
17
18
18
18
X
4
7
7
7
9031194
138420362
208751098
35333
56641211
68520
62108461
50042694
48065560
33463893
2078291
57917397
39760616
28642306
63644881
18064576
34242826
77695010
104412658
21144799
18454740
46376825
7630597
7706601
73496164
34797809
29595926
14262398
109805
2849943
151195407
2712722
63832920
110984823
6923230
45928837
38695484
18551315
34976100
39552568
50922221
109805
188430568
37484819
99592881
106671842
68411350
77383184
18276329
48277370
31988362
22366628
89036
16795645
19787207
109805
64238
14423337
82202975
114246859
226
47401490
208750732
242738117
184835845
187154263
45975785
147742828
51069452
146268947
38761831
15035731
60663486
99277751
51359201
70743113
20469115
51243638
79123594
107510550
34915342
20089383
57750339
78643088
14069519
74832802
50525629
51448805
46182876
2704240
151190023
153762374
27209311
64913417
112025487
8161920
47006984
47037730
19787121
45089513
42378291
52683828
2374135
199318533
38607492
108040001
135356682
73597400
134449982
46523976
56852401
33735555
26190060
4813857
19785544
76116029
154582680
191154267
17700279
89724241
125620853
3
3
2
3
3
3
2
3
3
3
3
2
2
3
3
4
2
3
3
3
2
2
3
3
2
3
3
3
3
2
3
2
2
2
2
2
2
2
2
4
4
2
3
3
4
2
4
2
2
3
2
3
4
4
2
2
2
3
3
3
Anhang
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
inv
pT1_6
pT1_6
pT1_6
pT1_6
pT1_6
pT1_7
pT1_7
pT1_7
pT1_7
pT1_7
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_8
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_9
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
pT1_10
9
17
17
20
X
1
2
4
8
8
1
1
1
2
4
4
4
6
8
8
9
10
13
15
16
17
22
1
1
1
3
4
4
4
5
8
8
9
9
11
11
11
11
14
14
17
20
20
1
3
5
6
6
12
12
13
16
17
36587
514
22360868
9293
388364
148038493
222493889
124825
591043
47534249
99089119
119298302
158026390
155451140
13714534
24975998
87704446
43376856
36386
61666150
136515237
74987524
28107182
33722569
28089285
37461291
19194940
149506018
156635649
181648274
167489323
58809
33829877
185618504
58243921
975871
36140697
21196426
70195938
188510
68557117
81635613
90211812
18690039
86980977
35923842
15014439
29298698
27114547
35333
68520
95288
12462373
20691
39773710
40145985
32136481
514
227
140130462
22127012
78643088
62426585
2018584
226409343
241145428
31898144
43943193
146268947
100112335
121041748
165442197
158658903
14932234
26252830
93419551
47723572
37043695
108414642
137884528
77315700
39869409
37911382
30453995
38501590
20437874
150695509
162571709
246755211
171146156
7984376
35265565
190486986
180652396
36134051
144333537
22687535
138811373
50553042
76534898
83597820
134106222
41573082
100003537
37225522
16244215
62386000
91553398
48748390
43941082
12461312
51332638
27964263
110569763
49919778
33734551
23183546
2
2
3
3
2
3
2
2
2
3
4
4
3
3
2
2
3
3
2
3
2
3
4
4
4
3
3
3
3
3
2
3
2
2
2
2
3
2
2
2
3
3
2
3
3
3
3
3
3
3
3
2
3
2
2
2
2
2
Anhang
9.6
Genotypen- und Risikoallelverteilung beim rs3242 SNP in SFRP1
Genotyp
Kontrollen
Alle Fälle (%)
Vergleich
*p=0,05
(%)
Hetero CT
138 (41,6)
202 (50,1)
Homo CC
147 (44,3)
145 (36)
Homo TT
47 (14,1)
56 (13,9)
Risiko TT+CT
185 (55,7)
257 (63,8)
*p=0,028
Risiko CC
147 (44,3)
146 (36,2)
OR: 0,715, 95% KI: 0,531-0,962
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Hetero CT
138 (41,6)
87 (46,3)
115 (53,5)
Ko vs KS vs
Homo CC
147 (44,3)
78 (41,5)
67 (31,2)
JP *p=0,032
Homo TT
47 (14,1)
23 (12,2)
33 (15,3)
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Hetero CT
138 (41,6)
87 (46,3)
Ko
Homo CC
147 (44,3)
78 (41,5)
p=0,559
Homo TT
47 (14,1)
23 (12,2)
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Vergleich
Vergleich
vs
Vergleich
Hetero CT
138 (41,6)
115 (53,5)
Ko
Homo CC
147 (44,3)
67 (31,2)
*p=0,007
Homo TT
47 (14,1)
33 (15,3)
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Hetero CT
87 (46,3)
115 (53,5)
KS
Homo CC
78 (41,5)
67 (31,2)
p=0,095
Homo TT
23 (12,2)
33 (15,3)
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
185 (55,7)
110 (58,5)
Genotyp
Risiko TT+CT
228
KS
vs
JP
Vergleich
vs
JP
Vergleich
Ko
vs
KS
Anhang
Risiko CC
147 (44,3)
78 (41,5)
p=0,581,
OR:
0,892, 95% KI:
0,621-1,282
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Vergleich
Risiko TT+CT
185 (55,7)
148 (68,8)
Ko
vs
Risiko CC
147 (44,3)
67 (31,2)
*p=0,002,
JP
OR:0,570, KI:
0,397-0,817
Genotyp
Kontrollen
Konsekutive
Junge
Vergleich
(%)
Studie (%)
Patienten (%)
Risiko TT+CT
110 (58,5)
148 (68,8)
KS
Risiko CC
78 (41,5)
67 (31,2)
*p=0,037, OR:
vs
JP
0,638, 95% KI:
0,424-0,961
9.7
Genotypenverteilung beim rs921142 SNP in SFRP1
Genotyp
Kontrollen
Alle Fälle (%)
Vergleich
p=0,306
(%)
Hetero AG
165 (40,3)
128 (44,1)
Homo AA
116 (35,4)
114 (39,3)
Homo GG
47 (14,3)
48 (16,6)
Genotyp
Kontrollen
Konsekutive
Junge
(%)
Studie (%)
Patienten (%)
Hetero AG
165 (40,3)
79 (42,9)
49 (46,2)
KO vs KS vs
Homo AA
116 (35,4)
71 (38,6)
43 (40,6)
JP p=0,432
Homo GG
47 (14,3)
34 (18,5)
14 (13,2)
229
Vergleich
Danksagung
10
Danksagung
Allen voran möchte ich mich ganz herzlich bei PD Dr. Robert Stöhr für die intensive und
hingebungsvolle Betreuung meiner Arbeit bedanken. Ein riesengroßes Dankeschön für die
zahlreichen konstruktiven und erheiternden Besprechungen und Ratschläge hinsichtlich
Versuchsplanung, -durchführung und Auswertung, für die geduldige Beantwortung jeder
noch so unwichtig scheinenden Frage, für die gemeinsame Zeit auf Kongressen und beim
Mittagessen, für die gleichzeitig kollegiale und freundschaftliche Art, die die hohem Maße
dazu beigetragen hat mich immer wieder aufs Neue zu motivieren und mit Freude an der
Dissertation zu arbeiten!
Ein herzliches und großes Dankeschön geht an Herrn Professor Dr. Arndt Hartmann, den
Direktor des Pathologischen Institutes Erlangen, für die Überlassung dieses wissenschaftlich
hoch interessanten Themas und die Möglichkeit, die Forschungsarbeiten dazu an seinem
sehr modernen und gut ausgestatteten Institut durchzuführen. Vielen Dank auch für die
Möglichkeit, an zahlreichen motivierenden und spannenden Wissenschaftskongressen und
Fortbildungsreisen teilzunehmen, für die Hilfe bei der Begutachtung der IHC-Färbungen,
sowie für die Zweitbegutachtung meiner Arbeit.
Herrn Professor Dr. Johann-Helmut Brandstätter vom Institut für Tierphysiologie danke ich
für die Übernahme des Erstgutachtes seitens der Naturwissenschaftlichen Fakultät.
Ein besonderer Dank gilt allen derzeitigen und früheren Mitarbeitern, Kollegen, Doktoranden,
Praktikanten und Studenten der AG Uropathologie, allen voran Dr. Christine Stöhr, Verena
Popp und Sabine Hoja, die mich während der Doktorarbeit auf jede erdenkliche Weise
unterstützt haben und mir sowohl mit freundschaftlichen als auch wissenschaftlichen Tipps
zur Seite standen. Verena Popp und Yvonne Sauermann danke ich für die exzellente
technische Unterstützung bei der Durchführung meiner Arbeit.
Ein großer Dank geht an alle Mitarbeiter der benachbarten AGs Moldiagnostik, Amman, Rau,
Büttner, Schneider-Stock und Haller für die immer währende freundliche Unterstützung bei
technischen Fragen aller Art. Ein besonderer Dank geht an Birgit Meyer für die Hilfe bei der
Etablierung schwieriger IHCs, an Rudolf Jung für die Anfertigung der TMAs, an Claudia
Knoll, Andi Kosel und Nina Oks für die Hilfe bei der Sequenzierung, an Nadine Hainz, Miriam
Reutelshöfer und Katrin Schmitt für die Einführung in das „Analysis“ und die wertvollen Tipps
zur Immunhisto, sowie an Moni Klewer, Tina Grigo, Judith Wagner, PD Dr. Christoph Daniel,
230
Danksagung
OÄ Dr. Maike Büttner, OA Dr. Tilman Rau, und Dr. Jan Schulze-Lührmann für die
Unterstützung.
Außerdem möchte ich mich bei meinen „Mit-DoktorandInnen“ Nadine Hainz, Jelena
Ivanovska, Saritha Chakilam, Mukthi Gandesiri, Yvonne Riedl, Romy Böhme und Silke Tudor
für die erkenntnisreichen und freudigen Diskussionen aller Art, sowie die gemeinsame
Doktorandenzeit bedanken.
Ich danke auch allen anderen bisher nicht erwähnten Mitarbeitern des Instituts für Pathologie
für jede noch so kleine Unterstützung und Hilfsbereitschaft und für jedes freundliche Wort
und jedes Lächeln auf dem Gang.
Ein großer Dank geht an die AG Molekulare Urologie der Urologischen Klinik unter Professor
Dr. Bernd Wullich, insbesondere an Elke Nolte, Dr. Sven Wach und Professor Dr. Helge
Taubert für die gegenseitige Unterstützung, die fruchtbare Kooperation, die Hilfe bei der
Erstellung der Kaplan-Meier-Kurven und die schöne gemeinsame Zeit beim AACR.
Ein herzlicher Dank geht auch an Dr. Arif Ekici vom Institut für Humangenetik, an Dr. Roman
Nawroth der experimentellen Urologie der TU München, Erlangen, an Emil Kendziorra und
Dr. Melanie Spitzner von der Universitätsmedizin in Göttingen, sowie an Frau Professor Dr.
Ellen Zwarthoff und Dr. Angela van Tilborg vom Erasmus MC in Rotterdam für die gute
Zusammenarbeit und Kooperation und die Möglichkeit mit und in ihren Laboren zu arbeiten.
Ich danke dem IZFK Erlangen für die Förderung meines Projektes und die Finanzierung über
Drittmittel.
Nicht zuletzt gebührt mein größter Dank meinen Freunden und meiner Familie, allen voran
meinen Eltern Uschi und Thomas, meinem Bruder Benni und meinem Lebensgefährten
Markus für die immerwährende Unterstützung und die Liebe, für die ich unendlich dankbar
bin. Meinem Papa danke ich außerdem für die gründliche und kritische Durchsicht meiner
Arbeit.
231
Herunterladen

Die Rolle von Chromosom 8p-Deletionen und Verlust der SFRP1