1 Einleitung - Universität Hamburg

Werbung
Mutp53 Interaktom in einem murinen
Tumorzellmodell
Dissertation
zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) am
Department Chemie der Fakultät für Mathematik, Informatik und
Naturwissenschaften an der Universität Hamburg
vorgelegt von
Dipl. Biochem. Annette März
aus Bad Münstereifel
Hamburg, Januar 2008
Diese Arbeit wurde am Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie
an der Universität Hamburg in der Arbeitsgruppe von Herrn Professor Dr. Deppert, Abteilung
Tumorvirologie, durchgeführt und von Herrn Dr. Genrich V. Tolstonog betreut.
1. Gutachter: Prof. Dr. Wolfgang Deppert, Heinrich-Pette-Institut Hamburg
2. Gutachter: Prof. Dr. Ulrich Hahn, Universität Hamburg
“The more we study the major problems of our time, the more we come to realize that
they cannot be understood in isolation. They are systemic problems, which means
that they are interconnected and interdependent.” Fritjof Capra.
Für meine Eltern
Inhaltsverzeichnis
I
INHALTSVERZEICHNIS
INHALTSVERZEICHNIS .......................................................................................................................... I
ABKÜRZUNGSVERZEICHNIS .............................................................................................................. IV
ZUSAMMENFASSUNG .......................................................................................................................... 1
SUMMARY .............................................................................................................................................. 3
1 EINLEITUNG ........................................................................................................................................ 5
1.1 GRUNDLAGEN DER TUMORGENESE ................................................................................................... 5
1.2 ONKOGENE UND TUMORSUPPRESSORGENE ...................................................................................... 7
1.3 DAS TUMORSUPPRESSORPROTEIN P53 ............................................................................................ 7
1.3.1 Historischer Rückblick ........................................................................................................... 7
1.3.2 Struktur von p53 .................................................................................................................... 8
1.3.3 Modifikationen von p53 .......................................................................................................... 9
1.3.4 Funktion von p53 ................................................................................................................. 11
1.4 MUTANTES P53: ZUGEWINN ONKOGENER EIGENSCHAFTEN ............................................................. 15
1.4.1 Art und Häufigkeit von Mutationen in p53............................................................................ 15
1.4.2 Hinweise auf einen gain-of-function bei bestimmten mutp53 Spezies ................................ 18
1.4.3 Mögliche Mechanismen des gain-of-function ...................................................................... 19
1.5 IN VIVO P53 MAUSMODELLE............................................................................................................ 21
1.6 DIE MAUS TUMOR-ZELLLINIE METHA .............................................................................................. 22
1.7 ZIELSETZUNG DER ARBEIT.............................................................................................................. 23
2 MATERIAL ......................................................................................................................................... 25
2.1 CHEMIKALIEN ................................................................................................................................ 25
2.2 LÖSUNGEN UND PUFFER ................................................................................................................ 25
2.3 ENZYME ........................................................................................................................................ 28
2.4 DNA- UND PROTEIN MOLEKULARGEWICHTSSTANDARDS .................................................................. 28
2.4.1 DNA Molekulargewichtsstandards ....................................................................................... 28
2.4.2 ProteinMolekuargewichtsstandards ..................................................................................... 28
2.5 PLASMIDE ..................................................................................................................................... 28
2.6 BAKTERIENSTÄMME ....................................................................................................................... 29
2.7 OLIGONUKLEOTIDE, PCR- UND SEQUENZIERPRIMER ....................................................................... 29
2.8 EUKARYOTISCHE ZELLLINIEN .......................................................................................................... 30
2.9 NÄHRMEDIEN UND ANTIBIOTIKA ...................................................................................................... 30
2.10 ANTIKÖRPER ............................................................................................................................... 31
2.10.1 Primärantikörper ................................................................................................................ 31
2.10.2 Sekundärantikörper ........................................................................................................... 31
2.11 KIT SYSTEME .............................................................................................................................. 31
2.12 VERBRAUCHSMATERIALIEN ........................................................................................................... 32
2.13 COMPUTER-SOFTWARE ............................................................................................................... 32
2.14 GERÄTE ...................................................................................................................................... 32
3 METHODEN ....................................................................................................................................... 34
3.1 ZELLKULTUR UND ZELLPASSAGE..................................................................................................... 34
3.2 CHROMATIN-IMMUNPRÄZIPITATION-SEQUENZIERUNG (CHIP-SEQ) ................................................... 34
3.2.1 Protein-DNA Isolierung ........................................................................................................ 34
3.2.2 Immunpräzipitation .............................................................................................................. 35
3.2.3 Klonieren der DNA Fragmente ............................................................................................ 35
3.3 RNA-IP (RNA-IMMUNPRÄZIPITATION) ............................................................................................ 37
3.4 SDS-POLYACRYLAMID-GELELEKTROPHORESE (SDS-PAGE) .......................................................... 38
3.5 WESTERN-BLOT / IMMUNBLOT (SEMI-DRY VERFAHREN) ................................................................... 38
3.6 DETEKTION (ECL-METHODE) ......................................................................................................... 39
3.7 IMMUNPRÄZIPITATION IN GROßEM MAßSTAB .................................................................................... 39
3.8 2D-GELELEKTROPHORESE ............................................................................................................. 40
3.9 MALDI TOF MASSENSPEKTROMETRIE ............................................................................................ 40
3.10 IMMUNFLUORESZENZ ................................................................................................................... 41
3.11 KONFOKALE LASER SCANNING MIKROSKOPIE (CLSM) .................................................................. 41
Inhaltsverzeichnis
II
3.12 AGAROSEGEL-ELEKTROPHORESE................................................................................................. 42
3.13 PROTEIN-KONZENTRATIONSBESTIMMUNG NACH BRADFORD ........................................................... 42
3.14 RNAI TECHNOLOGIE .................................................................................................................... 42
3.15 TRANSFEKTION VON METHA ZELLEN MIT AMAXA ........................................................................... 43
3.16 DURCHFLUSSZYTOMETRIE (FACS ANALYSE) ................................................................................ 44
3.17 LIVE CELL IMAGING MIKROSKOPIE ................................................................................................ 45
3.18 VIABILITÄTSMESSUNG .................................................................................................................. 45
3.19 INJEKTION VON METHA ZELLEN IN BALB/C MÄUSE UND AUFARBEITUNG DER PROBEN ..................... 46
3.19.1 Ascites ............................................................................................................................... 46
3.19.2 Solide Tumore ................................................................................................................... 46
3.20 MICROARRAY ANALYSE ................................................................................................................ 46
4 ERGEBNISSE .................................................................................................................................... 49
4.1 DIE MURINE METHA TUMORZELLLINIE ALS MODELLSYSTEM FÜR DIE FUNKTIONSANALYSE VON MUTP53
.......................................................................................................................................................... 49
4.1.1 MethA Zellen in vitro ............................................................................................................ 49
4.1.2 MethA Zellen in vivo ............................................................................................................ 50
4.2 ERNIEDRIGUNG DES EXPRESSIONSNIVEAUS VON METHA MUTP53 DURCH RNA INTERFERENZ ........... 51
4.3.1 Analyse von MethA Zellen nach Expression von dsRNA durch Live Cell Imaging
Mikroskopie ................................................................................................................................... 54
4.3.2 Validierung und Quantifizierung des durch dsRNA induzierten Wachstumsarrests durch
Viabilitätsmessung ........................................................................................................................ 59
4.4 ANALYSE DER FUNKTION VON MUTP53 AUF DER EBENE DES GENOMS .............................................. 62
4.4.1 Expressionsprofiluntersuchung durch die Microarray Technologie ..................................... 62
4.4.2 ChIP-Seq zur Analyse von in vivo DNA Bindungsstellen von MethA mutp53..................... 73
4.5 UNTERSUCHUNG DER MUTP53 FUNKTION AUF DER EBENE DES TRANSKRIPTOMS .............................. 78
4.5.1 Gesamt RNA-Immunpräzipitation (RNA IP) zur Analyse der in vivo Interaktion von mutp53
mit RNA ......................................................................................................................................... 78
4.6 GENOMISCHE VERTEILUNG DER MUTP53 BINDUNGSSTELLEN UND KODIERENDEN REGIONEN DER
MUTP53-GEBUNDENEN TRANSKRIPTE ................................................................................................... 80
4.7 UNTERSUCHUNG DER MUTP53 FUNKTION AUF DER EBENE DES PROTEOMS ...................................... 82
4.7.1 Proteomanalyse zur Identifizierung potentieller Proteininteraktionspartner von mutp53 .... 82
4.7.2 Verifizierung der potentiellen Interaktionspartner von mutp53 mittels konfokaler
Mikroskopie ................................................................................................................................... 86
4.7.3 Die Bedeutung der RNA in Interaktionen von mutp53 mit anderen Proteinen .................... 88
5 DISKUSSION ..................................................................................................................................... 90
5.1 DIE EXPRESSION VON KLEINEN DSRNAS HAT UNABHÄNGIG VON DEREN SEQUENZ EINE DEUTLICHE
REDUKTION DES WACHSTUMS SOWIE DES ÜBERLEBENS ZUR FOLGE ...................................................... 90
5.2 DER KNOCKDOWN VON MUTP53 POTENZIERT DIE DURCH DSRNA-VERMITTELTEN EFFEKTE ............... 93
5.3 ÜBERGEORDNETE FUNKTION VON MUTP53 IN DER REGULATION DER GENEXPRESSION ..................... 94
5.3.1 Genomische Verteilung und Sequenzkomposition der mutp53-Bindungsorte .................... 95
5.3.2 Einfluss von mutp53 auf die Genexpression ....................................................................... 97
5.3.3 Bindung von mutp53 an regulatorische Transkripte ............................................................ 98
5.3.4 Die Integration der ChIP und RIP Daten deuten auf eine Beteiligung von mutp53 an der
Ausbildung von transcription/processing factories hin............................................................... 100
5.3.5 RNA bindende Proteine bilden RNA-stabilisierte Komplexe mit mutp53 .......................... 101
5.4 MÖGLICHE BETEILIGUNG VON MUTP53 AM SPINDELKONTROLLPUNKT DER MITOSE .......................... 102
6 LITERATUR ..................................................................................................................................... 104
7 ANHANG .......................................................................................................................................... 121
7.1 LISTE DER DURCH CHIP-SEQ IDENTIFIZIERTEN DNA-FRAGMENTE .................................................. 121
7.2 LISTE DER DIFFERENTIELL REGULIERTEN GENE ZWISCHEN MIT PSUPSCR UND PSUPSHP53
TRANSFIZIERTEN METHA ZELLEN 24H NACH TRANSFEKTION ................................................................ 124
7.3 LISTE DER DURCH DIE RNA-IP IDENTIFIZIERTEN MUTP53 GEBUNDENEN TRANSKRIPTE .................... 125
7.4 LISTE DER IN MIT DSRNA EXPRESSIONSVEKTOREN TRANSFIZIERTEN IM VERGLEICH ZU ADHÄRENTEN
METHA ZELLEN HOCHREGULIERTEN GENE ......................................................................................... 127
7.5 LISTE DER IN MIT DSRNA EXPRESSIONSVEKTOREN TRANSFIZIERTEN IM VERGLEICH ZU ADHÄRENTEN
METHA ZELLEN HERUNTERREGULIERTEN GENE .................................................................................. 128
7.6 VEKTORKARTEN .......................................................................................................................... 129
7.6.1 pBluescript II sk (+) ............................................................................................................ 129
Inhaltsverzeichnis
III
7.6.2 pENTR/H1/TO ................................................................................................................... 129
7.6.3 pSuperior.neo.GFP ............................................................................................................ 130
7.7 SICHERHEITSTECHNISCHE DATEN...................................................................................... 131
7.7.1 Gefahrenstoffe ................................................................................................................... 131
7.7.2 Verzeichnis der Gefahrensymbole .................................................................................... 133
7.7.3 Verzeichnis der R- und S- Sätze ....................................................................................... 133
EIDESSTATTLICHE ERKLÄRUNG ................................................................................................... 135
DANKSAGUNG .................................................................................................................................. 136
Abkürzungsverzeichnis
ABKÜRZUNGSVERZEICHNIS
A
APC
APS
ARE
ARF
AS
ATM
ATP
ATR
BrdU
BS
BSA
bp
C
°C
CAK
CBB
cdk
cDNA
CTAB
ChIP
ChIP-Seq
C-Terminus
Cy
Cys
DAPI
ddNTPs
DEPC
DHB
DMEM
DMSO
DNA
DNase
dNTPs
dsRNA
DTE
DTT
dUTP
E1A
ECL
EDTA
FACS
FCS
G
GFP
Glu
Gly
GOF
HAT
HDAC
HEPES
hnRNA
Adenosin
Anaphase Promoting Komplex
Ammoniumperoxodisulfat
AU rich element
alternative reading frame
Aminosäure
Ataxia telangiectasia mutated
Adenosintriphosphat
ATM-related
Bromodesoxyuridin
Bindungsstelle
Bovines Serumalbumin
Basenpaare
Cytosin
Grad Celsius
CDK-aktivierende Kinase
coomassie brilliant blue
cyclin dependent kinase
copy DNA
N-cetyl-N,N,N-trimethylammoniumbromid (Cetavlon)
Chromatin Immunpräzipitation
Chromatin Immunpräzipitation-Sequenzierung
Carboxyl-Terminus
Cyanin
Cystein
4,6 Diamidino-2-phenylidol
Didesoxynukleotide
Diethylpyrocarbonat
2,5 Dihydroxybenzoesäure
Dulbecco’s Modified Eagle’s Medium
Dimethylsulfoxid
Desoxyribonukleinsäure
Desoxyribonuklease
Desoxynukleotide
doppelsträngige RNA
Dithioerythritol
Dithiothreitol
Desoxyuridintriphosphat
early region 1 A
Enhanced Chemoluminescence
Ethylendiamintetraessigsäure
Fluorescence Activated Cell Sorting
Fötales Kälberserum
Guanosin
Green Fluorescent Protein
Glutamin
Glycin
gain-of-function, Zugewinn von Funktionen
Histon-Acetylase
Histon-Deacetylase
(N-2-Hydroxyethyl)-piperazin-N’(2-ethansulfonsäure)
heterogene nukleäre RNA
IV
Abkürzungsverzeichnis
hnRNP
HPV
IAA
IEF
IgG
Ile
INK4
IPTG
IRES
kb
kDa
LB
LINE
LTR
LOH
M
MALDI ToF MS
MAR/SAR
MCS
Mdm2
Met
mg
min
ml
mRNA
mut
MW
nt
N-Terminus
OD
p.a.
PAGE
PBS
PCR
PGS
Phe
pI
pRb
PTGS
Pu
Py
RACE
RISC
RIP/ RNA-IP
RNA
RNAi
RNase
RPMI
rRNA
RT
RT-PCR
SAC
scr
SDS
SINE
heterogenes nukleäres Ribonukleoprotein
humanes Papillomvirus
Iodoacetamid
Isoelektrische Fokussierung
Immunglobulin G
Isoleucin
Inhibitors of cdk4
Isopropyl-β-D-thiogalaktopyranosid
internal ribosome entry site
Kilobasen
Kilodalton
Luria-Bertani
long interspersed nucleotide element
long terminal repeat
loss of heterozygosity
Molar
matrix assisted laser desorption/ionisation time of flight mass
spectrometry
nuclear matrix attachment region/scaffold attached region
multiple cloning site
Murine double minute 2
Methionin
Milligramm
Minute
Milliliter
messenger RNA
mutante(s)
molecular weight, Molekulargewicht
Nukleotide
Amino-Terminus
optische Dichte
pro analysis
Polyacrylamid Gelelektrophorese
Phosphat-gepufferte Kochsalzlösung
Polymerase Kettenreaktion
Protein G Sepharose
Phenylalanin
isoelektrischer Punkt
Retinoblastomaprotein
Posttranscriptional Gene Silencing
Purin
Pyrimidin
rapid amplification of cDNA ends
RNA-induced silencing complex
RNA-Immunipräzipitation
Ribonukleinsäure
RNA interference
Ribonuklease
am Roswell Park Memorial Institute entwickeltes Zellkulturmedium
ribosomale RNA
Raumtemperatur
reverse transcriptase PCR
spindle assembly checkpoint
scrambled
Natriumdodecylsulfat
short interspersed nucleotide element
V
Abkürzungsverzeichnis
siRNA
shRNA
SOB
SOC
SV40
T
TAE
TBST
TCA
TE
TEMED
Tris
TSS
UTR
UV
WAP
wt
w/v
v/v
X-Gal
small interfering RNA
short hairpin RNA
super optimal broth
super optimal broth, catabolite repression
Simian Virus 40
Thymidin
Tris-Acetat-EDTA
Tris-gepufferte Kochsalzlösung mit Tween 20
Trichloressigsäure
Tris-EDTA
N,N,N’,N’ Tetramethyl ethylendiamin
Trishydroxymethylaminomethan
Transkriptionelle Startstelle
untranslated region
Ultraviolette Strahlung
whey acidic protein
wildtyp
Gewicht pro Volumen
Volumen pro Volumen
5-Bromo-4-chloro-3-indolyl-β-D-galaktopyranosid
VI
Zusammenfassung
1
ZUSAMMENFASSUNG
Mutp53 Interaktom in einem murinen Tumorzellmodell
Missense Mutationen im p53 kodierenden Gen treten nicht nur häufig in humanen Tumoren
auf, sondern sind auch in spontan immortalisierten und chemisch transformierten murinen
Tumorzellen anzutreffen. Ähnlich wie bei menschlichen Zellen, findet eine Selektion für
bestimmte missense Trp53 Mutationen statt, die die Expression von mutantem p53
bedingen. Obwohl mutante p53 Proteine die Fähigkeit verloren haben, pro-apoptotische und
Wachstumsarrest auslösende Gene zu transaktivieren, können sie dennoch spezifisch mit
Nukleinsäuren und Proteinen interagieren und assoziieren mit Chromatin. Die Expression
von mutantem p53 wurde mit Tumor-unterstützenden Effekten in Verbindung gebracht, was
als sog. gain-of-function bekannt ist. Um die molekularen Wirkungsmechanismen von
mutp53 in einem murinen Tumorzellmodell zu untersuchen, wurde die mutp53 exprimierende
MethA Zelllinie verwendet, die aus einem Methylcholanthren induzierten Fibrosarkom einer
BALB/c Maus etabliert wurde.
Die Technik der RNA induzierten spezifischen Reduktion der Genexpression (RNAi) wurde
verwendet, um die mutp53 Expression zu dämpfen und das Verhalten der Zellen unter
mutp53 Defizit zu beobachten. Dazu wurden MethA Zellen mit einem Vektor transfiziert, der
die Expression einer p53 mRNA spezifischen- oder Kontroll-shRNA ermöglicht.
Obwohl der mutp53 Spiegel unmittelbar nach der Transfektion effektiv reduziert werden
konnte, war eine Expansion stabiler, mutp53-defizienter Klone nicht möglich. Mittels live cell
Imaging Mikroskopie konnte beobachtet werden, dass das Wachstum und Überleben von
MethA Zellen bereits durch die Expression einer Kontroll-shRNA dramatisch reduziert wird.
Durch die Reduktion von mutp53 wurde dieser Wachstumsarrest sogar noch potenziert. Die
mit pSUPshRNA transfizierten MethA Zellen weisen im Vergleich zu untransfizierten Zellen
eine stark erhöhte Expression zahlreicher Interferonantwort-assoziierter Gene wie Eif2ak2
(dsRNA abhängige Proteinkinase) und Oas2 (2‘-5‘ Oligonukleotidsynthetase 2) auf, deren
Aktivität höchstwahrscheinlich für den beobachteten Wachstumsarrest verantwortlich sind.
Die Grundvoraussetzung für eine detaillierte Analyse und Erklärung der Beobachtungen ist
die Identifikation funktioneller in vivo Partner von mutp53 und die Charakterisierung dieser
Interaktion. Für diesen Zweck wurden Techniken auf Genom-, Transkriptom- sowie Proteomebene verwendet. Durch die ChIP-Seq Methode, die die Identifizierung von mutp53
Bindungsstellen erlaubt, konnte festgestellt werden, dass mutp53 bevorzugt an repetitive
DNA Sequenzen bindet, die entfernt von transkriptionellen Startstellen kodierender Gene
liegen. Um den Einfluss von mutp53 auf die Transkription zu untersuchen, wurden die
Genexpressionprofile der transfizierten Zellen verglichen. Obwohl der Vergleich zwischen
den Effekten der Kontroll-shRNA und p53 shRNA wenig aufschlussreich war, da die
Zusammenfassung
2
Nebeneffekte der exogenen dsRNA überwogen, lieferte er einige Hinweise auf einen
positiven Einfluss von mutp53 auf den Fortgang der Mitose. Aufgrund vieler Indizien, die für
eine funktionelle Verbindung zwischen mutp53 und zellulärer dsRNA sprechen, wurde eine
RNA-Immunpräzipitation durchgeführt. Durch Sequenzanalyse der mutp53 assoziierten RNA
konnte eine Anreicherung nicht-kodierender, regulatorischer RNAs, nämlich B2-SINE
Transkripte und 3' UTR Transkripte identifiziert werden. Dies lieferte erste Hinweise auf eine
Beteiligung von mutp53 an der posttranskriptionellen Regulation. Diese Ergebnisse wurden
durch die Analyse der mutp53 assoziierten Proteine verstärkt. In mutp53 MultiproteinKomplexen wurden RNA bindende Proteine der hnRNP Familie, YB1 und Hsc70, die als
Ribonukleoprotein-Komplexen in funktionelle Domänen im Nukleus organisiert sind,
identifiziert.
Zusammenfassend lässt sich erkennen, dass DNA/RNA bindendes mutp53 Protein eine
strukturelle Komponente von Transkriptions- und Prozessierungseinheiten ist und durch die
Assoziation mit regulatorischen RNAs sowie RNA bindenden Proteinen an der Zelltyp- und
Kontextspezifischen Organisation des Chromatins beteiligt sein könnte. Diese Hypothese
wird auch durch die Bindung von mutp53 an MAR/SAR Elemente und anderen repetitiven
DNA-Elementen unterstützt.
Summary
3
SUMMARY
Mutp53 interactome in a mouse tumor cell model
Missense mutations in the gene encoding p53 are not only frequent genetic alterations in
human tumor tissue and cell lines, but also in spontaneously immortalized and chemically
transformed mouse cells. Similar to human cells, allelic selection for missense Trp53
mutations leads to the expression of mutant p53 (mutp53) proteins. Although mutp53
proteins have lost the transcriptional activity towards pro-apoptotic and growth arrest genes,
they can still undergo the specific interactions with nucleic acids and proteins characteristic
for wild-type p53 and are targeted to chromatin. The expression of mutp53 has been
connected to a gain-of-function by contributing to tumorigenesis.
To study the molecular mechanisms of the tumor-promoting and -supporting effect of mutp53
in a mouse tumor cell culture model, we used the mutp53 expressing MethA tumor cell line,
which was established from a methylcholanthrene-induced fibrosarcoma in BALB/c mice.
As a tool for studying mutp53 activity we used vector-driven expression of shRNA. Although
mutp53 down-regulation was efficient immediately after transfection, none of the cells with a
reduced mutp53 level could be expanded into stable clones.
With the live cell imaging microscopy technique it could be observed that the transfection
with dsRNA has a dramatic effect on the growth and survival of MethA cells. The reduction of
mutp53 even potentiates the growth arrest. In contrast to untransfected MethA cells the
transfection with dsRNA results in a dramatic increase in expression of genes, which are
functionally related to the interferon pathway, e.g. PKR and 2'-5' OAS2, which are very likely
responsible for the observed arrest and death of MethA cells.
The prerequisite for a detailed molecular analysis is the identification of functional in vivo
binding partners of mutp53 and the characterization of these interactions. For this purpose
we took advantage of three techniques: genome-wide ChIP-Seq, RNA co-IP (RIP), and
protein co-IP. Applying the ChIP-Seq Technique we observed that most mutp53 binding sites
are rich in repetitive DNA sequences, and are distantly localized from the transcriptional start
sites of coding genes. To study the influence of mutp53 on transcription, the gene expression
profiles of dsRNA transfected cells were compared. Although this comparison was not very
informative due to the dramatic unspecific effects of dsRNA, there are some hints of an
involvement of mutp53 in the progression of mitosis.
As much evidence points to a functional connection between mutp53 and cellular dsRNA, an
RIP was performed subsequently. It was observed that mutp53-bound transcripts are
strongly enriched in non-coding regulatory RNA: B2-type SINEs and solitary 3’-UTR
Summary
4
transcripts. This observation points to a posttranscriptional regulation by mutp53. This
indication is further corroborated by the analysis of mutp53 bound proteins.
In mutp53-containg protein complexes a large group of RNA interacting proteins were found
by co-IP including members of the hnRNP family, YB1 and Hsc70, which are organized in
the nucleus into functional domains and complexes stabilized via RNA. These observations
provide a basis for a working model according to which the DNA/RNA binding mutp53 protein
is a structural component of transcription/processing factories. Through the association with
regulatory RNAs and with RNA binding proteins a function of mutp53 in the cell- and context
specific 3D organization of chromatin can be postulated. This hypothesis is supported by the
binding of mutp53 to MAR/SAR elements and repetitive DNA-elements.
Einleitung
5
1 EINLEITUNG
1.1 Grundlagen der Tumorgenese
Krebserkrankungen stellen mit jährlich mehr als 400.000 neu diagnostizierten Fällen allein in
Deutschland nach den Herz-Kreislauferkrankungen die zweithäufigste Erkrankung in den
westlichen Industrienationen dar. Die molekularen Ursachen und Mechanismen der
Tumorentstehung sowie -progression zu verstehen, bildet die Grundlage jeder gezielten
Therapie und beschäftigt tausende Forscher weltweit. Das Genom ist unentwegt endogenen
Schäden
wie
spontaner
Depurinierung,
intrazellulären
durch
den
Metabolismus
entstehenden (Sauerstoff-) Radikale, Verkürzung der Telomere und Fehlerrate der
Polymerase sowie exogenen schädigenden Einflüssen wie UV-Strahlung, Höhenstrahlung
und chemisch-genotoxischen Agentien ausgesetzt. Demgegenüber steht einer Zelle das
DNA Reparatursystem bzw. das Apoptoseprogramm bei irreparablen Schäden als Schutz
gegen genomische Schäden zur Verfügung. Die Integrität der Zelle wird durch Zellteilung,
Differenzierung
und
Wachstum
einerseits
und
Zelltod
andererseits
erzeugt
und
aufrechterhalten. Trotz aller Schutzmechanismen können sich Mutationen mit einer Rate von
ca. 1,4 x 10-10 Mutationen/Nukleotid/Generation (Loeb, 1991) bzw. 10-7/Zelle/Generation
(Elmore, Kakunaga, and Barrett, 1983) manifestieren. Dies entspricht etwa drei Mutationen
pro Zelle in ihrer Lebensspanne. Dagegen wird die Zahl von Mutationen, die zur Entstehung
eines Tumors nötig ist, auf sechs bis neun Mutationen pro Zelle geschätzt (Sugimura et al.,
1992; Vogelstein et al., 1988).
β-Catenin
Axin
Normales
Epithel
Genomische
Instabilität
Aberrante
Foci
Frühes
Adenom
K-ras
fortgeschrittenes
Adenom
Smad4
spätes
Adenom
p53
Weitere
Veränderungen
Karzinom
Metastasen
„Two Hits“
APC
Abbildung 1 Genetisches Modell der Tumorprogression am Beispiel des Kolonkarzinoms nach
Fearon und Vogelstein.
Alle malignen Tumore weisen Störungen der Proliferations- und Zelltodkontrolle auf, die im
Gegensatz zur Normalzelle ein unbegrenztes Wachstumspotential, Immortalität, Invasion in
benachbarte Gewebe aufgrund fehlender Kontaktinhibition und Metastasierung in andere
Organe bedingen. Diese Eigenschaften werden nach dem Mehrschritt-Karzinogenese-Modell
am Beispiel des Kolonkarzinoms nach Fearon und Vogelstein (Abb. 1) (Fearon and
Vogelstein, 1990) durch klonale Evolution und Selektion von Zellen erworben, die sukzessive
Einleitung
6
wichtige Onkoproteine durch Mutationen aktivieren bzw. Tumorsuppressorproteine durch
Deletion oder Mutation inhibieren und dadurch einen Wachstumsvorteil gegenüber
benachbarten Zellen erhalten (Hernandez-Boussard, Montesano, and Hainaut, 1999).
Dementsprechend basiert der Prozess der Tumorentstehung auf einem Komplex
miteinander verknüpfter genetischer und epigenetischer Veränderungen.
Ein weiterer Aspekt der Tumorgenese wird durch das Stammzell-Modell der Tumorgenese
(Weissman, 2005) beschrieben. Diese Hypothese beruht auf der Ähnlichkeit der
Eigenschaften von Tumorzellen und Stammzellen, wie der Kapazität zur Selbsterneuerung,
der Bildung heterogener Populationen sowie der Fähigkeit zur Migration und Invasion in
umgebendes Gewebe. Nach dieser Hypothese besitzt eine Subpopulation der Zellen eines
Tumors Stammzell-Charakteristika. Nicht erfolgreiche Therapien bzw. Rückfälle beruhen
demnach auf einer ineffektiven Behandlung dieser Zellen (Dean, Fojo, and Bates, 2005;
Eckfeldt, Mendenhall, and Verfaillie, 2005). Charakteristisch für Malignome sind darüber
hinaus Abweichungen vom Chromosomensatz, die als Aneuploidie bezeichnet werden. Die
Aneuploidie könnte essentielle Grundvoraussetzung der akkumulierten genetischen
Veränderungen sein und die Tumorinitiation bedingen (mutator phenotype) (Duesberg and
Li, 2003) (s. Abb. 2).
Abbildung 2 Chromosomales Modell der Tumorentstehung und -entwicklung durch Selektion von
aneuploiden Zellen nach Duesberg.
Dieser Theorie der Tumorentstehung zufolge verursachen Karzinogene unspezifische
Veränderungen der normalen Chromosomenzusammensetzung und verändern dadurch die
Genexpression. Allerdings reicht Aneuploidie alleine nicht aus, um die weitere Progression
bis hin zu klinisch relevanten Tumoren zu beschreiben, da unkontrollierte Aneuploidie die
Tumorprogression verhindern würde. Beispielsweise scheinen Zell-Zell-Fusionen nötig zu
sein, um einer Tumorzelle die Eigenschaft der Metastasierung zu verleihen (Parris, 2006).
Um Krebspatienten künftig gezielt und mit einer höheren Wahrscheinlichkeit erfolgreich
Einleitung
7
therapieren zu können, scheint eine individuelle Analyse der genetischen Veränderungen
notwendig zu sein.
1.2 Onkogene und Tumorsuppressorgene
Die Produkte von Proto-Onkogenen (z.B. c-MYC, RAS) erfüllen in der Normalzelle wichtige
Aufgaben
bei
der
Wachstumsregulation
als
Wachstumsfaktoren,
intrazelluläre
Signalüberträger oder Transkriptionsfaktoren und sind evolutionär hoch konserviert. Durch
Mutationen von Proto-Onkogenen zu Onkogenen können diese dominant aktiviert werden,
was zu einer unkontrollierten Proliferation der Zelle führen und eine Tumorentstehung
initiieren kann (Bishop, 1991; Fearon and Vogelstein, 1990; Weinberg, 1989). Im Gegensatz
zu Proto-Onkogenprodukten üben die Produkte von Tumorsuppressorgenen (z.B. P53, pRB,
APC) eine inhibitorische Wirkung auf die Zell-Proliferation aus. Tumorsuppressoren können
je nach zellulärer Funktion in sogenannte Gatekeeper (direkte wachstumshemmende
Proteine), Caretaker (indirekte wachstumsinhibierende Wirkung durch Induktion von DNA
Reparatur geschädigter Zellen oder Prävention von genomischer Instabilität) und
Landscaper (Modulation der Mikroumgebung von Tumoren) eingeteilt werden (Macleod,
2000). Nach der Two Hit Hypothese von Knudson (Knudson, 1986) müssen beide Allele
inaktiviert werden, um eine Tumorprogression zu begünstigen, da diese rezessiv wirken
(Loss of heterozygosity, LOH) (Levine, 1993). Zahlreiche familiäre Krebssyndrome gehen auf
die Inaktivierung eines Allels von einem Tumorsuppressorgen in der Keimbahn zurück. Die
Wahrscheinlichkeit einer Inaktivierung des zweiten Allels und damit die Tumorentstehung ist
bei diesen Menschen um ein Vielfaches höher, weshalb diese Individuen zur Tumorbildung
prädisponiert sind.
1.3 Das Tumorsuppressorprotein p53
1.3.1 Historischer Rückblick
Das Tumorsuppressorprotein p53 ist in etwa 40% aller Karzinome mutiert und steht aufgrund
seiner wichtigen Funktion als „Wächter des Genoms“ - mit fast 45.000 Publikationen weltweit
- seit fast drei Jahrzehnten im Mittelpunkt der Krebsforschung. P53 wurde erstmals 1979 im
Komplex mit dem viralen T-Antigen in SV-40 transformierten Zellen entdeckt (DeLeo et al.,
1979; Kress et al., 1979; Lane and Crawford, 1979; Linzer, Maltzman, and Levine, 1979).
Das humane p53-Protein besteht aus 393 Aminosäuren, die vom 20 kb p53-Gen, welches
auf Chromosom 17p13.1 lokalisiert ist und aus 11 Exonen besteht, kodiert werden. Bei der
Maus ist p53 auf dem Chromosom 11q21-q22 lokalisiert und kodiert für 390 Aminosäuren
(Czosnek et al., 1984; Le Beau et al., 1985; Rotter et al., 1984). Seinen Namen verdankt p53
einem durch Anhäufung von helixbrechenden Prolin-Resten im N-Terminus verursachten
aberranten Laufverhalten in der SDS-PAGE bei 53 kDa, obwohl es ein Molekulargewicht von
43,5 kDa besitzt (Oren, 1985). Da in frühen Studien gezeigt wurde, dass p53 embryonale
Einleitung
8
Rattenzellen immortalisieren (Jenkins, Rudge, and Currie, 1984) und in Kooperation mit
aktiviertem Ras-Onkogen Fibroblasten transformieren kann (Eliyahu et al., 1984), wurde p53
zunächst als Onkoprotein klassifiziert. 1989 entdeckte man jedoch, dass diese Versuche
nicht mit Wildtyp-p53 (wtp53), sondern mit mutiertem p53 (mutp53) durchgeführt wurden
(Finlay, Hinds, and Levine, 1989; Hinds, Finlay, and Levine, 1989). Wtp53 dagegen
supprimiert die zelluläre Transformation, und die Tumorsuppressorfunktion von wtp53 ist in
einem großen Teil humaner Tumoren ausgeschaltet. Dementsprechend wurden die
Aussagen revidiert und p53 als Tumorsuppressorgen eingestuft.
1.3.2 Struktur von p53
Das p53-Protein besteht aus zwei aminoterminalen Transaktivierungsdomänen (AS 1-40 und
41-83), einer Prolin-reichen Sequenz (61-94) einer sequenzspezifischen DNA bindenden
Domäne (102-292), einer Kernlokalisationssignale enthaltende Domäne (326-355), einer
Oligomerisierungsdomäne (323-356) sowie einer carboxyterminalen sequenzunspezifischen
DNA bindenden Domäne (363-393). Die aminoterminale Transaktivierungsdomäne ist durch
Interaktion mit den elementaren Transkriptionsfaktoren TFIID und TBP charakterisiert (Lu
and Levine, 1995; Thut et al., 1995). Für die Transaktivierung sind die zwei Aminosäuren
Leuzin 22 und Tryptophan 23 entscheidend, da Mutationen beider Aminosäuren zusammen
mit einer DNA Bindungsmutation in der Aminosäure 281 zum Verlust der Transaktivierungseigenschaft führt (Lin et al., 1994). Die aminoterminale Domäne zeichnet sich weiterhin
durch
das
gehäufte
Vorkommen
saurer
Aminosäuren
und
durch
verschiedene
Phosphorylierungsstellen aus, die eine wichtige Rolle bei der p53-Stabilisierung spielen
(Fields and Jang, 1990; Raycroft, Wu, and Lozano, 1990). Hier befindet sich darüber hinaus
die Bindungsstelle für die Interaktion mit dem negativen Regulator und Onkoprotein Mdm2
(mouse double minute chromosome 2; humanes Homolog: HDM2), welches für eine strikte
Kontrolle des intrazellulären p53 Spiegels sorgt (Momand et al., 1992; Oliner et al., 1993).
Mdm2 wird einerseits durch p53 transaktiviert und leitet andererseits die proteolytische
Degradation von p53 durch den Ubiquitin-Proteasom Signalweg ein. p53 und Mdm2 sind
demnach über einen negativen Rückkopplungsmechanismus verbunden (Haupt et al., 1997;
Kubbutat, Jones, and Vousden, 1997; Perry et al., 1993; Wu et al., 1993). Mdm2 vermag
auch seine eigene Degradation durch Autoubiquitinierung zu induzieren. P53 induziert ferner
die Expression des Wip-1 Gens (Fiscella et al., 1997), ein weiterer negativer Regulator,
welcher für eine Phosphatase kodiert, die die p53 aktivierende p38 MAP Kinase durch
Dephosphorylierung inhibiert (Takekawa et al., 2000). Außerdem wird p53 durch das p53
Zielgen Zyklin G, welches mit der Phosphatase PP2A Mdm2 dephosphoryliert (Okamoto et
al., 2002) und damit aktiviert, negativ reguliert. Es wurden außer Mdm2 weitere E3
Ubiquitinligasen Pirh2 und COP1 für p53 entdeckt, die ebenfalls transkriptionell von p53
aktiviert werden (Dornan et al., 2004; Leng et al., 2003). Andererseits kann p53 auch durch
Einleitung
9
die Aktivität von HAUSP deubiquitiniert werden (Li et al., 2002). Die Funktion von p53 als
sequenzspezifischer Transkriptionsaktivator wird durch die hydrophobe DNA Bindungsdomäne vermittelt, die innerhalb der Vertebraten hoch konserviert ist, was die Bedeutung
dieser Domäne unterstreicht (el-Deiry et al., 1992; Friedman et al., 1993). Die Struktur der
DNA Bindungsdomäne wird von zwei Schichten antiparalleler β-Faltblätter bestimmt, welche
die Grundlage für mehrere Schleifen aus α-Helices bilden. Diese Schleifen binden die DNA
in der großen und kleinen Furche. Das Motiv wird teilweise durch ein tetraedrisch
koordiniertes Zinkatom stabilisiert (Cho et al., 1994). Onkoproteine kleiner DNA Tumorviren,
wie SV40-, Adeno- und Papillomaviren binden ebenfalls an diese Domäne. Ein großer Teil
der aktivierten Zielgene enthält im Promotorbereich eine Konsensussequenz, die von p53
gebunden
wird.
Diese
besteht
aus
zwei
Dekameren
der
Sequenz
5'-
PuPuPuC(A/T)(A/T)GPyPyPy-3', die bis zu 13 bp voneinander getrennt sein können (el-Deiry
et al., 1992). Des Weiteren bildet die Sekundärstruktur der DNA ein wichtiges Kriterium für
eine spezifische Bindung von p53 (Kim, Albrechtsen, and Deppert, 1997). Neben der
sequenzspezifischen
DNA-Bindung
ist
auch
die
3‘-5‘
Exonukleaseaktivität
in
der
Kerndomäne lokalisiert (Mummenbrauer et al., 1996). Die vorwiegend basische carboxyterminale Region von p53 beinhaltet die Oligomerisierungsdomäne von p53 Monomeren
(Sturzbecher et al., 1992), die nicht sequenzspezifische oder strukturspezifische DNA
Bindungsdomäne (Jeffrey, Gorina, and Pavletich, 1995), drei Kernlokalisationssignale
(Shaulsky et al., 1991), eine Domäne zur Bindung an einzelsträngige DNA Enden (Bakalkin
et al., 1995), sowie eine Bindungs-Plattform für Proteininteraktionen (Ahn and Prives, 2001).
1.3.3 Modifikationen von p53
In der Abbildung 3 sind zusätzlich zur Struktur zahlreiche potentielle posttranslationelle
Modifikationen wie Phosphorylierung, Acetylierung und Sumoylierung an den N- und Cterminalen Enden des Proteins dargestellt, die die Situation komplexieren. Diese
Modifikationen werden durch Stress-induzierte regulatorische Enzyme wie ATM, ATR,
CHK2, HIPK2, p300, PCAF, SUMO1 und PIN1 übertragen und modulieren dadurch den p53
Signalweg. Beispielsweise phosphoryliert die ATM-Kinase nach DNA Schäden durch
ionisierende Strahlung p53 an Serin 15, welches zur Akkumulation von p53 führt (Banin et
al., 1998; Canman et al., 1998; Kastan et al., 1992). Wie die Modifikation von p53 an den
bekannten
Phosphorylierungs-/Dephosphorylierungsstellen
und
Acetylierungs-/De-
acetylierungsstellen in vivo zur Antwort von p53 auf DNA Schäden beiträgt, bleibt eine offene
Frage. Zunächst wurde vermutet, dass die sequenzspezifische DNA Bindung von p53 durch
Signalwege nach DNA Schädigung verstärkt wird (Latenzmodell). Dies wurde durch
Modifizierung der carboxyterminalen 30 Aminosäuren durch Deletion, Phosphorylierung
durch Caseinkinase II, Proteinbindung durch hsp70 oder den Antikörper Pab421 belegt, die
Einleitung
10
alle zu einer Aktivierung der sequenzspezifischen DNA Bindung führen (Hupp and Lane,
1995; Hupp et al., 1992; Hupp, Sparks, and Lane, 1995).
Abbildung 3 Schematische Darstellung des Tumorsuppressors p53 (nach: Anderson und Appella,
2007) p53 wird vor allem am Amino- und am Carboxy-Terminus posttranslational durch
Phosphorylierung, Acetylierung und Sumoylierung modifiziert. Die zentrale DNA Bindungsdomäne, die
für die Transaktivierungsaktivität von p53 essentiell ist, weist die größte Sequenzkonservierung auf.
p53 interagiert weiterhin mit einer Reihe von Proteinen.
Die Aktivierung der DNA Bindung wird außerdem durch die Modifizierung der 30
carboxyterminalen AS z.B. Phosphorylierung durch Proteinkinase C (Takenaka et al., 1995),
Dephosphorylierung von Ser376 und Bindung an 14-3-3 (Waterman et al., 1998),
Acetylierung durch p300/CBP (Gu and Roeder, 1997), Bindung an Ref-1 (Jayaraman et al.,
1997), Bindung an c-abl (Nie et al., 2000), Sumoylierung (Gostissa et al., 1999; Rodriguez et
al., 1999), Bindung an S100β (Lin et al., 2001) oder Bindung an kurze Segmente
einzelsträngiger DNA erreicht (Jayaraman and Prives, 1995; Okorokov, Ponchel, and Milner,
1997). Demnach scheint der C-terminus für die Modulation der sequenzspezifischen DNA
Bindung verantwortlich zu sein und könnte die Latenz von p53 erklären, die erst durch
aktivierende
Signale
aufgehoben
wird.
Auf
der
anderen
Seite
konnten
weitere
Arbeitsgruppen herausfinden, dass die Bindung von p53 an DNA unabhängig von p53
aktivierenden Signalwegen ist. Untersuchungen zeigten, dass p53 in vivo an genomische
DNA bindet, obwohl keine aktivierenden Signale vorhanden sind (Espinosa and Emerson,
Einleitung
11
2001; Kaeser and Iggo, 2002). Dies lässt vermuten, dass andere Faktoren/Koregulatoren,
die mit p53 kooperieren, reguliert werden, um die Aktivität von p53 zu modulieren.
1.3.4 Funktion von p53
In normalen, ungestressten Zellen liegt p53 in geringen Mengen (1000-10.000 wtp53
Moleküle pro Zelle) mit einer Halbwertszeit von etwa 10-20 min in einem latenten Zustand
vor (Oren, Maltzman, and Levine, 1981; Patschinsky and Deppert, 1990). Es sorgt für die
Integrität des Genoms, indem es direkt an der Reparatur von DNA Schäden beteiligt ist und
die fehlerhafte Replikation der DNA verhindert (Janus et al., 1999). P53 nimmt außerdem
durch Protein-Protein Wechselwirkung und seine intrinsische 3‘-5‘ Exonukleaseaktivität
Einfluss auf DNA Reparatur, Rekombination und Replikation (Akyuz et al., 2002; Albrechtsen
et al., 1999; Janz and Wiesmuller, 2002; Susse et al., 2000; Zink et al., 2002). Die
Konzentration von p53 wird auf verschiedenen Ebenen der Transkription, Translation,
subzelluläre Lokalisation, Stabilität und Aktivität strikt kontrolliert. Für die biochemische
Wirkung von p53 ist die Oligomerisierung (Tetramerisierung) eine Voraussetzung. Nach
Zellschädigung durch diverse Stimuli wie DNA Schäden, onkogenen Stress, Hitzeschock
(Ohnishi et al., 1996), Hypoxie (Graeber et al., 1994), Glukosemangel, Schäden am
mitotischen Spindelapparat (Cross et al., 1995), Ribonukleotiddepletion (Linke et al., 1996),
Stickoxidexposition (Forrester et al., 1996) und Defekten der DNA Methylierung (Soussi and
Beroud, 2001) wird eine Erhöhung der wtp53 Konzentration durch verschiedene
Mechanismen erreicht, wie z.B. das Ablösen von p53 von seiner autoregulatorisch
inhibierten mRNA (Mosner et al., 1995) und durch posttranslationale Modifikationen
stabilisiert (Maltzman and Czyzyk, 1984), die vermutlich die Interaktion von p53 mit Mdm2
unterbinden. Generell werden höhere p53 Konzentrationen durch reduzierte Degradation
statt erhöhter Neusynthese erreicht (Levine, 1997). P53 kann einen temporären
Zellzyklusarrest, der die Reparatur von DNA Schäden ermöglicht, einen irreversiblen
Zellzyklusarrest,
terminale
Differenzierung,
Seneszenz
oder
die
Apoptose,
den
programmierten Zelltod veranlassen. Der Verlust von p53 geht mit einer erhöhten
Mutationsrate und genomischen Instabilität einher. Die Aktivierung verschiedenster p53
Zielgene scheint abhängig zu sein von Stimulus, Ausmaß der Schäden, Vorhandensein von
Wachstumsfaktoren, Zelltyp und zellulärem Kontext, da immer noch ungeklärt ist, warum
manche Zellen durch Apoptose eliminiert werden und p53 bei anderen dagegen einen
Zellzyklusarrest
veranlasst.
Hinzu
kommt,
dass
p53
eine
unterschiedliche
Promotorselektivität für seine Zielgene besitzt und darüber hinaus die Expression mancher
Gene reprimieren kann (Ho and Benchimol, 2003). Beispielsweise bewirkt onkogener Stress
durch deregulierte Expression von c-myc, ras, E1A oder β Catenin (Bates et al., 1998; Stott
et al., 1998) eine Aktivierung von ARF (alternative reading frame) (Prives and Hall, 1999;
Sharpless and DePinho, 1999; Sherr, 1998), welches Mdm2 negativ reguliert und somit die
Einleitung
12
Degradation von p53 verhindert. Dagegen werden durch DNA Schäden die Kinasen ATM
(Ataxia telangiectasia mutated) und CHK2 (cell cycle checkpoint kinase) aktiviert (Bell et al.,
1999), die Mdm2 sowie p53 phosphorylieren und dadurch eine verstärkte Interaktion von p53
mit dem Transkriptionskoaktivator p300 hervorrufen (Dornan et al., 2003).
Abbildung 4 Stark vereinfachte Darstellung des p53 Signalwegs, in der durch diverse Stressfaktoren
über Mediatoren und Effektoren p53 aktiviert wird und durch die Aktivierung von Transduktoren die
Angiogenese, den Wachstumsarrest, DNA Reparatur oder Apoptose auslösen kann (http://p53.free.fr).
P53 besitzt zudem die Eigenschaft, die Relaxation von Chromatin durch Rekrutierung von
HATs (Histonacetylasen) zu induzieren (Espinosa and Emerson, 2001; Rubbi and Milner,
2003), was auf eine Beteiligung von p53 an der globalen Umstrukturierung des Chromatins
(chromatin remodeling) und damit der Genregulation hindeutet. Darüber hinaus ist für p53
auch eine Rolle als RNA bindendes Protein bekannt (Samad and Carroll, 1991), z.B. die
Bindung an 5,8S rRNA (Fontoura et al., 1992), einzelsträngige RNA (Oberosler et al., 1993),
seine eigene mRNA (Mosner et al., 1995) und den 5´UTR von cdk4 (Miller et al., 2000).
1.3.4.1 G1 Arrest
P53 ist Teil eines Kontrollmechanismus, der das Fortschreiten des Zellzyklus an die Integrität
der DNA koppelt. Beim G1 Arrest steht die Transaktivierung des p21 Proteins, eines
Inhibitors zyklinabhängiger Kinasen (cyclin dependent kinase; CDK), im Vordergrund
(Brugarolas et al., 1995; Deng et al., 1995; Dulic et al., 1994; el-Deiry et al., 1993; Harper et
al., 1993; Waldman, Kinzler, and Vogelstein, 1995; Xiong et al., 1993). Ein Fortschreiten des
Zellzyklus von der G1 in die S Phase wird durch die Inhibition von Cyclin D-CDK 4/6 sowie
Einleitung
13
Cyclin E-CDK 2 Komplexen verhindert, da das Retinoblastomprotein pRB nicht sukzessive
durch die genannten Komplexe phosphoryliert werden kann. Die von hypophosphoryliertem
pRB gebundenen Transkriptionsfaktoren E2F können dadurch nicht freigesetzt werden und
Gene transaktivieren, deren Produkte zur Einleitung der S Phase benötigt werden (Dowdy et
al., 1993; Ewen et al., 1993; Hinds et al., 1992). Die p53 Zielgene Btg2, Gadd45 und Mcg10
sind zusätzlich im p53 abhängigen G1 Arrest involviert (Guardavaccaro et al., 2000; Kastan
et al., 1992; Lim et al., 1998; Rouault et al., 1996; Smith et al., 1994; Zhu and Chen, 2000).
Durch die Aktivierung von p21 können im Verlauf des Zellzyklusarrests in der G1 Phase DNA
Schäden behoben werden.
1.3.4.2 S Phase Arrest
Ein intra-S Arrest wird durch Δp53 vermittelt, ein alternativ gespleisstes p53 Protein, dem die
Exone 7 bis 9 fehlen und welches den intra-S Kontrollpunkt durch Induktion von p21 und 143-3s induziert (Rohaly et al., 2005). Die Signifikanz dieser Daten ist allerdings noch unklar
(Bourdon, 2007).
Die DNA Replikation wird durch die Bindung von p21, welches p53 abhängig aktiviert wird,
an PCNA (proliferating cell nuclear antigen) gestoppt (Waga et al., 1994). Während der DNA
Synthese kolokalisiert PCNA mit dem Replikationsfaktor C (RPC) an die DNA und rekrutiert
die Polymerase δ zur Elongation (Melendy and Stillman, 1991). Durch p21 Bindung werden
PCNA und die DNA Synthese inhibiert, während die Reparatur-DNA Synthese durch die
Polymerasen δ oder ε auch in Anwesenheit von p21 erfolgen kann (Li et al., 1994).
1.3.4.3 G2 Arrest
Im Vordergrund des p53 vermittelten G2 Arrests steht die transkriptionelle Aktivierung des
Zielgens 14-3-3σ, welches den Zyklin B- CDK 1 Komplex bindet und ins Cytoplasma
sequestriert (Hermeking et al., 1997). Dadurch wird das Fortschreiten zur Mitose
unterbunden. Des Weiteren wirkt die Kinase Wee1 der Phosphorylierung des Zyklin B- CDK
1 Komplexes durch die Phosphatase Cdc25C entgegen (Chan et al., 1999; Peng et al.,
1997). Am G2/M Arrest ist auch das p53 Zielgen Gadd45 beteiligt, dessen Produkt
beispielsweise mit cdc2 und PCNA interagiert
(Smith et al., 1994; Zhan et al., 1999).
Zusätzlich assoziiert p21 in der späten G2 Phase des Zellzyklus mit den Zyklin A und B
Komplexen (cdc2-cyclin B) und verhindert die Aktivierung durch die Kinase CAK (cyclin
activating kinase) (Poon et al., 1996). An der Aufrechterhaltung des G2/M Arrest sind
außerdem die p53 Zielgene Gadd45, BTG2, MCG10, REPRIMO, B99 und HZF beteiligt.
1.3.4.4 Apoptose
Die Apoptose verursacht die Eliminierung einer Zelle nach irreparabler Schädigung und dient
damit der Bewahrung der Integrität des Gewebeverbands (Clarke et al., 1993; Lowe et al.,
Einleitung
14
1993; Ryan et al., 1993; Shaw et al., 1992; Yonish-Rouach et al., 1991). Man unterscheidet
zwischen dem intrinsischen und dem extrinsischen Signalweg. Der intrinsische Signalweg
wird durch UV oder γ Strahlung verursachte DNA Schäden, toxische Agentien, oxidativen
oder metabolischen Stress eingeleitet, während der extrinsische Signalweg über die
Aktivierung von Todesrezeptoren (TNF death receptor) verläuft. Letztlich führen beide
Signalwege zur Aktivierung von Caspasen, die die Kondensierung der Zelle und deren
Fragmentierung verursachen. P53 aktiviert sowohl den intrinsischen als auch extrinsischen
Apoptoseweg. Durch Aktivierung von Bax und Reprimierung der Transkription von Bcl2 wird
das Verhältnis zwischen pro- und antiapoptotischen Bcl2 Proteinen zugunsten der
proapoptotischen Proteine verschoben (Miyashita and Reed, 1995), welches zur
Permeabilisierung der mitochondrialen Membran und Freisetzung von Cytochrom C (Schuler
et al., 2000) und APAF-1 führt und die Caspasekaskade (Caspase 9, 6 und 3) auslöst
(Jurgensmeier et al., 1998). Nukleäres p53 induziert außerdem die Expression der
proapoptotischen Gene (Chao et al., 2000; Jimenez et al., 2000) PUMA (Jeffers et al., 2003;
Nakano and Vousden, 2001; Villunger et al., 2003; Yu et al., 2001), NOXA (Oda et al.,
2000a; Shibue et al., 2003; Villunger et al., 2003), BID, APAF-1, DR5, p53AIP1 (Oda et al.,
2000b), Bax (Miyashita and Reed, 1995), PERP (Ihrie et al., 2003), Pidd/Lrdd (Lin, Ma, and
Benchimol, 2000), p53DINP1 (Okamura et al., 2001), PAC1 (Yin et al., 2003), UNC5H2
(Tanikawa et al., 2003) und TSAP6 (Passer et al., 2003). Obwohl die meisten Funktionen
von p53 als Transkriptionsfaktor vermittelt werden, gewinnen transkriptionsunabhängige
Aktivitäten immer mehr an Bedeutung. Zum Beispiel weist zytoplasmatisches p53 eine
transkriptionsunabhängige proapoptotische Aktivität auf, indem es direkt an Bcl-Xl in den
Mitochondrien bindet (Chipuk and Green, 2006; Moll, Marchenko, and Zhang, 2006). Sowohl
Bax, Noxa, PUMA und p53AIP1 sind in Mitochondrien lokalisiert und assoziieren mit Bcl2.
Wtp53 transaktiviert außerdem die Expression des Todesrezeptors CD95/APO/Fas (OwenSchaub et al., 1995), während dieser Rezeptor von mutp53 reprimiert wird (Miyashita et al.,
1994).
1.3.4.5 Differenzierung
Aus verschiedenen Arbeiten geht hervor, dass p53 eine Rolle in der Differenzierung von
Zellen spielt, welche zur Tumorsuppressoraktivität beiträgt und damit die Generation
genetisch veränderter Zellen verhindert (Stiewe, 2007). Die genomische Integrität wird
schließlich auch bewahrt, wenn Zellen aus dem proliferativen Pool von Zellen
ausgeschlossen werden. So kann die Expression von wtp53 in undifferenzierten Zellen ihre
Differenzierung auslösen (Li et al., 1998c; Lin et al., 2005). Dabei stellt die Seneszenz
ebenfalls einen Aspekt der Differenzierung dar. Die p53 Familienmitglieder p63 und p73 sind
evolutionäre Vorgänger von p53 und besitzen vor allem in der Embryonalentwicklung und
der Kontrolle der Differenzierung eine wichtige Funktion. Die Rolle von p53 in der
Einleitung
15
Differenzierung wurde bislang vernachlässigt, da p53 knockout Mäuse sich relativ normal
entwickeln, was allerdings auch auf die kompensatorische Wirkung durch die anderen p53
Familienmitglieder p63 und p73 zurückzuführen sein könnte. In vielen menschlichen
Tumoren kann zudem eine Korrelation zwischen der Expression von mutantem p53 und
geringem Differenzierungsgrad beobachtet werden.
1.3.4.6 Seneszenz
Die zelluläre Seneszenz stellt einen durch DNA Schäden oder Aktivierung von Onkogenen
ausgelösten permanenten Zellzyklusarrest von metabolisch aktiven Zellen in vitro in der G1
Phase des Zellzyklus dar, deren replikatives Potential erschöpft ist (Schmitt et al., 2007).
Diese
Zellen
sind
durch
eine
veränderte
Morphologie,
Physiologie
und
Gen-
expressionsmuster charakterisiert. P53 ist in Kooperation mit Rb2 an der Induktion von
zellulärer Seneszenz durch die Repression der Zyklin E und A Promotoren beteiligt. Bei
intaktem p53-Rb2 Signalweg kann in p16 negativen Zellen die Tumorprogression durch
Induktion zellulärer Seneszenz unterbunden werden (Helmbold, Deppert, and Bohn, 2006;
Kapic et al., 2006). Dieser Arrest kann durch die Inaktivierung dieser essentiellen
Tumorsuppressoren p53 oder pRb aufgehoben werden (Counter et al., 1992).
1.4 Mutantes P53: Zugewinn onkogener Eigenschaften
1.4.1 Art und Häufigkeit von Mutationen in p53
Mutationen im p53 Gen (mutp53) werden in 20-40% aller humanen Malignome gefunden
(Baker et al., 1990; Beroud and Soussi, 1998; Finlay, Hinds, and Levine, 1989; Olivier et al.,
2002; Vogelstein, Lane, and Levine, 2000). In 30% der Sarkome sowie zum Teil auch in
anderen Malignomen ist Mdm2 amplifiziert, welches ebenfalls die p53 Funktion eliminiert
(Freedman, Wu, and Levine, 1999). In anderen wtp53 exprimierenden Tumoren wiederum
sind dagegen Defekte in der Expression des Tumorsuppressors und Mdm2 Antagonisten
p14ARF (Maushomolog: p19ARF; (Sherr, 2001) oder Mutationen in Kinasen, wie
beispielsweise ATM oder Chk2 zu beobachten (Bartek, Falck, and Lukas, 2001; Dasika et
al., 1999). Demnach ist die wtp53 Funktion in nahezu allen Tumoren direkt durch Mutationen
oder indirekt durch Defekte in p53 regulierenden Signalwegen ausgeschaltet. Es findet in
erster Linie eine Selektion statt, die einen Verlust der p53 Tumorsuppressorfunktion durch
die Transaktivierungsaktivität sowie dominant negative Effekte bewirken. Als dominant
negative Wirkung ist die Suppression der Wildtyp p53 Aktivität durch einige p53 Mutanten
bekannt. Durch Hetero-Oligomerisierung von mutp53 mit wtp53 wird dieses in eine mutante
Konformation überführt (Eliyahu, Michalovitz, and Oren, 1985; Hinds, Finlay, and Levine,
1989; Kaczmarek et al., 1986; Milner and Medcalf, 1991). Es gibt allerdings auch vielfach
Hinweise dafür, dass bestimmte mutp53 Spezies im Gegensatz zum bloßen Verlust der
Tumorsuppressorfunktion von wtp53 durch transaktivierungsabhängige und -unabhängige
Einleitung
16
Wege zur Tumorprogression beitragen, was als so genannter gain-of-function (GOF;
Zugewinn an Funktionen) bekannt ist (Kim and Deppert, 2007; Petitjean et al., 2007; Strano
et al., 2007; Weisz, Oren, and Rotter, 2007). Ein immer wieder aufgeführtes Argument für
einen solchen Effekt ist die Tatsache, dass es sich im Gegensatz zu anderen
Tumorsuppressorgenen, die meist durch Deletionen, Trunkierungen oder Promotor-silencing
inaktiviert werden, bei Mutationen im p53-Gen in 80% aller Fälle um MissensePunktmutationen handelt (Hollstein et al., 1991; Levine, Momand, and Finlay, 1991). Diese
Punktmutationen liegen zu 80% in der zentralen Domäne des p53-Moleküls (Hainaut and
Hollstein, 2000; Levine et al., 1995; Olivier et al., 2002) und führen zur Expression eines
vollständigen p53-Proteins mit einem einzigen Aminosäure-Austausch (mutp53), welches
durch einen Verlust der Wildtyp p53 Transaktivierungsaktivität gekennzeichnet ist (Bullock
and Fersht, 2001; Ko and Prives, 1996). Das gehäufte Auftreten von missense Mutationen in
p53 alleine ist jedoch kein Argument für einen GOF, da keine Selektion von missense
gegenüber nonsense Mutationen in der DNA bindenden Domäne nachgewiesen werden
konnte, wenn man die Wahrscheinlichkeit des Auftretens von missense und nonsense
Mutationen in dieser Domäne berücksichtigt (Yang, Ro, and Rannala, 2003). Die mit einer
deutlich geringeren Wahrscheinlichkeit auftretenden nonsense Punktmutationen haben die
Expression von trunkiertem p53 oder die Abwesenheit von p53 aufgrund der Generierung
eines stop-codons zur Folge. Ausserdem wurden in einer Arbeit von Sjöblom und Kollegen,
die 13.023 Gene in elf Mamma- sowie elf Kolonkarzinomen sequenziert haben, insgesamt
1672 Mutationen detektiert mit einem Mutationsspektrum, welches generelle Mechanismen
der Mutagenese reflektiert und durch das Auftreten von 80% missense Mutationen, 7%
nonsense Mutationen, 4% Spleissmutationen und 8% Insertionen sowie Deletionen
charakterisiert ist (Sjoblom et al., 2006). Dies entspricht ziemlich genau dem Mutationsspektrum von p53 in humanen Tumoren und zeigt, dass missense Mutationen generell die
am häufigsten auftretenden Veränderungen in humanen Tumoren darstellen (Soussi, 2007).
Die Tatsache, dass p53 im Vergleich zu anderen Tumorsuppressoren vor allem durch
missense Mutationen verändert ist, kann durch das Ausschalten der Transaktivierungsaktivität durch eben diese Mutationen in der DNA Bindungsdomäne erklärt werden, welche
eine Selektion auf Deletionen wie bei anderen Tumorsuppressoren überflüssig macht.
Obwohl es keine starke Selektion für missense p53 Mutationen in Tumoren gibt, treten einige
p53 Mutanten mit einer höheren Frequenz auf als erwartet. Die Mutationen in den sechs
Codons 175, 245, 248, 249, 273 und 282 bei 1150 möglichen missense Mutanten machen
zusammen 35% der in menschlichen Krebsarten untersuchten Mutationen in p53 aus und
werden daher als hotspots bezeichnet (Olivier et al., 2002). P53 enthält in seinem
Promotorbereich zwar keine Anhäufung von CpG Dinukleotiden (CpG Inseln), jedoch 42
CpG Dinukleotide verstreut in der kodierenden Region, die meist methyliert sind und
Einleitung
17
bevorzugte Ziele von Mutationen durch genotoxische Agentien sowie UV Strahlung sind bzw.
durch Deamidierung mutieren. Insbesondere sind Argininreste betroffen, die durch das CGN
Basentriplett kodiert werden. Diese Erkenntnisse unterstützen die Vorstellung, dass in
Tumoren vor allem eine Selektion auf den Verlust der Tumorsuppressoraktivität stattfindet,
indem die Transaktivierungsfunktion der DNA bindenden Domäne durch missense oder
nonsense Mutationen ausgeschaltet wird und in einem Teil darüberhinaus eine Selektion für
bestimmte missense Punktmutationen stattfindet. In Abbildung 5 sind die in p53 gefundenen
Mutationen dargestellt, die statistischen Korrelationsanalysen von Tumor-Datenbanken (s.
z.B.
http://www.p53.iarc.fr,
http://p53.free.fr/,
http://p53.bii.a-star.edu.sg/index.php)
entnommen sind.
Abbildung 5 Schematische Darstellung der funktionellen Domänen von p53 mit Angabe der in
Tumoren gefundenen Häufigkeit von Mutationen in der sequenzspezifischen DNA bindenden
Domäne. Gezeigt sind die N-terminalen Aktivierungsdomänen (AD1, AD2), die Prolin-reiche Region
(PXXP), die zentrale sequenzspezifische DNA bindende Domäne, die Tetramerisierungsdomäne
(TETRA) und die C-terminale nicht sequenzspezifische DNA bindende Domäne (BASIC).
Zum Beispiel beinhaltet die Datenbank der Internationalen Agentur für Krebsforschung
(International Agency for Cancer Research (IARC)) 23.544 sequenzierte somatische und 376
Keimzellmutationen in p53 (R11, Oktober 2006). 75% der somatischen Mutationen sind
Punktmutationen, während die restlichen 25% durch Insertionen, Deletionen oder komplexe
Rearrangements zustande kommen. In der UMD Datenbank (Universal Mutation Database)
sind 3.555 verschiedene p53 Mutanten aufgelistet, deren Frequenzen des Auftretens in
Tumoren sehr heterogen sind. 3.233 Mutanten tauchen 1-10 mal auf, 298 Mutanten 10-100
mal und 24 Mutanten über 100 mal mit der höchsten Frequenz von 979 für die Mutante
R175H (Soussi et al., 2006). Eine Untersuchung des Einflusses von 2500 unterschiedlichen
p53 Mutanten auf die Transaktivierung ergab ein relativ heterogenes Bild. Die in humanen
Tumoren auftretenden hotspot Mutanten waren durch einen kompletten Verlust der
Transaktivierungsaktivität tumorsupprimierender Zielgene gekennzeichnet, während weniger
häufig auftetende Mutanten partiell alle oder einen bestimmten Teil dieser Gene aktivieren
konnten (Fujita et al., 2003).
Einleitung
18
1.4.2 Hinweise auf einen gain-of-function bei bestimmten mutp53 Spezies
Auf einen gain-of-function Effekt bestimmter Mutationen in p53 weisen ausser dem
gehäuften Auftreten bestimmter Mutationen in p53 folgende Befunde hin: Mutationen im p53
Gen sind sowohl in vitro als auch in vivo mit einer Resistenz gegenüber diversen
Chemotherapeutika assoziiert (Ferreira, Tolis, and Giaccone, 1999; Vogelstein, Lane, and
Levine, 2000). Diese Beobachtung wird gestützt durch Experimente, in denen eine
Rekonstruktion der p53 Aktivität in p53 negativen Zellen eine Chemosensitivität auslöst
(Wallace-Brodeur and Lowe, 1999). Mutationen in p53 in soliden Tumoren sowie lymphoiden
Malignomen korrelieren außerdem mit erhöhter Angiogenese und einer signifikant
schlechteren Prognose im Vergleich zur Abwesenheit von p53 (Greenblatt et al., 1994; Nigro
et al., 1989; Soussi and Beroud, 2001). Der Zugewinn onkogener Eigenschaften von mutp53
Spezies wurde in vitro als erhöhte Proliferation (Chen, Chen, and Lee, 1994; Muller,
Paulsen, and Deppert, 1996), erhöhtes Wachstum in Agar (Dittmer et al., 1993; Kawamura et
al., 1996), erhöhte Wachstumsdichte (Chen, Chen, and Lee, 1994), zerstörter SpindelKontrollpunkt sowie chromosomale Abnormalitäten (Agapova et al., 1996; Gualberto et al.,
1998; Wang et al., 1998a), antiapoptotische Aktivität (Lassus et al., 1999; Li et al., 1998b),
erhöhte Ras induzierte Transformation (Gloushankova et al., 1997) und erhöhte
Therapieresistenz beschrieben (Blandino, Levine, and Oren, 1999). So wurde für die
konstitutive Expression von mutantem p53 in 10-3 (Gualberto et al., 1998) p53-null Zellen
eine erhöhte Tumorigenität nach subkutaner Injektion in Nacktmäuse gezeigt. Es konnte
ferner gezeigt werden, dass p53 Mutanten mit Ras Onkogen in der Transformation primärer
Rattenzellen kooperieren können (Hinds et al., 1990; Slingerland, Jenkins, and Benchimol,
1993) und die Onkogen-induzierte Transformation und Tumorgenese von Saos-2 Zellen in
Nacktmäusen verstärken (Dittmer et al., 1993; Finlay, Hinds, and Levine, 1989; Preuss,
Kreutzfeld, and Scheidtmann, 2000). Außerdem sind einige mutante p53 exprimierenden
Krebszellen resistent gegenüber der wtp53 unabhängigen, durch zytotoxische Agentien
ausgelösten Apoptose. Die Reduktion der Expression von mutantem p53 in SKBR3, HT29
sowie SW480 Zellen geht außerdem mit reduzierter Proliferation, in vitro und in vivo
Tumorigenität und Resistenz gegen Antikrebsmittel einher (Di Agostino et al., 2006). In vivo
wurde eine erhöhte Tumorigenität (Cardinali et al., 1997; Dittmer et al., 1993; Lanyi et al.,
1998; Li et al., 1998a; Shaulsky, Goldfinger, and Rotter, 1991) sowie erhöhte Invasivität
(Cardinali et al., 1997; Hsiao et al., 1994; Wang et al., 1998b) für mutantes p53 beschrieben.
Der Zugewinn onkogener Eigenschaften scheint allerdings je nach Zelltyp und verwendetem
Promotor kontextabhängig zu sein und ist möglicherweise auf Unterschiede in koregulatorischen Proteinen zurückzuführen. Desweiteren besteht eine Diskrepanz zwischen in
vitro und in vivo Effekten von mutp53, die keine allgemeinen Aussagen über den gain-offunction Effekt ermöglichen. Jede Mutation in p53 kann unterschiedliche Konsequenzen in
Einleitung
19
der Transaktivierung von Zielgenen und Interaktion mit Proteinen nach sich ziehen. Diese
Heterogenität der Mutationen kompliziert die gain-of-function Hypothese erheblich, weshalb
sie auch von der Mehrheit der an p53 forschenden Wissenschaftler noch nicht anerkannt ist,
zumal auch Mechanismen noch nicht genügend geklärt sind. Unbestritten ist, dass die
meisten Mutationen im p53 Gen vermutlich durch reduzierte Degradation zu einer deutlichen
Erhöhung der Halbwertszeit des Proteins im Tumor führen. Dadurch akkumuliert mutp53 in
der Zelle (Buschmann et al., 2000; Haupt et al., 1997; Midgley and Lane, 1997). Li-Fraumeni
Syndrom Patienten weisen beispielsweise nur in Tumoren erhöhte Konzentrationen von p53
auf, während normale Zellen dieser Patienten kein p53 akkumulieren, was darauf schließen
lässt, dass Tumor-spezifische Veränderungen in der Degradation zur Stabilisierung von
mutp53 führen. Das Li-Fraumeni Syndrom ist durch eine Keimbahnmutation im p53 Gen
charakterisiert, welches zu einem vielfach höheren Risiko einer Tumorbildung führt, vor allem
Osteosarkome, Lymphome, Mammakarzinome, Sarkome, Hirntumore und Leukämien. LiFraumeni Patienten besitzen ein 50%iges Risiko einer Krebserkrankung im Alter von 30
Jahren (Malkin et al., 1990). Lediglich 57% der Tumore von Li-Fraumeni Individuen zeigen
einen LOH, während der andere Teil, abweichend von der two hit Regel von Knudson, ein
wtp53 Allel besitzt (Varley et al., 1997). Die meisten Mutationen in p53 resultieren in einer
reduzierten thermodynamischen Stabilität und partieller Entfaltung des Proteins und einer
dadurch verringerten DNA Bindungsaktivität (Bullock and Fersht, 2001). Selbst wtp53 besitzt
bereits eine geringe intrinsische thermodynamische Stabilität der Kerndomäne, da dessen
Schmelztemperatur mit 42-44°C nur knapp über der Körpertemperatur liegt (Bullock et al.,
1997; Bullock, Henckel, and Fersht, 2000). Diese geringe Stabilität verleiht dem Protein
vermutlich eine Flexibilität in der Transaktivierung von Zielgenen durch die Bindung an relativ
variable (Konsensus-) Sequenzen in den Promotoren von Zielgenen mit unterschiedlicher
Affinität (Inga et al., 2002). Dennoch behalten manche p53 Mutanten die Fähigkeit DNA zu
binden, allerdings sind sie meistens in dieser Eigenschaft temperatursensitiv. Vermutlich
findet die Bindung von mutp53 an DNA in Verbindung mit anderen stabilisierenden Proteinen
oder Koregulatoren statt.
1.4.3 Mögliche Mechanismen des gain-of-function
Die transkriptionelle Regulation von Überlebensgenen kann als ein möglicher Mechanismus
des gain-of-function von mutp53 in Betracht gezogen werden. Für Klasse I Mutanten (z.B.
248), welche durch eine Mutation in der DNA bindenden Domäne und daraus resultierendem
Verlust des Kontaktes mit DNA trotz Wildtyp Konformation gekennzeichnet sind, wurde eine
Transaktivierung von überlebensfördernden Genen beschrieben, die nicht vom Wildtyp
Protein transaktiviert werden, z. B. MDR-1 (multi drug resistance protein 1; Chen, Chen, and
Lee, 1994; Chin et al., 1992; Dittmer et al., 1993; Frazier et al., 1998; Lanyi et al., 1998), cmyc (Frazier et al., 1998; Matas et al., 2001), PCNA (human proliferating cell nuclear
Einleitung
20
antigen; Deb et al., 1992; Kawamura et al., 1996; Lanyi et al., 1998), IL-6 (human interleukin
6; Margulies and Sehgal, 1993), hsp70 (human heat shock protein 70; Tsutsumi-Ishii et al.,
1995), IGF-I-R (Werner et al., 1996), EGRI (epidermal growth factor receptor 1), EGFR
(Dittmer et al., 1993; Lanyi et al., 1998; Ludes-Meyers et al., 1996), IGFII (insulin growth
factor II; Lee et al., 2000), MDM2 Isoformen (Gorgoulis et al., 1998), VEGF (vascular
endothelial growth factor; Kieser et al., 1994), FGF2 (basic fibroblast growth factor; Ueba et
al., 1994), HIV-LTR, CD95 (Zalcenstein et al., 2003), c-fos (Kawamura et al., 1996; Preuss,
Kreutzfeld, and Scheidtmann, 2000),
BAG-1 (Yang, Pater, and Tang, 1999), 15-
lipoxygenase (Kelavkar and Badr, 1999) und NF-κB2 (Scian et al., 2005). Ein weiterer
Hinweis auf einen GOF liefern Experimente, in denen bestimmte mutp53 Spezies
präferentiell mit MAR/SAR DNA Elementen interagieren (Deppert, 1996; Muller, Paulsen,
and Deppert, 1996; Weissker et al., 1992; Will et al., 1998a; Will et al., 1998b), die sich in der
Regel an den Grenzen von Transkriptionseinheiten und regulatorischen Sequenzen befinden
und die an funktioneller Chromatinreorganisation beteiligt sind (Bode et al., 1995; Bode et al.,
1996; Boulikas, 1995). Dadurch beeinflusst mutp53 möglicherweise die Expressionskontrolle
von tumorrelevanten Genen. Zudem könnte ein weiterer Mechanismus des Zugewinns
onkogener Eigenschaften durch Interaktionen mit Proteinen, die nicht mit wtp53 interagieren,
charakterisiert sein, z.B. die inhibitorische Interaktion von mutp53 mit p73, welche das
Auslösen der p73 abhängigen Apoptose unterbindet (Di Como, Gaiddon, and Prives, 1999;
Marin and Kaelin, 2000; Monti et al., 2003; Strano and Blandino, 2003; Strano et al., 2002).
Alternativ ist eine Interaktion mit anderen Transkriptionsfaktoren beschrieben worden, mit
einer daraus resultierenden indirekten Beteiligung an der Transaktivierung überlebensfördernder
Gene.
Für
mutp53
wurde
beispielsweise
eine
Kooperation
mit
den
Transaktivatoren tumorassoziierter Gene Sp1, Ets-1 und NF-Y gefunden, deren Aktivität
durch wtp53 reprimiert wird (Chicas, Molina, and Bargonetti, 2000; Di Agostino et al., 2006;
Gu et al., 2004; Gualberto and Baldwin, 1995; Imbriano et al., 2005; Kim et al., 2003;
Pastorcic and Das, 2000; Sampath et al., 2001). Durch alle genannten Mechanismen würde
das Tumorwachstum aktiv von mutp53 unterstützt. Für mutantes p53 ist kein Konsensus
DNA Motiv bekannt; es wurde aber eine Präferenz der Bindung an repetitive DNA
Sequenzen sowie DNA Sequenzen, die zur Bildung einer nicht-B DNA Konformation
tendieren, gezeigt (Koga and Deppert, 2000; Muller, Paulsen, and Deppert, 1996; Walter et
al., 2005; Weissker et al., 1992). Die Expression von Klasse II Mutanten oder auch
Konformationsmutanten (z.B. R175H), die eine lokale oder globale Destabilisierung des
Proteins verursachen und durch Bindung an hsp70 charakterisiert sind, wurde in
verschiedenen Systemen mit größerem onkogenen Potential assoziiert. Verglichen mit der
Expression von trunkiertem p53 Protein oder der Abwesenheit von p53, wurde bei der
Einleitung
21
Expression von mutantem p53 eine signifikant höhere Tumorinzidenz sowie ein früheres
Auftreten von Tumoren bei Li-Fraumeni Patienten festgestellt.
1.5 in vivo p53 Mausmodelle
p53 knockout Mäuse sind überraschenderweise nicht letal, zeigen jedoch ein stark erhöhtes
Tumorrisiko. Im Gegensatz zum Li-Fraumeni Syndrom beim Menschen wird bei
heterozygoten
p53-Mäusen
ein
beschränktes
Tumorspektrum
mit
Sarkomen
und
Lymphomen beobachtet. Karzinome dagegen tauchen selten auf (Donehower et al., 1992;
Jacks et al., 1994; Purdie et al., 1994). Die durchschnittliche Überlebenszeit beträgt für
heterozygote p53 knockout Mäuse 15-16 Monate und für homozygote vier bis fünf Monate.
P53+/- Mäuse zeigen ein ähnliches Tumorspektrum wie p53+/+ Mäuse, während p53-/Mäuse
vor
allem
Lymphome
entwickeln
(Venkatachalam
and
Donehower,
1998;
Venkatachalam et al., 2001). Die in vivo Relevanz der missense p53 Mutationen ist noch
nicht vollständig geklärt (Lozano, 2007). Die erste Maus mit einer hotspot Mutation in
p53R172H in einem gemischten C57BL/6-129/Sv Hintergrund exprimierte zwar geringe Level
von mutp53 aufgrund einer zusätzlichen Mutation in einer Spleissstelle (p53R172HΔg), zeigte
allerdings ein deutlich verändertes Tumorspektrum verglichen mit p53+/- Mäusen mit einem
höheren Anteil an Karzinomen und einem leicht erhöhten Auftreten von Lymphomen (Liu et
al., 2000). 69% der sich in diesen Mäusen entwickelnden Osteosarkome und 40% der
Karzinome, metastasierten und lieferten so den ersten in vivo Hinweis eines gain-of-function,
da Metastasierung selten in p53 heterozygoten Mäusen gefunden wird. Ausserdem zeigen
p53R172H/+ knock-in Mäuse im Vergleich zu p53+/- Mäusen ein verändertes Tumorspektrum
mit einem erhöhten Vorkommen von Karzinomen und Osteosarkomen. Ähnlich weisen
p53R270H/+ Mäuse im Vergleich zu p53+/- Mäusen einen höheren Anteil an Karzinomen,
insbesondere Adenokarzinome der Lunge auf. Daher repräsentieren Mäuse mit einer
Mutation auf einem Allel (p53R270H/+ und p53R172H/+) eher das Li-Fraumeni Syndrom als p53+/Mäuse. Lang und Mitarbeiter fanden heraus, dass Mäuse mit p53R175H/+ des C57BL/6
Stammes zwar ähnliche Überlebenszeiten und Tumorspektren aufwiesen wie p53+/- Mäuse,
sich allerdings durch erhöhte Metastasierung unterschieden (Lang et al., 2004). Diese
Ergebnisse unterstützen die Theorie des Zugewinns onkogener Eigenschaften nach
Mutation von p53. Außerdem unterscheiden sich die Tumorspektren von p53R270H/- und
P53R172H/- Mäusen des 129S4/SVJae genetischen Hintergrunds von dem p53-/- Mäusen mit
einem ebenfalls erhöhten Vorkommen an Metastasen (Olive et al., 2004). In unserer
Arbeitsgruppe wurde eine Mauslinie etabliert, in der die p53 hotspot-Mutante R270H in WAPT transgenen Balb/c Mäusen koexprimiert wird. Die Expression von SV40 frühen Genen
unter dem mammagewebsspezifischen WAP (whey acidic protein) Promotor initiiert die
Bildung von Adenokarzinomen der Mammae. In bitransgenen WAP-T-p53R270H Tieren wurde
eine erhöhte Transition von intraepithelialen Neoplasien zu invasiven Karzinomen
Einleitung
22
beobachtet, die sich im erhöhten Vorkommen von invasiven Karzinomen und erhöhter
Metastasierung der Lunge äußerte. Allerdings führte die Expression von p53R270H in diesem
Modell nicht zu erhöhter genomischer Instabilität, welches diesen Mechanismus für den
beobachteten gain-of-function Effekt ausschließt (Heinlein et al., 2007).
1.6 Die Maus Tumor-Zelllinie MethA
Zur Untersuchung der Eigenschaften von mutantem p53 im Hinblick auf einen onkogenen
Zugewinn wurde die MethA Fibrosarkom-Zelllinie (Old et al., 1962; DeLeo et al., 1979;
DeLeo et al., 1977) als Modellsystem ausgewählt. Diese Zelllinie wurde aus einem Tumor
etabliert, welcher infolge einer einmaligen, subkutanen Injektion des Karzinogens
Methylcholanthren in eine weibliche Balb/c Maus entstand. Methylcholanthren gehört zur
Gruppe der polyzyklischen aromatischen Kohlenwasserstoffen mit karzinogener Wirkung.
Die relativ selten auftretenden und klinisch heterogenen Sarkome beinhalten diverse maligne
Tumore mesenchymalen Ursprungs, die in Bindegewebe wie Fett, Muskel, Fasergewebe,
Knochen und Blutgefässen entstehen. Fibrosarkome sind durch unreife, proliferierende
Fibroblasten oder undifferenzierte anaplastische Spindelzellen in Kollagenhintergrund
gekennzeichnet.
MethA Zellen sind aneuploid und exprimieren zwei verschiedene mutante p53 Spezies mit
stark erhöhter Halbwertszeit. Ein mutantes p53 Protein enthält die Mutation Cys132Phe,
während das vom zweiten Allel kodierte p53 Protein zwei Mutationen in Glu168Gly und
Met234Ile enthält (Arai et al., 1986; Bienz et al., 1984; Eliyahu et al., 1988). Die Theorie des
Zugewinns onkogener Eigenschaften besagt, dass die Mutationen in p53 selektioniert
wurden, da sie im Gegensatz zum bloßen Verlust der Tumorsuppressoreigenschaft von p53
einen Vorteil in der Tumorprogression darstellt. Die dem humanen p53 Protein
entsprechenden Mutationen in Codon 135 und 237 wurden relativ häufig, während die
Mutation in Codon 171 weniger häufig in menschlichen Tumoren gefunden wurde (IARC
Datenbank). Die Mutation im Codon 132 stellt eine Konformationsmutante dar, während die
in Codon 168 zu den DNA Bindungsmutanten gezählt wird. MethA Zellen exprimieren
zusätzlich eine alternativ gespleisste p53 mRNA, welche für ein kürzeres Protein mit einem
veränderten C-Terminus kodiert (Arai et al., 1986). Das Verwenden von MethA Zellen als
Modellsystem für die Forschung hat allerdings den Nachteil, dass es keine Diskriminierung
der Effekte der einzelnen p53 Punktmutationen erlaubt.
MethA mutp53 ist zum größten Teil im Nukleus lokalisiert, wo es stabil mit Chromatin, und
Kernmatrixfraktion assoziiert ist (Deppert et al., 1990; Deppert and Haug, 1986; Deppert and
Von Der Weth, 1990; Steinmeyer and Deppert, 1988; Zerrahn et al., 1992). Ein durch
Isoleuzin-Depletion vermitteleter G1-Wachstumsarrest führt zum Verlust der Assoziation von
MethA mutp53 mit nukleären Strukturen (Steinmeyer, Maacke, and Deppert, 1990). Im
Gegensatz zu wtp53 inhibiert MethA mutp53 nicht die Translation seiner eigenen mRNA,
Einleitung
23
obwohl es wie wtp53 an seine mRNA bindet (Mosner et al., 1995). MethA mutp53 ist stabil
mit dem Hitzeschockprotein hsp70 assoziiert, welches als erster Interaktionspartner
identifiziert wurde und vermutlich für die Stabilität von MethA mutp53 mitverantwortlich ist
(Gronostajski, Goldberg, and Pardee, 1984; Pinhasi-Kimhi et al., 1986). MethA mutp53
bindet in vitro an doppelsträngige sowie einzelsträngige DNA in nicht sequenzspezifischer
Weise. De Fromentel und Mitarbeiter beobachteten MethA mutp53 in Assoziation mit periund interchromatin Fibillen sowie mit hnRNP Strukturen (de Fromentel et al., 1986).
MethA Zellen bilden nach intraperitonealer Injektion in syngene Mäuse Ascites. Nach
subkutaner Injektion erfolgt eine Tumorbildung lediglich nach Vorbehandlung mit FreundAdjuvanz. Die Tumore sind durch tumorassoziierte Makrophagen und T Lymphozyten
charakterisiert, welche vermutlich für die Tumorbildung essentiell sind. Dies lässt darauf
schließen, dass MethA Zellen zur Manifestierung eines Tumors eine entzündliche Umgebung
benötigen.
Es ist zudem bekannt, dass die löslichen, für die Aktivierung von Makrophagen bzw.
Endothelzellen benötigten Cytokine M-CSF sowie EMAP I und II von MethA Zellen sezerniert
werden (Clarijs et al., 2003), was im Allgemeinen für die in vivo Tumorentstehung und progression von Entzündungs-assoziierten Tumoren von Bedeutung ist. Die Überexpression
von Cytokinen, insbesondere M-CSF wurde in einer klinischen Studie mit Mutationen in p53
korreliert (Asschert et al., 1997). Zwei unabhängige Arbeitsgruppen konnten ferner zeigen,
dass die Applikation der antisense Technik in MethA Zellen, welche die MethAp53 Mengen
ungefähr halbierten, signifikant die Wachstumsrate verringert (Shohat et al., 1987; Yamauchi,
Kobayashi, and Tanaka, 1996). Dies führte erstmals zur Hypothese, dass der hohe Spiegel
an mutp53 in MethA Zellen für das schnelle und kontinuierliche Wachstum dieser Zellen
verantwortlich ist. Nach dieser Hypothese ist mutp53 für das Wachstum und Überleben von
MethA Zellen essentiell und an der transkriptionellen und posttranskriptionellen Regulation
von Wachstumsfaktoren und Überlebensfaktoren beteiligt.
1.7 Zielsetzung der Arbeit
Die Tumorgenese ist ein noch nicht komplett verstandener komplexer Prozess und jeder
Tumor stellt einen im Bezug auf genetische, epigenetische oder chromosomale
Veränderungen einzigartigen Zellverband dar, der durch dereguliertes Wachstum und
Mechanismen zur Umgehung des Zelltods charakterisiert ist. So muss in entarteten Zellen
eine Balance zwischen der Integrität und der Funktionalität des Genoms auf der einen Seite
und der genetischen Instabilität auf der anderen Seite erreicht werden, um einen Fortbestand
des Tumors zu ermöglichen. Einer der wichtigsten Tumormarker, das Tumorsuppressorprotein p53, ist in fast allen Tumoren dereguliert. Die physiologische Funktion von p53 ist
entweder durch Deletionen oder nonsense Mutationen komplett ausgeschaltet, durch
missense Mutationen funktionell verändert oder p53 liegt in der wt Form vor und wird durch
Einleitung
24
andere Faktoren in seiner Funktion gehemmt. Für einige p53 missense Mutanten wurde ein
Zugewinn onkogener Eigenschaften postuliert, der nicht nur auf den Verlust der tumorsupprimierenden Funktion von wtp53 beruht, sondern durch einen aktiven Beitrag von p53
missense Mutanten zur Tumorgenese charakterisiert ist. Um den Beitrag von mutantem p53
an der Tumorgenese und den zugrunde liegenden Mechanismus zu verstehen, sollte die
murine Tumorzelllinie MethA, die hohe Mengen verschiedener mutp53 Spezies exprimiert,
als Untersuchungsmodell für einen Zugewinn an onkogenen Eigenschaften von mutantem
p53 dienen. Zunächst sollte die Bedeutung von mutp53 auf das Wachstum und Überleben
von MethA Zellen durch die Folgen der Reduktion von mutp53 mittels RNA Interferenz
untersucht
werden.
Da
p53/mutp53
durch
mehrere
Rückkopplungsmechanismen,
posttranslationale Modifikationen, Protein-Protein Interaktionen und Gewebsspezifität in
seiner Aktivität reguliert wird, scheint es notwendig, dieses komplexe Netzwerk als Ganzes
zu
betrachten.
Dazu
sollte
die
Funktion
von
mutp53
systematisch
durch
ein
Interaktomprojekt charakterisiert werden.
Hierfür wurden mehrere komplementäre Methoden eingesetzt. Mittels der Chromatinimmunpräzipitationstechnik können in vivo DNA Bindungsstellen von mutp53 Protein in MethA
Zellen untersucht werden. Durch die bioinformatische Analyse der in vivo Bindungsstellen
sollen die Eigenschaften der spezifischen Bindung durch MethAp53 analysiert werden, um
beurteilen zu können, ob diese Bindung sequenz- oder strukturspezifischer Natur ist. Durch
einen anschließenden Vergleich der Expressionsprofile von MethA Zellen mit normalem bzw.
durch RNA interference (RNAi) herunterreguliertem mutp53 Level mittels Microarray
Technologie soll der Einfluss von mutp53 auf die Regulation der Genexpression untersucht
werden. Des Weiteren soll mithilfe der Gesamt RNA Immunpräzipitationsmethode
herausgefunden werden, ob mutp53 in vivo an RNA bindet und wenn ja, welche RNA
Sequenzen
durch
mutp53
gebunden
werden.
Dies
soll
Aufschluss
über
die
posttranskriptionelle Genregulation durch mutp53 geben. Um das Interaktomprojekt
abzurunden,
sollen
außerdem
Protein
Interaktionspartner
durch
die
MALDI
ToF
Massenspektrometrie nach Immunpräzipitation identifiziert werden. Die Ergebnisse der
Techniken auf Genom, Transkriptom und Proteomebene sollen Rückschlüsse auf einen
möglichen gain-of-function Mechanismus von mutp53 im Bezug auf das Fortschreiten der
Tumorgenese insbesondere der Bedeutung von mutp53 auf das Wachstum in MethA Zellen
geben.
Material
25
2 MATERIAL
2.1 Chemikalien
Es wurden handelsübliche Chemikalien in Analysequalität der Firma Fluka (St. Gallen),
Merck (Darmstadt), Serva (Heidelberg) und Sigma (München) verwendet. Spezielle
Chemikalien und Biochemikalien wurden von folgenden Herstellern bezogen:
Acrylamid-Bis Fertiglsg. 40% (37,5:1)
Cetavlon
Coomassie Brilliant Blue (CBB) G250
Diammoniumcitrat
2, 5 Dihydroxybenzoesäure (DHB)
Dithioerythritol (DTE)
Freund-Adjuvanz
Harnstoff/Thioharnstoff
Iodoacetamid (IAA)
IPG Puffer (20 % Biolyte Ampholyte)
Protein G Sepharose
Tetradecanoylamidopropyldimethylammoniobutansulfonat (ASB-14)
Trypsin, proteomics grade
Vanadylribonukleosidkomplex
Merck, Darmstadt
Merck, Darmstadt
Merck, Darmstadt
Fluka, St. Gallen, Schweiz
Sigma-Aldrich Chemie GmbH, München
Fluka, St. Gallen, Schweiz
Calbiochem, San Diego, USA
Merck, Darmstadt
Sigma-Aldrich Chemie GmbH, München
Bio-Rad, Hercules, CA, USA
Amersham, Piscataway, NJ, USA
Calbiochem, San Diego, USA
Sigma-Aldrich Chemie GmbH, München
New England Biolabs, Frankfurt a. M.
2.2 Lösungen und Puffer
Zum Ansetzen von Puffern und Stammlösungen wurde stets bidestilliertes Wasser (18 MΩ)
einer Reinstwasseranlage verwendet.
Äquilibrierungspuffer
(4 mg/ml DTE oder 20 mg/ml IAA)
50 mM Tris-HCl pH 8,8
6 M Harnstoff, deionisiert
30% Glycerin
3% SDS
0,002% Bromphenolblau
Agarose Versiegelungslösung
25 mM Tris-HCl pH 7,0
192 mM Glycin
0,1% SDS
0,5% Agarose
0,002% Bromphenolblau
colloidale Coomassie Färbelösung
10% Lösung A (4 g/l CBB G250 in EtOH)
in Lösung B (200 g/l Ammoniumsulfat, 50
ml/l konz. H3PO4 mit Wasser)
CSK I Puffer
0,5% Triton X-100
10 mM PIPES-KOH pH 6,8
50 mM KCl
125 mM Glycin
300 mM Sucrose
1 mM EGTA
10 mM β-Mercaptoethanol
3 mM MgCL2
Material
26
CSK IV Puffer
CSKI Puffer ohne Triton X-100
DMEM + 5 % FCS
13,38 g/l DMEM-Pulver
3,7 g/l NaHCO3
in Wasser, pH 7,3
sterilfiltrieren
5% (v/v) FCS
E1A + Lysepuffer
1ml Puffer für 1x107 Zellen
50 mM HEPES
150 mM NaCl
0,1% NP-40
pH Wert mit KOH auf 7,0 einstellen
1% Trasylol
1% Pepstatin
1% Pefabloc sc
0,1% Leupeptin
Proteaseinhibitoren
Fixierungslösung I
Ethanol:Essigsäure:Wasser (30:10:60)
10 x Glycin Laufpuffer
292,8 g Glycin
121,1 g Tris
ad 2 l mit Wasser
1x Puffer hat pH 8,3
Harnstoffprobenpuffer
7 M/2 M Harnstoff/Thioharnstoff,
deionisiert
0,5% Dithioerythritol (DTE)
2% Tetradecanoylamidopropyldimethylammoniobutansulfonat (ASB-14)
1,25% IPG Puffer (20 % Biolyte
Ampholyte)
0,002% Bromphenolblau
KCl Puffer
200 mM KCl
10 mM Tris-HCl pH 7, 5
0,2 mM EDTA
1 mM β-Mercaptoethanol
Laemmli Probenpuffer (2x)
3,55 ml Wasser
1,25 ml 0,5 M Tris-HCl pH 6,8
2,5 ml Glycerin
2 ml 10% SDS
0,2 ml 0,5% Bromphenolblau
frisch 50 µl β-Mercaptoethanol zu 950 µl
Probenpuffer zusetzen
LB agar
10 g bacto-trypton
5 g bacto yeast extract
10 g NaCl
15 g agar
mit NaOH ad pH 7,0
ad 1 l mit Wasser, autoklavieren
Material
27
LB Medium
10 g bacto-trypton
5 g bacto yeast extract
10 g NaCl
mit NaOH ad pH 7,0
ad 1 l mit Wasser, autoklavieren
SOB Medium
20 g Bacto Trypton
5 g bacto yeast extrakt
0,5 g NaCl
2,5 ml 1M KCl
mit NaOH pH ad 7,0
ad 990 ml mit Wasser, autoklavieren
vor Gebrauch 10ml sterilfiltrierte 1 M
MgCl2 Lösung zugeben
SOC Medium
siehe SOB Medium
20 ml sterilfiltrierte 1M Glucoselösung
Matrix für MS
10 mg/ml DHB (2, 5
Dihydroxybenzoesäure)
5 mg/ml Diammoniumcitrat
50% Acetonitril
0,1% TFA
0,01% Phosphorsäure
10x PBS
1,37 M NaCl
0,027 M KCl
0,017 M KH2PO4
0,1 M Na2HPO4
pH 7,4
10x PBS (PIERCE)
1,4 M NaCl
0,08 M Na2PO4
0,02 M Kaliumphosphat
0,1 M KCl
pH 7,4
RIPA Puffer
10 mM Tris-HCl pH 8,0
140 mM NaCl
0,5% Triton X-100
0,1% SDS
0,1% Natriumdeoxycholat
Sammelgel
7 ml Wasser
0,75 ml 1,5 M Tris-HCl pH 6,8
1,25 ml Acrylamidlösung
100 µl 10% SDS
5 µl TEMED
25 µl 10% APS
1 ml Glycerin
SDS Elektrophoresepuffer
25 mM Tris
192 mM Glycin
0,1% SDS
Material
28
6x SDS Probenpuffer
300 mM Tris-HCl pH 7,0
12% SDS
0,6% Bromphenolblau
60% Glycerin
10% β-Mercaptoethanol
50 x TAE, pH 8,3
242,3 g Tris
37,3 g EDTA (Dinatriumsalz, Dihydrat)
57,1 ml Essigsäure
ad 1 l mit Wasser
Trenngel (12%)
34,7 ml Wasser
20 ml 1,5 M Tris-HCl pH 8,8
24 ml Acrylamidlösung
800 µl 10% SDS
50 µl TEMED
250 µl 10% APS
TRIS/Glycin Puffer
25 mM TRIS
192 mM Glycin
0,2% SDS
10% Ethanol
2.3 Enzyme
Calf Intestinal Phosphatase (CIP)
DNase I
EcoRV
Proteinase K
Reverse Transkriptase
RNase A
RNase H
Taq DNA Polymerase
T4 DNA Ligase
T4 Polynukleotidkinase
Trypsin (Proteomics grade)
New England Biolabs, Frankfurt a. M.
Qiagen, Hilden
New England Biolabs, Frankfurt a. M.
Sigma-Aldrich Chemie GmbH, München
Fermentas, St. Leon-Rot
Sigma-Aldrich Chemie GmbH, München
Fermentas, St. Leon-Rot
Eppendorf, Hamburg
New England Biolabs, Frankfurt a. M.
Gibco, (Invitrogen GmbH), Karlsruhe
Sigma-Aldrich Chemie GmbH, München
2.4 DNA- und Protein Molekulargewichtsstandards
2.4.1 DNA Molekulargewichtsstandards
Gene RulerTM 1kb DNA ladder
Gene RulerTM 100bp DNA ladder
Fermentas, St. Leon-Rot
Fermentas, St. Leon-Rot
2.4.2 ProteinMolekuargewichtsstandards
Roti®-Mark 10-150
Precision Plus ProteinTM All Blue Standards
Carl Roth®, Karlsruhe
Bio-Rad, Hercules, CA, USA
2.5 Plasmide
pBluescript II SK+ (2961 bp)
pENTRTM/H1/TO (3869 bp)
pSUPERIOR.neo+GFP (5430 bp)
Stratagene, La Jolla, CA, USA
Invitrogen GmbH, Karlsruhe
OligoEngine, Seattle, WA, USA
Material
29
2.6 Bakterienstämme
SURE® Electroporation competent cells
Stratagene, La Jolla, CA, USA
SURE strain Genotyp: e14– (McrA–) Δ(mcrCB-hsdSMR-mrr)171 endA1 supE44 thi-1 gyrA96 relA1
lac recB recJ sbcC umuC::Tn5 (Kanr) uvrC [F' proAB lacIqZΔM15 Tn10 (Tetr)].
XL1-Blue competent cells
Stratagene, La Jolla, CA, USA
XL1-Blue Genotyp: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F´ proAB lacIqZΔM15 Tn10
(Tetr)].
2.7 Oligonukleotide, PCR- und Sequenzierprimer
Oligonukleotid
5´- 3´ Sequenz
CatchA Adaptor
AATTCGGTCAAGTGAACACGAGCAG
Catch Bp Adaptor
CTGCTCGTGTTCACTTGACCGAATT
CDS Primer
AAGCAGTGGTAACAACGCAGAGT
M13 forward (-20) Primer
GTAAAACGACGGCCAG
M13 reverse
GTCATAGCTGTTTCCTG
scrambled sense Oligo
nukleotid
GATCCCCCGAACTTTTGGACGCGCACTTCAAGAGAGTGCG
CGTCCAAAAGTTCGTTTTTC
scrambled antisense
Oligonukleotid
TCGAGAAAAACGAACTTTTGGACGCGCACTCTCTTGAAGG
CGCGTCCAAAAGTTCGGGG
sip53 sense Oligonukleotid
GATCCCCGACTCCAGTGGGAACCTTCTTCAAGAGAGAAGG
TTCCCACTGGAGTCTTTTTC
sip53 antisense Oligonukleotid
TCGAGAAAAAGACTCCAGTGGGAACCTTCTCTCTTGAAGA
GGTTCCCACTGGAGTCGGG
SK new Primer
CGGCCGCTCTAGAACTAGTGGAT
T7 Primer
TAATACGACTCACTATAGGG
P1 Cap Primer
AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG
PCR CDS Primer
AAGCAGTGGTAACAACGCAGAGT
Poly T CDS Primer
AAGCAGTGGTAACAACGCAGAGTAC (T)30N-1N
Poly T MBO 20 Primer
CTGCTCGAATTCAACTGACG(T)30N-1N
Mbo-sip53.H
TCGAATTCAACTGACGGACTCCACTCCGAACCT
Material
30
qRT-PCR-primer
5´- 3´ Sequenz
Myo1e-Q1
CACAGTGGTGTGGACGACAT
Myo1e-Q2
GCTTGAATGGGTTGACAGAGATT
mActb_Q1
GAAATCGTGCGTGACATCAAAG
mActb_Q2
TGTAGTTTCATGGATGCCACAG
Trp53_Q1
TGGAGAGTATTTCACCCTCAAGA
Trp53_Q2
CTCCTCTGTAGCATGGGCATC
Ccl4-Q1
TTCCTGCTGTTTCTCTTACACCT
Ccl4-Q2
CTGTCTGCCTCTTTTGGTCAG
Cxcl10-Q1
CCAAGTGCTGCCGTCATTTTC
Cxcl10-Q2
GGCTCGCAGGGATGATTTCAA
Dync1h1-Q1
TTCCAGGCGATGGGACGTAT
Dync1h1-Q2
ATGTCTGGGCTAACCTTGACT
Galnt7-Q1
AGGGTTTGATTCAAGCTCGGA
Galnt7-Q2
CTCCTCGGGCATACCCATCT
Ctnnb1-Q1
ATGGAGCCGGACAGAAAAGC
Ctnnb1-Q2
CTTGCCACTCAGGGAAGGA
mOas2-Q1
AATGAAAGTGTCGAGTTCGATGT
mOas2-Q2
GCTCAATGAGATCCTTGTAGGC
mStat2-Q1
CCGAAGCAGTTGTGGAGAG
mStat2-Q2
GACATCCTGTTCGTCCTTCAG
mEif2ak2-Q3
TTCACACGTGCTTCACGGAGT
mEif2ak2-Q4
CCATTCAGCCAAGGTCTTCAG
2.8 Eukaryotische Zelllinien
MethA Fibroblasten isoliert aus einer mit Methylcholanthren transformierten Balb/c Maus, die
hohe Mengen verschiedener mutanter p53 Spezies exprimieren (132, 168 und 234) (DeLeo
et al., 1977).
10-1 Zellen sind Balb/c Mausembryofibroblasten mit Deletionen in beiden p53 Allelen
(Harvey and Levine, 1991).
2.9 Nährmedien und Antibiotika
DMEM
RPMI
FCS
Trypsin
Trypsin (1:250) 2,5 % (w/v)
Penicillin/Streptomycin
Kanamycin
Gibco (Invitrogen GmbH), Karlsruhe
Gibco (Invitrogen GmbH), Karlsruhe
PAA Laboratories, Pasching, A
Biochrom AG, Berlin
Biochrom AG, Berlin
PAA Laboratories, Pasching, A
Biochrom AG, Berlin
Material
Gentamycin, Neomycin
Zeocin
31
Sigma-Aldrich Chemie GmbH,
München
Gibco (Invitrogen GmbH), Karlsruhe
2.10 Antikörper
2.10.1 Primärantikörper
Maus-anti-p53 Pab 421 (Epitop: AS 371-380)
Maus-anti-p53 Pab 248 (Epitop: AS 157-192)
Maus-anti-p53 Pab 242 (Epitop: AS 18-27)
Ziege-anti-p53 polyklonal (FL-393; sc-6243)
Maus-anti hsc-70 (B-6; sc-7298)
Maus-anti-hnRNP A2/B1 (DP3B3; sc-32316)
Kaninchen-anti-YB1 polyklonal (ab12148)
Kaninchen-anti-hnRNP D (Poly6084; 608402)
Maus-anti-PKR (B-10; sc-6282)
Kaninchen-anti-cleaved caspase (9691)
Maus-anti-Tubulin (DM1A; CP06-100UG)
Ratte-anti-Tubulin (YL1/2; sc-53029)
Ziege-anti-Aktin (1-19; sc-1616)
Ratte-anti-Cd11b (ITGAM; CBL1313)
Ziege-anti-Vimentin polyklonal (C20; sc-7557)
Hybridomüberstand
Hybridomüberstand
Hybridomüberstand
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Biozol, Eching
BioLegend San Diego, CA, USA
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Cell Signaling, Danvers, MA, USA
Oncogene Research, USA
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Millipore (früher Chemicon), Schwalbach
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
2.10.2 Sekundärantikörper
2.10.2.1 Meerrettich Peroxidase (HRP) gekoppelte Sekundärantikörper
Ziege-anti-Maus IgG-HRP (sc-2005)
Santa Cruz Biotechnology, Santa Cruz,
CA, USA
Esel-anti-Ziege IgG-HRP (705-035-147)
dianova, Hamburg
Esel-anti-Maus IgG-HRP (715-035-151)
dianova, Hamburg
Esel-anti-Kaninchen IgG-HRP (711-035-152)
dianova, Hamburg
2.10.2.2 Fluorochrom konjugierte Sekundärantikörper
Esel-anti-Ziege IgG-Alexa 488 (A-11055)
Invitrogen Molecular Probes, NL
Esel-anti-Ziege IgG-Alexa 568 (A-11057)
Invitrogen Molecular Probes, NL
Esel-anti-Maus IgG-Alexa 488 (A-21202)
Invitrogen Molecular Probes, NL
Esel-anti-Maus IgG-Alexa 555 (A-31570)
Invitrogen Molecular Probes, NL
Esel-anti-Kaninchen IgG-Alexa 488 (A-21206)
Invitrogen Molecular Probes, NL
Ziege-anti-Kaninchen IgG-Alexa 555 (A-21429)
Invitrogen Molecular Probes, NL
Ziege-anti-Maus IgG-Alexa 568 (A-11031)
Invitrogen Molecular Probes, NL
2.11 Kit Systeme
Cell line Nucleofector® kit V
Cell Proliferation Reagent WST-1
Cyanine CTP 2-color dye pack
low RNA Input linear Amp Kit
Nucleobond AX
Amaxa biosystems, Köln
Roche, Basel, Schweiz
Agilent Technologies, Santa Clara,
CA, USA
Agilent Technologies
Macherey-Nagel, Düren
Material
32
NucleoBond PC 100/500
PCR cleanup Gel extraction kit
Power SYBR® Green PCR MasterMix
Macherey-Nagel, Düren
Macherey-Nagel, Düren
Applied Biosystems, Foster City,
CA, USA
Qiagen, Hilden
QIAshredder
RevertAidTM H Minus First Strand
cDNA Synthese kit
RNase free DNase set
RNA Mini Elute Cleanup Kit
RNA 6000 Nano LabChip® Kits
RNA spike-in kit
RNeasy® Mini kit
Taq DNA Polymerase
T-GelTM -Adsorbent
2.12 Verbrauchsmaterialien
Centricon® Centrifugal Filter devices
Dynabeads-Protein G
Filterpapier Whatman 3MM
ImmobilonTM-P Membran
Lysing Matrix D beads
S400 Micro Spin Säulen
Pack of Backings (4 Arrays/slide)
Protein Assay Reagenz
ReadyStripRM IPG Streifen
(18 cm, pI 4-7 oder 3-10)
Quick Spin Columns (G50 Sephadex)
SuperSignal® West Extended Duration Substrate
Trizol®
Vectashield® mounting medium
Whole mouse genome microarray 4x44K
ZipTip C18 Pipettenspitzen
Fermentas, St. Leon-Rot
Qiagen, Hilden
Qiagen, Hilden
Agilent Technologies
Agilent Technologies
Qiagen, Hilden
Eppendorf, Hamburg
Pierce, Rockford, IL, USA
Millipore, Schwalbach
Dynal, Oslo, Norwegen
Schleicher & Schüll, Dassel
Millipore, Schwalbach
MP biomedicals, Solon, OH, USA
Amersham, Piscataway, NJ USA
Agilent Technologies
Bio-Rad, Hercules, CA, USA
Bio-Rad, Hercules, CA, USA
Roche, Basel
Pierce, Rockford, IL, USA
Invitrogen GmbH, Karlsruhe
Vector, Wettenberg
Agilent Technologies
Millipore, Schwalbach
2.13 Computer-Software
Adobe Photoshop 7.0.1
BioStation IM version 1.01, build 60
Endnote Version X1
7500 Fast System Software (Applied Biosystems)
Feature Extraction 9.5 (Agilent Technologies)
GeneSpring GX (Agilent Technologies)
Imaris 4.3.1 (Bitplane AG)
Kratos software (Kompact V2.4.1)
Leica Confocal Software LCS Lite Version 2.0
MASCOT software (http://www.matrixscience.com)
Microsoft Word, Excel, Power Point
Sci Ed Central Clone Manager 5
2.14 Geräte
2100 Bioanalyzer
BioStation IM
Brutschrank B6060
Brutschrank Hera Cell 150
Brutschrank Hera Cell Function line
Elektrophoresesystem Hoefer® SemiPhorTM
Elektroporationsgerät NucleofectorTM I
Agilent Technologies
Nikon GmbH, Düsseldorf
Heraeus Instruments, Düsseldorf
Heraeus Instruments, Düsseldorf
Heraeus Instruments, Düsseldorf
GE healthcare, Chalfont St. Giles, GB
Amaxa biosystems, Köln
Material
Elisa Reader SUNRISE
Entwicklermaschine Classic E.O.S.
FACS Aria
Feinwaage H54AR
Fluoreszenzmikroskop DMRA
Fluoreszenzikroskop DMI 6000 B
Gefriertrockner Finn-Aqua® Lyovac GT 2E
Geldokumentation BioDocAnalyze
Heizblock Techne Dri-Block DB 2A
Immobiline® DryStrip Reswelling Tray
Isoelektrisches Fokussiersystem IPGphorTM
Konfokales Fluoreszenzmikroskop LSM 510
Kühlfalle RT100A
Massenspektrometer Kratos PC Axima CFR
Membran-Vakuumpumpe MZ2C/1,7
Mikroskop Labovert
Mikroskop Phase Contrast ULW CD0.30
Mikroskop IMT-2
Mikroskop CK40
PCR Maschine PTC-200
pH-Meter PHM82 Standard
pH-Meter Seven Easy
Real-Time PCR System 7500 Fast
Reinstwassersystem Milli-Q® Academic
Röntgenfilme
Sterilbank HERA safe KS18 und KS12
Stromversorgungsgerät Power Pac 200
Stromversorgungsgerät Power Pac 3000
Stromversorgungsgerät 2303 Multidrive XL
Spektrophotometer NanoDrop® ND-1000
Spektrophotometer DU® 800
Thermomixer Comfort
Vakuumzentrifuge Speed Vac® SPD 101B
Vortexer Vortex-Genie
Vortexer REAX top
Waage PE360
Waage PM460
Waage PB3001-S/FACT
Zentrifuge Biofuge pico
Zentrifuge RC50 Plus
Zentrifuge 5810 R
Zentrifuge 4 °C 5415 C
Zentrifuge 4 °C 5415 D
Zentrifuge Omnifuge 2.0RS
Zentrifuge Rotana 96
Zentrifuge L-70 Ultracentrifuge
Zentrifuge Sorvall® RC 5C Plus
33
TECAN AG, Mannedorf, Schweiz
AGFA, Köln
BD biosciences, Pharmingen, USA
Mettler Toledo, Gießen
Leica, Solms
Leica, Solms
Steris® Corporation, Mentor, OH, USA
Whatman Biometra, Göttingen
Thermo-Dux, Wertheim
Amersham Biosciences, Piscataway, NJ,
USA
Amersham Biosciences, Piscataway, NJ,
USA
Carl Zeiss AG, Oberkochen
Savant Instruments, Farmingdale NY,
USA
Shimadzu, Kyoto, Japan
Vakuubrand, Wertheim
Leitz, Wetzlar
Olympus, Hamburg
Olympus, Hamburg
Olympus, Hamburg
MJ Research, Watertown MA, USA
Radiometer, Kopenhagen, DK
Mettler Toledo, Gießen
Applied Biosystems, Foster City, CA,
USA
Millipore, Schwalbach
CEA Deutschland GmbH, Hamburg
Thermo Electron Corporation,
Langenselbold
BioRad, München
BioRad, München
Pharmacia, Erlangen
Peqlab Biotechnologie GmbH, Erlangen
Beckman Coulter, Fullerton, CA, USA
Eppendorf, Hamburg
Savant Instruments, Farmingdale NY,
USA
Bender & Hobein AG, Zürich, CH
Heidolph, Kelheim
Mettler Toledo, Gießen
Mettler Toledo, Gießen
Mettler Toledo, Gießen
Heraeus Instruments, Düsseldorf
Sorvall, Bad Homburg
Eppendorf, Hamburg
Eppendorf, Hamburg
Eppendorf, Hamburg
Heraeus Instruments, Düsseldorf
Hettrich Zentrifugen, Tuttlingen
Beckman Coulter, Fullerton, CA, USA
Kendro Laboratory Products GmbH,
Langenselbold
Methoden
34
3 METHODEN
3.1 Zellkultur und Zellpassage
MethA Zellen wurden adhärent in DMEM mit 5% FCS in beschichteten Zellkulturschalen
Nunc Delta in einem Inkubator mit 37°C und 6% CO2 kultiviert. Alternativ lassen sich MethA
Zellen in Suspension halten. Dazu wurde eine 1:1 Mischung aus DMEM und RPMI Medium
mit 10% FCS verwendet und die Zellen in Spinnergefäßen bei 37°C inkubiert. Aufgrund der
hohen Wachstumsrate wurden die adhärent wachsenden MethA Zellen zweimal wöchentlich
durch Zugabe von Trypsin EDTA und Inkubation bei 37°C für etwa 3 min passagiert.
3.2 Chromatin-Immunpräzipitation-Sequenzierung (ChIP-Seq)
Zur Charakterisierung von DNA Sequenzen, an die mutp53 in vivo bindet, wurde eine
Chromatin-Immunpräzipitation durchgeführt. Durch Behandlung der MethA Zellen mit
Formaldehyd wird eine kovalente Quervernetzung der Proteine an genomische DNA erreicht.
Das Chromatin wird durch Sonifizieren zerkleinert und die Chromatinfragmente mit
gebundenem mutp53 Protein danach durch Immunpräzipitation mit spezifischem Antikörper
angereichert.
Abbildung 6 Schematische Darstellung des experimentellen Ablaufs der Gesamtgenom- ChromatinImmunpräzipitation. MethA Zellen werden in vivo mit dem Vernetzungsreagenz Formaldehyd
behandelt, die DNA in kleinere Teile durch Sonifizieren geschert, anschließend mit p53 Antikörper
gekoppelt an Matrix immunpräzipitiert, die Proteine durch Proteinase K Inkubation abgebaut und die
DNA Fragmente isoliert. Anschließend werden die DNA Fragmente durch PCR amplifiziert, nach
Agarosegelauftrennung analysiert und zuletzt kloniert und sequenziert.
3.2.1 Protein-DNA Isolierung
Zunächst wurden mit PBS gewaschene MethA Zellen in der Kulturschale für 8 min bei 37°C
mit 0,25% Formaldehyd enthaltendem DMEM inkubiert, damit DNA-Protein Komplexe
reversibel quervernetzt werden, um diese dann isolieren und analysieren zu können. Die
Reaktion wurde durch Zugabe von 125 mM Glycin in PBS gestoppt. Die Zellen wurden dann
mit einem Gummiwischer von der Platte entfernt und in 3 ml CSK I Puffer supplementiert mit
Proteaseinhibitoren aufgenommen. Nach einer Zentrifugation bei 3300 rpm für 5 min bei 4°C
wurde das erhaltene Pellet zweimal mit 1 ml CSK IV Puffer inklusive Proteaseinhibitoren
gewaschen. Das Pellet wurde nun in 900 µl 10 mM Tris-HCl pH 7,5 und 150 mM NaCl gelöst
und sonifiziert. Nach einer Inkubation von 10 min auf Eis wurden 100 µl Cetavlon zugefügt
und wiederum bei 12000 g für 5 min bei RT zentrifugiert. Das Pellet wurde danach in 200 µl
Methoden
35
10 mM Tris-HCl pH 7,5 und 1,5 M NaCl aufgenommen und erneut sonifiziert. Nach Zugabe
von 1,7 ml 10 mM Tris-HCl pH 7,5 sowie 100 µl Cetavlon, wurde der Ansatz 15 min auf Eis
inkubiert und anschließend 5 min bei RT und 12000 g zentrifugiert. Durch Aufnahme des
Pellets in 400 µl 10 mM Tris-HCl pH 7,5; 1,5 M NaCl sowie 3 Volumen 100% Ethanol, wurde
die DNA gefällt. Das Pellet wurde zweimal mit 70% Ethanol gewaschen, luftgetrocknet und in
900 µl 10 mM Tris-HCl pH 7,5 und 0,5% SDS sowie 100 µl 2,5 M KCl aufgenommen und
erneut 5 min auf Eis inkubiert. Nach einer 3 minütigen Zentrifugation wurde das Pellet in 1 ml
KCl Puffer gelöst und 3 min bei 60°C geschüttelt, anschließend 5 min auf Eis inkubiert und 3
min bei 4°C und 12000 g zentrifugiert. Dieser Vorgang wurde dreimal wiederholt.
Abschließend wurde das Pellet in 400 µl 10 mM Tris-HCL pH 7,5 und 0,1% SDS durch
schütteln für 3 min bei 50°C gelöst.
3.2.2 Immunpräzipitation
Zunächst wurden die DNA-Protein Proben auf folgende Konzentrationen bei einem
Gesamtvolumen von 500 µl abgeglichen: 0,5% Triton X-100, 0,1% Natriumdeoxycholat, 140
mM NaCl und 10 mM Tris-HCl pH 8. Anschließend wurden 30 µl Protein G Sepharose (PGS,
50% w/v), welche in RIPA Puffer äquilibriert wurde, als Matrix zugegeben und 1 h bei 4°C
inkubiert. Um unspezifische Bindung an die Matrix zu vermeiden, wurden die PGS Partikel
nach einer kurzen Zentrifugation verworfen. Daraufhin wurde dem Überstand der
entsprechende Antikörper zugesetzt und über Nacht bei 4°C inkubiert. Danach wurden
wiederum 50 µl PGS zugegeben und 4 h bei 4°C rotiert. Die Matrix wurde nun fünfmal für je
10 min mit RIPA Puffer und anschließend mit 10 mM Tris-HCl pH 8,0 und 150 mM NaCl für 3
min gewaschen. Die PGS gebundenen Immunokomplexe wurden durch Inkubation mit 100
µl 2% SDS; 20 mM Tris-HCl pH 8,0 bei 65°C für 10 min eluiert und nochmals mit 300 µl
derselben Lösung gewaschen. Es folgte ein Proteinabbau durch Inkubation mit 0,5 mg/ml
Proteinase K und 2 mM CaCl2 für 1 h bei 50°C. Damit restliche Methylenbrücken
dissoziieren, wurden die Proben zusätzlich 4 h bei 65°C inkubiert. Nachdem die DNA
Fragmente durch Phenol-Chloroform Zugabe extrahiert wurden, wurde die DNA durch
Zusetzen von 2,5 Volumen 100% Ethanol, 1/ 10 V 3 M Natriumacetat pH 5,5 sowie 10 µg
Glycogen für 2-12 h bei -20°C gefällt, zentrifugiert, mit 70% Ethanol gewaschen,
luftgetrocknet und in 20 µl Wasser aufgenommen. Um die Enden der DNA Fragmente zu
polieren, wurden diese 30 min bei 72°C mit 2 Einheiten Pfu DNA Polymerase und 200 µM
dNTPs in einem Reaktionsvolumen von 25 µl inkubiert und anschließend auf 4°C abgekühlt.
Erneut wurde eine Phenol-Chloroform Extraktion mit anschließender DNA Fällung
durchgeführt, um die Polymerase wieder zu entfernen. Die in 10 µl Wasser aufgenommenen
DNA Fragmente wurden nun an so genannte Catch A/Bp Adaptoren ligiert, indem sie mit T4
Polynukleotid-Kinasepuffer, 100 µM dATP, 30 pmol Adaptoren und T4 DNA Ligase für 8 h
bei 16°C in einem Reaktionsvolumen von 20 µl inkubiert wurden. Eine anschließend
durchgeführte Zentrifugation durch S400 Mini Spin Säulen trennt nicht ligierte Adaptoren
wieder ab. Durch PCR wurden die immunoselektierten DNA Fragmente nun amplifiziert und
die entstandenen Produkte durch Agarose Gelelektrophorese analysiert.
3.2.3 Klonieren der DNA Fragmente
Zur Klonierung und Identifizierung der DNA Fragmente
phosphoryliert.
x µl PCR Produkt
1 µl T4 PNK
1-1.5 µl T4 PNK Puffer
1 µl 1mM ATP
y µl ddH2O
wurden
diese zunächst
Σ 10-15 µl
Dazu wurde der Phosphorylierungsansatz 30 min bei 37°C inkubiert und die
Polynukleotidkinase (PNK) durch 10 minütiges Erhitzen auf 70°C inaktiviert. Danach wurde
das PCR Produkt mithilfe des PCR cleanup kits aufgereinigt, die DNA durch Ethanol
Methoden
36
präzipitiert und anschließend in 10 µl Wasser resuspendiert. Parallel musste der verwendete
Vektor pBluescript II SK+ mit EcoRV linearisiert und anschließend dephosphoryliert werden.
Dazu wurde folgender Ansatz pipettiert:
1 µg Vektor DNA
5 µl 10x Restriktionspuffer
0.5 µl 100x BSA
1 µl EcoRV
x µl ddH2O
Σ 50µl
Der Ansatz wurde 1 h bei 37°C inkubiert und wiederum Phenol-Chloroform extrahiert und die
DNA durch Ethanol präzipitiert. Zur Dephosphorylierung wurde folgender Ansatz 1 h bei
37°C, dann 15 min bei 65°C inkubiert und erneut eine Phenol-Chloroform Extraktion sowie
Ethanol Präzipitation durchgeführt:
linearisierter Vektor
10x Dephosphorylierungspuffer
1 µl CIP (1U/µl)
ddH2O
Σ 50µl
Vor der Ligation wurden linearisierter und dephosphorylierter Vektor, sowie das aufgereinigte
PCR Produkt auf einem Agarosegel überprüft. Nun konnten die aufgereinigten DNA
Fragmente mit der vorbereiteten Vektor DNA ligiert und schließlich in chemisch kompetente
Zellen transformiert werden.
10 ng Vektor DNA (linearisiert und dephosphoryliert)
x µl insert DNA (molares Verhältnis 1:3 bis 1:5)
2 µl 10x Ligasepuffer
1 µl T4 DNA ligase (1U/µl)
y µl ddH2O
Σ 20µl
Der sog. blunt-end Ligationsansatz wurde über Nacht bei 16°C ohne Schütteln inkubiert. Als
negative Kontrolle diente Vektor DNA ohne PCR Insert DNA, um den Prozentsatz religierten
Vektors abschätzen zu können. Zur Transformation wurden 200 µl chemisch kompetente
Zellen (Inoue, Nojima, and Okayama, 1990) und 5 µl Ligationsprodukt 30 min auf Eis
inkubiert, dann 30 s bei 42°C inkubiert (Hitzeschock), direkt 800 µl SOC Medium zugegeben
und 1 h bei 37°C zur Ausbildung der Antibiotikaresistenz inkubiert. Ein Teil des Ansatzes
wurde auf eine vorbereitete LB-Ampicillin (50 µg/ml) Platte ausgestrichen, die IPTG (100 µl
10 mM) sowie Xgal (100 µl 2%) enthielten, um eine blau-weiß Selektion zu ermöglichen. Die
Platte wurde über Nacht bei 37°C in einem Brutschrank inkubiert. Die über Nacht
gewachsenen Bakterienkolonien wurden durch PCR auf die Aufnahme des Vektors mit
spezifischen Primern überprüft.
PCR Programm
0.1-0.2 µM primer (SKnew, T7, 10 µM)
2 µl 10x Taq pol Puffer
0.2 µl Taq Polymerase
0.4 µl dNTPs (10mM)
1.5 µl template DNA
15.7 µl ddH2O
Σ 20µl
1
94°C
2 min
2
96°C
20 s
3
55°C/
50°C
30 s
4
72°C
2 min
2-4
30 Zyklen
5
72°C
6
4°C
8 min
Methoden
37
Dazu wurde ein Teil einer Kolonie in 20 µl Wasser aufgenommen, welches 100 µg/ml RNase
enthält, 5 min bei 95°C inkubiert, nach Abkühlen zentrifugiert und 1,5 µl des Überstandes für
die PCR eingesetzt. Nach Ablauf des Programms wurden die PCR Ansätze auf einem
Agarosegel aufgetrennt und überprüft. Von den positiven Klonen wurde die DNA in kleinem
Maßstab präpariert und dann sequenziert. Dazu wurden 2-5 ml LB-amp Flüssigkultur
angesetzt, die 12-16 h bei 37°C und 200 rpm geschüttelt wurden. Mithilfe des MN kits zur
Mini-Präparation von Plasmid DNA wurde dann die Plasmid DNA laut Herstellerprotokoll
isoliert und deren Konzentration durch UV Messung bestimmt, sowie deren Qualität auf
einem Agarosegel überprüft. Die Sequenzierung erfolgte kommerziell von der Firma MWG
Biotech.
3.3 RNA-IP (RNA-Immunpräzipitation)
Um zu untersuchen, ob ein Protein an RNA bindet und wenn ja, an welche RNA Sequenzen,
wurde das in Abbildung 7 dargestellte Protokoll in unserem Labor von Lars Tögel entwickelt.
Extraktion von 5x106 Zellen mit E1A Puffer
spezifische Immunpräzipitation mit polyklonalen
Antikörper gegen p53 (lösliche Fraktion)
Aufreinigung der gebundenen RNA
cDNA Synthese:
5‘ Cap
A(n) 3‘
3‘T(n)
PolyT-CDS
5‘
MoMuL Virus RT
terminale
Desoxynukleotidtransferase
Aktivität
5‘ Cap
A(n) 3‘
T(n)
3‘CCC
P1Cap-CDS
5‘
P1Cap-CDS
GGG
3‘CCC
GGG
PolyT-CDS
5‘
template switch
A(n) 3‘
T(n)
PolyT-CDS
5‘
Rnase H Verdau
3‘
P1Cap-CDS
CCC
T(n)
PolyT-CDS
5‘
Synthese des zweiten Stranges, Amplifikation via PCR
Klonierung in pBuescript II sk (+) und Sequenzierung
Abbildung 7 Schematischer Ablauf des RNA-IP Experimentes (nach Lars Tögel).
Für die RNA-IP wurden MethA Zellen 5 min in E1A+ Puffer, dem 2 mM des RNase Inhibitors
Vanadylribonukleosidkomplex zugesetzt war, lysiert. Danach wurden die Zelltrümmer nach
einer Zentrifugation verworfen. Um eine unspezifische Bindung von RNA an die verwendete
Matrix zu vermeiden, wurde dem Überstand zunächst an Dynabeads gekoppelte Protein G
Methoden
38
als Matrix zugesetzt und 30 min inkubiert. Die Verwendung der magnetischen Dynabeads als
Matrix ermöglicht die Trennung der beads vom Überstand durch einen Magneten ohne
Zentrifugation. Danach folgte die eigentliche Immunpräzipitation von mutp53 durch Zugabe
von 1 µg p53 Antikörper für 1 h. Es wurden dann wiederum die Dynabeads-Protein G
zugegeben und eine weitere Stunde inkubiert. Die Matrix wurde nun viermal mit E1A+ Puffer
gewaschen und das Präzipitat anschließend mit RLT Puffer (RNeasy Mini kit) und
zugesetztem β-Mercaptoethanol eluiert. Die RNA wurde nun mithilfe des RNeasy Mini kit
isoliert und mit DNase I behandelt. Durch Verwendung der Poly T CDS und P1cap Primer
wurde die RNA mithilfe des RevertAidTM H Minus First Strand cDNA Synthese kits von
Fermentas in cDNA umgeschrieben, mit RNase H verdaut und durch eine PCR amplifiziert
(Matz et al., 1999). Daraufhin wurden die RNA Fragmente auf einem Agarosegel aufgetrennt
und für die Klonierung aufgereingt und phosphoryliert und in den mit EcoRV linearisierten
und dephosphorylierten pBluescript II SK+ Vektor ligiert (vgl. ChIP 3.2.3). Die
Transformation, Präparation und Sequenzierung erfolgte wie unter 3.2 beschrieben.
3.4 SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE)
Zur Analyse der Proteinexpression wurde die SDS-Polyacrylamid-Gelelektrophorese (SDSPAGE) verwendet. SDS (sodium dodecyl sulfate) ist ein anionisches Detergenz, welches die
Eigenladung von Proteinen so effektiv überdeckt, dass Micellen mit konstanter negativer
Ladung pro Masseneinheit entstehen. Bei der Probenvorbereitung wurden die Ansätze mit
einem Überschuss von SDS auf 95°C erhitzt und so die Tertiär- und Sekundärstrukturen der
Moleküle weitgehend aufgelöst. Schwefelbrücken zwischen Cysteinen wurden durch die
Zugabe einer reduzierenden Thiolverbindung, hier β-Mercaptoethanol, aufgespalten. Die mit
SDS beladenen, gestreckten Aminosäureketten bilden so Ellipsoide, deren Migrationsverhalten nur noch von der Anzahl der Aminosäuren abhängig ist.
Um eine hohe Auflösung der einzelnen Banden zu erhalten, wurde hier eine Elektrophorese
mit diskontinuierlichem Tris-HCl/Tris-Glycin-Puffersystem durchgeführt (Laemmli, 1970).
Dabei ist die Gelmatrix in zwei Bereiche eingeteilt: das engporige Trenngel und das
weitporige Sammelgel. Beide sind darüber hinaus unterschiedlich gepuffert. Beim Anlegen
des elektrischen Feldes entsteht im Sammelgel ein Feldstärkegradient, in dem die ProteinIonen während der Wanderung einen Stapel in der Reihenfolge ihrer Mobilitäten bilden. Beim
Erreichen des Trenngels treten die Proteine in einen Bereich mit konstanter Feldstärke ein,
wobei schließlich eine Auftrennung nach Molekülgröße erfolgt. Es wurden jeweils 12,5%ige
Gele angefertigt, da alle zu detektierenden Proteine im Bereich um 50-70 kDa zu erwarten
waren.
3.5 Western-Blot / Immunblot (semi-dry Verfahren)
Mit dieser Methode lassen sich elektrophoretisch aufgetrennte Proteine mit spezifischen
Bindungseigenschaften über Antikörper direkt auf der Membran nachweisen. Für den
elektrophoretischen Transfer sind zwei unterschiedliche Verfahren im Laboreinsatz: das
semi-dry-Blotting und das Tankblotting. Beim Vorgang des Elektroblottings werden die zu
einer Bande fokussierten Proteine aus der Polyacrylamidmatrix über das angelegte
elektrische Feld eluiert und auf die Membran transferiert. Nach dem Transfer auf eine
Nitrocellulosemembran kann eine weitere unspezifische Adsorption durch Blocken der noch
verbliebenen bindenden Stellen mithilfe von Magermilchpulver zurückgedrängt werden. Für
die Zurückdrängung von unspezifischen Bindungen hat sich auch in einigen Fällen der
Einsatz nichtionischer Detergenzien in den Waschlösungen bewährt, weshalb Tween® 20 in
einigen Fällen dem Waschpuffer zugesetzt wurde. Die hier verwendeten Waschpuffer waren
PBS und PBST (T = Tween® 20) und richteten sich nach dem verwendetem Antikörper. Für
den elektrophoretischen Transfer wurde die Hoefer® SemiPhorTM Apparatur verwendet und
das Gel auf eine ImmobilonTM-P Membran transferiert. Danach wurde die Membran durch
Inkubation mit 5% Magermilchpulver in PBST blockiert und anschließend mit dem ersten
Antikörper inkubiert. Nach gründlichem Waschen der Membran mit PBST erfolgte die
Inkubation mit dem zweiten HRP gekoppelten Antikörper.
Methoden
39
3.6 Detektion (ECL-Methode)
Bei der Immundetektion wird eine spezifische Antigen-Antikörper-Reaktion ausgenutzt, bei
der die Membran zuerst mit einem Antikörper für das zu untersuchende Protein inkubiert
wird. Dieser Antikörper ist gleichzeitig Antigen für den zweiten Antikörper, der einen
Amplifikator (HRP; mit Lumineszenz-System) enthält. Proteinbanden oder -spots wurden
durch das SuperSignal® West Extended Duration Substrate visualisiert.
3.7 Immunpräzipitation in großem Maßstab
Zur Identifizierung potentieller mutp53 interagierender Proteine, wurde eine
Immunpräzipitation mit p53 spezifischem Antikörper durchgeführt und das Immunpräzipitat
durch 2D Gelelektrophorese aufgetrennt. Die nach Coomassiefärbung sichtbaren Proteinspots können anschließend durch massenspektrometrische Analyse identifiziert werden.
Hierzu wurden in Suspension kultivierte MethA Zellen vor der Ernte zweimal mit PBS
gewaschen, zentrifugiert und das Zellpellet bei -20°C aufbewahrt. Für den weiteren
Gebrauch wurde das MethA Zellpellet in E1A+ Lysepuffer resuspendiert und 20 min auf Eis
inkubiert, bevor die unlöslichen Zelltrümmer abzentrifugiert wurden.
Abbildung 8 Ablauf des Proteomexperiments schematisch dargestellt. MethA Zellen werden in
großem Maßstab mit p53 Antikörper an PGS gekoppelt, immunpräzipitiert und das Präzipitat danach
zweidimensional nach isoelektrischen Punkt pI und Molekulargewicht aufgetrennt. Nach
Coomassiefärbung des Gels werden interessierende Proteinspots ausgestochen und der
massenspektrometrischen Analyse unterzogen.
Für eine Immunpräzipitation in großem Maßstab wurden 5x109 MethA Zellen in 100 ml E1A+
Lysepuffer aufgenommen. Für die anschließende Immunpräzipitation wurde der Überstand
mit der Matrix, an die eine anti-p53 Antikörpermischung gekoppelt wurde, versetzt und über
Nacht bei 4°C zur Inkubation rotiert (5 mg Antikörpermix an 2 ml PGS gekoppelt). Pro 100 µg
Totalprotein wurde ungefähr 1 µg Antikörper verwendet. Für die Kopplung an die Matrix PGS
wurde eine Mischung dreier monoklonaler Maus p53 Antikörper verwendet: Pab 242, 248
sowie 421, die in unserem Labor als Hybridomüberstände hergestellt und mittels T-Gel
Adsorbent nach Herstellerprotokoll aufgereinigt wurden. Nach der Inkubation wurde die
Matrix mehrmals mit E1A+ Lysepuffer sowie PBS gewaschen. Anschließend wurden die
Antikörper-Protein Komplexe durch kurze Inkubation mit 0,1 M Glycin pH 2.5 oder 2x Lämmli
Puffer ohne β-Mercaptoethanol eluiert. Im Falle der Elution mit Glycin wurde das Eluat direkt
durch Zugabe von 1 M Tris-HCl pH 9,0 neutralisiert. Ein Aliquot des Eluats wurde nun zur
Proteinbestimmung nach Bradford verwendet. Die Proteine des Eluates wurden durch
Zugabe von 20% TCA und 20% Isopropanol bei 4°C gefällt und das Präzipitat anschließend
zur Salzentfernung zweimal mit Diethylether gewaschen. Danach wurde das Präzipitat in 8 M
Harnstoffpuffer aufgenommen und sofort für die Isoelektrische Fokussierung (IEF) benutzt.
Durch Verwendung des Harnstoffpuffers liegen die meisten Proteine solubilisiert, reduziert,
deaggregiert und denaturiert vor, welches für die 2D-Gelelektrophorese notwendig ist.
Methoden
40
3.8 2D-Gelelektrophorese
Zunächst wurde etwa 1 mg Präzipitat, welches in 350 µl Harnstoffpuffer resuspendiert wurde,
über Nacht mit dem entsprechenden ReadyStripRM IPG Streifen (18 cm, pI 4-7 oder 3-10) bei
RT in dem so genannten Reswelling Tray inkubiert, um das Gel des Streifens mit der Probe
zu rehydrieren. Danach wurde das Präzipitat in der ersten Dimension durch Isoelektrische
Fokussierung an einem Streifen mit immobilisierten pH Gradienten (Ampholyte) gemäß des
isoelektrischen Punktes pI aufgetrennt. Proteine wandern bei Anlegen einer Spannung zu
dem pH Wert, an dem ihre Nettoladung 0 ist, dem sog. pI Wert. Die IEF startete mit 100 V
und steigerte sich bis 8000 V. Eine gute Auftrennung wurde erreicht, wenn die IEF über
100.000 Vh lief. Der Streifen wurde nach erfolgreicher IEF zur Reduktion von Thiolgruppen
im Äquilibrierungspuffer, der DTE enthält, 15 min inkubiert. Anschließend wurde der Streifen
zur Alkylierung in den Äquilibrierungspuffer mit IAA überführt und ebenfalls 15 min inkubiert.
Die SDS PAGE stellt die zweite Dimension der Auftrennung nach Molekulargewicht der
Proteine dar. Hierfür wurden 12%ige SDS Polyacrylamidgele im Tris-Glycin Puffer System
nach Laemmli verwendet (Laemmli, 1970). Dazu wurde der Streifen mit Agarose
Versiegelungslösung auf das Sammelgel aufgebracht. Nach der Elektrophorese wurden die
Gele zunächst in Fixierungslösung I inkubiert und dann mit Colloidaler Coomassie Blau
Lösung nach dem Protokoll von Neuhoff et al. (Neuhoff et al., 1990) oder mit Silber nach
Heukeshoven et al. (Heukeshoven and Dernick, 1985) gefärbt. Alternativ wurden die Gele
durch Westernblotting an einer Membran immobilisiert, um einen immunologischen
Nachweis durchzuführen.
3.9 MALDI ToF Massenspektrometrie
(matrix assisted laser desorption/ionization time of flight mass spectrometry)
Die MALDI ToF MS erlaubt die Analyse von intakten Peptiden, Nukleotiden sowie Polymeren
bis 500 kDa mit einer Sensitivität im pmol bis fmol Bereich. Ein Massenspektrometer besteht
aus einer Ionenquelle, einem Massenanalysator, der die Ionen nach ihrem
Masse/Ladungsverhältnis trennt und einem Detektor, der die Ionen detektiert.
Abbildung 9 Schematische Darstellung des Ionisationsprinzips bei der MALDI ToF MS.
Durch die sanfte Ionisationsmethode wird die Fragmentierung der Peptide stark reduziert.
Für die Analyse von Massen >10 kDa wird der lineare Modus verwendet, während Massen
<10 kDa im Reflektronmodus analysiert werden. Eine für die Massenspektrometrie geeignete
Matrix muss ohne Präzipitation mit dem Analyten kokristallisieren, UV Licht absorbieren und
den Protonentransfer ermöglichen. Durch einen UV Laserstrahl wird die UV absorbierende
Methoden
41
mit dem Analyten kokristallisierte Matrix unter Hochvakuumbedingungen ionisiert, wobei die
absorbierte Energie von der Matrix auf den Analyten transferiert wird, wodurch dieser
ionisiert. Durch ein elektrostatisches Feld werden die Ionen nun beschleunigt, bevor sie im
feldfreien Massenanalysator gemäß ihrem Masse/Ladungsverhältnis getrennt werden. Für
die massenspektrometrische Analyse wurden interessierende Proteinspots aus dem Gel
ausgeschnitten und mit Fixierungslösung I entfärbt, gewaschen und vakuumgetrocknet. Die
Gelstücke wurden danach in einer 1:10 Trypsin enthaltenden 25 mM Ammoniumhydrogencarbonatlösung resuspendiert und über Nacht bei 37°C inkubiert. Die Serinprotease
Trypsin hydrolysiert Proteine spezifisch am carboxyterminalen Ende von Lysin- und
Argininresten. Nach dem Trypsinverdau der Proteine in die spezifischen Peptide, wurden
diese durch sukzessive Inkubation mit zweimal Wasser bei 37°C und 20% Acetonitril in
Wasser bei RT extrahiert und anschließend Vakuum getrocknet. Zum Entsalzen wurden sog.
ZipTip C18 Pipettenspitzen nach Herstellerprotokoll benutzt. Die massenspektrometrische
Analyse erfolgte mit dem Kratos PC Axima CFR Gerät, welches mit einem gepulsten
Stickstofflaser (337 nm, Pulsweite 4 ns) ausgestattet ist und im Reflektron Modus bei einer
Beschleunigungsspannung von 20kV im Hochvakuum operierte. Die extrahierten und
entsalzten Peptidproben wurden in einer frisch präparierten Matrixlösung resuspendiert, auf
eine Stahlträgerplatte aufgebracht, luftgetrocknet und anschließend im Massenspektrometer
gemessen. Zur externen Kalibrierung wurde eine Mischung synthetisierter Peptide mit
folgenden Massen verwendet: m/z 717.4, 963.55, 1102.47, 1448.64, 2018.03, 2287.22,
3084.59, 3512.62, 4479.27. Die Spektren wurden mit der Kratos Software (Kompact V2.4.1)
aufgenommen und analysiert. Normalerweise wurden 100-500 individuelle Laserschüsse auf
eine Probe abgegeben. Mittels MASCOT Software (http://www.matrixscience.com) wurden
die experimentell erhaltenen Peptidmassen mit theoretischen verglichen und dem jeweiligen
Protein zugeordnet.
3.10 Immunfluoreszenz
Die zu untersuchenden MethA Zellen wurden einen Tag vor Durchführung der
Immunfluoreszenz auf einem Deckglas ausplattiert. Zuerst wurden diese dreimal 5 min bei
RT mit PBS gewaschen und anschließend in einer 4 prozentigen Paraformaldehydlösung für
10 min fixiert. Durch Zugabe von 1% Triton X-100 in PBS wurden die Zellen permeabilisiert,
wodurch die zu verwendenden Antikörper Zugang zum Inneren des Zellkerns erhalten.
Alternativ wurde die Extraktion durch Inkubation mit CSK I Puffer für 10 min bei 4°C
durchgeführt und anschließend zweimal mit CSK IV Puffer gewaschen. Danach wurden die
Deckgläser nochmals mit PBS gewaschen, bevor durch Inkubation mit 0,5% BSA in PBS
unspezifische Bindungsstellen blockiert wurden. Nun konnte die Inkubation mit dem ersten
Antikörper für 1 h erfolgen. Bevor mit dem zweiten Farbstoff gekoppelten Antikörper für eine
weitere Stunde inkubiert wurde, wurde erneut mit PBST gewaschen. Nach erneutem
Waschen mit PBST wurden die Deckgläser wieder mit 4% PFA fixiert. Die DNA wurde nun,
nachdem mit PBS gewaschen wurde, mit DAPI angefärbt und das Deckgläschen
anschließend mit Vectashield-Lösung auf einem Objektträger eingebettet. Die Objektträger
wurden nach Trocknen des Einbettmediums mit dem Zeiss LSM 510 Konfokalen
Fluoreszenzmikroskop, der mit Argon-, Helium- und Neon- Lasern ausgestattet ist,
betrachtet. Alternativ wurden die Objektträger in einem Fluoreszenzmikroskop beurteilt.
3.11 Konfokale Laser Scanning Mikroskopie (CLSM)
Die Verwendung der Konfokalen Laser Scanning Mikroskopie bietet den besonderen Vorteil,
optische Schnitte mit einem bestimmten Abstand durch ein entsprechendes Präparat zu
legen. Dabei ermöglicht eine zur Fokusebene angeordnete Lochblende, dass Licht, welches
nicht aus der Brennebene stammt, nicht vom Detektor erfasst wird und somit nicht zum Bild
beiträgt. Durch das punkt- bzw. zeilenweise Abtasten der Fokusebene wird so ein
hochaufgelöster optischer Schnitt innerhalb der Ebene erzeugt. Die minimale Schnittdicke
wird durch ein Zusammenspiel aus der Numerischen Apertur und der verwendeten
Wellenlänge bestimmt. Ein Verschieben der Fokusebene ermöglicht das spätere
Zusammensetzen der einzelnen Ebenen zu einem dreidimensionalen Abbild der Probe (Z-
Methoden
42
Stapel). Dabei wurde der Anfang und das Ende des Stapels vor Beginn des Scannings
festgelegt. Mit Hilfe des sogenannten Multitracking, einem Scanverfahren zur Detektion von
Mehrfachfluoreszenzen, bei dem die Überlagerung der Emissionen durch ein schnelles
Umschalten der Anregung vermieden wird, ist es möglich, aus einem Punkt quasi eine
simultane Fluoreszenz zweier Farbstoffe zu ermitteln. Durch eine spätere Überlagerung der
Einzelfluoreszenzen lässt sich bei entsprechender Farbdarstellung eine Kolokalisation der
Fluoreszenzfarbstoffe oder der mit ihnen markierten Proteine nachweisen.
Zur Durchführung der CLSM wurde das LSM 510 META von Zeiss verwendet. Die digitalen
Aufnahmen wurden mit Hilfe der LSM-Software, welche das Forschungsmikroskop Axiovert
200M und die Scan-Module steuert, ausgewertet. Um eine optimale Auflösung zu erreichen
und Aufnahme unter Anwendung der Methode des Differentiellen Interferenzkontrasts (DIC)
zu ermöglichen, wurde das Immersionsöl-Objektiv Plan-Neofluar Ph3 63x NA 1.4 verwendet.
Das Mikroskop war mit folgenden Lasern ausgestattet: Ar-Laser (458 nm, 488 nm, 514 nm,
25 mW), HeNe-Laser (543 nm, 1 mW) HeNe-Laser (633 nm, 5 mW). Nach der Aufnahme der
Bilder wurden die Rohdaten in die Huygens Essential Software (Version 2.7.2p0, Scientific
Volume Imaging B.V., Hilversum, NL; http://www.svi.nl) exportiert, um Dekonvolution unter
Anwendung des Maximum Likelihood Estimation (MLE) Algorithmus durchzuführen. Die
dekonvolierten Daten wurden dann mit Hilfe des Imaris Software Pakets (Version 4.1.3,
Bitplane AG, Switzerland; http://www.bitplane.com) bearbeitet (Tonwertkorrektur inkl.
Schwellenwertanpassung und Gammakorrektur) und 3D-rekonstruiert. Die Kolokalisation
wurde mit dem Imaris Coloc Modul analysiert, und für die Darstellung als separate Kanäle
abgespeichert und in das 3D-Bild integriert.
3.12 Agarosegel-Elektrophorese
Das Trennprinzip der Elektrophorese beruht auf unterschiedlicher Wanderungsgeschwindigkeit von DNA unterschiedlicher Ladung und Größe im elektrischen Feld, wobei
die DNA diskrete Zonen im Gel ausbildet. Für die Analyse und Präparation von DNAFragmenten wurden 1-2%ige Agarosegele in TAE verwendet.
3.13 Protein-Konzentrationsbestimmung nach Bradford
Die Gesamtprotein-Konzentrationsbestimmung wurde in Anlehnung an die Methode von M.
M. Bradford (Bradford, 1976) durchgeführt, bei der die Bindung des Farbstoffes Coomassie
Brilliant Blue an Proteine in saurer Lösung ausgenutzt wird, welche zu einer bathochromen
Verschiebung des Absorptionsmaximums von 465 nm zu 595 nm führt. Dadurch verändert
sich die braunrote Färbung, die Coomassie in saurer Lösung besitzt, in eine blaue Färbung.
Die Absorptionsintensität bei 595 nm hängt somit von der Menge an gebundenem Protein ab
und kann photometrisch verfolgt werden.
3.14 RNAi Technologie
RNA interference (RNAi) oder auch Posttranscriptional Gene Silencing (PTGS) beschreibt
einen evolutionär konservierten Mechanismus der posttranskriptionellen Degradation von
Transkripten durch dsRNA, die dem Schutz des Organismus vor viraler RNA oder
Transposons dient. DsRNA wird durch die RNase III Enzymfamilie (Dicer in Drosophila
melanogaster) in 21–23 Nukleotide (nt) lange RNAs mit charakteristischen 2 Thymin 3'
Überhängen geschnitten. Die Prozessierung von dsRNA in siRNA (small interfering RNA) ist
ein ATP abhängiger Prozess. Aktive siRNAs besitzen eine 5' Phosphat- und eine 3'
Hydroxylgruppe (Zamore et al., 2000). Es folgt die Integration der dsRNA in einen ~360 kDa
Protein/RNA Komplex namens RNA Induced Silencing Complex (RISC) mit anschließendem
ATP abhängigem Entwinden der siRNA durch die Helikaseaktivität. Abschließend leitet die
siRNA den RISC zur komplementären mRNA und verursacht deren Degradation, wobei die
mRNA in der Mitte der komplementären Region restringiert wird (Hammond et al., 2000). Die
siRNAs werden als short hairpin RNAs (shRNAs) konstruiert und in einen Vektor mit
Polymerase III Promotor exprimiert, damit die durch Faltung gebildete dsRNA die Restriktion
durch Dicer, sowie Inkorporation in den RISC hervorruft. Außerdem dient das auf microRNA
Methoden
43
basierende Loop Motiv dazu, dass die dsRNA in das Cytoplasma gelangt und prozessiert
wird (Kawasaki and Taira, 2003).
Abbildung 10 Vereinfachter schematischer Ablauf der RNA interference. Die dsRNAs mit mehr als
30bp induzieren eine potente antivirale Antwort durch die Aktivierung der IFN und dsRNA activated
proteinkinase (PKR). Synthetisch hergestellte 21-23nt RNAs, auch siRNAs genannt, vermitteln als
Intermediate des natürlichen Mechanismus die Degradation der komplementären mRNA. Die siRNAs
können direkt in die Zellen transfiziert werden oder werden als short hairpin RNAs (shRNAs)
konstruiert, damit die nach Expression in einem geeigneten Vektor durch Faltung gebildete dsRNA die
Restriktion durch Dicer sowie Inkorporation in den RISC hervorruft. Außerdem dient das auf
microRNA basierende Loop Motiv dazu, dass die dsRNA in das Cytoplasma gelangt und prozessiert
wird. DsRNA generell wird in den RISC (RNA induced silencing complex) inkorporiert mit
anschließendem ATP abhängigem Entwinden der siRNA durch die Helikaseaktivität. Abschließend
leitet die siRNA den RISC zur komplementären mRNA und verursacht deren Degradation, wobei die
mRNA in der Mitte der komplementären Region restringiert wird.
Um das mutp53 Level mittels shRNA Technologie herunterzuregulieren, wurde eine von der
shRNA gegen humanes p53 (Nukleotide 867-885) abgewandelte shRNA, welche
komplementär zur murinen p53 Sequenz ist, kommerziell von MWG synthetisiert. Zunächst
wurden sense und antisense Strang miteinander hybridisiert. Diese wurden daraufhin in den
pSUPERIOR.neo-GFP Vektor einkloniert und mittels Amaxa Elektroporation in MethA Zellen
transfiziert. Als Kontrolle diente eine sog. scrambled shRNA, bei der die Nukleotide
vertauscht werden, so dass sie nicht komplementär zu einem exprimierten Gen sind und
daher als Negativkontrolle dienen können.
3.15 Transfektion von MethA Zellen mit Amaxa
Zur transienten Transfektion von MethA Zellen mit linearisierter oder zirkulärer DNA, wurden
die Zellen zunächst trypsinisiert und in ein 15 ml Gefäß überführt, die Zellzahl mithilfe einer
Neubauer-Zählkammer ermittelt und 1x106 Zellen pro Transfektionsansatz 10 min bei 200 g
zentrifugiert.
Methoden
44
Abbildung 11 Schematische Darstellung des experimentellen Ablaufs. Die 19 nt lange zu murinem
p53 komplementäre Sequenz wird in Form einer shRNA in den pSUPERIOR Expressionsvektor
kloniert und durch Amaxa Elektroporation in MethA Zellen transfiziert. 12 oder 24 h später werden die
GFP exprimierenden Zellen durch FACS angereichert und durch Immunfluoreszenz analysiert.
Zusätzlich wird aus diesen Zellen RNA isoliert.
Anschließend wurde das Zellpellet in 100 µl nucleofector solution (Amaxa kit V)
aufgenommen und mit 2 µg zu transfizierender DNA (pSUPscr/shp53) versetzt, in die vom
Hersteller gelieferten Elektroporationsküvetten überführt und sofort im Amaxa Gerät
elektroporiert. Hierfür wurde das für MethA Zellen optimierte Programm D30 verwendet. Die
Zellen wurden sofort in 500 µl vorgewärmtes DMEM Medium aufgenommen und in eine
Schale ausplattiert. Zur Beobachtung der Zellen in der BioStation wurden spezielle Schalen
mit beschichtetem Glasboden zum Ausplattieren verwendet. Ein Mediumwechsel kann 5-6 h
nach dem Ausplattieren durchgeführt werden. Bei stabiler Transfektion mit linearisierter DNA
kann 24 h nach Transfektion mit der Antibiotikaselektion begonnen werden.
3.16 Durchflusszytometrie (FACS Analyse)
Die fluoreszenzaktivierte Zellanalyse (FACS-Analyse) ist ein Verfahren zur quantitativen
Bestimmung von Oberflächenmolekülen und intrazellulären Proteinen, und ermöglicht eine
schnelle und genaue Multiparameter-Bestimmung und Sortierung vieler einzelner Zellen in
Suspension. Dafür werden die Zellen durch hydrodynamische Fokussierung in einem
Flüssigkeitsstrom an einem gebündelten Laserstrahl geeigneter Wellenlänge tropfenweise
vorbeigeführt. Zu einer der häufigsten Anwendungen auf Einzelzellebene zählt die Detektion
von Fluoreszenz-Farbstoffen, die direkt von den Zellen produziert werden, wie z.B. EGFP.
Die Zellen werden dazu in einer Kammer (flow chamber) durch eine feine Nadel als
Probenstrom (core) in die Mitte eines breiten Mantelstroms (sheat) injiziert. Über eine sich
verjüngende Düse (nozzle) verlassen die Zellen die Kammer, fliegen tropfenweise mit hoher
Geschwindigkeit (ca. 10 m/s) am Beobachtungs- bzw. Abfragepunkt durch einen Laserstrahl
hindurch und landen schließlich in einem Auffangbehälter. Während die Zellen den
Abfragepunkt passieren, treten sie in Wechselwirkung mit dem Anregungslicht. Das
daraufhin von den Zellen ausstrahlende Streu- und Fluoreszenzlicht wird durch
Detektorsysteme erfasst und gibt Aufschluss über die verschiedenen physikalischen und
chemischen Eigenschaften der Zellen. Durch voreingestellte Sortierungs-Parameter für
einzelne Eigenschaften, z.B. dem Fluoreszenzsignal von EGFP-positiven Zellen, bekommen
diese Zellen kurz nach dem Tropfenabriss von den distal seitlich angebrachten Deflektoren
einen elektrischen Puls und werden dadurch in ihrer Flugbahn in verschiedene Richtungen
abgelenkt (und können somit in verschiedene Auffangbehälter einsortiert werden). Für die
Methoden
45
Vorbereitung einer FACS-Analyse bzw. Sortierung wurden die mit pSUP-EGFP transfizierten
MethA Zellen 12 bzw. 24 h nach Transfektion in 1xPBS gewaschen, trypsiniert und in 500 –
700 µl 1xPBS/5% FCS suspendiert. Die Suspension wurde in ein 5 ml Reaktionsgefäß
gegeben und möglichst schnell der FACS zugeführt. Die durchflusszytometrischen Arbeiten
wurden mit einem FACS Aria™ Flow Cytometer der Firma BD Bioscience durchgeführt und
dokumentiert.
3.17 Live Cell Imaging Mikroskopie
Zur Beobachtung der transfizierten Zellen wurden diese 12 h nach Transfektion in der
BioStation IM, einem integrierten Mikroskopsystem für Zell-Kultivierung und -Beobachtung,
inkubiert und an mehreren definierten Punkten alle 3 min über 60 h aufgenommen. Zur
Auswahl stehen Phasenkontrast sowie Mehrfach-Fluoreszenzaufnahmen mit den
Vergrößerungen 20, 40 und 80-fach.
3.18 Viabilitätsmessung
Als indirektes Maß für die Proliferation und Viabilität einer Zelle kann deren metabolische
Aktivität verwendet werden. Dazu wurden ohne Vektor, mit pSUP Leervektor, pSUPscr oder
pSUPshp53 Vektor transfizierte MethA oder 10-1 Zellen in 96 well Schalen in definierter
Anzahl (1000, 1500 und 2000 Zellen pro well) ausplattiert und die Viabilität 48 bzw. 72 h
nach Transfektion gemessen. Dafür wurde das kolorimetrische Tetrazoliumsalz WST-1
zugegeben, welches durch endogene mitochondriale Dehydrogenasen in ein rotes
Formazanprodukt reduziert wird. Die mitochondrialen Dehydrogenasen, die WST-1
reduzieren, gehören vornehmlich dem Komplex I der Atmungskette in den Mitochondrien an
und sind ausschließlich in lebenden Zellen aktiv. Die Bildung des Formazans kann in einem
Spektrophotometer gemessen und quantifiziert werden. Die Absorption ist proportional zur
metabolischen Aktivität der Zellen und somit zum Wachstum und Viabilität der Zellen.
Abbildung 12 Spaltung des Tetrazoliumsalzes WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5tetrazolio]-1,3-benzene disulfonate) in Formazan. EC Electron koppelndes Reagenz; RS
mitochondriales succinat-tetrazolium-Reduktase System).
Es wurden 15 µl WST-1 Reagenz zu 200 µl Medium pro 96 well zugegeben und die
Absorption bei 450 nm und 620 nm als Referenz 0,5 bis 4 h nach Zugabe gemessen. Für die
Auswertung wurde eine Inkubationszeit von 1 bzw. 1,5 h verwendet um sicherzustellen, dass
die Werte sich im linearen Bereich befinden. Aus 6 Replikaten wurden nach Subtraktion des
Medium-Leerwertes (Medium und WST-1 Reagenz) jeweils der Mittelwert und die
Standardabweichung bestimmt. Für jeden Versuch wurden außerdem drei unabhängige
Messungen durchgeführt.
Methoden
46
3.19 Injektion von MethA Zellen in Balb/c Mäuse und Aufarbeitung der Proben
3.19.1 Ascites
Zur Produktion von Ascites wurden 106 exponentiell wachsende MethA Zellen in DMEM
ohne FCS intraperitoneal in Balb/c Mäuse gespritzt und diese etwa 20 Tage später zur
Entnahme der Zellen präpariert. Die Ascitesflüssigkeit wurde zunächst zentrifugiert, und die
Erythrozyten durch Zugabe von 8 ml 0.17 M NH4Cl und 2 ml FCS und Inkubation für 6-7 min
bei 4°C lysiert. Anschließend wurden die Zellen abzentrifugiert und mehrmals mit PBS
gewaschen. Ein Teil wurde für die RNA Isolierung mittels Qiagen RNeasy mini kit verwendet.
3.19.2 Solide Tumore
Zur Induktion von soliden Tumoren wurden Balb/c Mäuse zunächst eine Woche vor
subkutaner Inkjektion von 106 MethA Zellen mit Freund-Adjuvanz gespritzt. Die Mäuse
wurden nach 20 bis 30 Tagen zur Präparation der Tumore getötet. Ein Teil der Tumore
wurde direkt in flüssigem Stickstoff eingefroren, während der andere Teil in saurem Formalin
fixiert wurde. Zur Isolierung von RNA aus Tumorstücken wurden diese zunächst in 1 ml
Trizolreagenz und Lysing Matrix D beads 2-3 mal in einem Schüttler auf Stufe 4 für 15 s
homogenisiert und anschließend 10 min bei RT inkubiert. Danach wurden 200 µl Chloroform
zugegeben, die Lösung durch Vortexen gemischt, zentrifugiert und die wässrige obere
Phase abgenommen und durch Zugabe von Ethanol gefällt. Bevor die RNA mithilfe des RNA
Mini Elute Cleanup Kits nach Herstellerprotokoll aufgereinigt wurde, erfolgte eine Inkubation
mit DNase I.
3.20 Microarray Analyse
Die Microarray Technologie ermöglicht die massenhafte, simultane Durchführung von
Hybridisierungsreaktionen an der Oberfläche einer Festphase (array) bei geringem Material-,
Platz- und Zeitbedarf (Brown and Botstein, 1999). Sie beruht auf dem Prinzip der
Hybridisierung von markierten RNA Molekülen an komplementäre genspezifische
Sequenzen, die auf der Oberfläche der Festphase immobilisiert sind. Die globalen
Genexpressionsstudien von MethA Zellen wurden unter Verwendung von whole genome
mouse Microarrays der Firma Agilent Technologies durchgeführt, die durch Immobilisierung
von 60mer Oligonukleotiden mehr als 41.000 Gene und Transkripte repräsentiert. Jeder
Array beinhaltet zudem diverse Kontrollproben, z.B. RNAs prokaryotischer/viraler Gene als
Hybridisierungskontrollen sowie positive und negative Kontrollen. Für diese Arbeit wurden
insgesamt fünf zweifarbige-Microarrays durchgeführt, die in Tabelle 1 schematisch
dargestellt sind.
Array
1
2
3
4
5
Kontrolle/Cy3
scr 12 h Exp.1
scr 24 h Exp.1
scr 12 h Exp.2
scr 24 h Exp.2
MethA adhärent
Test/Cy5
shp53 12 h Exp.1
shp53 24 h Exp.1
shp53 12 h Exp.2
shp53 24 h Exp.2
MethA suspension
Tabelle 1 Zusammenfassung der 5 Microarray-Experimente, in der jeweils eine mit Cy3 markierte
Kontroll RNA mit der entsprechenden mit Cy5 markierten Test RNA auf einem Microarray hybridisiert
wurde. Die ersten vier Experimente wurden aus mit pSUPscr bzw. pSUPshp53 transfizierten und
FACS sortierten Zellen an zwei verschiedenen Zeitpunkten nach der Transfektion und zwei
verschiedenen Tagen erhalten. Experiment 5 diente zum Vergleich von in Suspension und adhärent
wachsenden MethA Zellen.
Ein typisches Microarray-Experiment umfasst die Herstellung Fluoreszenz-markierter cRNA
ausgehend von der Gesamt-RNA über cDNA als Zwischenstufe, die Hybridisierung mit den
auf dem Microarray immobilisierten Oligonukleotidproben, das Waschen der Microarrays
nach der Hybridisierung sowie die Laser-induzierte Detektion der Hybridisierungssignale.
Methoden
47
Abbildung 13 Schematische Darstellung des experimentellen Ablaufs, in dem zunächst RNA aus
Zellen, die entweder mit pSUPscr Kontroll- oder pSUPshp53 RNA transfiziert wurden, isoliert wird und
durch RT/PCR in cRNA umgeschrieben und gleichzeitig mit den Fluoreszenzfarbstoffen Cy3 oder Cy5
markiert werden. Gleiche Mengen an markierter RNA werden anschließend mit einem kommerziellen
Microarray hybridisiert. Zum Schluss wird der Microarray gescannt und die Daten analysiert.
Nach Isolierung der Gesamt RNA aus den entsprechenden Zellen wurde zunächst die
Konzentration der RNA durch Messung mit dem NanoDrop Spektrophotometer gemessen
und die Integrität der RNA am Agilent 2100 Bioanalyzer bestimmt. Dabei erfolgte die
Durchführung der Messung mithilfe des RNA 6000 Nano Assay Protokolls unter Verwendung
der Komponenten des RNA 6000 Nano LabChip® Kits. Dieses Verfahren beruht auf dem
Prinzip der Kapillarelektrophorese und der Detektion des in die RNA interkalierenden
Fluoreszenzfarbstoffes PicoGreen durch einen Laser. Etwa 200 ng RNA wurden
anschließend mithilfe des low RNA Input linear amplification kits in cRNA transkribiert und
mithilfe des Cyanine CTP 2-color dye pack kits markiert. So genannte spike-in RNAs dienen
als Kontrolle der Hybridisierung. Alle Schritte wurden nach Angaben des Herstellers
durchgeführt.
Die Hybridisierung der RNA mit Whole mouse genome microarrays (44K), sowie das
Waschen und Scannen der Microarrays wurde freundlicherweise von Hr. Dr. Andreas Polten
der Firma Agilent Technologies, Waldbronn durchgeführt. Nach der Visualisierung des
Microarrays durch Scannen werden die Hybridisierungssignale in numerische Daten
umgewandelt. Die Qualitätskontrolle, Normalisierung der Daten und Hintergrundfilterung
wurde mithilfe der Agilent Feature Extraction Software im default Modus mit einer
zusätzlichen Hintergrundfilterung (average of all negative control features) automatisch
durchgeführt. Die weitere Auswertung der Daten erfolgte mit Microsoft Excel. Zunächst
wurde eine Hintergrundfilterung vorgenommen, wobei alle Gene, deren Signale in beiden
Kanälen rot und grün nicht größer als 50 bzw. 100 waren, verworfen wurden. Außerdem
wurden alle Daten herausgefiltert, deren Laserintensitäten im roten sowie grünen Kanal nicht
über dem Hintergrundsignal lagen. Darüber hinaus wurden alle Gene mit einem p Wert >0,01
(0,05) sowie einer Änderung um <1,5-fach von der Auswertung ausgeschlossen. Duplikate
wurden ebenfalls eliminiert. Für den Vergleich zwischen normalen und mit dsRNA
Expressionsvektoren transfizierten MethA Zellen wurde außerdem eine Clusteranalyse von
Hr. Benjamin Otto von der Arbeitsgruppe Klinische Chemie des UKE, Hamburg durchgeführt.
Die sog. Clusteranalyse von Genen/Proben dient der Entdeckung von Gruppen oder
Methoden
48
Strukturen in einem Datensatz. In der Clusteranalyse wird nach Gengruppen oder
Subgruppen gesucht, die ähnliche Expressionsmuster zeigen (Eisen et al., 1998; Tamayo et
al., 1999). Bei diesem Verfahren erfolgt eine Einteilung der Proben nach der Ähnlichkeit ihrer
Expression in Gruppen, den so genannten Clustern. Das Ziel ist es, die Proben so
zusammenzufassen, dass sie innerhalb einer Gruppe einen minimalen Abstand haben, also
möglichst ähnlich sind, und zwischen den Gruppen einen großen Abstand aufweisen und
demnach möglichst unähnlich sind (Brazma and Vilo, 2001; Quackenbush, 2001). Die
Visualisierung der Microarray Daten wurde in Form von sog. heatmaps vorgenommen, um
die hochdimensionalen Daten in zwei Ebenen darzustellen.
Zur Validierung der differentiellen Regulation ausgewählter Gene wurde eine quantitative
Real-time PCR (qRT-PCR) mit spezifischen Primern durchgeführt. Dazu wurden 2 µl cDNA,
5 µl 2x Power SYBR® Green PCR Master Mix, 2 µl Wasser und 1 µl Primer mix (je 10 µM)
pipettiert und die PCR im Real-Time PCR System 7500 Fast von Applied Biosystems
durchgeführt und mit der entsprechenden Software ausgewertet.
Ergebnisse
49
4 ERGEBNISSE
4.1 Die murine MethA Tumorzelllinie als Modellsystem für die Funktionsanalyse von
mutp53
4.1.1 MethA Zellen in vitro
Die für diese Arbeit als Modellsystem verwendeten MethA Fibrosarkomzellen entstanden
durch eine einmalige Injektion von Methylcholanthren in Balb/c Mäuse (Old et al., 1962).
MethA Zellen sind in der Lage sowohl Substrat-abhängig (adhärent) als auch Substratunabhängig (in Suspension) zu wachsen. Ihr Phänotyp ist durch folgende Merkmale
charakterisiert: (i) runde (Abb. 14a) bis spindelförmige (Abbildung 14b) Morphologie der
adhärent wachsenden Zellen; (ii) Expression von mutantem p53 Protein (Abbildung 14c), (iii)
Expression des Intermediärfilamentproteins Vimentin als Marker mesenchymaler Zellen
(Abbildung 14e) und (iv) spontane Fusion zu mehrkernigen Riesenzellen unter hoher
Zelldichte (Abbildung 14d,e). In Abbildung 14c ist die Färbung von in MethA Zellen endogen
exprimiertem
mutantem
p53
mit
einem
polyklonalen
p53
Antikörper
durch
Immunfluoreszenzfärbung zu sehen. Während sich der Grossteil von mutp53 im Zellkern
befindet, lokalisiert eine Fraktion von mutp53 zusätzlich im Zytoplasma. Es ist auffällig, dass
die Nukleoli groß sind, von denen mutp53 ausgeschlossen ist. Die großen Nukleoli der
MethA Zellen lassen auf einen schnellen Umsatz der ribosomalen RNA sowie hohe
Proliferation schließen. Die nukleolare Hypertrophie wurde häufig in Tumorzellen beobachtet
und kann in Zusammenhang mit dem Verlust der reprimierenden Wirkung von wtp53 auf die
Transkription der ribosomalen RNA gebracht werden (White, 2005).
a
b
d
c
e
Abbildung 14 Phänotypische Charakterisierung von MethA Zellen: (a,b) Phasenkontrastaufnahmen von dünn (a) und dicht (b) ausgesäten MethA Zellen; Vergrößerung 60 und 40-fach. (c)
Ergebnisse
50
Immunfluoreszenzfärbung von Paraformaldehydfixierten MethA Zellen mit polyklonalem p53spezifischen
Antikörper;
60-fache
Vergrößerung.
(d,e)
Immunfluoreszenzfärbung
von
Paraformaldehydfixierten über längere Zeit konfluent wachsenden MethA Zellen mit polyklonalem
Vimentin-spezifischen Antikörper (e) und zugehörige DAPI- Kernfärbung (d); Vergrößerung 40-fach.
4.1.2 MethA Zellen in vivo
Injiziert man 106 MethA Zellen subkutan in syngene Balb/c Mäuse, nachdem man sieben
Tage zuvor Freund-Adjuvanz injiziert hat, erhält man nach drei bis vier Wochen solide
Tumoren. In Abbildung 15 sind repräsentative Beispiele Formalin fixierter und Hämatoxilin
und Eosin (H&E) gefärbter Schnitte von zwei soliden MethA Tumoren gezeigt. Die soliden
MethA Tumore sind durch eine Stroma-Kapsel von umgebendem Gewebe abgegrenzt. Die
Immunfluoreszenzfärbung eines Kryoschnittes des Tumors 7.3 (Abbildung 15c) zeigt eine
Färbung von mutantem p53 (rot) in der Mehrheit der Zellen, die mit DAPI gefärbten Kernen
(blau) überlappt (violett). Im grünen Kanal ist die Färbung von CD11b, einem Makrophagen
spezifischen Integrin (ITGAM) dargestellt. Man erkennt eine Färbung der Zellmembran durch
CD11b in Zellen, die negativ für p53 sind und deren Kern durch die DAPI Färbung blau
dargestellt ist. MethA Zellen hingegen sind negativ für den Makrophagenmarker CD11b. Die
soliden Tumoren enthalten demnach außer MethA Zellen auch Makrophagen, die vermutlich
durch Stimulation mit Freund-Adjuvanz zum Tumor rekrutiert wurden und eine essentielle
Rolle in der Etablierung des Tumors spielen. Es sind in diesen kleinen (0,5 – 2 cm
Durchmesser) soliden Tumoren keine Blutgefäße erkennbar.
a
b
c
Abbildung 15 Phänotypische Charakterisierung von MethA Tumoren (a,b) H&E Färbung
formalinfixierter Paraffin-eingebetteter Schnitte der soliden MethA Tumoren 12244 und 7.3. (c)
Immunfluoreszenzfärbung eines Kryoschnittes des soliden MethA Tumors 7.3. Die mutp53 Färbung ist
in rot und die CD11b Färbung in grün dargestellt und die DAPI Färbung ist in blau gezeigt. Der
Maßstab entspricht 50 µm.
Ergebnisse
51
4.2 Erniedrigung des Expressionsniveaus von MethA mutp53 durch RNA Interferenz
Die Methode der RNA Interferenz (RNAi) oder RNA induzierten spezifischen Reduktion der
Genexpression lässt sich ausnutzen, um spezifisch die Expression eines Proteins von
Interesse herunterzuregulieren und den dadurch entstehenden Effekt auf die Zellen zu
beobachten. Dabei wird die Nukleotidsequenz einer shRNA (short hairpin RNA), die perfekt
komplementär zur Sequenz des Zielgens ist, in einen geeigneten Expressionsvektor kloniert
und die Synthese dieser shRNA durch den RNA Polymerase III abhängigen H1 Promotor
nach Transfektion in einer Zielzelle initiiert (Vektorkarten s. Anhang). Um herauszufinden,
welchen Einfluss mutp53 in MethA Zellen auf deren Proliferation hat, wurde die Technik der
RNA induzierten spezifischen Reduktion der Genexpression von mutp53 angewendet. Zur
Senkung der mutp53 Proteinspiegel in MethA Zellen wurde eine für murines p53 spezifische
shRNA Sequenz im Vektor pENTRTM/H1/TO (abgekürzt mit pENTR) kloniert. Diese shRNA
Sequenz wurde von der in der Literatur beschriebenen humanen p53 spezifischen shRNA
Sequenz (Aminosäuren 867-885) abgeleitet (Brummelkamp, Bernards, and Agami, 2002) (s.
2.7 Oligonukleotide). Als Negativkontrolle diente eine Sequenz, in denen die Nukleotide der
shRNA unter Verwendung einer Software (http://bioinfo.wistar.upenn.edu/siRNA/siRNA.htm)
so vertauscht wurden, dass sie nicht komplementär zu einer Gensequenz ist (scr,
scrambled). Nach Expression der shRNA in der Zelle, wird diese doppelsträngige RNA von
zelleigenen Enzymen prozessiert, so dass letztlich eine 21-23 nt lange, zum Zieltranskript
komplementäre Sequenz an die mRNA des Zielgens hybridisiert und zum Abbau des
Zieltranskriptes führt. Dies hat je nach Wirkungsgrad der verwendeten shRNA eine deutliche
Reduktion der Proteinmenge des Zielgens zur Folge.
Die stabile Expressionshemmung von mutp53 in MethA Zellen durch Transkription von
shp53 RNA vom Vektor pENTRshp53 mit anschließender Antibiotikaselektion von Klonen
war erfolglos. Es konnten zwar Antibiotika-resistente Klone selektioniert werden, diese
zeigten allerdings sowohl in der Immunfluoreszenz- als auch in Immunblot-Analysen keine
verringerte mutp53 Proteinmenge, obwohl eine Integration der shRNA Expressionskassette
in das MethA Genom durch PCR bestätigt werden konnte (Daten nicht gezeigt). Im
Gegensatz zu den mit pENTRscr Vektor transfizierten Zellen wiesen die mit pENTRshp53
Vektor transfizierten Zellen ein verringertes Wachstum sowie erhöhte Sensitivität auf,
weshalb aus diesen Zellen weniger Klone erhalten wurden als mit pENTRscr transfizierten
Zellen. Zusammen mit Literaturdaten, in denen die Behandlung von MethA Zellen mit
antisense p53 RNA ein stark reduziertes Wachstum zur Folge hatte (Shohat et al., 1987;
Yamauchi, Kobayashi, and Tanaka, 1996), führten diese Ergebnisse zur Annahme, dass
mutp53 für die Proliferation von MethA Zellen essentiell ist. Um diese Hypothese genauer zu
untersuchen, wurde der Effekt der shRNA Expression in MethA Zellen über transiente
Transfektionen analysiert. Der dafür verwendete pSUPERIOR.neo+GFP Expressionsvektor
Ergebnisse
52
(abgekürzt mit pSUP) enthält neben der shRNA Expressionskassette mit H1 Promotor
außerdem das Gen, das für EGFP (enhanced green fluorescent protein) kodiert. EGFP
diente als Markerprotein für eine erfolgreiche Transfektion. Da MethA Zellen schlecht
transfizierbar sind (abhängig von der Passagenanzahl sind ca. 10-20% der Zellen positiv für
die Expression von EGFP nach Amaxa-Transfektion mit pSUP Vektor), lassen sich durch
diese Technik mithilfe des Aria FACS-Gerätes (Fluorescence activated cell sorting) EGFP
exprimierende Zellen anreichern. 106 MethA Zellen wurden dazu mit 2 µg pSUPscr oder
pSUPshp53 DNA durch Elektroporation gemäß des Amaxa Herstellerprotokolls transfiziert
und 12 bzw. 24 h danach mit einem FACS-Gerät auf EGFP Expression sortiert und
anschließend auf Deckgläschen ausplattiert. Wiederum 24 h später erfolgte eine
Immunfluoreszenzfärbung nach mutp53. Der Ablauf des Experimentes ist in Abbildung 11 im
Methodenteil schematisch dargestellt.
In den folgenden Abbildungen 16.1 bis 16.4 ist die DAPI Kernfärbung (jeweils Abbildung a),
die mutp53 Färbung (jeweils Abbildung b) sowie die EGFP Expression (Abbildungen c)
jeweils zweier repräsentativer Präparatsausschnitte gezeigt. Die mit dem Kontrollvektor
pSUPscr transfizierten und angereicherten Zellen weisen ein starkes Signal für mutp53 auf
(Abb. 16.1 und 16.2), während im Vergleich dazu eine deutliche Reduktion des mutp53
Spiegels in der Mehrzahl der mit pSUPshp53 transfizierten Zellen zu erkennen ist (Abb. 16.3
und 16.4). Da nicht alle mit pSUPshp53 Vektor transfizierten Zellen einen gleichermaßen
reduzierten mutp53 Gehalt aufweisen, handelt es sich um eine vergleichsweise heterogene
Population, deren mutp53 Expression gemittelt um ca. 50% verringert ist (s. Tabelle 4). Man
kann außerdem erkennen, dass die EGFP Expression transfizierter Zellen unterschiedlich
ist. Die Immunfluoreszenzbilder zeigen jedoch, dass die ausgewählte shRNA gegen mutp53
spezifisch den mutp53 Proteinspiegel herunterreguliert. Demnach wird die verwendete
shRNA in den MethA Zellen exprimiert und prozessiert und kann daher für weitere
Experimente verwendet werden.
1 scr
2 scr
A DAPI
B p53
C EGFP
Ergebnisse
53
3 shp53
4 shp53
Abbildung 16.1 bis 4 (a,b,c) Immunfluoreszenzaufnahmen von transfizierten und 24 h später über
FACS angereicherten MethA Zellen. In Abbildung 1 und 2 sind die mit dem Kontrollvektor pSUPscr
transfizierten Zellen gezeigt, während die in 3 und 4 dargestellten Zellen mit pSUPshp53 transfiziert
wurden. In Abbildung a ist jeweils die DAPI Färbung, während in den Abbildungen b und c die mutp53
Färbung bzw. EGFP Expression dargestellt ist. Die Vergrößerung beträgt 40-fach.
Die nachfolgenden Abbildungen zeigen ein repräsentatives Beispiel der FACS-Analyse von
MethA Zellen 24 h nach Transfektion mit pSUPshRNA Expressionsvektoren. Man kann
erkennen, dass sich die EGFP Expressionswerte bei den definierten Gitterrastern zwischen
pSUPscr und pSUPshp53 transfizierten Zellen kaum unterscheiden (21,8 und 18,6%), und
dass auch die Anzahl toter oder fragmentierter Zellen ungefähr gleich ist (2,5 und 2,3%).
Generell war jedoch zu beobachten, dass die EGFP Expressionseffizienz in pSUPshp53
Vektor transfizierten im Vergleich zu pSUPscr transfizierten MethA Zellen leicht niedriger
war, und dass trotz exakt gleicher Behandlung auch die Gesamtzellzahl der shp53
transfizierten Zellen geringer war. Diese Befunde lassen darauf schließen, dass durch die
Transfektion mit pSUPshp53 vermutlich schon einige EGFP exprimierende Zellen vor der
durchflusszytometrischen Analyse abgestorben sind und experimentell nicht erfasst werden
konnten.
Ergebnisse
54
Population
P1 (Blau+grün)
P2 (grün)
NOT(P2) (blau)
violett
scr
97,5 %
21,8 %
78,2 %
2,5 %
shp53
97,7 %
19,6 %
80,4 %
2,3 %
Abbildung 17 Durchflusszytometrische Analyse von MethA Zellen, die mit pSUPscr Kontroll- (oben)
oder pSUPshp53 Vektoren (unten) transfiziert wurden und 24 h nach Transfektion auf ihre EGFP
Expression untersucht wurden. Es ist repräsentativ das Beispiel für das Experiment 1 zum Zeitpunkt
24 h nach Transfektion gezeigt. Die Bilder a, b und c repräsentieren unterschiedliche
Darstellungsweisen. Das verwendete FACS Gerät besitzt eine Sortierungseffizienz von > 95 %. FSCH (forward scatter) entspricht der Größe bzw. dem Volumen der Zellen und SSC-H (sideward scatter)
deren Granularität. Die in violett dargestellten Zellen repräsentieren aufgrund ihres Verhältnisses von
Größe und Granularität tote oder fragmentierte Zellen. Die Gitterraster wurden anhand von nichttransfizierten MethA Zellen definiert. Die in grün dargestellten Zellen exprimieren EGFP, während die
in blau dargestellten Zellen kein EGFP exprimieren. Die EGFP Expression ist als relative
Leuchtintensität dargestellt. Man beachte, dass es sich bei allen gezeigten physikalischen Größen um
relative Einheiten handelt. In der zugehörigen Tabelle sind die Populationen mit dem jeweiligen
prozentualen Anteil angegeben.
4.3 Analyse des Effekts der Reduktion von mutp53 auf das Wachstum von MethA
Zellen
4.3.1 Analyse von MethA Zellen nach Expression von dsRNA durch Live Cell Imaging
Mikroskopie
Aufgrund der Hinweise aus der Literatur sowie der erfolglosen Versuche, MethA Klone mit
reduziertem mutp53 Gehalt zu erhalten, sollte die Bedeutung von mutp53 für die Proliferation
mit einer weiteren Methode untersucht werden. Dazu wurden 150.000 MethA Zellen transient
mit pSUPscr bzw. pSUPshp53 über Elektroporation transfiziert und das Wachstum ohne
EGFP-FACS-Sortierung direkt in der BioStation IM der Firma Nikon dokumentiert. Als
Kontrollen wurden MethA Zellen ferner ohne Vektor nach AMAXA Protokoll behandelt sowie
mit pSUP Leervektor transfiziert, um den Einfluss der Transfektionsmethode bzw. des
Vektors oder der EGFP Expression auf das Wachstum zu untersuchen. Die nach AMAXA
Protokoll behandelten MethA Zellen verdoppelten ihre Zahl schon 24 h nach Transfektion
(Abb. 18). Teilweise gingen aus einer Zelle sogar drei neue Zellen hervor. Im Gegensatz zu
den AMAXA behandelten Zellen wurde bei den Zellen, die mit pSUP Leervektor (Abb. 19)
transfiziert wurden, ein reduziertes Wachstum und erhöhtes Absterben beobachtet.
Ergebnisse
55
Abbildung 18.1 bis 5 Phasenkontrastaufnahmen 8 bis 56 h nach der Transfektion von MethA Zellen
ohne Plasmid (Kontrolle). Es sind fünf repräsentative Ausschnitte einer Zellkulturschale ausgewählt
und in der BioStation IM aufgenommen. Die Vergrößerung beträgt 40-fach.
1
2
3
Ergebnisse
56
Abbildung 19.1 bis 5 Phasenkontrastaufnahmen 8 bis 56 h nach der Transfektion von MethA Zellen
mit pSUP Leervektor. Es sind fünf repräsentative Ausschnitte einer Zellkulturschale ausgewählt und in
der BioStation IM aufgenommen. Die Vergrößerung beträgt 40-fach.
Die Transfektion von MethA Zellen mit pSUPscr (Abb. 20) oder pSUPshp53 (Abb. 21) führte
zu einer weiteren drastischen Reduktion des Wachstums und der Viabilität. Dies lässt darauf
schließen, dass dsRNA <30 bp in MethA Zellen einen deutlichen Effekt auf das
Zellwachstum sowie das Überleben der Zellen hat. Für die Nutzung der RNAi Technologie
wurden die dsRNA so konzipiert, dass sie kleiner als 30 bp sind, um einer für dsRNA >30bp
bekannten sequenz-unspezifischen Interferonantwort zu entgehen. In einigen wenigen
Publikationen wird berichtet, dass schon die Transfektion von dsRNA kleiner 30 bp eine
potente Interferon-ähnliche Reaktion auslöst (Sledz et al., 2003).
Der Einfluss von dsRNA <30 bp auf MethA Zellen ist daher überraschend. Der Effekt der
Transfektion mit dsRNA im Vektor pSUP auf das Wachstum und die Viabilität von MethA
Zellen scheint von mutp53 abhängig zu sein, da durch die Reduktion von mutp53 mittels
shp53 Expression dieser Effekt zusätzlich verstärkt wird. Dieses Ergebnis ist ein starkes
Indiz für eine essentielle Funktion von mutp53 in MethA Zellen für deren Wachstum in
Gegenwart von exogen exprimierter dsRNA. Der größte Teil der mit pSUPshp53
transfizierten Zellen verbleibt in einem Wachstumsarrest und teilt sich nicht weiter oder stirbt
Ergebnisse
57
ab. Morphologisch ist zu beobachten, dass die sterbenden Zellen runder und größer werden
und schließlich platzen. Diese Anzeichen lassen einen Arrest in der Mitose und einen Tod
durch die mitotische Katastrophe (Castedo et al., 2004; Galluzzi et al., 2007), ein Sonderfall
der Apoptose, vermuten.
Abbildung 20.1 bis 5 Phasenkontrastaufnahmen 8 bis 56 h nach der Transfektion von MethA Zellen
mit pSUPscr Kontrolle. Es sind wiederum fünf verschiedene Ausschnitte der Zellkulturschale gezeigt,
die in der BioStation IM aufgenommen wurden.
Ergebnisse
58
Abbildung 21.1 bis 5 Phasenkontrastaufnahmen 8 bis 56 h nach der Transfektion von MethA Zellen
mit pSUPshp53. Es wurden fünf verschiedene Bereiche der Zellkulturschale zur Beobachtung in der
BioStation IM ausgewählt.
Um das Wachstum quantifizieren zu können, wurde die Zellanzahl in fünf aufgenommenen
Ausschnitten einer Zellkulturschale zum Startpunkt 8 h nach Transfektion sowie 56 h nach
Transfektion als Endpunkt bestimmt und der Quotient aus Zellanzahl zum Endpunkt und
Zellanzahl zum Anfangspunkt gebildet. Aus diesen Zahlen wurde der Mittelwert gebildet und
die Standardabweichung berechnet.
Startpunkt 8 h
Endpunkt 56 h
Quotient
Kontrolle
38 (0,5)
199 (5,5)
5,24
pSUP
45 (1,2)
65 (4,7)
1,4
pSUPscr
20 (1,7)
38 (1,1)
1,9
pSUPshp53
21 (1,3)
14 (0,8)
0,71
Tabelle 2 Bestimmung des Wachstumquotienten der live cell imaging Mikroskopieaufnahmen.
den Startpunkt 8h und 56h nach der Transfektion von MethA Zellen ohne Vektor (Kontrolle),
pSUP, pSUPscr oder pSUPshp53 wurde die Summe der Zellen aus den fünf Bereichen
Zellkulturschalen ermittelt und der Quotient aus beiden Zeitpunkten bestimmt.
Standardabweichung ist in Klammern angegeben.
Für
mit
der
Die
Ergebnisse
59
Der Wachstumsquotient zeigt, dass MethA Zellen nach Transfektion mit pSUPscr ein im
Vergleich zur Kontrolle reduziertes Wachstum aufweisen, im Versuchszeitraum aber
immerhin noch ihre Zellzahl fast verdoppeln. Dagegen nimmt nach Transfektion mit
pSUPshp53 die MethA Zellzahl ab. Die Standardabweichung ist in Klammern angegeben
(Tabelle 2).
Zusammenfassend können durch dieses Experiment zwei voneinander abhängige Effekte
der exogenen dsRNA deutlich gemacht werden. Zum einen wird durch die pSUP
Vektorvermittelte Expression von dsRNA eine starke Reduktion des Wachstums und der
Viabilität von MethA Zellen erzeugt und zum anderen wird dieser Effekt durch Reduktion des
mutp53 Gehaltes potenziert. Dies weist darauf hin, dass mutp53 dem wachstumshemmenden Effekt von exogen exprimierter dsRNA entgegenwirken kann, da im Vergleich
zur Transfektion mit pSUPscr Kontrolle die Reduktion des mutp53 Spiegels ein reduziertes
Wachstum und eine reduzierte Viabilität der MethA Zellen zur Folge hat. Die
Beobachtungen, die durch die live cell imaging Mikroskopie gemacht wurden, sollen durch
eine Viabilitätsmessung weitere unabhängige experimentelle Bestätigung finden und den
Effekt quantifizieren.
4.3.2 Validierung und Quantifizierung des durch dsRNA induzierten Wachstumsarrests
durch Viabilitätsmessung
Der Einfluss der Transfektion von dsRNA auf das Wachstum und die Viabilität der MethA
Zellen ist deutlich durch live cell imaging Mikroskopie zu erkennen. Der dsRNA-vermittelte
Effekt scheint außerdem abhängig von mutp53 zu sein, da ein reduzierter mutp53 Gehalt die
Sterblichkeit erhöht und das Wachstum der MethA Zellen zusätzlich verringert.
Dies lässt vermuten, dass mutp53 der Reduktion des Wachstums nach Expression von
dsRNA partiell entgegenwirkt. Um diese Effekte mit einer größeren und dadurch
repräsentativen Menge an Zellen quantifizieren zu können, wurde die metabolische Aktivität
als indirektes Maß für das Wachstum und die Viabilität von transfizierten MethA Zellen zu
verschiedenen Zeitpunkten gemessen. Dazu wurden kolorimetrische Messungen mit dem
Substrat WST-1, einem Tetrazoliumsalz, durchgeführt. WST-1 wird durch lebende Zellen
aufgenommen und durch mitochondriale Dehydrogenasen zu einem löslichen FormazanFarbstoff reduziert. Die Reduktion von WST-1, die mit der Aktivität der Atmungskette und
dadurch mit der Proliferation bzw. Viabilität von transfizierten Zellen korreliert, kann durch
Messung in einem Spektralphotometer quantifiziert werden. Es wurden dazu drei
voneinander unabhängige Experimente durchgeführt mit je zwei Messungen zu den
Zeitpunkten 48 und 72 h nach Transfektion mit pSUP Leervektor, pSUPscr, pSUPshp53,
oder Behandlung nach Amaxa-Protokoll. Die Zellen wurden nach der Transfektion nicht über
FACS nach EGFP Expression sortiert, da die Beobachtungen durch live cell imaging
Mikroskopie ebenfalls ohne Anreicherung transfizierter Zellen gemacht wurden. Es wurden
Ergebnisse
60
1000, 1500 und 2000 Zellen pro well in einer 96-well Schale ausplattiert und je 6 Replikate
pro Transfektion, Zellzahl und Experiment angefertigt. Als Nullwert der Messung diente
Zellkulturmedium ohne Zellen. Aus 6 Replikaten für jede Probe wurde der Mittelwert
berechnet und die Standardabweichung ermittelt. Mit dieser Methode konnte der durch live
cell imaging Mikroskopie beobachtete Trend bestätigt und quantifiziert werden. Es wird
deutlich, dass die Viabilität von MethA Zellen sowohl 48 als auch 72 h nach Transfektion mit
pSUP Leervektor, pSUPscr und pSUPshp53 im Vergleich zu Zellen, die ohne Vektor DNA
(mock) transfiziert wurden, sukzessive abnimmt. In der Abbildung 22 sind die Ergebnisse der
Viabilitätsmessungen repräsentativ 72 h nach Transfektion von MethA Zellen als Mittelwerte
der drei unabhängigen Experimente dargestellt.
Viabilität MethA 72h nach Transfektion
1.1
1.0
rel. Absorption
0.9
0.8
pSUP
scr
shp53
0.7
0.6
0.5
0.4
0.3
0.2
500
1000
1500
2000
2500
Zellzahl
Abbildung 22 Graphische Darstellung der WST-1-basierenden Viabilitätsmessung von MethA Zellen
72 h nach der Transfektion mit pSUP Leervektor (blau), pSUPscr (pink) oder pSUPshp53 (gelb). Es
wurden insgesamt drei unabhängige Experimente durchgeführt, aus denen der Mittelwert berechnet
wurde. Auf der Ordinate ist die relative Absorption bei 450 nm und auf der Abszisse die Zahl der
ausplattierten Zellen dargestellt. Die Standardabweichung ist ebenfalls in den Fehlerbalken
angegeben.
Die relative Absorption bei 450 nm ist auf der Ordinate und die Zellzahl (1000, 1500 und
2000 Zellen pro well) auf der Abszisse für die mit pSUP Leervektor (pSUP), pSUPscr (scr)
oder pSUPshp53 (shp53) transfizierten MethA Zellen dargestellt. Die Messwerte für die
mock transfizierten MethA Zellen sind nicht dargestellt, weil diese deutlich höher als die
Messwerte für die Vektor-transfizierten Zellen lagen. Um herauszufinden, ob die Viabilität
durch die Expression von dsRNA bzw. shp53 RNA abhängig von mutp53 sinkt, wurden die
gleichen Messungen für murine 10-1 Zellen, die kein p53 exprimieren, wiederholt. Die
Viabilität von 10-1 Zellen, die entweder mit pSUP Leervektor oder pSUPscr bzw. pSUPshp53
Ergebnisse
61
Vektor transfiziert wurden, ist nahezu identisch (Abb. 23). Dieses Ergebnis zeigt, dass die
reduzierte Viabilität durch Transfektion mit pSUPscr oder pSUPshp53 wahrscheinlich
abhängig von mutp53 ist. Zusätzlich wird deutlich, dass die Transfektion von 10-1 Zellen mit
pSUP Leervektor im Gegensatz zu MethA Zellen keinen Einfluss auf deren Viabilität hat.
Diese Ergebnisse wurden mit einer weiteren unabhängigen Methode, der Kristallviolettfärbung bestätigt (Daten nicht gezeigt).
Viabilität 10-1 72h nach Transfektion
0.9
0.8
rel. Absorption
0.7
0.6
pSUP
scr
shp53
mock
0.5
0.4
0.3
0.2
0.1
0.0
500
1000
1500
2000
2500
3000
Zellzahl
Abbildung 23 Graphische Darstellung der WST-1-basierenden Viabilitätsmessung von 10-1 Zellen 72
h nach der Transfektion mit pSUP Leervektor (blau), pSUPscr (pink) oder pSUPshp53 (gelb).
Außerdem ist die Viabilität von 10-1 Zellen ohne Vektor (mock) in türkis gezeigt. Es wurde der
Mittelwert aus insgesamt drei unabhängigen Experimenten verwendet. Auf der Ordinate ist die relative
Absorption bei 450 nm und auf der Abszisse die Zahl der ausplattierten Zellen dargestellt. Die
Standardabweichung ist ebenfalls in den Fehlerbalken angegeben.
Die bisherigen Versuche zeigen, dass mutp53 in Gegenwart von exogen exprimierter dsRNA
einen Einfluss auf das Wachstum sowie die Viabilität von MethA Zellen hat, da die durch
Expression von exogener dsRNA verursachte Reduktion des Wachstums und der Viabilität
von MethA Zellen durch Reduktion von mutp53 noch verstärkt wird. Dieser Zusammenhang
liefert bereits mögliche Hinweise auf eine wichtige Funktion von mutp53 im RNA
Metabolismus von MethA Zellen. Um nun die molekularen Mechanismen von mutp53 in
MethA Zellen zu untersuchen, die den beobachteten Effekt erklären könnten, wurde ein
systemischer Ansatz gewählt. Hierfür wurden Experimente auf Genom-, Transkriptom- und
Proteinebene durchgeführt, um durch die Analyse der Interaktionen und Interaktionspartnern
die physiologische Funktion von mutp53 in MethA Zellen zu entschlüsseln. Dies soll die
Interpretation des Beitrags von mutp53 auf das Wachstum von MethA Zellen ermöglichen
und damit Rückschlüsse auf den Einfluss von mutp53 zur Tumorgenese zulassen.
Ergebnisse
62
4.4 Analyse der Funktion von mutp53 auf der Ebene des Genoms
4.4.1 Expressionsprofiluntersuchung durch die Microarray Technologie
Um
Hinweise
über
den
molekularen
Mechanismus
des
mutp53
abhängigen
Wachstumsarrests nach Transfektion von dsRNA Expressionsvektoren in MethA Zellen auf
der Ebene der Genexpression zu erhalten, wurde die Microarray Technologie verwendet.
Dazu wurden zunächst die Genexpressionsprofile von pSUPscr und pSUPshp53
transfizierten MethA Zellen verglichen (s. 4.4.1.1). Danach erfolgte ein Vergleich der
Expressionsprofile
von
untransfizierten
MethA
Zellen
mit
dem
von
dsRNA
Expressionsvektoren transfizierten Zellen (s. 4.4.1.2). Die Genexpressionsprofile sollen
Aufschluss auf den Einfluss des reduzierten mutp53 Spiegels bzw. der dsRNA im
Allgemeinen auf die Genexpression in MethA Zellen geben.
4.4.1.1 Vergleich der Expressionsprofile zwischen pSUPscr und pSUPshp53 transfizierten MethA
Zellen
Zum Vergleich der Expressionsprofile zwischen pSUPscr und pSUPshp53 transfizierten
MethA Zellen wurde die Gesamt-RNA aus mit pSUPscr bzw. pSUPshp53 transfizierten und
mittels FACS-Analyse nach EGFP Expression angereicherten MethA Zellen isoliert und in
einer Reversen Transkription und danach folgenden linearen T7-RNA Polymerasevermittelten Amplifikation in eine Cy3 bzw. Cy5-markierte cRNA umgeschrieben. Die
fluoreszierenden cRNA Proben wurden auf einem Gesamtmausgenom-Microarray mit
44.000 Druckpunkten der Firma Agilent Technologies hybridisiert (s. Abbildung 13).
Es wurden insgesamt vier Microarray-Experimente mit zwei biologischen Replikaten
(Experiment 1 und 2) zu jeweils zwei verschiedenen Zeitpunkten (12 und 24 h nach
Transfektion) für diesen Vergleich durchgeführt. Zunächst erfolgt eine Qualitätskontrolle und
Normalisierung der Daten wie im Methodenteil beschrieben. Danach wurden die vier
Experimente zunächst getrennt mit den beschriebenen Filterkriterien (Hintergrundsubtraktion
der relativen Expressionswerte von 50; alle Werte mit einem p-Wert >0,01 wurden
herausgefiltert) ausgewertet und anschließend die überlappenden Gene zwischen den
Experimenten bestimmt. Wie erwartet, ist (mut)p53 in der Liste der differentiell regulierten
Gene mit einer etwa 2-fachen Reduktion nach knockdown von mutp53 durch die
Transfektion mit pSUPshp53 zu finden. Dies impliziert, dass eine hinsichtlich des mutp53
Spiegels heterogene Zellpopulation vorliegt (s. Abb. 16). Daher wurde für die Auswertung
der Expressionsdaten ein weniger stringenter Grenzwert von einer 1,5-fachen Änderung
gewählt. Die Heterogenität der FACS angereicherten Zellen spiegelt sich ebenfalls in der
vergleichsweise geringen Überlappung von Genen der vier Experimente wider. Wichtig zu
erwähnen ist außerdem, dass die MethA Zellen für das Experiment 1 zwei Tage zuvor frisch
aufgetaut wurden, während die Zellen vom Experiment 2 neun Tage zuvor aufgetaut wurden.
Ergebnisse
63
Dies hat möglicherweise einen Einfluss auf das Expressionsprofil der Zellen. In der
nachfolgenden Tabelle 3 ist die Anzahl der differentiell regulierten Gene der vier
Experimente und der überlappenden Gene verschiedener Experimente dargestellt nach
Verwendung der Filterungskriterien.
FACS Proben
P<0,01; 1,5 fache Änderung;
BG50
Differentiell
regulierte Gene
hochreguliert
herrunterreguliert
scr-shp53-12h-Experiment 1
673
342 (50,8%)
331 (49,2%)
scr-shp53-24h-Experiment 1
209
123 (58,8%)
86 (41,2%)
scr-shp53-12h-Experiment 2
132
95 (72%)
37 (28%)
scr-shp53-24h- Experiment 2
439
206 (46,9%)
233 (63,1%)
Überlappung 12h- Exp. 1 und 2
24
15 (62,5%)
9 (37,5%)
Überlappung 24h-Exp. 1 und 2
59
38 (64,4%)
21 (35,6%)
Überlappung 12h+24h-Exp. 1
31
18 (56,2%)
14 (43,8%)
Überlappung 12h+24h- Exp. 2
30
16 (51,6%)
15 (48,4%)
Überlappung alle Proben
8
6 (75%)
2 (25%)
Tabelle 3 Auswertung der zweifarbigen Microarray Experimente für FACS angereicherte Zellen. Bei
Anwendung der Filterungskriterien 1,5-fache Expressionsänderung, p <0,01 und Hintergrundsubtraktion von 50 (BG 50) erhält man zwischen 130 und 670 differentiell regulierte Gene. Bestimmt
man überlappende differentiell regulierte Gene zwischen den Experimenten, verringert sich die Anzahl
differentiell regulierter Gene deutlich. Der prozentuale Anteil hochregulierter Gene beträgt 50 -70%.
4.4.1.1.1 Differentiell regulierte Gene in allen vier Microarray Experimenten
In allen vier Experimenten führte die Erniedrigung des mutp53 Spiegels zur einer
verringerten Expression der Gene für die Chemokine Ccl4 und Cxcl10 sowie Galnt7 (UDP-Nacetyl-alpha-D-galaktosamine: polypeptide N-acetylgalaktosaminyltransferase 7).
Ergebnisse
64
Gen
Genbeschreibung
Exp.1
12h
Exp.1
24h
Exp.2
12h
Exp.2
24h
Mittelwert
Ccl4
chemokine (C-C motif)
ligand 4
-1,53
-1,62
-1,51
-1,57
-1,56
Cxcl10
chemokine (C-X-C motif)
ligand 10
-1,60
-1,69
-2,00
-1,61
-1,72
Dync1h
1
dynein cytoplasmic 1
heavy chain 1
1,69
-1,57
-1,54
-2,15
-1,33
Galnt7
UDP-N-acetyl-alpha-Dgalactosamine: polypeptide Nacetylgalactos-aminyltransferase 7
-1,63
-1,66
-1,63
-1,75
-1,67
Trp53
transformation related
protein 53
-2,56
-2,36
-1,97
-1,97
-2,2
U59758
p53-variant
-2,03
-2,51
-1,71
-1,88
-2,01
Ctnnb1
catenin beta
2,54
1,58
1,56
1,75
1,82
Myo1e
myosin IE
1,51
1,70
2,00
1,74
1,73
Tabelle 4 Liste der in allen vier Micrarray-Experimenten überlappenden differentiell regulierten Gene
bei Filterungskriterien von p< 0,01; 1,5-fachen Änderung der Expression sowie Hintergrundsubtraktion
von 50. Die angegebenen Werte stellen die Änderung des Verhältnisses zwischen scr Kontrolle und
shp53 dar.
Dagegen wurden die Gene Ctnnb1 (Catenin beta) und Myo1e (Myosin 1E) hochreguliert
(Tabelle 4). Es konnte keine differentielle Regulation klassischer Zellzyklusarrest-,
Differenzierungs- oder Apoptose-induzierender Gene nach Reduktion von mutp53 durch die
Expressionsanalyse festgestellt werden, die den beobachteten phänotypischen Effekt direkt
erklären würden. Mutp53 ist in Experiment 1 stärker herunterreguliert als in Experiment 2.
Dies ist vermutlich auf die höhere Transfektionseffizienz von frisch aufgetauten MethA Zellen
verglichen mit Zellen, die länger kultiviert wurden, zurückzuführen. Man kann außerdem
feststellen, dass zytoplasmatisches Dynein (Dync1h1) im Experiment 1-12h nach Verringern
des mutp53 Spiegels hochreguliert, während es in den anderen drei Experimenten
herunterreguliert ist. In der Tumorgenese spielen Chemokine (chemotaktische Cytokine) eine
wichtige Rolle bei der Migration und Aktivierung von Leukozyten in Tumorerkrankungen, die
durch eine entzündliche Umgebung charakterisiert sind. Viele Malignome produzieren
Cytokine, die als Mediatoren der Infiltration von Makrophagen und Leukozyten in diesen
Tumoren wirken. Beispielsweise benötigen MethA Zellen eine entzündliche Umgebung zur
Bildung eines Tumors in syngenen Mäusen, weshalb eine vorherige Behandlung mit FreundAdjuvanz essentiell ist. Des Weiteren wurde festgestellt, dass die MethA-Tumore mit
Makrophagen und Leukozyten assoziiert sind (siehe 4.1.2). Eine Erklärung des Einflusses
von mutp53 auf die Proliferation und das Überleben von MethA Zellen ergibt sich aus diesem
Vergleich allerdings nicht direkt. Daher wurden zusätzlich die Gene untersucht, die in zwei
Ergebnisse
65
Experimenten 24 h nach Transfektion mit pSUPscr oder pSUPshp53 differentiell reguliert
sind, und für die eine stärkere Expressionsänderung erwartet wurde.
4.4.1.1.2 Differentiell regulierte Gene in Microarray Experimenten 24 h nach der
Transfektion
Da für den Zeitpunkt 24 h nach Transfektion eine stärkere Änderung der Genexpression
erwartet wurde, fokussierten wir uns auf Gene, die 24 h nach Transfektion differentiell
reguliert waren (siehe Tabelle 10 im Anhang 7.2). Auffällig waren Gene, die funktionell dem
APC Komplex (Anaphase promoting complex), der den Fortschritt von der Metaphase zur
Anaphase in der Mitose einleitet, zugeordnet werden konnten, darunter: Cdc23, Dync1h1,
Rap1gap, Csnk1δ und Ajuba. Eine andere Gruppe differentiell regulierter Gene kann dem
Zellwachstum und der Migration zugeordnet werden, z.B. Akt, Fhl1, Prodocan, Fut8, Rpl41
und Rpl5. Die könnte darauf zurückgeführt werden, dass die Reduktion von mutp53 durch
shRNA gemittelt lediglich 50% beträgt und diese Reduktion von mutp53 auf die
Transkriptmenge in MethA Zellen offensichtlich nur einen geringen Einfluss hat.
4.4.1.1.3 Validierung der differentiell regulierten Gene mittels qRT-PCR
Für die sechs Gene neben mutp53, die in allen vier FACS-Microarrays als differentiell
reguliert gefunden wurden, wurden Primer zur Überprüfung der Regulation durch quantitative
real-time PCR aus PrimerBank (http://pga.mgh.harvard.edu//primerbank) verwendet. Zur
Normalisierung der Daten wurde das Gapdh Gen ausgewählt. Der Expressionswert der
Kontrolle scr (rot) wurde gleich 1 gesetzt und die Expression der Gene in Zellen, die mit
pSUPshp53 transfiziert wurden (blau) ist relativ zur Kontrolle angegeben (Abb. 24-27). In
dem Experiment 1-12h kann eine differentielle Regulation von allen Genen mit Ausnahme
von Ccl4 und Cateninb bestätigt werden (Abb. 24). Zytoplasmatisches Dynein war für dieses
Experiment im Microarray hochreguliert nach knockdown von MethAp53, ist in der qRT-PCR
jedoch eindeutig herunterreguliert. Im Experiment 1-24h kann eine differentielle Regulation
für alle Gene mit Ausnahme von Cateninb zwischen pSUPscr und pSUPshp53 transfizierten
MethA Zellen beobachtet werden (Abb. 25). Auch die Änderung der Expression stimmt bis
auf Cateninb zwischen Expressionsdaten und qRT-PCR überein.
Ergebnisse
66
8
7
6.321
6
5
4
3
2
1
0.96
0.667
0.862
0.397
0.341
0.321
0
Ccl4
Cxcl10
Dync1h1
Galnt7
p53
myo1e
Cateninb
Abbildung 24 Relative Quantifizierung mittels qRT-PCR von RNA aus Zellen, die mit pSUPscr (rot)
oder pSUPshp53 (blau) transfiziert wurden und 12 h (Exp. 1) danach angereichert wurden.
2.5
1.947
2
1.5
1.088
1
0.688
0.65
0.506
0.456
0.5
0.379
0
Ccl4
Cxcl10
Dync1h1
Galnt7
p53
myo1e
Cateninb
Abbildung 25 Relative Quantifizierung mittels qRT-PCR von RNA aus Zellen, die mit pSUPscr (rot)
oder pSUPshp53 (blau) transfiziert wurden und 24 h (Exp. 1) danach angereichert wurden.
Im Vergleich der Expression zwischen Kontrolle und mit shRNA herunterreguliertem mutp53
in MethA Zellen 12 h nach Transfektion des Experimentes 2 kann eine differentielle
Expression für alle Gene beobachtet werden mit Ausnahme von Myo1E (Abb. 26). Die
Änderungen für Ccl4 und Cateninb sind ebenfalls gering.
Ergebnisse
67
3
2.5
2
1.5
1.071
1
0.855
0.842
0.48
0.5
1.16
0.455
0.522
0
Ccl4
Cxcl10
Dync1h1
Galnt7
p53
myo1e
Cateninb
Abbildung 26 Relative Quantifizierung mittels qRT-PCR von RNA aus Zellen, die mit pSUPscr (rot)
oder pSUPshp53 (blau) transfiziert wurden und 12 h (Exp. 2) danach angereichert wurden.
1.6
1.4
1.153
1.2
1.1
1
0.816
0.8
0.72
0.6
0.457
0.465
0.399
0.4
0.2
0
Ccl4
Cxcl10
Dync1h1
Galnt7
p53
myo1e
Cateninb
Abbildung 27 Relative Quantifizierung mittels qRT-PCR von RNA aus Zellen, die mit scr (rot) oder
shp53 RNA (blau) transfiziert wurden und 24 h (Exp. 2) danach angereichert wurden.
Für das Experiment 2-24h (Abb. 27) ist für alle ausgewählten Gene eine differentielle
Regulation in der qRT-PCR zu beobachten. Allerdings findet man für zytoplasmatisches
Dynein im Vergleich zur Expressionsanalyse mittels Microarray in der qRT-PCR im
Gegensatz zu allen anderen Zeitpunkten eine leichte Hochregulation nach knockdown von
mutp53
(vgl.
4.4.1.1.1
Tabelle
4).
Insgesamt
kann
man
eine
Korrelation
der
Expressionsdaten mit den zwei Methoden Microarray und qRT-PCR feststellen mit
Ausnahme von Cateninb, für das in der qRT-PCR keine signifikante differentielle Regulation
durch mutp53 sichtbar ist. Generell ist festzustellen, dass aufgrund der nur 50%igen
Ergebnisse
68
Reduktion von mutp53 in den mit pSUPshp53 transfizierten MethA Zellen relativ geringe
Expressionsänderungen der Gene auftraten.
Dies kann zum einen daran liegen, dass mutp53 keinen großen Einfluss auf die Transkription
von Genen hat oder dass die Expression von exogener dsRNA sich so gravierend auf die
Genexpression von MethA Zellen auswirkt, dass die Effekte der 50%igen Reduktion von
mutp53 in den Hintergrund treten. Diese Überlegungen machten einen Vergleich zwischen
untransfizierten und mit dsRNA transfizierten Zellen im Bezug auf deren Expressionsprofile
interessant, welcher im nächsten Kapitel beschrieben ist.
4.4.1.2
Vergleich
der
Expressionsprofile
zwischen
untransfizierten
und
mit
dsRNA
Expressionsvektoren transfizierten MethA Zellen
Durch die live cell imaging Mikroskopie konnte ein überraschend starker mutp53 abhängiger
Effekt der dsRNA auf das Wachstum und die Viabilität von MethA Zellen beobachtet werden.
Dieser Effekt impliziert einen starken Einfluss auf die Genexpression von MethA Zellen durch
die Expression von dsRNA. Die Beobachtung der Reduktion des Wachstums von MethA
Zellen durch dsRNA macht einen Vergleich der Expressionsprofile von untransfizierten und
mit dsRNA Expressionsvektoren (pSUPscr oder pSUPshp53) transfizierten MethA Zellen
interessant. Dazu wurde RNA aus untransfizierten MethA Zellen in Cy5-markierte cRNA
konvertiert und auf einem Gesamtmausgenomarray wie unter 4.4.1.1 beschrieben
hybridisiert. Danach wurden die Expressionsprofile der Kontroll-Zellen mit transfizierten
Zellen verglichen. Zum Vergleich zwischen Expressionsprofilen einzelner Proben wurden die
Microarray-Messwerte mit Hilfe des Limma-package (version 2.10.0) im R-Programm mittels
Quantile-Methode normalisiert. Diese Normalisierung ist innerhalb eines zweifarbigen
Microarray Experimentes nicht notwendig, da die zwei Kanäle eines Microarrays, die
normalerweise miteinander verglichen werden, bereits normiert sind. Anschließend wurden
die Daten gefiltert. Dafür wurden alle Gene, deren Messwerte einen Wert von <100 hatten,
als unspezifischer Hintergrund herausgefiltert sowie alle Gene, die einen Expressionsunterschied von weniger als 2-fach oder einen p-Wert <0,05 zwischen den zu
vergleichenden Kanälen aufwiesen. So können die zwischen untransfizierten und mit dsRNA
transfizierten MethA Zellen differentiell regulierten Gene für die zu vergleichenden
Hybridisierungen identifiziert werden. Zur Visualisierung der Daten erfolgte, ausgehend von
den differentiell exprimierten Genen, eine hierarchische Clusteranalyse, die Gene aufgrund
von
ähnlichen
Transkriptionsprofilen
in
Gruppen
einteilt.
Diese
Analyse
wurde
freundlicherweise von Hr. Benjamin Otto von der Arbeitsgruppe Klinische Chemie des UKE,
Hamburg angefertigt.
Die Visualisierung der Microarray Daten wurde in Form von sog. Heat Maps und
Dendrogrammen in den Abbildungen 28 und 29 vorgenommen, um die hochdimensionalen
Daten in zwei Ebenen darzustellen. Die Expressionsänderung ist farblich dargestellt. Auf der
Ergebnisse
69
Ordinate sind die differentiell regulierten Gene dargestellt, während auf der Abszisse die
Proben/Hybridisierungen aufgelistet werden. In Abb. 28 sind die in den mit dsRNA
Expressionsvektoren transfizierten Zellen im Vergleich zu untransfizierten MethA Zellen
scr-12-2
shp53-12-2
scr-24-1
shp53-24-1
shp53-12-1
scr-12-1
scr-24-2
shp53-24-2
adhärent
hochregulierten, während in Abb. 29 die herunterregulierten Gene dargestellt sind.
Abbildung 28 Hierarchisches Clustering (complete linkage- und euklidische-Distanz) der
Genexpressionsprofile der mit dsRNA Expressionsvektoren transfizierten Zellen im Vergleich zu
untransfizierten MethA Zellen und Darstellung als Heat Map. Die Heat Map gibt das Expressionsverhältnis der Gene nach Expression von dsRNA im Vergleich zu normalen Zellen farblich wieder. Es
sind die im Vergleich zu normalen Zellen hochregulierten Gene gezeigt. Die Farbkodierung ist
oberhalb der Heat Map dargestellt. Dabei nimmt die Expressionsstärke von gelb über grün bis blau zu.
Jede Reihe der Heat Map repräsentiert ein Gen und jede Spalte eine einzelne Hybridisierung. Die
Gennamen sind aufgrund der Vielzahl in dieser Darstellung nicht erkennbar (Liste unter 7.4).
Ergebnisse
adhärent
shp53-24-2
scr-24-2
scr-12-1
shp53-12-1
shp53-24-1
scr-24-1
shp53-12-2
scr-12-2
70
Abbildung 29 Hierarchisches Clustering der Genexpressionsprofile der mit dsRNA
Expressionsvektoren transfizierten MethA Zellen im Vergleich zu untransfizierten Zellen und
Darstellung als Heat Map. Es sind die im Vergleich zu normalen Zellen herunterregulierten Gene in
Form einer Heat Map gezeigt. Die Farbkodierung ist oberhalb der Heat Map dargestellt. Jede Reihe
der Heat Map repräsentiert ein Gen und jede Spalte eine einzelne Hybridisierung. Die Liste der Gene
ist in 7.5 im Anhang zusammengestellt.
In den Heat Maps ist deutlich zu erkennen, dass die jeweiligen Experimente beispielsweise
scr-12.1 und shp53-12.1 zusammen clustern und daher ähnlicher sind, als dieselbe
Transfektion eines anderen Experimentes wie zum Beispiel scr-12.1 und scr-12.2. Zwischen
scr und shp53 RNA exprimierenden Zellen sind ebenfalls leichte Unterschiede in der
Expression bestimmter Gene zu sehen. Allerdings sind diese Unterschiede nicht groß genug,
Ergebnisse
71
um eigene scr oder shp53 Cluster zu bedingen. Ein sehr wichtiges Ergebnis dieses
Vergleichs der Genexpression zwischen untransfizierten und mit dsRNA transfizierten MethA
Zellen ist die Tatsache, dass die Expression von dsRNA verglichen mit unbehandelten
MethA Zellen zu einer massiven Hochregulation von Genen führt, die funktionell dem
Interferonsignalweg (wie dsRNA abhängige PKR (Genname: Prkr oder Eif2ak2), Oas2, Tlr3
etc.) zugeordnet werden können und die die phänotypischen Veränderungen von MethA
Zellen nach Expression von dsRNA erklären könnten (s. Listen 7.4 und 7.5 im Anhang). Mit
dem
GATHER
web
Programm
(Gene
Annotation
Tool
to
Help
Explain
Relationships; http://gather.genome.duke.edu/ unter Verwendung der Annotation: Gene
Ontology) findet man die Immunantwort als einer der überrepräsentierten Signalwege, aus
dem die größte einem Signalweg zuzuordnende Zahl an Genen (35) mit dem höchsten
Bayes
Faktor
der
376
hochregulierten
Gene
identifiziert
wurden
(9830147J24Rik, Ccl2, Ccl5, Ccl7, Cxcl1, Cxcl5, Elf1, Fyb, G1p2, Gadd45g, Gbp1, Gbp2, Gb
p4, Ifi202b, Ifi203, Ifi204, Ifi35, Ifit1, Ifit2, Ifit3, Ifitm3, Irf1, Isgf3gm, Ly96, Nfkbiz, Oas1a, Oas
3, Oasl2, Prkr, Samhd1, Stat3, Tap1, Tapbp, Tlr2, Tlr3). Auch die mutp53 Expression ist in
mit pSUPscr transfizierten Zellen im Vergleich zu unbehandelten MethA Zellen in dieser
Analyse etwa 2-fach erhöht, während die p53 Expression in mit pSUPshp53 transfizierten
Zellen verglichen mit unbehandelten Zellen fast gleich ist.
OAS2
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
adh
scr-12.1
scr-24.1
sh-12.1
sh-24.1
scr-12.2
scr-24.2
sh-12.2
sh-24.2
-0.5
Abbildung 30 Validierung der differentiellen Regulation von Oas2 zwischen untransfizierten und mit
dsRNA Expressionsvektoren transfizierten MethA Zellen durch qRT-PCR mit Oas2 spezifischen
Primern.
Zur Bestätigung der Microarray Ergebnisse wurde eine qRT-PCR durchgeführt. Die
Expression von mutp53, Prkr und Oas2 wurde zwischen untransfizierten MethA Zellen und
mit
dsRNA
Expressionsvektoren
(pSUPscr
oder
pSUPshp53)
transfizierten
Zellen
verglichen. Die qRT-PCR mit p53 spezifischen Primern zeigte keine eindeutige differentielle
Ergebnisse
72
Regulation von mutp53 im Vergleich zwischen normalen adhärenten MethA Zellen und
dsRNA exprimierenden Zellen (Daten nicht gezeigt). Die Transkription des Oas2 Gens
hingegen war in allen mit dsRNA Expressionsvektoren transfizierten MethA Zellen im
Vergleich zu untransfizierten Zellen deutlich erhöht, und dies korreliert mit den Microarray
Ergebnissen (Abb. 30). Auch die Transkription des Eif2ak2 Genes ist gemessen in der qRTPCR in pSUPscr transfizierten MethA Zellen höher als in untransfizierten Zellen. Durch
knockdown von mutp53 mittels pSUPshp53 wird die Expression von PKR nochmals erhöht
(Abbildung 31).
PKR
35
30
25
20
15
10
5
0
adh
scr
shp53
Abbildung 31 Validierung der differentiellen Regulation von Eif2ak2 (PKR) zwischen untransfizierten
und mit dsRNA Expressionsvektoren transfizierten MethA Zellen durch qRT-PCR mit PKR
spezifischen Primern.
Generell war zu beobachten, dass die Änderungen der Transkriptmenge durch Microarray
und qRT-PCR in der Richtung, jedoch nicht in der Quantität übereinstimmen. Beispielsweise
waren die Oas2 Transkriptmengen in mit dsRNA exprimierenden Zellen im Microarray
Experiment 10-fach höher als in Kontrollzellen, jedoch war durch qRT-PCR lediglich eine 3fache Zunahme der Oas2 Transkription zu beobachten.
mock
scr
shp53
Abbildung 32 Immunfluoreszenzfärbung von mutp53 (rot) und PKR (grün) von Kontrollzellen und mit
pSUPscr oder pSUPshp53 transfizierten MethA Zellen nach Fixierung mit Paraformaldehyd.
Ergebnisse
73
Die Immunfluoreszenzfärbung von MethA Zellen zeigt die nukleäre Lokalisation von mutp53
in rot und die überwiegend zytoplasmatische und nukleoläre Färbung von PKR. Es ist zudem
eine geringe Kolokalisation beider Proteine im Nukleus erkennbar (Abb. 32).
Durch Immunblotting kann eine höhere Menge an PKR Protein in mit dsRNA
Expressionsvektoren transfizierten MethA Zellen im Vergleich zu untransfizierten oder mit
pSUP Leervektor transfizierten MethA Zellen detektiert werden. Diese Beobachtung
bestätigt, dass die PKR Menge durch Expression von dsRNA erhöht wird.
~65kDa
αPKR
~53kDa
αp53
~50kDa
αTubulin
shp53
scr
Leervektor
pSUPshp53
pSUPscr
pSUP
MethA
12h
24h
Abbildung 33 Immunblot von untransfizierten und mit pSUP Leervektor, pSUPscr oder pSUPshp53
transfizierten MethA Zellen. Die Zellen wurden 12h nach der Transfektion in Laemmli SDS Puffer
aufgenommen und in einem 10%igen Polyacrylamidgel aufgetrennt. Die Proteinnachweise erfolgten
mit Tubulin-, p53- und PKR-spezifischen Antikörpern.
Zusammenfassend führt dieses Ergebnis zur Hypothese, dass die Expression von dsRNA
vermutlich die Aktivierung von Interferon stimulierten Genen durch die PKR zur Folge hat,
die u.a. einen Translationsstop hervorruft und den beobachteten Wachstumsarrest erklären
könnte. Die könnte auch erklären, warum in pSUPscr und pSUPshp53 transfizierten MethA
Zellen zwar eine höhere mutp53 mRNA Konzentration gefunden wird, im Immunblot aber
weniger mutp53 als in pSUP transfizierten Zellen.
4.4.2 ChIP-Seq zur Analyse von in vivo DNA Bindungsstellen von MethA mutp53
Die Bindung von mutp53 an genomische DNA soll Aufschluss über den Einfluss von MethA
mutp53 auf die Regulation der Genexpression und dadurch wiederum eine mögliche
Erklärung für den beobachteten Effekt von mutp53 auf die Proliferation und die Viabilität von
MethA
Zellen
geben.
Kombiniert
mit
den
Expressionsdaten
könnte
die
Bindungsstellenanalyse auf die von mutp53 regulierten Gene hinweisen. Dadurch könnte mit
höherer Sicherheit eine Regulation von Genen durch mutp53 bestätigt werden. Um
genomische DNA Bindungssequenzen von mutp53 in adhärent wachsenden MethA Zellen
zu charakterisieren, wurde die ChIP-Seq Technologie eingesetzt. Diese Methode basiert auf
Ergebnisse
74
der Eigenschaft von membranpermeablem Formaldehyd Reagenz, welches die direkten
Protein-DNA-Kontakte durch Ausbildung von Methylenbrücken zwischen Aminogruppen der
Proteine und heterozyklischen Stickstoffatomen der Nukleotid-Basen vernetzt. Die
Verwendung von Formaldehyd hat den Vorteil, dass die Vernetzung vollständig reversibel ist.
Die vernetzten Protein-DNA Komplexe wurden aufgereinigt, wie im Kapitel Methoden
beschrieben, und anschließend wurde eine Immunpräzipitation mit polyklonalem anti-p53
Antikörper durchgeführt. Die angereicherten DNA Fragmente wurden über LM-PCR
amplifiziert, kloniert und sequenziert. Das Prinzip der ChIP-Seq ist vereinfacht in Abbildung 6
im Kapitel Methoden dargestellt. Als Negativkontrollen wurden Proben ohne Antikörper
inkubiert, um unspezifische Bindung von DNA Fragmenten an die Matrix verfolgen zu
können. In Abbildung 34 sind die Ergebnisse dreier Immunpräzipitations-Versuche gezeigt.
Das Ethidiumbromid-gefärbte Agarosegel zeigt eine Auftrennung der immunpräzipitierten
und amplifizierten DNA Fragmente, die sich aufgrund der Ultraschallbehandlung der Proben
im Bereich zwischen 200 und 1000 bp konzentrieren.
Abbildung 34 Elektrophoretische Auftrennung der immunpräzipitierten und amplifizierten DNA
Fragmente im Agarosegel. Dazu wurden Formaldehyd-vernetzte Protein-DNA Komplexe mit einem
polyklonalen p53 spezifischen Antikörper und PGS präzipitiert oder als Kontrolle ohne Antikörper
inkubiert. Die DNA wurde anschließend aufgereinigt, mit doppelsträngigen Adaptermolekülen ligiert
und durch LM-PCR amplifiziert. Die Größe der DNA Markerbanden ist angegeben.
In den Versuchen 2 und 3, die mit polyklonalem anti-p53 Antikörper inkubiert wurden, ist im
Vergleich zu den ohne Antikörper inkubierten Proben eine deutlich stärkere Amplifikation der
DNA Fragmente zu sehen, was auf die Spezifität der Antikörper und Vernetzung von mutp53
an genomische DNA in MethA Zellen schließen lässt. Die DNA Fragmente der Ansätze 2
und 3 wurden daraufhin in einen Klonierungsvektor eingebaut, und insgesamt 164 Inserts
Ergebnisse
75
sequenziert. Die sequenzierten DNA Fragmente repräsentieren potentielle genomische
Bindungsstellen (BS) für mutp53 in MethA Zellen, weil eine unspezifische Präzipitation nicht
vollständig vermieden werden kann (Abb. 34). Die darauf folgende bioinformatische
Auswertung der Daten sollte die genomische Verteilung der potentiellen mutp53-BS sowie
deren Sequenzinhalt entschlüsseln. Die Koordinaten von 154 DNA Fragmenten wurden
mithilfe des Online-Programms Blat (http://genome.ucsc.edu/cgi-bin/hgBlat; Kent, 2002) auf
Chromosomen (Mouse Mar. 2005 (mm6) assembly) identifiziert, während die restlichen 10
DNA Fragmente aufgrund ihren Ursprungs aus mehrfach vorkommenden repetitiven
Sequenzen, wie z.B. Zentromer-DNA, nicht positioniert werden konnten. In der Tabelle 9 im
Anhang 7.1 sind die Koordinaten aller sequenzierten mutp53-kopräzipitierten DNA
Fragmente aufgelistet. Die Untersuchung der genomischen Umgebung der potentiellen
mutp53-BS ergab, dass ca. 55% in intergenischen Regionen lokalisiert sind und 45% (69 von
154) innerhalb von Genen (davon 10 hypothetische protein-kodierende Gene). Bei den
ingenischen Sequenzen kann man eine Präferenz für das erste Intron (26%; 18 von 69)
beobachten. Das erste Intron enthält häufig regulatorische Elemente der Transkription wie
gewebsspezifische enhancer, alternative Promotoren, LCR (locus control region) oder
MAR/SARs (Chernov et al., 2002; Glazko et al., 2003; Shabalina and Spiridonov, 2004).
MAR/SARs befinden sich außerdem an den Grenzen von Transkriptionseinheiten und sind
durch einen hohen Anteil an repetitiven DNA Sequenzen charakterisiert. In diesem
Zusammenhang kommt der Anreicherung der repetitiven Sequenzen in potentiellen mutp53BS eine wichtige Bedeutung zu. 70% (114 von 164) der DNA-Fragmente beinhalten
repetitive Sequenzen, hauptsächlich LINE (long interspersed nucleotide elements), SINE
(short interspersed nucleotide elements) und LTR (long terminal repeats) Elemente.
30
25
percentage
20
15
10
5
0
LINE
SINE
LTR
simple
low compl
DNA
satellite
Abbildung 35 Darstellung der prozentualen Häufigkeit des Auftretens von repetitiven DNA-Elementen
in den durch ChIP-Seq identifizierten DNA-Fragmenten.
Ergebnisse
76
Die prozentuale Verteilung der repetitiven Elemente ist in Abbildung 35 grafisch dargestellt.
Im nächsten bioinformatischen Ansatz wurde der Abstand der potentiellen mutp53-BS zu
den nächstmöglichen Transkriptionsstarts (TSS) untersucht. Diese Analyse, die freundlicherweise von Mark Koudritsky und Tal Shay vom Weizmann Institute, Israel in der
Arbeitsgruppe von Eytan Domany durchgeführt wurde, ergab, dass lediglich 6 von 152 DNAFragmente sich in einem Abstand von 5 kb, also Promotor-nahe, von der nächsten TSS
befinden. Insgesamt befanden sich 43 potentielle Bindungsstellen innerhalb von 100 kb von
einer Transkriptionsstartseite (Tabelle 5).
Distanz zu
Transkriptionsstarts
mutp53 DNA
Fragmente
1 KB
1
5 KB
6
10 KB
11
100 KB
43
Tabelle 5 Zusammenfassung der Untersuchung des Abstandes der durch ChIP-Seq identifizierten
potentiellen mutp53-BS zu den nächstmöglichen transkriptionellen Startpunkten. Die Positionen der
DNA Fragmente wurden analysiert im Abstand von 1 bis 100 kb zu TSS.
Aufgrund dieser Ergebnisse kann die Aussage getroffen werden, dass die Beteiligung von
mutp53 an der Genregulation eher indirekt durch die Bindung an regulatorische repetitive
DNA Sequenzen, die im gesamten Genom verteilt sind, stattfindet und daher die globale
Chromatinorganisation beeinflusst wird. Eine Präferenz der Bindung in der Nähe der
Transkriptionsstarts konnte nicht festgestellt werden, dagegen wurde eine bevorzugte
Bindung an Sequenzen des ersten Introns beobachtet. Die Gene, in denen oder in deren
Nähe eine potentielle mutp53-BS gefunden wurde, sind im Bezug auf ihre biologischen
Funktionen heterogen, so dass sie ohne weitere Analysen keinen direkten Hinweis auf einen
Wirkmechanismus von mutp53 in MethA Zellen liefern. Auffällig ist jedoch, dass ein mutp53kopräzipitiertes DNA-Fragment aus dem Eif2ak2 (PKR) Gen stammt, was auf mögliche
Beteiligung von mutp53 an der Regulation der Transkription des Eif2ak2 Gens hindeutet. Die
Annahme einer solchen Regulation als Antwort auf die Expression von dsRNA könnte den
partiellen Schutz vor Arrest und Zelltod durch Repression der PKR Expression durch mutp53
erklären.
4.4.2.1 Einfluss von mutp53 DNA-Bindungsstellen auf die Genregulation
Die Identifikation der mutp53 DNA-Bindungsstellen durch die ChIP-Seq reicht alleine nicht
aus, um deren Funktionalität im Hinblick auf die Genregulation beurteilen zu können. Zur
Evaluation der ChIP-Seq Daten sollte deshalb durch Vergleich der Expressionsprofile von
Ergebnisse
77
MethA Zellen transfiziert mit pSUPscr oder pSUPshp53 der Einfluss von mutp53 auf die
Expression von Genen untersucht werden.
Zur Untersuchung des direkten oder indirekten Einflusses der mutp53 Bindung an
genomische DNA auf die Expression benachbarter Gene, wurden die Expressionswerte aller
Gene, die eine mutp53 Bindungsstelle beinhalten, genauer betrachtet. Wendet man die
stringenten Filterungskriterien 1,5-fache Expressionsänderung und p-Wert <0,01 an, erhält
man 3 Gene, die nach shRNA-vermittelter Reduktion der mutp53 Expression zwischen mit
pSUPscr und pSUPshp53 transfizierten Zellen in mindestens einem der vier Experimente
differentiell reguliert sind und für die außerdem eine DNA-Bindungsstelle durch die ChIP-Seq
gefunden wurde (Tabelle 6). Das in blau dargestellte Gen wurde herunterreguliert, während
die in gelb dargestellten Gene nach knockdown von MethAp53 hochreguliert wurden.
ChIP-Seq
Lokalisation der
Bindungsstelle
Gen
Beschreibung
WW domain-containing protein 2
SM2-39
chr8:106831030-106831354
Wwp2
XM2-28
chr4:143841892-143842147
Dhrs3
XM2-38
chr9:70411728-70411955
Myo1e
dehydrogenase/reductase (SDR
family) member 3
myosin IE
Tabelle 6 Liste der Gene, in denen durch die ChIP-Seq eine Bindungsstelle von mutp53 gefunden
und außerdem eine differentielle Regulation in der Genexpression in pSUPshp53 transfizierten Zellen
verglichen mit pSUPscr transfizierten Zellen gemessen wurde. Die in blau dargestellten Gene sind in
pSUPshp53 transfizierten Zellen herunterreguliert, während die in gelb dargestellten Gene
hochreguliert sind.
Die 779 zwischen untransfizierten und mit dsRNA transfizierten Zellen differentiell regulierten
Gene wurden ebenfalls auf eine mutp53 Bindungsstelle überprüft. Für die Gene Eif2ak2,
Mast4 und Zfand1 wurde durch die ChIP-Seq Methode eine mutp53 Bindungsstelle im Gen
gefunden und außerdem eine differentielle Regulation zwischen untransfizierten und mit
dsRNA transfizierten MethA Zellen. Aufgrund des nur geringen Einflusses von mutp53 auf
die Genexpression in unseren Experimenten und des wenig informativen Vergleichs der
Genexpressionsprofile von pSUPscr und pSUPshp53 transfizierten Zellen, stellte sich die
Frage, ob die Funktion von mutp53 vielleicht auf posttranskriptionelle Regulation
zurückzuführen ist. Um dies herauszufinden, wurde die Funktion von mutp53 auf der Ebene
des Transkriptoms untersucht. Das Verhalten von MethA Zellen nach Transfektion mit
dsRNA Expressionsvektoren deutet auf eine funktionelle Verbindung zwischen mutp53 und
dsRNA hin.
Ergebnisse
78
4.5 Untersuchung der mutp53 Funktion auf der Ebene des Transkriptoms
4.5.1 Gesamt RNA-Immunpräzipitation (RNA IP) zur Analyse der in vivo Interaktion von
mutp53 mit RNA
Der Befund der Reduktion des durch dsRNA und folgenden Aktivierung der PKR
verursachten Wachstumsarrests durch mutp53 könnte im Zusammenhang mit der Interaktion
von mutp53 mit RNA stehen. Diese These wird durch in vitro Daten unterstützt, die zeigen,
dass p53 mit einer höheren Affinität mit RNA verglichen mit DNA interagiert (Oberosler et al.,
1993). Um herauszufinden, ob mutp53 in MethA Zellen in vivo funktionell mit RNA interagiert,
wurde eine RNA-Immunpräzipitation durchgeführt. Der experimentelle Ablauf ist in Abbildung
7 im Kapitel Methoden gezeigt. Ähnlich wie bei der Chromatin-Immunpräzipitation werden
auch hier Nukleinsäuren indirekt über den gebundenen Protein-Interaktionspartner
präzipitiert und nach Aufreinigung aus diesem Komplex kloniert und sequenziert. Allerdings
findet bei der RNA IP keine Quervernetzung statt, so dass nur stabile Interaktionspartner
erfasst werden. Auf dem Ethidiumbromid-gefärbten Agarosegel in der Abbildung 36 wurden
die über PCR amplifizierte, doppelsträngigen cDNA Moleküle aufgetrennt, die als RNA mit
spezifischem p53 Antikörper oder in einem Kontroll-Ansatz (mit Ziege IgG bzw. ohne
Antikörper) präzipitiert wurden. Eine deutliche Anreicherung von amplifizierten DNA
Molekülen in Versuchen mit anti-p53 Antikörper ist zu erkennen.
Abbildung 36 Elektrophoretische Auftrennung der durch RNA IP angereicherten, in cDNA
konvertierten und über PCR amplifizierten DNA Fragmente. Der lösliche Bestandteil von 5x 106 Zellen
wurde durch Zugabe von E1A Puffer mit 0,1% NP-40 extrahiert. Die spezifische Präzipitation von p53Proteinen erfolgte mit Hilfe polyklonaler Antikörper und Protein G-gekoppelten Dynabeads. Die p53gebundenen Transkripte wurden extrahiert, in cDNA umgeschrieben und anschließend amplifiziert.
Gezeigt ist die Auftrennung der PCR-Produkte in einem 1%igen Agarose-gel.
Die Spezifität der Immunpräzipitation wurde durch Immunblot-Analyse der Überstände aus
allen Ansätzen überprüft (Abb. 37).
Ergebnisse
79
Abbildung 37 Immunblot-Analyse der Überstände nach der Immunpräzipitation und Nachweis des
p53 Proteins. Als Kontrolle wurde die Immunpräzipitation ohne Antikörper bzw. mit Ziege IgG
durchgeführt.
Der Immunblot zeigt, dass mutp53 durch die Immunpräzipitation mit spezifischen Antikörpern
vollständig aus den Proben entfernt wurde, während in den Überständen aus KontrollAnsätzen p53 detektierbar ist.
86 klonierte cDNA Moleküle, die die durch mutp53 direkt oder indirekt gebundenen
Transkripte
repräsentieren,
wurden
sequenziert.
Eine
Sequenz-Analyse
der
p53-
gebundenen Transkripte ergab, dass keine der Transkripte aus MethA Zellen den in
Sequenzdatenbanken gespeicherten vollständigen Transkripten entsprach. Ein Teil dieser
verkürzten Transkripte ist methodisch bedingt. So wurde zur cDNA Synthese ein
Oligonukleotid (P1CAP-CDS) eingesetzt, das an eine Folge aus drei Cytosinen hybridisiert.
Diese Pyrimidinfolge wird durch die Reverse Transkriptase an die entstehende cDNA
angehängt. Enthielt nun die mRNA intrinsische Cytosin-Folgen, könnte man sich vorstellen,
dass der Primer an diese hybridisierte und es zur Synthese verkürzter cDNA kam. Weiterhin
kann eine Verkürzung der RNAs durch Degradation während der Präparation nicht
ausgeschlossen werden. Eine bioinformatische Analyse ergab, dass aus 74 Transkripten 29mal 3' UTR (Untranslated Regions) Transkripte, die vermutlich auf die Aktivität alternativer
Promotoren oder alternatives Splicing zurückzuführen sind. Außerdem gehören weitere 29
mutp53 kopräzipitierte Transkripte zur B2/B1 SINE Familie der repititiven Elemente. Die Liste
der Transkripte ist im Anhang in Tabelle 11 zusammengestellt. 3' UTRs sind – durch
Kompetition mit Faktoren, die an den 3‘ UTR der entsprechenden mRNA binden – an der
Regulation von RNA Prozessierung, Abbau, Lokalisation und Effizienz der Translation
beteiligt (Kugel and Goodrich, 2000; Kugel and Goodrich, 2002; Mignone et al., 2002;
Rastinejad and Blau, 1993; Rastinejad et al., 1993; Workman and Kingston, 1998), während
für B2 SINE eine Bindung an RNA Polymerase II gezeigt wurde, die die Transkriptsynthese
unterbindet (Espinoza et al., 2004). Unter den analysierten Transkripten sind 12, die am 3'
oder 5' Ende trunkiert sind. Dies lässt darauf schließen, dass mutp53 in MethA Zellen
präferentiell an nicht kodierende Transkripte bindet. Durch 5' RACE PCR konnte die Existenz
ausgewählter 3' UTR Transkripte bestätigt werden (Bcas2, Hnrpc, Rab34, Anxa2, Arf6, Got1,
Cnih; Daten nicht gezeigt). Für die 3' UTR Transkripte wird eine Regulation des
Ergebnisse
80
Gesamtlängentranskriptes im Gegensatz zur Translation des verkürzten Transkriptes
postuliert. Unter den von mutp53 gebundenen Transkripten befindet sich eine Gruppe von
Transkripten, die für RNA bindende Proteine kodieren wie snRNP E, hnRNP C und
ribosomale Proteine sowie Proteine, die funktionell der Mitose zugeordnet werden können,
wie Anapc11, Mad2l1bp, Dynll1, Tpx2 und Nucks1. Wenn man die thermodynamisch
stabilste Sekundärstruktur der gefundenen Transkripte mit der RNA fold 1.5 Software
(http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) berechnen läßt, kann man feststellen, dass
alle Transkripte Strukturen wie Haarnadel (hairpin), Ausbuchtungen (bulges), interne
Schleifen (interior loops) und mehrfache Schleifen (multiloop) enthalten. Dies lässt darauf
schließen, dass die RNA Konformation eine wichtige Bedeutung für die direkte oder indirekte
Interaktion
mit
mutp53
haben
könnte
und
mutp53
strukturspezifisch
und
nicht
sequenzspezifisch an RNA bindet.
Abbildung 38 Sekundärstrukturen einiger ausgewählter Transkripte, die durch mutp53 ko-präzipitiert
wurden und deren Struktur mittels RNA fold 1.5 Software bestimmt wurde. Es sind die
Sekundärstrukturen mit der geringsten freien Enthalpie dargestellt.
4.6 Genomische Verteilung der mutp53 Bindungsstellen und kodierenden Regionen
der mutp53-gebundenen Transkripte
Die durch ChIP-Seq Analyse erhaltenen 154 mutp53 DNA Bindungsstellen sowie die
Sequenzen der durch RNA-IP identifizierten 87 mutp53 gebundenen Transkripte wurden für
die Analyse der genomischen Verteilung im murinen Genom lokalisiert und grafisch
Ergebnisse
81
dargestellt, wie in Abb. 39 gezeigt. Vergleichbar mit den Ergebnissen aus den ChIP-Seq
Experimenten waren auch die Loci der mutp53-gebundenen Transkripte über das gesamte
Genom verteilt. Man kann jedoch deutlich Anreicherungen von mutp53 Bindungsstellen oder
Transkripten in bestimmten Bereichen von Chromosomen erkennen. Interessant ist
außerdem, dass in bestimmten chromosomalen Bereichen eine Anreicherung von
Bindungsstellen sowie Genen der mutp53-kopräzipitierten Transkripte gefunden werden.
Diese in einem Bereich von höchstens 1 Mb auseinander liegenden Sequenzen wurden als
ChIP/RIP Cluster definiert und sind in der Abbildung 39 schwarz umrandet. Anhand dieser
Parameter konnten für MethA Zellen 15 Cluster identifiziert werden.
Abbildung 39 Integrative Darstellung der Positionen der durch die ChIP-Seq gefundenen mutp53
DNA-Bindungsstellen (oben) und der kodierenden Regionen der durch die RNA-IP Methodik
identifizierten mutp53-kopräzipitierten Transkripte (unten) an den Chromosomen durch die SigmaPlot
10.0 software. Cluster von mutp53 DNA-Bindungsstellen und gebundenen Transkripten sind schwarz
umrandet.
Durch
dieses
Ergebnis
wird
die
Beteiligung
von
mutp53
an
so
genannten
transcription/processing factories, an denen die Transkription sowie posttranskriptionelle
Prozesse simultan stattfinden, unterstützt (Cook, 2003). Nach diesem Modell sind die in die
Transkription und RNA Prozessierung involvierten Proteine in großen Komplexen
(transcription factories) konzentriert, um die Chromatin-Schleifen gewunden sind, was eine
simultane Transkription sowie Prozessierung der Transkripte mehrerer Gene ermöglicht, da
Ergebnisse
82
eine limitierte Menge an RNA Polymerasen im Vergleich zur Menge an transkribierten Genen
präsent sind.
4.7 Untersuchung der mutp53 Funktion auf der Ebene des Proteoms
4.7.1 Proteomanalyse zur Identifizierung potentieller Proteininteraktionspartner von
mutp53
Die Ergebnisse der ChIP-Seq und RIP Experimente haben bereits einige Einblicke in die
Funktion von mutp53 gewährt und auf eine übergeordnete Funktion von mutp53 in MethA
Zellen in der Regulation der Genexpression hingewiesen. Angenommen, dass mutp53 mit
transcription/processing factories assoziiert ist, wird man erwarten, dass infolge der ZellFraktionierung und Immunpräzipitation mutp53 in Multiprotein-Komplexen detektierbar ist.
Um die Komposition dieser Multiprotein-Komplexe mittels Immunpräzipitation aufzuklären,
wurden in Suspension wachsende MethA Zellen mit NP40-haltigem E1A Puffer extrahiert. Es
wurde festgestellt, dass unter diesen Bedingungen nur ein Teil des nukleären mutp53
extrahierbar ist (Abb. 40), was auf stabile Assoziation von mutp53 mit Chromatin hinweist
und eine Limitierung des Versuches darstellt, weil man für die nachfolgenden Studien mehr
Zellen im Experiment einsetzen muss. Eine Extraktion unter stringenteren Bedingungen (z.B.
höherer pH-Wert, höhere Salzkonzentration, Nuklease-Behandlung) oder die UltraschallBehandlung wurde aus dem Grund nicht verwendet, weil es den Verlust einiger Interaktionen
zur Folge haben kann. Das Zell-Extrakt wurde für eine IP mit einer Mischung monoklonaler
Maus p53-spezifischer Antikörper (Pab242, -248, -421) eingesetzt, und die Immunkomplexe
wurden anschließend mithilfe von Protein G-Sepharose präzipitiert.
Extraktion
Abbildung 40 Immunfluoreszenzfärbung von mutp53 in MethA Zellen vor und nach der Extraktion mit
NP40-haltigem E1A Lysepuffer mit anti-p53 Antikörper.
In einer Immunblot-Analyse wurden der Zell-Extrakt, der Überstand nach Immunpräzipitation, die Waschfraktionen sowie das Eluat auf p53 Gehalt untersucht (Abb. 41). Es
ist eine deutliche Anreicherung von p53 im Eluat verglichen mit dem MethA Zell-Extrakt zu
erkennen, während die Überstand- und Waschfraktionen kaum p53 aufweisen.
Ergebnisse
83
Abbildung 41 Nachweis von p53 durch Immunblot-Analyse in MethA Zell-Extrakt, den Überständen
nach erfolgter Immunpräzipitation, den Waschfraktionen und den Eluaten.
Das Eluat wurde in der ersten Dimension, der isoelektrischen Fokussierung nach
isoelektrischem Punkt pI und in der zweiten Dimension, der SDS PAGE nach
Molekulargewicht aufgetrennt. Das resultierende 2D-Gel wurde daraufhin mit colloidaler
Coomassie Blau Lösung gefärbt, gescannt und alle signifikanten Proteinspots ausgestochen
und der Analyse durch MALDI ToF Massenspektrometrie unterzogen (Abb. 42). Um die
Reproduzierbarkeit des IP-Versuches zu testen, wurde das Experiment dreimal wiederholt.
In Abbildung 42 stellt das bei ca. 53 kDa und pI 3-4 mit Pfeil versehene „schwarze“ Signal
das Ergebnis der Immunblot-basierenden Detektion von mutp53 dar, welches mit einem
polyklonalen anti-p53 Antikörper spezifisch nachgewiesen wurde und mit dem colloidalen
Coomassie Blau gefärbten Gel überlagert wurde. Warum in 2D Gelen mutp53 nur durch
Immunblotting detektiert werden konnte, ist unklar. Die eingesetzten p53-spezischen
monoklonalen Antikörper weisen keine unspezifische Reaktion mit anderen zellulären
Proteinen auf, da in Kontroll-Versuchen mit p53-negativen Maus EAT Zellen keine Färbung
beobachtet wurde (Daten nicht gezeigt). Dies lässt vermuten, dass die Unterrepräsentation
von mutp53 im Immunpräzipitat die stöchiometrischen Verhältnisse der Komponenten der
mutp53-haltigen Komplexe widerspiegelt. Es könnte sein, dass in NP40-extrahierbaren
Komplexen der Anteil des mutp53 im Vergleich zu anderen Komponenten deutlich geringer
ist. Alternativ, kann man auch nicht ausschließen, dass eine Fraktion des präzipitierten
mutp53 z.B. durch Aggregation während der isoelektrischen Fokussierung in der zweiten
Dimension analytisch nicht erfasst werden konnte. Diese These findet eine indirekte
Unterstützung in der Beobachtung, dass rekombinantes mutp53, das aus Insektenzellen
isoliert wurde, schwer löslich ist und zur Ausbildung großer Aggregate tendiert (Daten nicht
gezeigt).
Ergebnisse
84
Abbildung 42 Repräsentatives 2D-SDS Polyacrylamidgel des Immunpräzipitats. Die Proteine wurden
entlang der x-Achse nach isoelektrischem Punkt aufgetrennt. Es wurde ein pH Bereich von 3 bis 10
verwendet. Entlang der y Achse wurden die Proteine in der zweiten Dimension nach Molekulargewicht
in der SDS PAGE aufgetrennt. In schwarz ist das Signal von p53 überlagert, welches durch
Immunblot-Analyse detektiert wurde. Analysierte Proteinspots sind markiert und mit arabischen Ziffern
gekennzeichnet. Das Molekulargewicht ist durch den verwendeten Protein Standard markiert.
Die mittels Peptidmassen-Fingerabdruck Methode identifizierten Proteinspots aus drei
unabhängigen Experimenten sind in der zugehörigen Tabelle 8 aufgelistet.
Wie aus Tabelle 8 zu entnehmen ist, kann man die mutp53-kopräzipitierten Proteine in vier
Gruppen einteilen. Die größte Gruppe besteht aus RNA-Bindeproteinen, zu denen Proteine
der hnRNP Familie, die 3' nicht-translatierte Regionen der Transkripte beispielsweise via
deren AU reichen Sequenzen (AU rich elements, ARE) binden und dadurch die Stabilität
dieser Transkripte und somit die posttranskriptionelle Regulation beeinflussen, gehören.
Diese (de-) stabilisierenden Elemente werden in ca. 8% aller humanen mRNAs gefunden,
welche für strikt kontrollierte Gene wie Cytokine, Interleukine, Interferone, TNFα und einige
Proto-Onkogene kodieren (Bakheet et al., 2001; Barreau et al., 2006).
Ergebnisse
85
Spot
Protein
I. RNA bindende Proteine
1
2
8/9
10/11/29
12/13
14/15
16 -18/28
27/31
21
36
34
24
YB1 (nuclease sensitive element binding protein 1)
Rbm3 (RNA binding motif 3)
Taf15 (RNA binding protein 56)
Hnrpa3***
Hnrnpa2b1***
Hnrpdl***
Hnrpab***
Hnrpd
Rps5 (ribosomal protein S5)**
Rps7 (ribosomal protein S7)
Khsrp (KH type splicing regulatory protein)
Tardbp (TAR DNA binding protein)
II. Zytosolische Proteine
19/20/32
22
30
35
26
25
LOC68045 (new mitotic spindle associated protein)**
Actg (gamma-actin)***
Tubb5 (tubulin beta, 5)***
Tpi1 (Triosephosphate-isomerase)**
Akap95 (A kinase anchor protein 95)
Psme1 (proteasome 28 subunit, alpha)
III. Hitzeschockproteine
3
4
26
Hsp90aa1 (heat shock protein 1)***
Hspa1 (heat shock70 kDa protein)**
Hspa9***
IV. Andere
6
Mcm9 (minichromosome maintenance 9)
Tabelle 7 Liste der mutp53 ko-präzipitierten Proteine aus MethA Zellen, die durch
Massenspektrometrie-basierender Peptidmassen-Fingerabdruck Methode identifiziert wurden. Die mit
drei Sternen gekennzeichneten Proteine wurden in drei unabhängigen Experimenten identifiziert,
während die mit zwei Sternen gekennzeichneten Proteine in zwei Experimenten gefunden wurden.
Die Überexpression von hnRNP A2 und B1 wurde in vielen Tumoren entdeckt und mit der
Zellproliferation korreliert (He et al., 2005). Es wurden auch Proteine identifiziert, für die eine
Interaktion mit wtp53 bekannt ist, z.B. YB1 (Lasham et al., 2003; Zhang et al., 2003), Hspa1
(Hsp70) und Triosephosphat Isomerase (Rahman-Roblick et al., 2007). YB1 kann auch zur
Gruppe
RNA-bindender
Proteine
gezählt
werden,
weil
es
spezifisch
an
Spleiß-
Erkennungsstellen bindet und die Auswahl alternativer Spleißstellen reguliert. Die
Identifikation des RNA Polymerase II assoziierten Taf15 Proteins in Komplexen mit mutp53
unterstützt
die
postulierten
Interaktionen
von
mutp53
mit
Komponenten
des
transcription/processing factories. Die Detektion dreier Hitzeschockproteine bestätigt
außerdem die Ergebnisse früherer Studien, in denen Hsp70 als erster Interaktionspartner
von mutp53 identifiziert wurde und vermutlich für die Stabilität von mutp53 in MethA Zellen
mitverantwortlich ist (Gronostajski, Goldberg, and Pardee, 1984; Pinhasi-Kimhi et al., 1986).
Der reproduzierbare Nachweis der zytosolischen Proteine im mutp53-Kopräzipitat, zu denen
Ergebnisse
86
vor allem gamma-Aktin und beta-Tubulin gehören, ist nicht überraschend, wenn man die
kurze Generationszeit der MethA Zellen berücksichtigt, was zur Folge hat, dass sich zirka
30% der Zellen während der Zell-Extraktion in der Mitose befinden (Daten nicht gezeigt).
Während der Zellteilung wird mutp53 nicht proteolytisch abgebaut, und ist im Zytoplasma
diffus verteilt. Offensichtlich ist mutp53 in mitotischen Zellen mit zytoplasmatischen
Strukturen, vor allem zytoskeletalen Filamenten, assoziiert. Eine interessante Verknüpfung
zur möglichen Funktion von mutp53 in mitotischen Zellen, ist die Identifikation zweier
Proteine in mutp53 Komplexen, Mcm9 (minichromosome maintenance 9) und LOC68045
(new mitotic spindle associated protein), die funktionell der Mitose zugeordnet werden
können.
4.7.2 Verifizierung der potentiellen Interaktionspartner von mutp53 mittels konfokaler
Mikroskopie
Um die durch massenspektrometrische Analyse identifizierten potentiellen ProteinInteraktionspartner von mutp53 zu verifizieren, wurden Immunfluoreszenzfärbungen von
MethA
Zellen
durchgeführt
und
diese
anschließend
mittels
Konfokalmikroskopie
ausgewertet. Die Konfokalmikroskopie ermöglicht die Beschreibung der räumlichen
Anordnung der untersuchten Proteine und Berechnung deren Kolokalisation. Dabei ist die
Kolokalisation durch die Präsenz zweier oder mehrerer Proteine an der gleichen physischen
Lokalisation einer Probe definiert. Zur Kolokalisation verschiedener Fluoreszenzmarker wird
das Fluoreszenzlicht in spektrale Bereiche zerlegt, die simultan mit verschiedenen
Detektoren verarbeitet werden können. Die digitalisierten Fluoreszenzsignale von jedem
Detektor werden als getrennte Kanäle gespeichert und können mittels speziellen
Computerprogrammen (z.B. Imaris) überlagert werden.
Abbildung 43 Konfokalmikroskopische Darstellung der Immunfluoreszenzfärbung von Triton X100
extrahierten MethA Zellen mit mutp53 (rot) und hspa1 (grün) spezifischen Antikörper. Die Aufnahmen
wurden mit dem konfokalen Laser-Scanning Mikroskop gemacht und anschließend digital bearbeitet.
Der Kolokalisations-Kanal (gelb) wurde mit Hilfe des Imaris Coloc Moduls berechnet. Objektiv: PlanApochromat 63x / 1,4 Oil; Maßstab: 10 µm.
Ergebnisse
87
Die Abbildung 43 zeigt die Kolokalisation von hspa1 Protein mit mutp53 im Zellkern nach
Extraktion mit Triton X100. Die Extraktion hat zur Folge, dass das zytoplasmatische mutp53
fast vollständig entfernt wurde, während noch zytoplasmatisches hspa1 Signal zu sehen ist.
Des Weiteren wurde die Kolokalisation zwischen mutp53 und YB1 (Y box binding protein 1),
hnRNP A/B (heterogeneous nuclear Ribonucleoprotein) sowie hnRNP D untersucht. Für
mutp53 und hnRNP D Protein ist ebenfalls eine Kolokalisation von <5% in Abbildung 44a zu
erkennen. Nach Extraktion mit Triton X100 geht die zytoplasmatische Färbung von hnRNP D
zurück (Abb. 44b), die nukleäre Kolokalisation mit mutp53 bleibt jedoch erhalten. Demnach
entgehen sowohl mutp53 als auch hnRNP D teilweise der Extraktion und verbleiben im
Zellkern. Für hnRNP D ist zusätzlich eine leichte zytoplasmatische Färbung erkennbar.
a
b
c
Abbildung 44 Konfokalmikroskopische Darstellung der Immunfluoreszenzfärbung von MethA Zellen
mit mutp53 (rot) und hnRNP D (grün) spezifischen Antikörper ohne (a) oder mit vorheriger Triton X100 Extraktion (b) oder mit Triton X-100 Extraktion und RNase A Behandlung (c). Die Aufnahmen
wurden mit dem konfokalen Laser-Scanning Mikroskop gemacht und anschließend digital bearbeitet.
Der Kolokalisations-Kanal (gelb) wurde mit Hilfe des Imaris Coloc Moduls berechnet. Objektiv: PlanApochromat 40x oder 63x / 1,4 Oil; Maßstab: 10 µm.
Um die Frage zu beantworten, ob die Interaktion zwischen mutp53 und hnRNP D indirekt
über RNA stattfindet, wurde zusätzlich zur Extraktion eine Inkubation mit RNase A
durchgeführt und anschließend die Immunfluoreszenzfärbung gemacht. In Abbildung 44c ist
eine deutliche Reduktion des hnRNP D Signals nach RNase A Behandlung sichtbar, was die
Schlussfolgerung zulässt, dass die Verankerung von hnRNP D im Kern sensitiv gegenüber
der Behandlung mit RNase A ist und demnach durch RNA vermittelt wird. Die Analyse der
intrazellulären Verteilung von hnRNP A/B und mutp53 ergab ebenfalls eine Kolokalisation, in
Übereinstimmung mit den hnRNP D Daten (Daten nicht gezeigt). Ein ähnliches Bild ergibt
sich nach Untersuchung der Kolokalisation zwischen mutp53 und YB1. YB1 wurde in der
Literatur bereits als Interaktionspartner von wtp53 beschrieben (Lasham et al., 2003; Zhang
et al., 2003). Die Abbildung 45a zeigt ein nukleäres wie zytoplasmatisches Signal für YB1,
dargestellt in grün, während mutp53 vornehmlich im Nukleus anzutreffen ist. Im Kern ist eine
deutliche in gelb dargestellte Kolokalisation zu sehen, was einen weiteren Hinweis auf eine
physische Interaktion beider Proteine liefert. Nach Behandlung mit Triton X100 wird ein
Großteil von YB1, vor allem der zytoplasmatische Teil, sowie ein Teil mutp53 Protein aus der
Ergebnisse
88
Zelle extrahiert (Abb. 45b). Die Behandlung der Zellen mit RNase A hat einen dramatischen
Rückgang des YB1 Signals zur Folge (Abb. 45c). Dies lässt darauf schließen, dass YB1
ähnlich wie hnRNP D durch RNA in der nukleären Matrix der Zelle verankert ist und
deswegen nach RNase A Behandlung freigesetzt wird.
a
b
c
Abbildung 45 Konfokalmikroskopische Darstellung der Immunfluoreszenzfärbung von MethA Zellen
mit mutp53 (rot) und YB1 (grün) spezifischen Antikörper ohne Extraktion (a) mit vorheriger Extraktion
durch Triton X-100 (b) oder mit Triton X-100 und RNase A Behandlung (c). Die Aufnahmen wurden
mit dem konfokalen Laser-Scanning Mikroskop gemacht und anschließend digital bearbeitet. Der
Kolokalisations-Kanal (gelb) wurde mit Hilfe des Imaris Coloc Moduls berechnet. Objektiv: PlanApochromat 63x / 1,4 Oil; Maßstab: 10 µm.
4.7.3 Die Bedeutung der RNA in Interaktionen von mutp53 mit anderen Proteinen
Die Bedeutung der RNA in Protein-Protein Interaktionen, auf welche die konfokale
Mikroskopie hinweist, wurde des Weiteren in Immunblot-Analysen verifiziert. MethA Zellen
wurden hierfür mit Triton X100 extrahiert und entweder mit Benzonase, RNase A oder
beiden Nukleasen bei 37°C inkubiert. Als Kontrolle dient ein unbehandeltes, bei 37°C
inkubiertes
MethA
Zelllysat.
Anschließend
wurden
die
Proben
in
einem
SDS
Polyacrylamidgel aufgetrennt, auf eine PVDF Membran transferiert und mit den
entsprechenden Antikörpern inkubiert (Abb. 46). Die Nukleasebehandlung ruft einen
kompletten Verlust des p53 Signals hervor, während die Signale der potentiellen
Interaktionspartner YB1, hnRNP D und hnRNP A/B erst durch Nukleasebehandlung sichtbar
werden. Dies zeigt deutlich, dass die Nukleasebehandlung eine Freisetzung von YB1,
hnRNP D sowie hnRNP A/B aus dem Nukleus hervorruft, während mutp53 vermutlich
irreversibel aggregiert und deswegen aus der Analyse ausgeschlossen wird. Des Weiteren
lässt sich festhalten, dass sowohl YB1 als auch hnRNP D und hnRNP A/B durch RNA im
Nukleus verankert sind. Daraus folgt, dass die mutp53-haltigen Multiprotein-Komplexe an
DNA gebunden sind und RNA enthalten. In einem zusätzlichen Experiment, das in Abbildung
47 dargestellt ist, wird dieser Zusammenhang bekräftigt.
Ergebnisse
89
Abbildung 46 Immunblot-Analyse von Triton X100 extrahierten MethA Zellen, die mit Benzonase (B),
RNase A (R) oder beidem (B+R) behandelt wurden bzw. unbehandelt blieben (37°C).
Es wurde eine analytische Immunpräzipitation von MethA Zelllysat und währenddessen eine
Inkubation mit Benzonase, RNase A oder beidem bzw. keine Behandlung als Kontrolle
durchgeführt und anschließend mittels Immunblot analysiert. Im MethA Zelllysat ist lediglich
ein Signal für mutp53 und YB1 erkennbar, wohingegen die Proteinmengen an hnRNP D und
A/B nicht ausreichend zu sein scheinen, um sie im Immunblot visualisieren zu können. Führt
man nun eine Immunpräzipitation mit polyklonalem anti-p53 Antikörper durch, detektiert man
in dem Eluat ebenfalls ein Signal für hnRNP D und A/B, welches in der Menge durch
Nukleasebehandlung verstärkt wird. Im Gegensatz dazu verringert sich der Gehalt an p53
nach Nuklease-behandlung deutlich.
Abbildung 47 Immunblot-Analyse von p53 immunpräzipitierten MethA Zellen, die mit Benzonase (B),
RNase A (R) oder beidem (B+R) behandelt wurden bzw. unbehandelt blieben (-R/B). Als zusätzliche
Kontrolle wurde unbehandeltes MethA Zelllysat (MethA asc) aufgetragen.
Diskussion
90
5 DISKUSSION
Ziel der Arbeit war die Charakterisierung der Funktion von mutp53 in einem murinen
Tumorzellmodell im Hinblick auf eine unterstützende Wirkung in der Tumorgenese. Um die
Funktion von mutp53 in MethA Zellen zu untersuchen, wurde die Proteinkonzentration von
mutp53 durch RNA induzierte spezifische Reduktion der Genexpression erniedrigt.
Phänotypische Veränderungen der mutp53 Reduktion auf das Wachstum und die Viabilität
von MethA Zellen konnten beobachtet werden und deuten darauf hin, dass zwischen mutp53
und dsRNA eine funktionelle Verbindung besteht. Durch einen systematischen Ansatz wurde
das
Interaktionsspektrum
von
mutp53
mittels
ChIP-Seq,
RNA-
und
Protein-Ko-
Immunpräzipitation charakterisiert. Damit konnte ein Einblick der Funktion von mutp53 in
diesem Tumorzellmodell erhalten werden, der auf eine wichtige Rolle von mutp53 für die
kontrollierte Proliferation in einem Tumorzellverbund vor allem durch eine übergeordnete
Rolle in der Regulation der Genexpression hindeutet.
5.1 Die Expression von kleinen dsRNAs hat unabhängig von deren Sequenz eine
deutliche Reduktion des Wachstums sowie des Überlebens zur Folge
Lässt man in MethA Zellen dsRNA <30 bp durch Transfektion mit einem geeigneten Vektor
exprimieren, kann man mittels live cell imaging Mikroskopie eine überraschend drastische
Reduktion des Wachstums und des Überlebens der Zellen unabhängig von der verwendeten
RNA-Sequenz im Vergleich zu Kontrollzellen innerhalb von 50 h nach Transfektion
beobachten. Dieses Ergebnis wird durch Messungen der Viabilität sowie Messungen der
Zellanzahl durch Kristallviolettfärbung bestätigt (Daten nicht gezeigt). Grundsätzlich können
dsRNAs unspezifische Effekte in der Zelle auslösen, z.B. sog. off-target Effekte durch die
Degradation
der
mRNA
anderer
Gene
und
Bindung
an
zelluläre
Proteine
in
sequenzspezifischer Weise und Beeinflussung deren Funktion durch den sog. Aptamer
Effekt (Shi, Hoffman, and Lis, 1999). So konnte für antisense Oligonukleotide die Bindung an
viele verschiedene Proteine nachgewiesen werden (Branch, 1998; Brukner and Tremblay,
2000; Lebedeva and Stein, 2001), welches signifikante nichtspezifische Effekte hervorrufen
kann (Cho et al., 2001; Fisher et al., 2002; Stein, 1995). Außerdem kann dsRNA durch einen
miRNA Effekt die Translation von bestimmten Genen regulieren (Silencing) (Doench,
Petersen, and Sharp, 2003) oder die Induktion einer nichtspezifischen Interferonantwort
hervorrufen.
In Säugetierzellen können dsRNAs nicht-spezifische inhibitorische Effekte auslösen, die
kollektiv als Interferonantwort bezeichnet werden. Diese Antwort ist ein konservierter
Mechanismus der Zellen als Schutz vor viraler RNA. Das Zytokin Interferon induziert die
Expression zahlreicher intrazellulärer Gene zur Prävention der viralen Invasion und
Diskussion
91
ermöglicht die Auslösung der Apoptose infizierter Zellen. Beispielsweise wird durch
Interferon die Expression der dsRNA abhängigen Serin-/Threoninkinase PKR induziert
(Meurs et al., 1990). Die am besten beschriebene Funktion der PKR ist daher der Interferon
vermittelte Schutz gegen virale Infektion. Die PKR wird allerdings nicht nur in Virus-infizierten
sondern
auch
in
uninfizierten,
erkrankten
Geweben
(Tumore,
neurodegenerative
Erkrankungen) als intrazellulärer Stresssensor aktiviert (Sadler and Williams, 2007) und
wurde auch mit Zellwachstum, Signaltransduktion, Induktion von Apoptose, Differenzierung
und RNAi in Verbindung gebracht. Wie in Abbildung 47 schematisch dargestellt, führt die
durch dsRNA hervorgerufene Aktivierung der 2'-5' Oligoadenylatsynthetase 2 zur
Degradation der dsRNA, während die Aktivierung der PKR einen generellen Translationsstop
zur Folge hat.
dsRNA
IFN
TNFα
Induktion
PKR
2‘ 5‘ OAS
aktive PKR
(Autophosphorylierung und
Dimersierung)
NFκB Aktivierung
Zytokin Produktion
P eIF2α
Translation
2‘ 5‘ Oligoadenylate
RNase L
Degradation der RNA
Abbildung 48 Schematische und vereinfachte Darstellung der Aktivierung von PKR und 2'-5'
Oligoadenylatsynthetase 2 durch dsRNA als Schutzmechanismus der Zelle vor viraler Replikation.
(modifiziert nach H. Helmbold).
Es konnte kürzlich in einer Arbeit gezeigt werden, dass Alu-SINE Transkripte, deren
Expression durch Stress rapide steigt, die Translation stimulieren, indem sie als
Antagonisten die Aktivität der PKR inhibieren (Chu et al., 1998). Auf der anderen Seite wurde
berichtet, dass die 3' UTR Bereiche von cytoskeletalen Muskel mRNAs (Tropomyosin,
Troponin und Herzmuskel-Aktin) die Translation durch direkte Bindung an die RNA
bindenden Domänen der PKR inhibieren (Nussbaum, Gunnery, and Mathews, 2002). Die
Expression einer katalytisch inaktiven PKR (z.B. die Mutante K296R oder K296P) in NIH-3T3
Zellen führt zu deren Transformation und Bildung von Tumoren in Nacktmäusen und erhöht
das Wachstum von HeLa Zellen (Barber et al., 1995; Jagus, Joshi, and Barber, 1999;
Diskussion
92
Koromilas et al., 1992; Meurs et al., 1993). Diese Befunde implizieren eine positive Wirkung
auf die Zellproliferation durch das PKR- Protein, wenn die Kinasedomäne inaktiv ist.
Die PKR ist in den meisten Zelltypen in geringen Mengen im Zytoplasma vorhanden
(Hovanessian, 1987). Erst durch Bindung von dsRNA an die beiden RNA bindenden
Domänen im N-Terminus wird die im C-Terminus befindliche Kinasedomäne durch Änderung
der Konformation aktiviert. Dies hat eine Autophosphorylierung und Dimerisierung der PKR
und dadurch eine Aktivierung zur Folge (PKR review: Sadler and Williams, 2007). Die durch
dsRNA aktivierte PKR phosphoryliert u.a. die alpha Untereinheit des eukaryontischen
Initiationsfaktors eIF-2 und inhibiert dadurch die Proteinsynthese (Williams, 1999). Zudem
induziert die PKR die Expression von NFκB (Gil, Alcami, and Esteban, 1999).
Matsumoto und Kollegen beschrieben, dass die durch dsRNA ausgelöste Apoptose über drei
Signalwege verläuft: den klassischen PKR abhängigen Signalweg (FADD-caspase 8), einen
JNK/SAPK vermittelten mitochondrialen Signalweg sowie ein ERK2 bezogener Signalweg
(Matsumoto et al., 2005).
In der Literatur wird die Interferonantwort allerdings für dsRNA größer als 30 bp beschrieben
(Lengyel, 1987). Aus diesem Grund verwendet man zur Umgehung dieser Antworten für die
RNAi Technologie zum spezifischen knockdown eines Zielgens dsRNA, die 21 bis 23 nt lang
ist (Elbashir, Lendeckel, and Tuschl, 2001). Die PKR kann zwar bereits durch dsRNA von 11
bp Länge aktiviert werden, allerdings sind für die volle Aktivierung 30 bp nötig (Manche et al.,
1992; Nanduri et al., 1998). Eine andere Arbeit zeigt, dass die Induktion einer
Interferonantwort durch dsRNA vom Zelltyp und der Duplexlänge abhängig ist (Reynolds et
al., 2006).
Vergleicht man Genexpressionsprofile zwischen transfizierten und unbehandelten Zellen, ist
eine drastische Hochregulation von Interferonantwort assoziierten Genen, zu denen die
dsRNA abhängige PKR sowie 2'-5' Oligoadenylatsynthetase 2 gehören, als Antwort auf
Expression der exogenen dsRNA zu beobachten. Diese Ergebnisse sprechen für die
Aktivierung einer nichtspezifischen Interferonantwort durch die in dieser Arbeit verwendete
dsRNA. Allerdings weisen einige Ergebnisse auf einen alternativen Signalweg im Gegensatz
zum Translationsstop hin. Zum einen konnte mittels live cell Imaging Mikroskopie ein
morphologischer Wachstumsarrest während der Mitose beobachtet werden und zum
anderen konnte keine Phosphorylierung von eIF2α nachgewiesen werden (Helmbold,
unpublizierte Daten). Durch die Resultate dieser Arbeit kann postuliert werden, dass in
MethA Zellen die Expression der exogenen dsRNA von 21-23 bp Länge zur Induktion der
dsRNA abhängigen PKR, der OAS2 sowie zahlreichen Interferonantwort assoziierten Genen
führt und diese Aktivierung vermutlich einen Wachstumsarrest mit anschließendem Zelltod
verursacht. Diese Daten werden durch die Arbeit von Sledz und Mitarbeitern unterstützt, die
ebenfalls
zeigen
konnten,
dass
das
Interferonsystem
durch
siRNAs
in
mutp53
Diskussion
93
exprimierenden T98G Glioblastomzellen aktiviert wird (Sledz et al., 2003). Weitere Gruppen
konnten beobachten, dass siRNAs oder shRNAs eine Interferonantwort auslösen (Bridge et
al., 2003; Jackson et al., 2003; Kariko et al., 2004; Persengiev, Zhu, and Green, 2004; Zhang
et al., 2006). Semizarov und Mitarbeiter haben beschrieben, dass erst nach Optimierung des
siRNA Designs und der Transfektion die Expressionssignaturen von verschiedenen siRNAs
gegen ein Zielgen gleich waren und sich von den Signaturen von siRNAs gegen ein anderes
Zielgen unterschieden (Semizarov et al., 2003). Es ist außerdem bekannt, dass sich viele
Tumorzelllinien, die für shRNA Experimente verwendet werden, durch einen defekten
Interferonsignalweg auszeichnen (Stojdl et al., 2000). Dies könnte ein Grund sein, warum in
der Mehrheit der RNAi Experimente eine solche Interferonantwort nicht in der Literatur
beschrieben wird. Durch weitere Versuche unserer Arbeitsgruppe konnte mittels TUNEL Test
(TdT-mediated dUTP nick end labeling), welcher zur Detektion von fragmentierter DNA
verwendet wird, und Nachweis der Prozessierung von Caspase 3 durch Immunblot,
Zellabsterben durch Apoptose infolge der Transfektion mit in in vitro synthetisierten dsRNA
transfizierten Zellen beobachtet werden (Helmbold, unpublizierte Daten).
Es konnte weiterhin gezeigt werden, dass nur dsRNA, welche z.B. durch die Expression von
shRNA mittels Vektoren oder in vitro Transkription generiert werden, die Aktivierung der PKR
auslöst, während chemisch synthetisierte und über PAGE aufgereinigte 21-23bp siRNAs
diesen Effekt nicht zeigten (Helmbold, unpublizierte Daten). Dies impliziert, dass die
Aktivierung der PKR nicht durch perfekte doppelsträngige RNA <30 bp stattfindet.
Möglicherweise entstehen durch Transfektion mit shRNA Expressionsvektoren oder in vitro
Transkription längere Intermediate der dsRNA, die nicht effizient genug prozessiert werden
und zur Aktivierung der PKR führen können. Der Einfluss der dsRNA auf das Wachstum und
das Überleben der MethA Zellen unterstreicht die essentielle Bedeutung der Kontroll dsRNA
(scr shRNA) für den Versuch und die Interpretation der Daten. Es ist aufgrund dieser
Ergebnisse ratsam, die Expression von klassischen Interferon induzierten Genen wie PKR
und 2'-5' Oligoadenylatsynthetase 2 bei Verwendung der RNAi Technologie zu überprüfen.
5.2 Der knockdown von mutp53 potenziert die durch dsRNA-vermittelten Effekte
Der knockdown von mutp53 in MethA Zellen potenziert die durch dsRNA induzierten
Wachstumshemmenden Effekte. Bei einer transienten Transfektion von MethA Zellen mit
shp53 konnte 12 und 24 h nach Transfektion noch ein reduzierter mutp53 Spiegel
beobachtet werden. Dies bestätigt die Potenz der ausgewählten shp53 RNA und die
erfolgreiche Expression und Prozessierung dieser RNA in MethA Zellen. Doch schon in
einem Zeitraum von 20 bis 40 h nach der Transfektion von MethA Zellen mit pSUPshp53
kann man im Vergleich zu pSUPscr transfizierten Zellen ein verlangsamtes Wachstum
erkennen, wie durch die live cell imaging Mikroskopie zu beobachten ist. Gleiche Ergebnisse
wurden
durch
Messen
der
metabolischen
Aktivität
sowie
der
Zellanzahl
mittels
Diskussion
94
Kristallviolettfärbung von transfizierten MethA Zellen erhalten (Daten nicht gezeigt). Diese
Beobachtung erklärt den erfolglosen Versuch einer stabilen Reduktion des mutp53 Spiegels
mittels RNAi Technologie und wird zusätzlich durch publizierte Daten bestätigt (Shohat et al.,
1987; Yamauchi, Kobayashi, and Tanaka, 1996). Die Transfektion mit dsRNA <30 bp ruft in
MethA Zellen entgegen der vorherrschenden Meinung eine Erhöhung der Konzentration der
PKR hervor, die zusammen mit den anderen induzierten Genen zu einer starken
Wachstumsreduktion und zum Tod der Zellen führt. Wahrscheinlich ist der PKR abhängige
Effekt auf das Wachstum und Überleben von MethA Zellen mutp53 abhängig, da die
Transfektion mit den entsprechenden Expressionsvektoren von 10-1 Zellen, die p53 defizient
sind, keinen Einfluss auf deren Wachstum haben. In der qRT-PCR ist eine höhere
Aktivierung der PKR durch shp53 RNA im Vergleich zu pSUPscr transfizierten Zellen
festzustellen. Sowohl mutp53 als auch PKR binden dsRNA und kompetitieren vermutlich in
der Bindung. Ein höherer mutp53 Spiegel kann möglicherweise die Aktivierung der PKR
durch dsRNA partiell kompensieren. Aufgrund der Ergebnisse der RNA- und Protein-KoImmunpräzipitation kann eine Involvierung von mutp53 in den RNA Metabolismus und
Bindung an regulatorische RNAs postuliert werden. Demnach könnte der Effekt von mutp53
auf das Wachstum dadurch erklärt werden, dass mutp53 in MethA Zellen auf der RNA
Ebene ein Gleichgewicht an regulatorischen RNAs hält, welches ein schnelles aber
kontrolliertes Wachstum durch posttranskriptionelle Regulation der Genexpression bedingt.
Das Gleichgewicht wird durch die Expression von exogener dsRNA, die ebenfalls von
mutp53 gebunden wird, empfindlich gestört. In Tumorzellen muss generell das Wachstum
der Zellen kontrolliert werden. Je weniger mutp53 in MethA Zellen vorhanden ist, desto
weniger kann die durch die Expression von exogener dsRNA hervorgerufene Dysbalance
kompensiert werden.
Diese Ergebnisse sprechen für die Existenz von mutp53 Spezies, die die Tumorgenese nicht
nur durch den Verlust der Tumorsuppressoraktivität von wtp53, sondern durch einen
Zugewinn an Funktionen aktiv unterstützen. Im speziellen sind die in MethA Zellen
exprimierten mutp53 Spezies für die Regulation des Wachstums der Zellen verantwortlich.
Um den molekularen Mechanismus der Funktion von mutp53 zu entschlüsseln, wurden
daher mehrere komplementäre Techniken im Rahmen dieser Arbeit angewendet.
5.3 Übergeordnete Funktion von mutp53 in der Regulation der Genexpression
Transkriptionsfaktoren können zum einen durch direkte Bindung an Promotoren die
Expression von Genen regulieren. Auf der anderen Seite können sie auch indirekt Einfluss
auf die Genexpression nehmen, indem sie durch Änderungen der Chromatinstruktur die
Voraussetzungen für die Transkription bestimmter Gene schaffen. Um Anhaltspunkte für den
Wirkungsmechanismus von mutp53 zu erhalten, wurde die ChIP-Seq Technik verwendet, die
eine Identifikation von potentiellen mutp53 Bindungsstellen ermöglicht.
Diskussion
95
5.3.1 Genomische Verteilung und Sequenzkomposition der mutp53-Bindungsorte
Die molekulare Basis für eine DNA Bindung durch mutp53 ist noch unzureichend geklärt und
es konnte bislang kein Konsensussequenzmotiv für mutp53 identifiziert werden. Im
Gegensatz zu wtp53 haben die meisten mutp53 Proteine die Kapazität, sequenzspezifisch
an DNA zu binden, verloren, können jedoch die Transkription von einigen Genen aktivieren
oder reprimieren. Unsere Gruppe konnte zeigen, dass verschiedene mutp53 Proteine
spezifisch und selektiv nichtlineare DNA aufgrund deren Konformation und daher in
strukturspezifischer Weise binden (Gohler et al., 2005; Kim and Deppert, 2004). Diese
Strukturselektivität von mutp53 aus MethA Zellen bildet die Basis für die spezifische und
hochaffine Interaktion mit MAR/SAR regulatorischen DNA Elementen. Diese können durch
ihre AT reiche Sequenz und ihre Entwindungsmotive ähnlich zur Sequenz AATATATTT sehr
flexible DNA-Strukturen ausbilden und können strukturelle Veränderungen von Chromatin,
wie z.B. regionales Entpaaren von Basen auslösen (Berezney, 1991; Bode et al., 1992;
Gasser and Laemmli, 1987; Herbomel, 1990; Jenuwein et al., 1997; Kohwi-Shigematsu and
Kohwi, 1990; Mielke et al., 1990). MAR/SARs sind 400 bp bis einige kb groß und an den
Grenzen von transkriptionellen Einheiten und in der Nähe von enhancer-ähnlichen Regionen
lokalisiert. Durch ihre Eigenschaften sind diese Elemente an der übergeordneten Regulation
der Transkription durch Ausbildung von Chromatin-Schleifen involviert (Bode et al., 2000;
Heng et al., 2004). Die Genregulation durch MAR/SAR transkriptionsmodulierende Elemente
ist durch den Einfluss auf die Expression von mehreren Genen charakterisiert (Alvarez et al.,
2000; Dobreva, Dambacher, and Grosschedl, 2003). Durch die in vitro und in vivo Bindung
von MethA mutp53 an MAR/SAR Elemente und die enge Assoziation mit der nukleären
Matrix durch Protein-Protein Interaktionen wurde für mutp53 eine Funktion in der
übergeordneten Modulation der Genexpression postuliert (Müller et al., 1996; Koga und
Deppert, 2000; Steinmeyer et al., 1990; Weißker et al., 1992; Will et al., 1998; Will et al.,
1998). Aus unserer Gruppe geht außerdem aus verschiedenen Experimenten hervor, dass
durch die Bindung von mutp53 an bestimmte Genomloci die Expression von mehreren
Genen in einem Gencluster reguliert wird. Durch diese Ergebnisse wird ein Modell
unterstützt, in dem mutp53 an repetitive DNA-Bereiche mit struktureller Flexibilität bindet,
welches zur Umstrukturierung von Chromatin führt, entweder durch diese Bindung oder das
Rekrutieren von anderen Faktoren. Um die Daten der in vitro Bindungsstudien zu verifizieren
bzw. die Bindungsorte von mutp53 im Genom der MethA Zellen zu identifizieren, wurde im
Rahmen dieser Arbeit die ChIP-Seq Technik eingesetzt. Durch diese Technik wurden 164
potentielle mutp53 DNA Bindungsstellen sequenziert. Aufgrund der Tatsache, dass die
Behandlung der Zellen mit Formaldehyd zur Vernetzung von mit DNA assoziierten
Multiprotein-Komplexen führt, kann man nicht unterscheiden, ob mutp53 direkt oder indirekt
durch ein anderes DNA-bindendes Protein an die DNA gebunden war. Wenn man jedoch
Diskussion
96
davon ausgeht, dass die Mehrheit der sequenzierten DNA-Fragmente spezifisch über die IP
isoliert wurde, was durch Kontroll-Versuch (IP ohne Antikörper) unterstützt wird, kann man
annehmen, dass diese DNA Fragmente die Bindungsorte von mutp53-enthaltenden ProteinKomplexen repräsentieren.
Obwohl 45% der mutp53-BS in Protein-kodierenden Genen lokalisiert sind, befanden sich
nur 6 Bindungsorte innerhalb von 5 kb von der nächsten TSS eines kodierenden Gens.
Auffällig ist es jedoch, dass sich 70% dieser Bindungsorte durch einen hohen Anteil an
unterschiedlichen Typen von repetitiven Sequenzen auszeichnen. Eine höhere Frequenz
(45%)
der
Bindungsorte
in
Genen
(verglichen
mit
einer
geschätzten
25%igen
Genomabdeckung durch Exone und Introne in der Maus; Waterston et al., 2002) sowie
Überrepräsentation (20%) der repetitiven SINE-Sequenzen (verglichen mit geschätzten 9%
SINE im Mausgenom; (Waterston et al., 2002) weisen auf die Spezifität des ChIPExperimentes hin. Ein häufiges Vorkommen von repetitiven DNA Sequenzen in
Bindungsorten scheint eine generelle Eigenschaft von mutp53 zu sein, weil auch mutp53 aus
humanen Zelllinien überwiegend an repetitive DNA Orte bindet (Marie Brazdova, Lars Tögel,
unpublizierte
Daten).
Repetitive
Sequenzen
machen
insgesamt
zirka
37,5%
des
Mausgenoms aus (Waterston et al., 2002) und bedingen eine größere strukturelle Flexibilität
der DNA, was unter Transkriptions-bedingter superhelikaler Spannung zur Ausbildung einer
nicht-B-DNA Konformation führt. Diese DNA-Strukturen stellen eine Basis für die Bindung
bzw. die Rekrutierung von regulatorischen Proteinen dar. Aufgrund der Heterochromatisierung können nicht alle repetitiven Sequenzen an der Genregulation teilnehmen
und außerdem könnte die Bindung von regulatorischen Proteinen an nicht-B-DNA abhängig
vom Chromatin-Kontext sein. Mutp53 könnte demzufolge alleine oder in Kooperation mit
anderen nicht-B-DNA Bindungsproteinen die verfügbaren DNA Orte besetzen und übt auf
diese
Weise
die
Regulation
der
Transkription
durch
Einflüsse
auf
die
globale
Chromatinorganisation aus. Dieser Wirkmechanismus könnte eine generelle Eigenschaft von
p53 sein, weil auch für wtp53 eine strukturspezifische Bindung von DNA, vor allem an nichtB DNA Strukturen, gezeigt wurde. Außerdem sind die DNA Sequenzen, an die mutp53
bindet, in ihrer biologischen Funktion heterogen und zeichnen sich nicht durch eine
Konsensussequenz aus. Des Weiteren zeigt eine Studie von Wei und Kollegen, dass die
Verteilung der Bindungsstellen von wtp53 in HCT116 kolorektalen Krebszellen nach 6stündiger Induktion mit 5-FU nicht so promotornah ist, wie man für einen Transkriptionsfaktor
erwarten würde (Wei et al., 2006). Unter Anwendung der ChIP-PET Methode wurden von
65.572 ChIP-PET DNA-Fragmenten 542 als wtp53 Bindungsstellen mit hoher Sicherheit
identifiziert, da diese mehrfach (bezeichnet als PET-Cluster) gefunden wurden. 474 PETClustern befinden sich in der Nähe von 458 Genen, während 68 aus nicht-kodierenden Orten
stammen. Über 73% der mehr als dreimal gefundenen Bindungsstellen enthalten das
Diskussion
97
Konsensusmotiv für eine p53 Bindung. 90% der 474 PET-Cluster sind innerhalb von 60 kb
der Gene lokalisiert, davon aber nur 156 in Promotorregionen.
Korrespondierende Expressionsdaten von mit 5-FU behandelten Zellen mit wt bzw.
mutantem p53 zeigten die differentielle Expression von 122 Genen, in deren Nähe eine
wtp53 Bindungsstelle detektiert wurde, von denen 65 hoch- und 57 herunterreguliert waren
(Kho et al., 2004). Insgesamt waren durch die Behandlung mit 5-FU ~1280 Gene 2-fach
differentiell reguliert, während 10% davon eine Bindungsstelle in der Nähe des Gens
aufwiesen. Dieses Ergebnis wird durch verschiedene Studien unterstützt, in denen zwar viele
infolge transkriptioneller Aktivierung von p53 induzierte Gene identifiziert werden konnten,
von denen allerdings nur wenige einen Hinweis auf eine direkte Bindung an Promotorregionen durch p53 liefern (Chen and Sadowski, 2005; el-Deiry et al., 1992; Yin et al., 2003;
Yoon et al., 2002).
Ob durch die Bindung von mutp53 z.B. an repetitive Sequenzen die Transkription von
potentiellen Zielgenen beeinflusst wird, kann durch die ChIP-Seq Methode nicht beurteilt
werden. Daher wurden die Genexpressionsprofile von mit pSUPscr und pSUPshp53
Vektoren transfizierten MethA Zellen verglichen. Dafür ist es notwendig, die Expression von
mutp53 auszuschalten oder zumindest signifikant zu reduzieren, um die Folgen dieser
Reduktion studieren zu können.
5.3.2 Einfluss von mutp53 auf die Genexpression
Um den Einfluss von mutp53 auf die Genexpression in MethA Zellen zu untersuchen,
wurden Microarray-Experimente durchgeführt, in denen die Genexpressionsprofile von
Kontrollzellen bzw. Zellen transfiziert mit pSUPscr und pSUPshp53 Vektoren verglichen
wurde.
Durch
Verwendung
strikter
Filterungskriterien
in
dem
Vergleich
der
Genexpressionsprofile von transfizierten Zellen untereinander wurde eine differentielle
Expression in einer geringen Anzahl der Gene beobachtet, unter denen nur 3 Gene mit einer
mutp53-Bindungsstelle sind. Ein sehr wichtiges Ergebnis dieser Studie ist jedoch ein
massiver Effekt der doppelsträngigen shRNA auf die Genexpression durch Induktion
Interferonantwort-assoziierter Signalwege. Dies macht auf der einen Seite eine Aussage
über den mutp53 vermittelten Effekt auf die Transkription durch die RNAi Technik zumindest
in dieser Zelllinie unmöglich, aber auf der anderen Seite stellt sich die Frage über eine
mögliche Beteiligung von mutp53 an den dsRNA-vermittelten Prozessen auf der Ebene der
transkriptionellen Regulation. Diese Frage scheint berechtigt zu sein, weil in p53-defizienten
Zellen (10-1 Zelllinie) kein toxischer Effekt der Transfektion mit pSUPscr und pSUPshp53
Vektoren beobachtet wurde.
Eine weitere Komplikation des Versuches, über shRNA Expression mutp53 zu reduzieren, ist
die nur 2-fache Reduktion von mutp53 Expression nach Transfektion mit pSUPshp53.
Obwohl bei der Auswertung der Microarray-Daten nur geringfügige Unterschiede in der
Diskussion
98
Transkriptmenge des Eif2ak2 (PKR) Gens zwischen transfizierten Zellen beobachtet wurde,
zeigte dagegen die qPCR-Analyse wesentlich stärkere Eif2ak2 Expression in den Zellen, die
mit pSUPshp53 transfiziert wurden. Dieses Ergebnis deutet darauf hin, dass das Eif2ak2
Gen durch mutp53 reprimiert wird und diese Repression durch mutp53 Reduktion
aufgehoben wird. Eine starke Unterstützung dieser Hypothese liefert die ChIP-Seq Analyse.
Eines der klonierten mutp53-kopräzipitierten DNA Fragmente (SM3-43; siehe Tabelle 7.1
und Abb. 49) stammt aus dem vierten Intron des Eif2ak2 Genes, und es lässt die Vermutung
zu, dass mutp53 in der Tat an der transkriptionellen Regulation dieses Gens beteiligt ist. Es
bleibt nun die Frage, warum sich die Ergebnisse der Microarray-Hybridisierung und qPCR
unterscheiden. Zu beachten bei der Auswertung der Expressionsdaten ist nämlich die
Auswahl der Sequenz der Oligonukleotide, die ein Gen auf einem Microarray repräsentieren.
Im Falle des Eif2ak2 Gens liegt die Sequenz des Oligonukleotids am Ende des letzen Exon
(siehe Abb. 49).
Wie aus Abb. 49 ersichtlich, ist die Position des Transkriptionsendes
variabel, und unter Umständen werden Transkripte unterschiedlicher Länge generiert, die
nicht
mit
dem
Array-Oligonukleotid
erfasst
werden.
Die
Sequenzen
der
qPCR-
Oligonukleotide wurden dagegen aus Exonen 14 und 16 gewählt (siehe Abb. 49), um die
Transkripte unabhängig von der Länge des 3’UTR detektieren zu können. Aus diesem Grund
wäre es sinnvoller bei dem Design der Oligonukleotid-basierenden Microarrays alle Exonen
abzudecken, damit ein vollständiges Profil der Transkription erstellt werden kann.
Abbildung 49 Nukleotidspositionen der mutp53-BS (SM3-43), qPCR Oligonukleotide (mEif2ak2Q3/Q4) und Agilent Microarray Oligonukleotid A_52_P559919 im Eif2ak2 Gen
5.3.3 Bindung von mutp53 an regulatorische Transkripte
Aufgrund unzureichender Beweise für eine direkte Beteiligung von mutp53 an der Regulation
der Transkription im Sinne eines Transkriptionsfaktors, wurde eine RNA Immunpräzipitation
mit anti-p53 Antikörper durchgeführt. Für die Möglichkeit, dass RNA in die Aktivität von
mutp53 involviert sein kann, spricht auch die Tatsache, dass p53 mit einer höheren Affinität
an RNA bindet als an DNA (Oberosler et al., 1993). Mithilfe der RNA Immunpräzipitation
wurde die Sequenz von 86 mutp53 kopräzipitierten Transkripten ermittelt. Von diesen sind
Diskussion
99
29 B2/B1 SINE Transkripte, die mit tRNA verwandt sind und von der RNA Polymerase III in
der Zelle als kurze nichttranslatierte RNA generiert werden.
SINEs sind im Genom weit verbreitet und kommen vor allem in Regionen hoher Gendichte
vor, dabei findet man sie oft innerhalb von Intronen oder in flankierenden Regionen von
Genen. Mehr als 95% aller Gene sind mit SINEs assoziiert. SINE B2 Elemente können in
entgegengesetzte Richtungen durch Pol II und Pol III Promotoren transkribiert werden (Allen
et al., 2004; Ferrigno et al., 2001). Laut neuesten Studien lassen sich SINEs als wichtige
Regulatoren der Genexpression klassifizieren. Die Repression Pol II regulierter Gene wurde
nach Hitzeschock mit der erhöhten Transkription der B2 SINEs korreliert (Allen et al., 2004),
und es gelang Espinoza und Mitarbeitern zu zeigen, dass B2 SINE RNA direkt an RNA Pol II
bindet und die Transkriptsynthese reprimiert (Espinoza et al., 2004). B2 SINE RNA bindet mit
hoher Affinität, Spezifität und kinetischer Stabilität an den Pol II Kern und wird dadurch in den
Präinitiationskomplex an Promotoren inkorporiert. Eine weitere Studie zeigte, dass die
gewebsspezifische Transkription eines SINEs im murinen Wachstumshormon Locus (GH) für
dessen Aktivierung benötigt wird und eine Restrukturierung des regulierten Lokus in nukleäre
Kompartimente ermöglicht (Lunyak et al., 2007). SINE Kopien sind in größerer Anzahl in der
Nähe von deregulierten Genen in Tumoren vorhanden und beeinflussen deren Expression
(Lerat and Semon, 2007). Je mehr SINE Elemente in der Nähe eines Gens gefunden
wurden, desto mehr waren diese Gene in ihrer Expression in Tumorgewebe dereguliert.
Unter diesem Aspekt könnte man sich vorstellen, dass die Bindung von mutp53 an SINEreiche DNA Orte und die Interaktion mit SINE RNA entscheidend für die Proliferation der
Tumorzellen sein könnte.
Die bisherigen Ergebnisse deuten auf eine Rolle der durch SINE Elementen kodierten B2
RNA
als
transkriptionelle
Repressoren,
z.B.
bei
Hitzeschock
oder
anderen
Stressbedingungen, oder Aktivatoren hin. Eine weitere überrepräsentierte Gruppe von
mutp53 kopräzipitierter RNA waren 3' UTR Transkripte. Diese Transkripte scheinen kein
Artefakt der Klonierungsmethode zu sein, sondern man geht davon aus, dass im
Mausgenom für die Mehrheit der Gene zusätzlich zum Volllängen-Transkript auch ein 3' UTR
Transkript bzw. ein alternativ gespleisstes Transkript existiert (Gustincich et al., 2006). Die
Bedeutung der 3' UTR Transkripte ist noch nicht komplett geklärt; ihre Beteiligung an der
Regulation von RNA Prozessierung, Abbau und Lokalisierung von RNA wird vermutet.
Untranslatierte Regionen (UTR untranslated regions) spielen im Allgemeinen eine wichtige
Rolle in der posttranskriptionellen Regulation der Genexpression durch Einfluss auf die
Effizienz der Translation, auf ihre subzelluläre Lokalisation und die mRNA Stabilität (Gray
and Wickens, 1998; Mignone et al., 2002). Kürzlich konnte eine Gruppe zeigen, dass p53
spezifisch an den 3' UTR der Urokinase Rezeptor mRNA bindet und durch diese Bindung
diese RNA destabilisiert (Shetty et al., 2007). Aufgrund der Anreicherung von
Diskussion
100
nichtkodierenden Transkripten in Komplexen mit mutp53 kann postuliert werden, dass
mutp53 vorwiegend durch posttranskriptionelle Regulation mittels strukturspezifischer
Bindung an regulatorische RNAs Einfluss auf das Wachstum von MethA Zellen nimmt.
5.3.4 Die Integration der ChIP und RIP Daten deuten auf eine Beteiligung von mutp53
an der Ausbildung von transcription/processing factories hin
Die genomische Verteilung der mutp53 Bindungsstellen und der kodierenden Regionen der
mutp53 gebundenen Transkripte lässt deutlich eine Anreicherung an bestimmten
genomischen Loci (Cluster) erkennen. Diese Entdeckung stützt das Modell der
transcription/processing factories der Genexpression (Bartlett et al., 2006; Faro-Trindade and
Cook, 2006). Mutp53 könnte demnach eine Komponente der Ausbildung von Transkriptionsund simultanen Prozessierungseinheiten (transcription/processing factories) darstellen. Nach
diesem Modell der Organisation von Chromatin im Zellkern geprägt von Peter Cook sind
euchromatische Chromatinschleifen (euchromatic loops) um eine solche Transkriptions- und
Prozessierungseinheit mit Anhäufung von RNA Polymerasen gewunden, welches eine
simultane Transkription mehrerer Gene sowie deren Prozessierung (5' Capping, Spleißen,
Polyadenylierung und Korrekturlesen) ermöglicht (Abb. 50).
Abbildung 50 Modell der Organisation von Chromatin im Nukleus und der Genexpression durch
transcription/processing factories nach Peter Cook, Oxford University. Danach sind euchromatische
Schleifen um Transkriptions- und simultane Prozessierungseinheiten (rosa Kugel) gewunden.
Transkriptionsfaktoren sind in diesem Modell in rot dargestellt.
Diskussion
101
Dieses Clustern oder Kompartimentieren von (Transkriptions-) faktoren und RNA
Polymerasen in einer „Fabrik“ ermöglicht eine effiziente Interaktion durch hohe lokale
Konzentrationen. Während der Interphase sind eukaryotische Chromosomen alle 5 bis 200
kb in topologisch abhängigen Schleifen, die von MAR/SAR Regionen organisiert werden,
gewunden. Dieses Modell ist im Einklang mit der Beobachtung, dass eine größere Menge an
Transkriptionsfaktoren die Expression eines Gens veranlassen, da mehrere Bindungsstellen
in Kooperation durch den Transkriptionsfaktor gebunden sein müssen.
Die Assoziation von mutp53 mit solchen Fabriken wird durch Analyse der mutp53
kopräzipitierten Proteine unterstützt.
5.3.5 RNA bindende Proteine bilden RNA-stabilisierte Komplexe mit mutp53
Die durch die Protein-co-IP identifizierten Komponenten von mutp53-haltigen Komplexen
weisen auf eine Rolle in der posttranskriptionellen Regulation von RNA hin. Die in dieser
Arbeit angewendete Methode zur Proteinidentifikation ist allerdings limitiert, da aufgrund der
Sensitivität des Massenspektrometers lediglich in größeren Mengen vorhandene Proteine
identifiziert werden konnten und außerdem nur Proteine mit einem Molekulargewicht
zwischen 10 und 150 kDa sowie pI Wert von 3-10 analysiert wurden. Darüber hinaus
müssen die identifizierbaren Proteine in den jeweils verwendeten Puffern löslich sein. Auch
die Extraktion von Proteinen durch den verwendeten Lysepuffer ist eingeschränkt. Demnach
sind die beschriebenen Ergebnisse unvollständig. Dennoch lieferten die Experimente erste
Hinweise auf die Funktion von mutp53 in MethA Zellen vor allem durch Interaktion mit RNA
bindenden Proteinen und tragen somit zum Verständnis der mutp53 Funktion bei. Die
potentielle Interaktion von mutp53 mit hsc70 (hspa1), YB1, hnRNP A/B und hnRNP D konnte
mit einer weiteren unabhängigen Methode, der Kolokalisationsanalyse bestätigt werden.
Fibrogranuläre RNP Strukturen sind an intranukleäre, nicht-Chromatin Strukturen, der
nukleären Matrix, angeheftet. Es ist bekannt, dass RNP Partikel erst durch Verdau mit
Ribonukleasen freigesetzt werden, da sie Teil einer Struktur, der nukleären Matrix, sind und
nicht durch die Permeabilisierung des Kernmembran oder leichte Homogenisierung
freigesetzt werden. HnRNP Proteine sind in großen Mengen in der Zelle vorhandene
Proteine mit vielfältigen Aufgaben mit zentraler Rolle im RNA Metabolismus. Sie sind in das
Verpacken entstehender hnRNA, dem alternativen RNA Spleißen, dem mRNA Export vom
Nukleus und dem Transfer im Zytoplasma, der Stabilität und Translation involviert (Dreyfuss,
Kim, and Kataoka, 2002; Krecic and Swanson, 1999; Shyu and Wilkinson, 2000; Weighardt,
Biamonti, and Riva, 1996). Sie spielen außerdem eine Rolle in der Aufrechterhaltung der
Telomere und regulieren die Genexpression auf transkriptioneller und translationaler Ebene.
Es sind mehr als 20 hnRNP Proteine bekannt, von denen viele RNA Erkennungsmotive
(RRM RNA recognition motifs) enthalten. Die Immunpräzipitation sowie Kolokalisation
lieferten
beide
Hinweise
auf
eine
Interaktion
der
genannten
Proteine.
Eine
Diskussion
102
Nukleasebehandlung zeigte außerdem, dass Multiprotein-Komplexe vorliegen, die RNA
abhängig gebildet wurden.
Zusammengefasst kann postuliert werden, dass mutp53 durch Interaktion mit RNA
bindenden Proteinen und regulatorischen RNAs eine übergeordnete Funktion in der
Regulation der Genexpression trägt und dadurch Einfluss auf das Wachstum von MethA
Zellen nimmt. Durch Expression exogener dsRNA findet vermutlich eine Kompetition von
exogenen und endogenen RNAs um die Bindung an mutp53 statt, die das Gleichgewicht
stören.
Die
Bindung
von
endogener
sowie
exogener
RNA
an
mutp53
findet
höchstwahrscheinlich in strukturspezifischer Weise statt.
5.4 Mögliche Beteiligung von mutp53 am Spindelkontrollpunkt der Mitose
In den letzten Kapiteln wurde eingehend diskutiert, dass aus den Ergebnissen der
Untersuchung der mutp53 Funktion eine Beteiligung an einer globalen transkriptionellen und
posttranskriptionellen Regulation der Genexpression hervorgeht. Doch wie wirkt sich diese
übergeordnete Funktion in der Genexpression konkret auf das Verhalten der MethA Zellen
aus? Aus mehreren unabhängigen Experimenten wurden Hinweise auf eine Beteiligung von
mutp53 an einem Arrest in der Mitose gesammelt. Wichtigster Indikator für einen mutp53
abhängigen mitotischen Arrest nach Transfektion mit exogener dsRNA war die Beobachtung
der Morphologie der MethA Zellen durch die live cell imaging Mikroskopie nach Transfektion
mit verschiedenen DNA-Konstrukten. Differentiell reguliert und interessant im Hinblick auf
einen gain-of-function Effekt, der eine erhöhte Wachstumsrate bedingt, ist das Dync1h1 Gen,
welches für zytoplasmatisches Dynein kodiert. Das Gen für die schwere Kette des
zytoplasmatischen Dyneinkomplexes ist in drei von vier angefertigten Genexpressionsanalysen nach Reduktion von mutp53 differentiell reguliert und wurde außerdem in
verschiedenen Zelllinien nach Screening von RNAi Bibliotheken auf reduziertes Wachstum
als eines der neun essentiellen Gene für das Zellwachstum identifiziert (Harborth et al.,
2001). Die Reduktion von Dync1h1 durch die RNAi Technologie korrelierte mit einem
aberranten mitotischen Arrest. Zytoplasmatisches Dynein ist in das Ausschalten des
Kontrollpunktes der Spindelanordnung (Spindle Assembly Checkpoints; SAC) involviert,
indem es die Kontrollpunktproteine Mad2 und den RZZ Komplex von ausgerichteten
Kinetochoren entfernt und ein Fortschreiten von der Metaphase in die Anaphase einleitet
(Dotiwala et al., 2007; Griffis, Stuurman, and Vale, 2007; Yang et al., 2007). Die differentielle
Regulation von Dync1h1 konnte durch qRT-PCR bestätigt werden. Der Verlust des
mitotischen Spindelkontrollpunktes ist mit chromosomaler Instabilität in frühen Stadien der
Entwicklung von Fibrosarkomen assoziiert. Eine Störung des Spindelkontrollpunktes durch
einige mutante p53 Proteine wurde bereits als gain-of-function Effekt beschrieben (Gualberto
et al., 1998). Durch die ChIP-Seq Technologie wurde außerdem eine Bindungsstelle von
mutp53 in der Nähe des Dynlt3 Gens, welches für eine leichte Kette des zytoplasmatischen
Diskussion
103
Dyneinkomplexes kodiert, gefunden und dieses ebenfalls in mindestens einem der vier
Microarray
Experimente
differentiell
reguliert.
Diese
leichte
Kette
verbindet
zytoplasmatisches Dynein mit dem Spindelkontrollprotein Bub3 (budding uninhibited by
benzimidazoles 3) (Lo, Kogoy, and Pfister, 2007). Die leichte Kette von zytoplasmatischen
Dynein hat zudem eine Rolle außerhalb des Dynein Komplexes. Nukleäres Dynlt3 bindet an
den Transkriptionsfaktor Satb1 an Strukturen der nukleären Matrix. Durch diese Interaktion
ist Dynlt3 in die durch Satb1 vermittelte Repression des proapoptotischen Gens Bcl2
involviert (Yeh, Chuang, and Sung, 2005). In beiden Genexpressionsanalysen 24 h nach
Transfektion wurde zusätzlich die Untereinheit Cdc23 des APC Komplexes (Anaphase
promoting complex) als herrunterreguliert nach knockdown von mutp53 gefunden. Der
hochkonservierte APC Komplex stellt eine E3 Ubiquitinligase dar, die Cyclin B durch
Katalyse der Bildung von Cyclin B-Ubiquitin Konjugaten zur Degradation markiert. Cdc23 ist
außerdem notwendig für die Phosphorylierung von Mcm (Minichromosome maintenance)
durch die Dfp1-HSK1 Kinase. Veränderungen in Cdc23 werden in Kolonkarzinomen
gefunden. Weitere Hinweise auf eine Beteiligung von mutp53 am Spindelkontrollpunkt
konnten durch die Entdeckung der 24h nach Transfektion differentiell regulierten Genen wie
Rap1gap, Csnk1δ und Ajuba gefunden werden. Außerdem wurden unter den mutp53
gebundenen Transkripten das 3‘ UTR Transkript von Dynll1 durch die RNA-IP identifiziert,
welches für eine leichte Untereinheit des zytoplasmatischen Dyneinkomplexes kodiert. Des
Weiteren wurden die 3‘ UTR der Anapc11 und Mad2l1bp Transkripte durch die RNA-IP
gefunden, welche ebenfalls in den Spindelkontrollpunkt der Mitose involviert sind. Dabei stellt
Anapc11 eine essentielle Untereinheit des APC Komplexes dar, während das Mad2
Bindeprotein den Spindelkontrollpunkt durch Inaktivierung von Mad2 inaktiviert und ein
Fortschreiten in die Mitose ermöglicht. Das Protein Tpx2, dessen 3‘ UTR Transkript ebenfalls
durch die RNA-IP in Assoziation mit mutp53 gefunden wurde, wird strikt durch den APC
Komplex kontrolliert und aktiviert die Aurora A Kinase, die in vielen Tumoren überexprimiert
ist, da sie eine wichtige Rolle in der Mitose spielt. Durch die Protein-co-IP konnte ferner die
potentielle Interaktion von mutp53 mit den Proteinen Mcm9 sowie LOC68045, einem neuen
mitotischen Spindel assoziiertem Protein identifiziert werden. Zusammenfassend wurden aus
verschiedenen unabhängigen Analysen erste Hinweise auf das mutp53-abhängige
Ausschalten
des
Spindelkontrollpunktes
durch
mehrere
Untereinheiten
des
zyto-
plasmatisches Dyneinkomplexes sowie Proteine, die Untereinheiten des APC bilden
während der Mitose gesammelt. Ob der positive Effekt von mutp53 in MethA Zellen
tatsächlich auf ein Fortschreiten der Metaphase zur Anaphase während der Mitose
zurückzuführen ist, muss in weiteren Experimenten geklärt werden.
Literatur
104
6 LITERATUR
Agapova, L. S., Ilyinskaya, G. V., Turovets, N. A., Ivanov, A. V., Chumakov, P. M., and Kopnin, B. P.
(1996). Chromosome changes caused by alterations of p53 expression. Mutat Res 354(1),
129-38.
Ahn, J., and Prives, C. (2001). The C-terminus of p53: the more you learn the less you know. Nat
Struct Biol 8(9), 730-2.
Akyuz, N., Boehden, G. S., Susse, S., Rimek, A., Preuss, U., Scheidtmann, K. H., and Wiesmuller, L.
(2002). DNA substrate dependence of p53-mediated regulation of double-strand break repair.
Mol Cell Biol 22(17), 6306-17.
Albrechtsen, N., Dornreiter, I., Grosse, F., Kim, E., Wiesmuller, L., and Deppert, W. (1999).
Maintenance of genomic integrity by p53: complementary roles for activated and non-activated
p53. Oncogene 18(53), 7706-17.
Allen, T. A., Von Kaenel, S., Goodrich, J. A., and Kugel, J. F. (2004). The SINE-encoded mouse B2
RNA represses mRNA transcription in response to heat shock. Nat Struct Mol Biol 11(9), 81621.
Alvarez, J. D., Yasui, D. H., Niida, H., Joh, T., Loh, D. Y., and Kohwi-Shigematsu, T. (2000). The
MAR-binding protein SATB1 orchestrates temporal and spatial expression of multiple genes
during T-cell development. Genes Dev 14(5), 521-35.
Arai, N., Nomura, D., Yokota, K., Wolf, D., Brill, E., Shohat, O., and Rotter, V. (1986). Immunologically
distinct p53 molecules generated by alternative splicing. Mol Cell Biol 6(9), 3232-9.
Asschert, J. G., Vellenga, E., Hollema, H., van der Zee, A. G., and de Vries, E. G. (1997). Expression
of macrophage colony-stimulating factor (M-CSF), interleukin-6, (IL-6), interleukin-1 beta (IL-1
beta), interleukin-11 (IL-11) and tumour necrosis factor-alpha (TNF-alpha) in p53characterised human ovarian carcinomas. Eur J Cancer 33(13), 2246-51.
Bakalkin, G., Selivanova, G., Yakovleva, T., Kiseleva, E., Kashuba, E., Magnusson, K. P., Szekely, L.,
Klein, G., Terenius, L., and Wiman, K. G. (1995). p53 binds single-stranded DNA ends
through the C-terminal domain and internal DNA segments via the middle domain. Nucleic
Acids Res 23(3), 362-9.
Baker, S. J., Preisinger, A. C., Jessup, J. M., Paraskeva, C., Markowitz, S., Willson, J. K., Hamilton,
S., and Vogelstein, B. (1990). p53 gene mutations occur in combination with 17p allelic
deletions as late events in colorectal tumorigenesis. Cancer Res 50(23), 7717-22.
Bakheet, T., Frevel, M., Williams, B. R., Greer, W., and Khabar, K. S. (2001). ARED: human AU-rich
element-containing mRNA database reveals an unexpectedly diverse functional repertoire of
encoded proteins. Nucleic Acids Res 29(1), 246-54.
Banin, S., Moyal, L., Shieh, S., Taya, Y., Anderson, C. W., Chessa, L., Smorodinsky, N. I., Prives, C.,
Reiss, Y., Shiloh, Y., and Ziv, Y. (1998). Enhanced phosphorylation of p53 by ATM in
response to DNA damage. Science 281(5383), 1674-7.
Barber, G. N., Jagus, R., Meurs, E. F., Hovanessian, A. G., and Katze, M. G. (1995). Molecular
mechanisms responsible for malignant transformation by regulatory and catalytic domain
variants of the interferon-induced enzyme RNA-dependent protein kinase. J Biol Chem
270(29), 17423-8.
Barreau, C., Watrin, T., Beverley Osborne, H., and Paillard, L. (2006). Protein expression is increased
by a class III AU-rich element and tethered CUG-BP1. Biochem Biophys Res Commun 347(3),
723-30.
Bartek, J., Falck, J., and Lukas, J. (2001). CHK2 kinase--a busy messenger. Nat Rev Mol Cell Biol
2(12), 877-86.
Bartlett, J., Blagojevic, J., Carter, D., Eskiw, C., Fromaget, M., Job, C., Shamsher, M., Trindade, I. F.,
Xu, M., and Cook, P. R. (2006). Specialized transcription factories. Biochem Soc Symp(73),
67-75.
Bates, S., Phillips, A. C., Clark, P. A., Stott, F., Peters, G., Ludwig, R. L., and Vousden, K. H. (1998).
p14ARF links the tumour suppressors RB and p53. Nature 395(6698), 124-5.
Bell, D. W., Varley, J. M., Szydlo, T. E., Kang, D. H., Wahrer, D. C., Shannon, K. E., Lubratovich, M.,
Verselis, S. J., Isselbacher, K. J., Fraumeni, J. F., Birch, J. M., Li, F. P., Garber, J. E., and
Haber, D. A. (1999). Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome.
Science 286(5449), 2528-31.
Berezney, R. (1991). The nuclear matrix: a heuristic model for investigating genomic organization and
function in the cell nucleus. J Cell Biochem 47(2), 109-23.
Literatur
105
Beroud, C., and Soussi, T. (1998). p53 gene mutation: software and database. Nucleic Acids Res
26(1), 200-4.
Bienz, B., Zakut-Houri, R., Givol, D., and Oren, M. (1984). Analysis of the gene coding for the murine
cellular tumour antigen p53. Embo J 3(9), 2179-83.
Bishop, J. M. (1991). Molecular themes in oncogenesis. Cell 64(2), 235-48.
Blandino, G., Levine, A. J., and Oren, M. (1999). Mutant p53 gain of function: differential effects of
different p53 mutants on resistance of cultured cells to chemotherapy. Oncogene 18(2), 47785.
Bode, J., Benham, C., Knopp, A., and Mielke, C. (2000). Transcriptional augmentation: modulation of
gene expression by scaffold/matrix-attached regions (S/MAR elements). Crit Rev Eukaryot
Gene Expr 10(1), 73-90.
Bode, J., Kohwi, Y., Dickinson, L., Joh, T., Klehr, D., Mielke, C., and Kohwi-Shigematsu, T. (1992).
Biological significance of unwinding capability of nuclear matrix-associating DNAs. Science
255(5041), 195-7.
Bode, J., Schlake, T., Rios-Ramirez, M., Mielke, C., Stengert, M., Kay, V., and Klehr-Wirth, D. (1995).
Scaffold/matrix-attached regions: structural properties creating transcriptionally active loci. Int
Rev Cytol 162A, 389-454.
Bode, J., Stengert-Iber, M., Kay, V., Schlake, T., and Dietz-Pfeilstetter, A. (1996). Scaffold/matrixattached regions: topological switches with multiple regulatory functions. Crit Rev Eukaryot
Gene Expr 6(2-3), 115-38.
Boulikas, T. (1995). Chromatin domains and prediction of MAR sequences. Int Rev Cytol 162A, 279388.
Bourdon, J. C. (2007). p53 and its isoforms in cancer. Br J Cancer 97(3), 277-82.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-54.
Branch, A. D. (1998). A good antisense molecule is hard to find. Trends Biochem Sci 23(2), 45-50.
Brazma, A., and Vilo, J. (2001). Gene expression data analysis. Microbes Infect 3(10), 823-9.
Bridge, A. J., Pebernard, S., Ducraux, A., Nicoulaz, A. L., and Iggo, R. (2003). Induction of an
interferon response by RNAi vectors in mammalian cells. Nat Genet 34(3), 263-4.
Brown, P. O., and Botstein, D. (1999). Exploring the new world of the genome with DNA microarrays.
Nat Genet 21(1 Suppl), 33-7.
Brugarolas, J., Chandrasekaran, C., Gordon, J. I., Beach, D., Jacks, T., and Hannon, G. J. (1995).
Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature 377(6549), 552-7.
Brukner, I., and Tremblay, G. A. (2000). Cellular proteins prevent antisense phosphorothioate
oligonucleotide (SdT18) to target sense RNA (rA18): development of a new in vitro assay.
Biochemistry 39(37), 11463-6.
Brummelkamp, T. R., Bernards, R., and Agami, R. (2002). A system for stable expression of short
interfering RNAs in mammalian cells. Science 296(5567), 550-3.
Bullock, A. N., and Fersht, A. R. (2001). Rescuing the function of mutant p53. Nat Rev Cancer 1(1),
68-76.
Bullock, A. N., Henckel, J., DeDecker, B. S., Johnson, C. M., Nikolova, P. V., Proctor, M. R., Lane, D.
P., and Fersht, A. R. (1997). Thermodynamic stability of wild-type and mutant p53 core
domain. Proc Natl Acad Sci U S A 94(26), 14338-42.
Bullock, A. N., Henckel, J., and Fersht, A. R. (2000). Quantitative analysis of residual folding and DNA
binding in mutant p53 core domain: definition of mutant states for rescue in cancer therapy.
Oncogene 19(10), 1245-56.
Buschmann, T., Minamoto, T., Wagle, N., Fuchs, S. Y., Adler, V., Mai, M., and Ronai, Z. (2000).
Analysis of JNK, Mdm2 and p14(ARF) contribution to the regulation of mutant p53 stability. J
Mol Biol 295(4), 1009-21.
Canman, C. E., Lim, D. S., Cimprich, K. A., Taya, Y., Tamai, K., Sakaguchi, K., Appella, E., Kastan, M.
B., and Siliciano, J. D. (1998). Activation of the ATM kinase by ionizing radiation and
phosphorylation of p53. Science 281(5383), 1677-9.
Cardinali, M., Kratochvil, F. J., Ensley, J. F., Robbins, K. C., and Yeudall, W. A. (1997). Functional
characterization in vivo of mutant p53 molecules derived from squamous cell carcinomas of
the head and neck. Mol Carcinog 18(2), 78-88.
Castedo, M., Perfettini, J. L., Roumier, T., Andreau, K., Medema, R., and Kroemer, G. (2004). Cell
death by mitotic catastrophe: a molecular definition. Oncogene 23(16), 2825-37.
Chan, T. A., Hermeking, H., Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1999). 14-3-3Sigma is
required to prevent mitotic catastrophe after DNA damage. Nature 401(6753), 616-20.
Chao, C., Saito, S., Kang, J., Anderson, C. W., Appella, E., and Xu, Y. (2000). p53 transcriptional
activity is essential for p53-dependent apoptosis following DNA damage. Embo J 19(18),
4967-75.
Literatur
106
Chen, J., and Sadowski, I. (2005). Identification of the mismatch repair genes PMS2 and MLH1 as p53
target genes by using serial analysis of binding elements. Proc Natl Acad Sci U S A 102(13),
4813-8.
Chen, Y., Chen, P. L., and Lee, W. H. (1994). Hot-spot p53 mutants interact specifically with two
cellular proteins during progression of the cell cycle. Mol Cell Biol 14(10), 6764-72.
Chernov, I. P., Akopov, S. B., Nikolaev, L. G., and Sverdlov, E. D. (2002). Identification and mapping
of nuclear matrix-attachment regions in a one megabase locus of human chromosome
19q13.12: long-range correlation of S/MARs and gene positions. J Cell Biochem 84(3), 590600.
Chicas, A., Molina, P., and Bargonetti, J. (2000). Mutant p53 forms a complex with Sp1 on HIV-LTR
DNA. Biochem Biophys Res Commun 279(2), 383-90.
Chipuk, J. E., and Green, D. R. (2006). Dissecting p53-dependent apoptosis. Cell Death Differ 13(6),
994-1002.
Cho, Y., Gorina, S., Jeffrey, P. D., and Pavletich, N. P. (1994). Crystal structure of a p53 tumor
suppressor-DNA complex: understanding tumorigenic mutations. Science 265(5170), 346-55.
Cho, Y. S., Kim, M. K., Cheadle, C., Neary, C., Becker, K. G., and Cho-Chung, Y. S. (2001). Antisense
DNAs as multisite genomic modulators identified by DNA microarray. Proc Natl Acad Sci U S
A 98(17), 9819-23.
Chu, W. M., Ballard, R., Carpick, B. W., Williams, B. R., and Schmid, C. W. (1998). Potential Alu
function: regulation of the activity of double-stranded RNA-activated kinase PKR. Mol Cell Biol
18(1), 58-68.
Clarijs, R., Schalkwijk, L., Ruiter, D. J., and de Waal, R. M. (2003). EMAP-II expression is associated
with macrophage accumulation in primary uveal melanoma. Invest Ophthalmol Vis Sci 44(5),
1801-6.
Clarke, A. R., Purdie, C. A., Harrison, D. J., Morris, R. G., Bird, C. C., Hooper, M. L., and Wyllie, A. H.
(1993). Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature
362(6423), 849-52.
Cook, P. R. (2003). Nongenic transcription, gene regulation and action at a distance. J Cell Sci 116(Pt
22), 4483-91.
Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and
Bacchetti, S. (1992). Telomere shortening associated with chromosome instability is arrested
in immortal cells which express telomerase activity. Embo J 11(5), 1921-9.
Cross, S. M., Sanchez, C. A., Morgan, C. A., Schimke, M. K., Ramel, S., Idzerda, R. L., Raskind, W.
H., and Reid, B. J. (1995). A p53-dependent mouse spindle checkpoint. Science 267(5202),
1353-6.
Czosnek, H. H., Bienz, B., Givol, D., Zakut-Houri, R., Pravtcheva, D. D., Ruddle, F. H., and Oren, M.
(1984). The gene and the pseudogene for mouse p53 cellular tumor antigen are located on
different chromosomes. Mol Cell Biol 4(8), 1638-40.
Dasika, G. K., Lin, S. C., Zhao, S., Sung, P., Tomkinson, A., and Lee, E. Y. (1999). DNA damageinduced cell cycle checkpoints and DNA strand break repair in development and
tumorigenesis. Oncogene 18(55), 7883-99.
de Fromentel, C. C., Viron, A., Puvion, E., and May, P. (1986). SV40 large T-antigen and
transformation related protein p53 are associated in situ with nuclear RNP structures
containing hnRNA of transformed cells. Exp Cell Res 164(1), 35-48.
Dean, M., Fojo, T., and Bates, S. (2005). Tumour stem cells and drug resistance. Nat Rev Cancer
5(4), 275-84.
Deb, S., Jackson, C. T., Subler, M. A., and Martin, D. W. (1992). Modulation of cellular and viral
Promotors by mutant human p53 proteins found in tumor cells. J Virol 66(10), 6164-70.
DeLeo, A. B., Jay, G., Appella, E., Dubois, G. C., Law, L. W., and Old, L. J. (1979). Detection of a
transformation-related antigen in chemically induced sarcomas and other transformed cells of
the mouse. Proc Natl Acad Sci U S A 76(5), 2420-4.
DeLeo, A. B., Shiku, H., Takahashi, T., John, M., and Old, L. J. (1977). Cell surface antigens of
chemically induced sarcomas of the mouse. I. Murine leukemia virus-related antigens and
alloantigens on cultured fibroblasts and sarcoma cells: description of a unique antigen on
BALB/c Meth A sarcoma. J Exp Med 146(3), 720-34.
Deng, C., Zhang, P., Harper, J. W., Elledge, S. J., and Leder, P. (1995). Mice lacking p21CIP1/WAF1
undergo normal development, but are defective in G1 checkpoint control. Cell 82(4), 675-84.
Deppert, W. (1996). Binding of MAR-DNA elements by mutant p53: possible implications for its
oncogenic functions. J Cell Biochem 62(2), 172-80.
Deppert, W., Buschhausen-Denker, G., Patschinsky, T., and Steinmeyer, K. (1990). Cell cycle control
of p53 in normal (3T3) and chemically transformed (Meth A) mouse cells. II. Requirement for
cell cycle progression. Oncogene 5(11), 1701-6.
Literatur
107
Deppert, W., and Haug, M. (1986). Evidence for free and metabolically stable p53 protein in nuclear
subfractions of simian virus 40-transformed cells. Mol Cell Biol 6(6), 2233-40.
Deppert, W., and Von Der Weth, A. (1990). Functional interaction of nuclear transport-defective simian
virus 40 large T antigen with chromatin and nuclear matrix. J Virol 64(2), 838-46.
Di Agostino, S., Strano, S., Emiliozzi, V., Zerbini, V., Mottolese, M., Sacchi, A., Blandino, G., and
Piaggio, G. (2006). Gain of function of mutant p53: the mutant p53/NF-Y protein complex
reveals an aberrant transcriptional mechanism of cell cycle regulation. Cancer Cell 10(3), 191202.
Di Como, C. J., Gaiddon, C., and Prives, C. (1999). p73 function is inhibited by tumor-derived p53
mutants in mammalian cells. Mol Cell Biol 19(2), 1438-49.
Dittmer, D., Pati, S., Zambetti, G., Chu, S., Teresky, A. K., Moore, M., Finlay, C., and Levine, A. J.
(1993). Gain of function mutations in p53. Nat Genet 4(1), 42-6.
Dobreva, G., Dambacher, J., and Grosschedl, R. (2003). SUMO modification of a novel MAR-binding
protein, SATB2, modulates immunoglobulin mu gene expression. Genes Dev 17(24), 3048-61.
Doench, J. G., Petersen, C. P., and Sharp, P. A. (2003). siRNAs can function as miRNAs. Genes Dev
17(4), 438-42.
Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Montgomery, C. A., Jr., Butel, J. S., and
Bradley, A. (1992). Mice deficient for p53 are developmentally normal but susceptible to
spontaneous tumours. Nature 356(6366), 215-21.
Dornan, D., Shimizu, H., Perkins, N. D., and Hupp, T. R. (2003). DNA-dependent acetylation of p53 by
the transcription coactivator p300. J Biol Chem 278(15), 13431-41.
Dornan, D., Wertz, I., Shimizu, H., Arnott, D., Frantz, G. D., Dowd, P., O'Rourke, K., Koeppen, H., and
Dixit, V. M. (2004). The ubiquitin ligase COP1 is a critical negative regulator of p53. Nature
429(6987), 86-92.
Dotiwala, F., Haase, J., Arbel-Eden, A., Bloom, K., and Haber, J. E. (2007). The yeast DNA damage
checkpoint proteins control a cytoplasmic response to DNA damage. Proc Natl Acad Sci U S
A 104(27), 11358-63.
Dowdy, S. F., Hinds, P. W., Louie, K., Reed, S. I., Arnold, A., and Weinberg, R. A. (1993). Physical
interaction of the retinoblastoma protein with human D cyclins. Cell 73(3), 499-511.
Dreyfuss, G., Kim, V. N., and Kataoka, N. (2002). Messenger-RNA-binding proteins and the messages
they carry. Nat Rev Mol Cell Biol 3(3), 195-205.
Duesberg, P., and Li, R. (2003). Multistep carcinogenesis: a chain reaction of aneuploidizations. Cell
Cycle 2(3), 202-10.
Dulic, V., Kaufmann, W. K., Wilson, S. J., Tlsty, T. D., Lees, E., Harper, J. W., Elledge, S. J., and
Reed, S. I. (1994). p53-dependent inhibition of cyclin-dependent kinase activities in human
fibroblasts during radiation-induced G1 arrest. Cell 76(6), 1013-23.
Eckfeldt, C. E., Mendenhall, E. M., and Verfaillie, C. M. (2005). The molecular repertoire of the
'almighty' stem cell. Nat Rev Mol Cell Biol 6(9), 726-37.
Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. (1998). Cluster analysis and display of
genome-wide expression patterns. Proc Natl Acad Sci U S A 95(25), 14863-8.
el-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B. (1992). Definition of a
consensus binding site for p53. Nat Genet 1(1), 45-9.
el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W.
E., Kinzler, K. W., and Vogelstein, B. (1993). WAF1, a potential mediator of p53 tumor
suppression. Cell 75(4), 817-25.
Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by 21- and 22nucleotide RNAs. Genes Dev 15(2), 188-200.
Eliyahu, D., Goldfinger, N., Pinhasi-Kimhi, O., Shaulsky, G., Skurnik, Y., Arai, N., Rotter, V., and Oren,
M. (1988). Meth A fibrosarcoma cells express two transforming mutant p53 species.
Oncogene 3(3), 313-21.
Eliyahu, D., Michalovitz, D., and Oren, M. (1985). Overproduction of p53 antigen makes established
cells highly tumorigenic. Nature 316(6024), 158-60.
Eliyahu, D., Raz, A., Gruss, P., Givol, D., and Oren, M. (1984). Participation of p53 cellular tumour
antigen in transformation of normal embryonic cells. Nature 312(5995), 646-9.
Elmore, E., Kakunaga, T., and Barrett, J. C. (1983). Comparison of spontaneous mutation rates of
normal and chemically transformed human skin fibroblasts. Cancer Res 43(4), 1650-5.
Espinosa, J. M., and Emerson, B. M. (2001). Transcriptional regulation by p53 through intrinsic
DNA/chromatin binding and site-directed cofactor recruitment. Mol Cell 8(1), 57-69.
Espinoza, C. A., Allen, T. A., Hieb, A. R., Kugel, J. F., and Goodrich, J. A. (2004). B2 RNA binds
directly to RNA polymerase II to repress transcript synthesis. Nat Struct Mol Biol 11(9), 822-9.
Literatur
108
Ewen, M. E., Sluss, H. K., Sherr, C. J., Matsushime, H., Kato, J., and Livingston, D. M. (1993).
Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell
73(3), 487-97.
Faro-Trindade, I., and Cook, P. R. (2006). Transcription factories: structures conserved during
differentiation and evolution. Biochem Soc Trans 34(Pt 6), 1133-7.
Fearon, E. R., and Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell 61(5),
759-67.
Ferreira, C. G., Tolis, C., and Giaccone, G. (1999). p53 and chemosensitivity. Ann Oncol 10(9), 101121.
Ferrigno, O., Virolle, T., Djabari, Z., Ortonne, J. P., White, R. J., and Aberdam, D. (2001).
Transposable B2 SINE elements can provide mobile RNA polymerase II Promotors. Nat
Genet 28(1), 77-81.
Fields, S., and Jang, S. K. (1990). Presence of a potent transcription activating sequence in the p53
protein. Science 249(4972), 1046-9.
Finlay, C. A., Hinds, P. W., and Levine, A. J. (1989). The p53 proto-oncogene can act as a suppressor
of transformation. Cell 57(7), 1083-93.
Fiscella, M., Zhang, H., Fan, S., Sakaguchi, K., Shen, S., Mercer, W. E., Vande Woude, G. F.,
O'Connor, P. M., and Appella, E. (1997). Wip1, a novel human protein phosphatase that is
induced in response to ionizing radiation in a p53-dependent manner. Proc Natl Acad Sci U S
A 94(12), 6048-53.
Fisher, A. A., Ye, D., Sergueev, D. S., Fisher, M. H., Shaw, B. R., and Juliano, R. L. (2002). Evaluating
the specificity of antisense oligonucleotide conjugates. A DNA array analysis. J Biol Chem
277(25), 22980-4.
Fontoura, B. M., Sorokina, E. A., David, E., and Carroll, R. B. (1992). p53 is covalently linked to 5.8S
rRNA. Mol Cell Biol 12(11), 5145-51.
Forrester, K., Ambs, S., Lupold, S. E., Kapust, R. B., Spillare, E. A., Weinberg, W. C., Felley-Bosco,
E., Wang, X. W., Geller, D. A., Tzeng, E., Billiar, T. R., and Harris, C. C. (1996). Nitric oxideinduced p53 accumulation and regulation of inducible nitric oxide synthase expression by wildtype p53. Proc Natl Acad Sci U S A 93(6), 2442-7.
Frazier, M. W., He, X., Wang, J., Gu, Z., Cleveland, J. L., and Zambetti, G. P. (1998). Activation of cmyc gene expression by tumor-derived p53 mutants requires a discrete C-terminal domain.
Mol Cell Biol 18(7), 3735-43.
Freedman, D. A., Wu, L., and Levine, A. J. (1999). Functions of the MDM2 oncoprotein. Cell Mol Life
Sci 55(1), 96-107.
Friedman, P. N., Chen, X., Bargonetti, J., and Prives, C. (1993). The p53 protein is an unusually
shaped tetramer that binds directly to DNA. Proc Natl Acad Sci U S A 90(8), 3319-23.
Fujita, F., Taniguchi, Y., Kato, T., Narita, Y., Furuya, A., Ogawa, T., Sakurai, H., Joh, T., Itoh, M.,
Delhase, M., Karin, M., and Nakanishi, M. (2003). Identification of NAP1, a regulatory subunit
of IkappaB kinase-related kinases that potentiates NF-kappaB signaling. Mol Cell Biol 23(21),
7780-93.
Galluzzi, L., Maiuri, M. C., Vitale, I., Zischka, H., Castedo, M., Zitvogel, L., and Kroemer, G. (2007).
Cell death modalities: classification and pathophysiological implications. Cell Death Differ
14(7), 1237-43.
Gasser, S. M., and Laemmli, U. K. (1987). Improved methods for the isolation of individual and
clustered mitotic chromosomes. Exp Cell Res 173(1), 85-98.
Gil, J., Alcami, J., and Esteban, M. (1999). Induction of apoptosis by double-stranded-RNA-dependent
protein kinase (PKR) involves the alpha subunit of eukaryotic translation initiation factor 2 and
NF-kappaB. Mol Cell Biol 19(7), 4653-63.
Glazko, G. V., Koonin, E. V., Rogozin, I. B., and Shabalina, S. A. (2003). A significant fraction of
conserved noncoding DNA in human and mouse consists of predicted matrix attachment
regions. Trends Genet 19(3), 119-24.
Gloushankova, N., Ossovskaya, V., Vasiliev, J., Chumakov, P., and Kopnin, B. (1997). Changes in
p53 expression can modify cell shape of ras-transformed fibroblasts and epitheliocytes.
Oncogene 15(24), 2985-9.
Gohler, T., Jager, S., Warnecke, G., Yasuda, H., Kim, E., and Deppert, W. (2005). Mutant p53
proteins bind DNA in a DNA structure-selective mode. Nucleic Acids Res 33(3), 1087-100.
Gorgoulis, V. G., Zacharatos, P. V., Manolis, E., Ikonomopoulos, J. A., Damalas, A., Lamprinopoulos,
C., Rassidakis, G. Z., Zoumpourlis, V., Kotsinas, A., Rassidakis, A. N., Halazonetis, T. D., and
Kittas, C. (1998). Effects of p53 mutants derived from lung carcinomas on the p53-responsive
element (p53RE) of the MDM2 gene. Br J Cancer 77(3), 374-84.
Literatur
109
Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S. E., Scheffner, M., and Del Sal, G.
(1999). Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. Embo J 18(22),
6462-71.
Graeber, T. G., Peterson, J. F., Tsai, M., Monica, K., Fornace, A. J., Jr., and Giaccia, A. J. (1994).
Hypoxia induces accumulation of p53 protein, but activation of a G1-phase checkpoint by lowoxygen conditions is independent of p53 status. Mol Cell Biol 14(9), 6264-77.
Gray, N. K., and Wickens, M. (1998). Control of translation initiation in animals. Annu Rev Cell Dev
Biol 14, 399-458.
Greenblatt, M. S., Bennett, W. P., Hollstein, M., and Harris, C. C. (1994). Mutations in the p53 tumor
suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 54(18),
4855-78.
Griffis, E. R., Stuurman, N., and Vale, R. D. (2007). Spindly, a novel protein essential for silencing the
spindle assembly checkpoint, recruits dynein to the kinetochore. J Cell Biol 177(6), 1005-15.
Gronostajski, R. M., Goldberg, A. L., and Pardee, A. B. (1984). Energy requirement for degradation of
tumor-associated protein p53. Mol Cell Biol 4(3), 442-8.
Gu, L., Zhu, N., Findley, H. W., Woods, W. G., and Zhou, M. (2004). Identification and characterization
of the IKKalpha Promotor: positive and negative regulation by ETS-1 and p53, respectively. J
Biol Chem 279(50), 52141-9.
Gu, W., and Roeder, R. G. (1997). Activation of p53 sequence-specific DNA binding by acetylation of
the p53 C-terminal domain. Cell 90(4), 595-606.
Gualberto, A., Aldape, K., Kozakiewicz, K., and Tlsty, T. D. (1998). An oncogenic form of p53 confers
a dominant, gain-of-function phenotype that disrupts spindle checkpoint control. Proc Natl
Acad Sci U S A 95(9), 5166-71.
Gualberto, A., and Baldwin, A. S., Jr. (1995). p53 and Sp1 interact and cooperate in the tumor
necrosis factor-induced transcriptional activation of the HIV-1 long terminal repeat. J Biol
Chem 270(34), 19680-3.
Guardavaccaro, D., Corrente, G., Covone, F., Micheli, L., D'Agnano, I., Starace, G., Caruso, M., and
Tirone, F. (2000). Arrest of G(1)-S progression by the p53-inducible gene PC3 is Rb
dependent and relies on the inhibition of cyclin D1 transcription. Mol Cell Biol 20(5), 1797-815.
Gustincich, S., Sandelin, A., Plessy, C., Katayama, S., Simone, R., Lazarevic, D., Hayashizaki, Y., and
Carninci, P. (2006). The complexity of the mammalian transcriptome. J Physiol 575(Pt 2), 32132.
Hainaut, P., and Hollstein, M. (2000). p53 and human cancer: the first ten thousand mutations. Adv
Cancer Res 77, 81-137.
Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-directed nuclease
mediates post-transcriptional gene silencing in Drosophila cells. Nature 404(6775), 293-6.
Harborth, J., Elbashir, S. M., Bechert, K., Tuschl, T., and Weber, K. (2001). Identification of essential
genes in cultured mammalian cells using small interfering RNAs. J Cell Sci 114(Pt 24), 455765.
Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. (1993). The p21 Cdkinteracting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75(4), 80516.
Harvey, D. M., and Levine, A. J. (1991). p53 alteration is a common event in the spontaneous
immortalization of primary BALB/c murine embryo fibroblasts. Genes Dev 5(12B), 2375-85.
Haupt, Y., Maya, R., Kazaz, A., and Oren, M. (1997). Mdm2 promotes the rapid degradation of p53.
Nature 387(6630), 296-9.
He, Y., Brown, M. A., Rothnagel, J. A., Saunders, N. A., and Smith, R. (2005). Roles of heterogeneous
nuclear ribonucleoproteins A and B in cell proliferation. J Cell Sci 118(Pt 14), 3173-83.
Heinlein, C., Krepulat, F., Lohler, J., Speidel, D., Deppert, W., and Tolstonog, G. V. (2007). Mutant
p53(R270H) gain of function phenotype in a mouse model for oncogene-induced mammary
carcinogenesis. Int J Cancer.
Helmbold, H., Deppert, W., and Bohn, W. (2006). Regulation of cellular senescence by Rb2/p130.
Oncogene 25(38), 5257-62.
Heng, H. H., Goetze, S., Ye, C. J., Liu, G., Stevens, J. B., Bremer, S. W., Wykes, S. M., Bode, J., and
Krawetz, S. A. (2004). Chromatin loops are selectively anchored using scaffold/matrixattachment regions. J Cell Sci 117(Pt 7), 999-1008.
Herbomel, P. (1990). From gene to chromosome: organization levels defined by the interplay of
transcription and replication in vertebrates. New Biol 2(11), 937-45.
Hermeking, H., Lengauer, C., Polyak, K., He, T. C., Zhang, L., Thiagalingam, S., Kinzler, K. W., and
Vogelstein, B. (1997). 14-3-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol Cell
1(1), 3-11.
Literatur
110
Hernandez-Boussard, T., Montesano, R., and Hainaut, P. (1999). Analysis of somatic mutations of the
p53 gene in human cancers: a tool to generate hypotheses about the natural history of cancer.
IARC Sci Publ(146), 43-53.
Heukeshoven, J., and Dernick, R. (1985). Characterization of a solvent system for separation of waterinsoluble poliovirus proteins by reversed-phase high-performance liquid chromatography. J
Chromatogr 326, 91-101.
Hinds, P., Finlay, C., and Levine, A. J. (1989). Mutation is required to activate the p53 gene for
cooperation with the ras oncogene and transformation. J Virol 63(2), 739-46.
Hinds, P. W., Finlay, C. A., Quartin, R. S., Baker, S. J., Fearon, E. R., Vogelstein, B., and Levine, A. J.
(1990). Mutant p53 DNA clones from human colon carcinomas cooperate with ras in
transforming primary rat cells: a comparison of the "hot spot" mutant phenotypes. Cell Growth
Differ 1(12), 571-80.
Hinds, P. W., Mittnacht, S., Dulic, V., Arnold, A., Reed, S. I., and Weinberg, R. A. (1992). Regulation
of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 70(6), 9931006.
Ho, J., and Benchimol, S. (2003). Transcriptional repression mediated by the p53 tumour suppressor.
Cell Death Differ 10(4), 404-8.
Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991). p53 mutations in human cancers.
Science 253(5015), 49-53.
Hsiao, M., Low, J., Dorn, E., Ku, D., Pattengale, P., Yeargin, J., and Haas, M. (1994). Gain-of-function
mutations of the p53 gene induce lymphohematopoietic metastatic potential and tissue
invasiveness. Am J Pathol 145(3), 702-14.
Hupp, T. R., and Lane, D. P. (1995). Two distinct signaling pathways activate the latent DNA binding
function of p53 in a casein kinase II-independent manner. J Biol Chem 270(30), 18165-74.
Hupp, T. R., Meek, D. W., Midgley, C. A., and Lane, D. P. (1992). Regulation of the specific DNA
binding function of p53. Cell 71(5), 875-86.
Hupp, T. R., Sparks, A., and Lane, D. P. (1995). Small peptides activate the latent sequence-specific
DNA binding function of p53. Cell 83(2), 237-45.
Ihrie, R. A., Reczek, E., Horner, J. S., Khachatrian, L., Sage, J., Jacks, T., and Attardi, L. D. (2003).
Perp is a mediator of p53-dependent apoptosis in diverse cell types. Curr Biol 13(22), 198590.
Imbriano, C., Gurtner, A., Cocchiarella, F., Di Agostino, S., Basile, V., Gostissa, M., Dobbelstein, M.,
Del Sal, G., Piaggio, G., and Mantovani, R. (2005). Direct p53 transcriptional repression: in
vivo analysis of CCAAT-containing G2/M Promotors. Mol Cell Biol 25(9), 3737-51.
Inga, A., Storici, F., Darden, T. A., and Resnick, M. A. (2002). Differential transactivation by the p53
transcription factor is highly dependent on p53 level and Promotor target sequence. Mol Cell
Biol 22(24), 8612-25.
Inoue, H., Nojima, H., and Okayama, H. (1990). High efficiency transformation of Escherichia coli with
plasmids. Gene 96(1), 23-8.
Jacks, T., Remington, L., Williams, B. O., Schmitt, E. M., Halachmi, S., Bronson, R. T., and Weinberg,
R. A. (1994). Tumor spectrum analysis in p53-mutant mice. Curr Biol 4(1), 1-7.
Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., Li, B., Cavet, G.,
and Linsley, P. S. (2003). Expression profiling reveals off-target gene regulation by RNAi. Nat
Biotechnol 21(6), 635-7.
Jagus, R., Joshi, B., and Barber, G. N. (1999). PKR, apoptosis and cancer. Int J Biochem Cell Biol
31(1), 123-38.
Janus, F., Albrechtsen, N., Knippschild, U., Wiesmuller, L., Grosse, F., and Deppert, W. (1999).
Different regulation of the p53 core domain activities 3'-to-5' exonuclease and sequencespecific DNA binding. Mol Cell Biol 19(3), 2155-68.
Janz, C., and Wiesmuller, L. (2002). Wild-type p53 inhibits replication-associated homologous
recombination. Oncogene 21(38), 5929-33.
Jayaraman, J., and Prives, C. (1995). Activation of p53 sequence-specific DNA binding by short single
strands of DNA requires the p53 C-terminus. Cell 81(7), 1021-9.
Jayaraman, L., Murthy, K. G., Zhu, C., Curran, T., Xanthoudakis, S., and Prives, C. (1997).
Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev 11(5), 55870.
Jeffers, J. R., Parganas, E., Lee, Y., Yang, C., Wang, J., Brennan, J., MacLean, K. H., Han, J.,
Chittenden, T., Ihle, J. N., McKinnon, P. J., Cleveland, J. L., and Zambetti, G. P. (2003). Puma
is an essential mediator of p53-dependent and -independent apoptotic pathways. Cancer Cell
4(4), 321-8.
Jeffrey, P. D., Gorina, S., and Pavletich, N. P. (1995). Crystal structure of the tetramerization domain
of the p53 tumor suppressor at 1.7 angstroms. Science 267(5203), 1498-502.
Literatur
111
Jenkins, J. R., Rudge, K., and Currie, G. A. (1984). Cellular immortalization by a cDNA clone encoding
the transformation-associated phosphoprotein p53. Nature 312(5995), 651-4.
Jenuwein, T., Forrester, W. C., Fernandez-Herrero, L. A., Laible, G., Dull, M., and Grosschedl, R.
(1997). Extension of chromatin accessibility by nuclear matrix attachment regions. Nature
385(6613), 269-72.
Jimenez, G. S., Nister, M., Stommel, J. M., Beeche, M., Barcarse, E. A., Zhang, X. Q., O'Gorman, S.,
and Wahl, G. M. (2000). A transactivation-deficient mouse model provides insights into Trp53
regulation and function. Nat Genet 26(1), 37-43.
Jurgensmeier, J. M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D., and Reed, J. C. (1998). Bax
directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci U S A
95(9), 4997-5002.
Kaczmarek, L., Miller, M. R., Hammond, R. A., and Mercer, W. E. (1986). A microinjected monoclonal
antibody against human DNA polymerase-alpha inhibits DNA replication in human, hamster,
and mouse cell lines. J Biol Chem 261(23), 10802-7.
Kaeser, M. D., and Iggo, R. D. (2002). Chromatin immunoprecipitation analysis fails to support the
latency model for regulation of p53 DNA binding activity in vivo. Proc Natl Acad Sci U S A
99(1), 95-100. Epub 2001 Dec 26.
Kapic, A., Helmbold, H., Reimer, R., Klotzsche, O., Deppert, W., and Bohn, W. (2006). Cooperation
between p53 and p130(Rb2) in induction of cellular senescence. Cell Death Differ 13(2), 32434.
Kariko, K., Bhuyan, P., Capodici, J., and Weissman, D. (2004). Small interfering RNAs mediate
sequence-independent gene suppression and induce immune activation by signaling through
toll-like receptor 3. J Immunol 172(11), 6545-9.
Kastan, M. B., Zhan, Q., el-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S.,
Vogelstein, B., and Fornace, A. J., Jr. (1992). A mammalian cell cycle checkpoint pathway
utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71(4), 587-97.
Kawamura, M., Yamashita, T., Segawa, K., Kaneuchi, M., Shindoh, M., and Fujinaga, K. (1996). The
273rd codon mutants of p53 show growth modulation activities not correlated with p53-specific
transactivation activity. Oncogene 12(11), 2361-7.
Kawasaki, H., and Taira, K. (2003). Short hairpin type of dsRNAs that are controlled by tRNA(Val)
Promotor significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells.
Nucleic Acids Res 31(2), 700-7.
Kelavkar, U. P., and Badr, K. F. (1999). Effects of mutant p53 expression on human 15-lipoxygenasePromotor activity and murine 12/15-lipoxygenase gene expression: evidence that 15lipoxygenase is a mutator gene. Proc Natl Acad Sci U S A 96(8), 4378-83.
Kho, P. S., Wang, Z., Zhuang, L., Li, Y., Chew, J. L., Ng, H. H., Liu, E. T., and Yu, Q. (2004). p53regulated transcriptional program associated with genotoxic stress-induced apoptosis. J Biol
Chem 279(20), 21183-92.
Kieser, A., Weich, H. A., Brandner, G., Marme, D., and Kolch, W. (1994). Mutant p53 potentiates
protein kinase C induction of vascular endothelial growth factor expression. Oncogene 9(3),
963-9.
Kim, E., Albrechtsen, N., and Deppert, W. (1997). DNA-conformation is an important determinant of
sequence-specific DNA binding by tumor suppressor p53. Oncogene 15(7), 857-69.
Kim, E., and Deppert, W. (2004). Transcriptional activities of mutant p53: when mutations are more
than a loss. J Cell Biochem 93(5), 878-86.
Kim, E., and Deppert, W. (2007). Interactions of mutant p53 with DNA: guilt by association. Oncogene
26(15), 2185-90.
Kim, E., Gunther, W., Yoshizato, K., Meissner, H., Zapf, S., Nusing, R. M., Yamamoto, H., Van Meir,
E. G., Deppert, W., and Giese, A. (2003). Tumor suppressor p53 inhibits transcriptional
activation of invasion gene thromboxane synthase mediated by the proto-oncogenic factor ets1. Oncogene 22(49), 7716-27.
Knudson, A. G., Jr. (1986). Genetics of human cancer. J Cell Physiol Suppl 4, 7-11.
Ko, L. J., and Prives, C. (1996). p53: puzzle and paradigm. Genes Dev 10(9), 1054-72.
Koga, H., and Deppert, W. (2000). Identification of genomic DNA sequences bound by mutant p53
protein (Gly245-->Ser) in vivo. Oncogene 19(36), 4178-83.
Kohwi-Shigematsu, T., and Kohwi, Y. (1990). Torsional stress stabilizes extended base unpairing in
suppressor sites flanking immunoglobulin heavy chain enhancer. Biochemistry 29(41), 955160.
Koromilas, A. E., Roy, S., Barber, G. N., Katze, M. G., and Sonenberg, N. (1992). Malignant
transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science
257(5077), 1685-9.
Literatur
112
Krecic, A. M., and Swanson, M. S. (1999). hnRNP complexes: composition, structure, and function.
Curr Opin Cell Biol 11(3), 363-71.
Kress, M., May, E., Cassingena, R., and May, P. (1979). Simian virus 40-transformed cells express
new species of proteins precipitable by anti-simian virus 40 tumor serum. J Virol 31(2), 47283.
Kubbutat, M. H., Jones, S. N., and Vousden, K. H. (1997). Regulation of p53 stability by Mdm2. Nature
387(6630), 299-303.
Kugel, J. F., and Goodrich, J. A. (2000). A kinetic model for the early steps of RNA synthesis by
human RNA polymerase II. J Biol Chem 275(51), 40483-91.
Kugel, J. F., and Goodrich, J. A. (2002). Translocation after synthesis of a four-nucleotide RNA
commits RNA polymerase II to Promotor escape. Mol Cell Biol 22(3), 762-73.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227(5259), 680-5.
Lane, D. P., and Crawford, L. V. (1979). T antigen is bound to a host protein in SV40-transformed
cells. Nature 278(5701), 261-3.
Lang, G. A., Iwakuma, T., Suh, Y. A., Liu, G., Rao, V. A., Parant, J. M., Valentin-Vega, Y. A., Terzian,
T., Caldwell, L. C., Strong, L. C., El-Naggar, A. K., and Lozano, G. (2004). Gain of function of
a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell 119(6), 861-72.
Lanyi, A., Deb, D., Seymour, R. C., Ludes-Meyers, J. H., Subler, M. A., and Deb, S. (1998). 'Gain of
function' phenotype of tumor-derived mutant p53 requires the oligomerization/nonsequencespecific nucleic acid-binding domain. Oncogene 16(24), 3169-76.
Lasham, A., Moloney, S., Hale, T., Homer, C., Zhang, Y. F., Murison, J. G., Braithwaite, A. W., and
Watson, J. (2003). The Y-box-binding protein, YB1, is a potential negative regulator of the p53
tumor suppressor. J Biol Chem 278(37), 35516-23.
Lassus, P., Bertrand, C., Zugasti, O., Chambon, J. P., Soussi, T., Mathieu-Mahul, D., and Hibner, U.
(1999). Anti-apoptotic activity of p53 maps to the COOH-terminal domain and is retained in a
highly oncogenic natural mutant. Oncogene 18(33), 4699-709.
Le Beau, M. M., Westbrook, C. A., Diaz, M. O., Rowley, J. D., and Oren, M. (1985). Translocation of
the p53 gene in t(15;17) in acute promyelocytic leukaemia. Nature 316(6031), 826-8.
Lebedeva, I., and Stein, C. A. (2001). Antisense oligonucleotides: promise and reality. Annu Rev
Pharmacol Toxicol 41, 403-19.
Lee, Y. I., Lee, S., Das, G. C., Park, U. S., Park, S. M., and Lee, Y. I. (2000). Activation of the insulinlike growth factor II transcription by aflatoxin B1 induced p53 mutant 249 is caused by
activation of transcription complexes; implications for a gain-of-function during the formation of
hepatocellular carcinoma. Oncogene 19(33), 3717-26.
Leng, R. P., Lin, Y., Ma, W., Wu, H., Lemmers, B., Chung, S., Parant, J. M., Lozano, G., Hakem, R.,
and Benchimol, S. (2003). Pirh2, a p53-induced ubiquitin-protein ligase, promotes p53
degradation. Cell 112(6), 779-91.
Lengyel, P. (1987). Double-stranded RNA and interferon action. J Interferon Res 7(5), 511-9.
Lerat, E., and Semon, M. (2007). Influence of the transposable element neighborhood on human gene
expression in normal and tumor tissues. Gene 396(2), 303-11.
Levine, A. J. (1993). The tumor suppressor genes. Annu Rev Biochem 62, 623-51.
Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88(3), 323-31.
Levine, A. J., Momand, J., and Finlay, C. A. (1991). The p53 tumour suppressor gene. Nature
351(6326), 453-6.
Levine, A. J., Wu, M. C., Chang, A., Silver, A., Attiyeh, E. F., Lin, J., and Epstein, C. B. (1995). The
spectrum of mutations at the p53 locus. Evidence for tissue-specific mutagenesis, selection of
mutant alleles, and a "gain of function" phenotype. Ann N Y Acad Sci 768, 111-28.
Li, B., Murphy, K. L., Laucirica, R., Kittrell, F., Medina, D., and Rosen, J. M. (1998a). A transgenic
mouse model for mammary carcinogenesis. Oncogene 16(8), 997-1007.
Li, M., Chen, D., Shiloh, A., Luo, J., Nikolaev, A. Y., Qin, J., and Gu, W. (2002). Deubiquitination of
p53 by HAUSP is an important pathway for p53 stabilization. Nature 416(6881), 648-53.
Li, R., Sutphin, P. D., Schwartz, D., Matas, D., Almog, N., Wolkowicz, R., Goldfinger, N., Pei, H.,
Prokocimer, M., and Rotter, V. (1998b). Mutant p53 protein expression interferes with p53independent apoptotic pathways. Oncogene 16(25), 3269-77.
Li, R., Waga, S., Hannon, G. J., Beach, D., and Stillman, B. (1994). Differential effects by the p21 CDK
inhibitor on PCNA-dependent DNA replication and repair. Nature 371(6497), 534-7.
Li, Z. R., Hromchak, R., Mudipalli, A., and Bloch, A. (1998c). Tumor suppressor proteins as regulators
of cell differentiation. Cancer Res 58(19), 4282-7.
Lim, I. K., Lee, M. S., Ryu, M. S., Park, T. J., Fujiki, H., Eguchi, H., and Paik, W. K. (1998). Induction of
growth inhibition of 293 cells by downregulation of the cyclin E and cyclin-dependent kinase 4
proteins due to overexpression of TIS21. Mol Carcinog 23(1), 25-35.
Literatur
113
Lin, J., Blake, M., Tang, C., Zimmer, D., Rustandi, R. R., Weber, D. J., and Carrier, F. (2001).
Inhibition of p53 transcriptional activity by the S100B calcium-binding protein. J Biol Chem
276(37), 35037-41.
Lin, J., Chen, J., Elenbaas, B., and Levine, A. J. (1994). Several hydrophobic amino acids in the p53
amino-terminal domain are required for transcriptional activation, binding to mdm-2 and the
adenovirus 5 E1B 55-kD protein. Genes Dev 8(10), 1235-46.
Lin, T., Chao, C., Saito, S., Mazur, S. J., Murphy, M. E., Appella, E., and Xu, Y. (2005). p53 induces
differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol
7(2), 165-71.
Lin, Y., Ma, W., and Benchimol, S. (2000). Pidd, a new death-domain-containing protein, is induced by
p53 and promotes apoptosis. Nat Genet 26(1), 122-7.
Linke, S. P., Clarkin, K. C., Di Leonardo, A., Tsou, A., and Wahl, G. M. (1996). A reversible, p53dependent G0/G1 cell cycle arrest induced by ribonucleotide depletion in the absence of
detectable DNA damage. Genes Dev 10(8), 934-47.
Linzer, D. I., Maltzman, W., and Levine, A. J. (1979). The SV40 A gene product is required for the
production of a 54,000 MW cellular tumor antigen. Virology 98(2), 308-18.
Liu, G., McDonnell, T. J., Montes de Oca Luna, R., Kapoor, M., Mims, B., El-Naggar, A. K., and
Lozano, G. (2000). High metastatic potential in mice inheriting a targeted p53 missense
mutation. Proc Natl Acad Sci U S A 97(8), 4174-9.
Lo, K. W., Kogoy, J. M., and Pfister, K. K. (2007). The DYNLT3 light chain directly links cytoplasmic
dynein to a spindle checkpoint protein, Bub3. J Biol Chem 282(15), 11205-12.
Loeb, L. A. (1991). Mutator phenotype may be required for multistage carcinogenesis. Cancer Res
51(12), 3075-9.
Lowe, S. W., Schmitt, E. M., Smith, S. W., Osborne, B. A., and Jacks, T. (1993). p53 is required for
radiation-induced apoptosis in mouse thymocytes. Nature 362(6423), 847-9.
Lozano, G. (2007). The oncogenic roles of p53 mutants in mouse models. Curr Opin Genet Dev 17(1),
66-70.
Lu, H., and Levine, A. J. (1995). Human TAFII31 protein is a transcriptional coactivator of the p53
protein. Proc Natl Acad Sci U S A 92(11), 5154-8.
Ludes-Meyers, J. H., Subler, M. A., Shivakumar, C. V., Munoz, R. M., Jiang, P., Bigger, J. E., Brown,
D. R., Deb, S. P., and Deb, S. (1996). Transcriptional activation of the human epidermal
growth factor receptor Promotor by human p53. Mol Cell Biol 16(11), 6009-19.
Lunyak, V. V., Prefontaine, G. G., Nunez, E., Cramer, T., Ju, B. G., Ohgi, K. A., Hutt, K., Roy, R.,
Garcia-Diaz, A., Zhu, X., Yung, Y., Montoliu, L., Glass, C. K., and Rosenfeld, M. G. (2007).
Developmentally regulated activation of a SINE B2 repeat as a domain boundary in
organogenesis. Science 317(5835), 248-51.
Macleod, K. (2000). Tumor suppressor genes. Curr Opin Genet Dev 10(1), 81-93.
Malkin, D., Li, F. P., Strong, L. C., Fraumeni, J. F., Jr., Nelson, C. E., Kim, D. H., Kassel, J., Gryka, M.
A., Bischoff, F. Z., Tainsky, M. A., and et al. (1990). Germ line p53 mutations in a familial
syndrome of breast cancer, sarcomas, and other neoplasms. Science 250(4985), 1233-8.
Maltzman, W., and Czyzyk, L. (1984). UV irradiation stimulates levels of p53 cellular tumor antigen in
nontransformed mouse cells. Mol Cell Biol 4(9), 1689-94.
Manche, L., Green, S. R., Schmedt, C., and Mathews, M. B. (1992). Interactions between doublestranded RNA regulators and the protein kinase DAI. Mol Cell Biol 12(11), 5238-48.
Margulies, L., and Sehgal, P. B. (1993). Modulation of the human interleukin-6 Promotor (IL-6) and
transcription factor C/EBP beta (NF-IL6) activity by p53 species. J Biol Chem 268(20), 15096100.
Marin, M. C., and Kaelin, W. G., Jr. (2000). p63 and p73: old members of a new family. Biochim
Biophys Acta 1470(3), M93-M100.
Matas, D., Sigal, A., Stambolsky, P., Milyavsky, M., Weisz, L., Schwartz, D., Goldfinger, N., and
Rotter, V. (2001). Integrity of the N-terminal transcription domain of p53 is required for mutant
p53 interference with drug-induced apoptosis. Embo J 20(15), 4163-72.
Matsumoto, S., Miyagishi, M., Akashi, H., Nagai, R., and Taira, K. (2005). Analysis of double-stranded
RNA-induced apoptosis pathways using interferon-response noninducible small interfering
RNA expression vector library. J Biol Chem 280(27), 25687-96.
Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov, S., Diatchenko, L., and Chenchik, A.
(1999). Amplification of cDNA ends based on template-switching effect and step-out PCR.
Nucleic Acids Res 27(6), 1558-60.
Melendy, T., and Stillman, B. (1991). Purification of DNA polymerase delta as an essential simian
virus 40 DNA replication factor. J Biol Chem 266(3), 1942-9.
Literatur
114
Meurs, E., Chong, K., Galabru, J., Thomas, N. S., Kerr, I. M., Williams, B. R., and Hovanessian, A. G.
(1990). Molecular cloning and characterization of the human double-stranded RNA-activated
protein kinase induced by interferon. Cell 62(2), 379-90.
Meurs, E. F., Galabru, J., Barber, G. N., Katze, M. G., and Hovanessian, A. G. (1993). Tumor
suppressor function of the interferon-induced double-stranded RNA-activated protein kinase.
Proc Natl Acad Sci U S A 90(1), 232-6.
Midgley, C. A., and Lane, D. P. (1997). p53 protein stability in tumour cells is not determined by
mutation but is dependent on Mdm2 binding. Oncogene 15(10), 1179-89.
Mielke, C., Kohwi, Y., Kohwi-Shigematsu, T., and Bode, J. (1990). Hierarchical binding of DNA
fragments derived from scaffold-attached regions: correlation of properties in vitro and function
in vivo. Biochemistry 29(32), 7475-85.
Mignone, F., Gissi, C., Liuni, S., and Pesole, G. (2002). Untranslated regions of mRNAs. Genome Biol
3(3), REVIEWS0004.
Miller, S. J., Suthiphongchai, T., Zambetti, G. P., and Ewen, M. E. (2000). p53 binds selectively to the
5' untranslated region of cdk4, an RNA element necessary and sufficient for transforming
growth factor beta- and p53-mediated translational inhibition of cdk4. Mol Cell Biol 20(22),
8420-31.
Milner, J., and Medcalf, E. A. (1991). Cotranslation of activated mutant p53 with wild type drives the
wild-type p53 protein into the mutant conformation. Cell 65(5), 765-74.
Miyashita, T., Krajewski, S., Krajewska, M., Wang, H. G., Lin, H. K., Liebermann, D. A., Hoffman, B.,
and Reed, J. C. (1994). Tumor suppressor p53 is a regulator of bcl-2 and bax gene
expression in vitro and in vivo. Oncogene 9(6), 1799-805.
Miyashita, T., and Reed, J. C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the
human bax gene. Cell 80(2), 293-9.
Moll, U. M., Marchenko, N., and Zhang, X. K. (2006). p53 and Nur77/TR3 - transcription factors that
directly target mitochondria for cell death induction. Oncogene 25(34), 4725-43.
Momand, J., Zambetti, G. P., Olson, D. C., George, D., and Levine, A. J. (1992). The mdm-2
oncogene product forms a complex with the p53 protein and inhibits p53-mediated
transactivation. Cell 69(7), 1237-45.
Monti, P., Campomenosi, P., Ciribilli, Y., Iannone, R., Aprile, A., Inga, A., Tada, M., Menichini, P.,
Abbondandolo, A., and Fronza, G. (2003). Characterization of the p53 mutants ability to inhibit
p73 beta transactivation using a yeast-based functional assay. Oncogene 22(34), 5252-60.
Mosner, J., Mummenbrauer, T., Bauer, C., Sczakiel, G., Grosse, F., and Deppert, W. (1995). Negative
feedback regulation of wild-type p53 biosynthesis. Embo J 14(18), 4442-9.
Muller, B. F., Paulsen, D., and Deppert, W. (1996). Specific binding of MAR/SAR DNA-elements by
mutant p53. Oncogene 12(9), 1941-52.
Mummenbrauer, T., Janus, F., Muller, B., Wiesmuller, L., Deppert, W., and Grosse, F. (1996). p53
Protein exhibits 3'-to-5' exonuclease activity. Cell 85(7), 1089-99.
Nakano, K., and Vousden, K. H. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Mol
Cell 7(3), 683-94.
Nanduri, S., Carpick, B. W., Yang, Y., Williams, B. R., and Qin, J. (1998). Structure of the doublestranded RNA-binding domain of the protein kinase PKR reveals the molecular basis of its
dsRNA-mediated activation. Embo J 17(18), 5458-65.
Neuhoff, V., Stamm, R., Pardowitz, I., Arold, N., Ehrhardt, W., and Taube, D. (1990). Essential
problems in quantification of proteins following colloidal staining with coomassie brilliant blue
dyes in polyacrylamide gels, and their solution. Electrophoresis 11(2), 101-17.
Nie, Y., Li, H. H., Bula, C. M., and Liu, X. (2000). Stimulation of p53 DNA binding by c-Abl requires the
p53 C terminus and tetramerization. Mol Cell Biol 20(3), 741-8.
Nigro, J. M., Baker, S. J., Preisinger, A. C., Jessup, J. M., Hostetter, R., Cleary, K., Bigner, S. H.,
Davidson, N., Baylin, S., Devilee, P., and et al. (1989). Mutations in the p53 gene occur in
diverse human tumour types. Nature 342(6250), 705-8.
Nussbaum, J. M., Gunnery, S., and Mathews, M. B. (2002). The 3'-untranslated regions of cytoskeletal
muscle mRNAs inhibit translation by activating the double-stranded RNA-dependent protein
kinase PKR. Nucleic Acids Res 30(5), 1205-12.
Oberosler, P., Hloch, P., Ramsperger, U., and Stahl, H. (1993). p53-catalyzed annealing of
complementary single-stranded nucleic acids. Embo J 12(6), 2389-96.
Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T., and
Tanaka, N. (2000a). Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of
p53-induced apoptosis. Science 288(5468), 1053-8.
Oda, K., Arakawa, H., Tanaka, T., Matsuda, K., Tanikawa, C., Mori, T., Nishimori, H., Tamai, K.,
Tokino, T., Nakamura, Y., and Taya, Y. (2000b). p53AIP1, a potential mediator of p53dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell 102(6), 849-62.
Literatur
115
Ohnishi, T., Wang, X., Ohnishi, K., Matsumoto, H., and Takahashi, A. (1996). p53-dependent
induction of WAF1 by heat treatment in human glioblastoma cells. J Biol Chem 271(24),
14510-3.
Okamoto, K., Li, H., Jensen, M. R., Zhang, T., Taya, Y., Thorgeirsson, S. S., and Prives, C. (2002).
Cyclin G recruits PP2A to dephosphorylate Mdm2. Mol Cell 9(4), 761-71.
Okamura, S., Arakawa, H., Tanaka, T., Nakanishi, H., Ng, C. C., Taya, Y., Monden, M., and
Nakamura, Y. (2001). p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis.
Mol Cell 8(1), 85-94.
Okorokov, A. L., Ponchel, F., and Milner, J. (1997). Induced N- and C-terminal cleavage of p53: a core
fragment of p53, generated by interaction with damaged DNA, promotes cleavage of the Nterminus of full-length p53, whereas ssDNA induces C-terminal cleavage of p53. Embo J
16(19), 6008-17.
Old, L. J., Boyse, E. A., Clarke, D. A. & Carswell, E. (1962) Immunologie Studies on Chemically
Induced Tumors. Ann. N.Y. Acad. Sci. 101, 80-106.
Oliner, J. D., Pietenpol, J. A., Thiagalingam, S., Gyuris, J., Kinzler, K. W., and Vogelstein, B. (1993).
Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53. Nature
362(6423), 857-60.
Olive, K. P., Tuveson, D. A., Ruhe, Z. C., Yin, B., Willis, N. A., Bronson, R. T., Crowley, D., and Jacks,
T. (2004). Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell
119(6), 847-60.
Olivier, M., Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C., and Hainaut, P. (2002). The IARC TP53
database: new online mutation analysis and recommendations to users. Hum Mutat 19(6),
607-14.
Oren, M. (1985). The p53 cellular tumor antigen: gene structure, expression and protein properties.
Biochim Biophys Acta 823(1), 67-78.
Oren, M., Maltzman, W., and Levine, A. J. (1981). Post-translational regulation of the 54K cellular
tumor antigen in normal and transformed cells. Mol Cell Biol 1(2), 101-10.
Owen-Schaub, L. B., Zhang, W., Cusack, J. C., Angelo, L. S., Santee, S. M., Fujiwara, T., Roth, J. A.,
Deisseroth, A. B., Zhang, W. W., Kruzel, E., and et al. (1995). Wild-type human p53 and a
temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol 15(6), 3032-40.
Parris, G. E. (2006). The cell clone ecology hypothesis and the cell fusion model of cancer
progression and metastasis: history and experimental support. Med Hypotheses 66(1), 76-83.
Passer, B. J., Nancy-Portebois, V., Amzallag, N., Prieur, S., Cans, C., Roborel de Climens, A., Fiucci,
G., Bouvard, V., Tuynder, M., Susini, L., Morchoisne, S., Crible, V., Lespagnol, A., Dausset,
J., Oren, M., Amson, R., and Telerman, A. (2003). The p53-inducible TSAP6 gene product
regulates apoptosis and the cell cycle and interacts with Nix and the Myt1 kinase. Proc Natl
Acad Sci U S A 100(5), 2284-9.
Pastorcic, M., and Das, H. K. (2000). Regulation of transcription of the human presenilin-1 gene by ets
transcription factors and the p53 protooncogene. J Biol Chem 275(45), 34938-45.
Patschinsky, T., and Deppert, W. (1990). Phosphorylation of p53 in primary, immortalised and
transformed Balb/c mouse cells. Oncogene 5(7), 1071-6.
Peng, C. Y., Graves, P. R., Thoma, R. S., Wu, Z., Shaw, A. S., and Piwnica-Worms, H. (1997). Mitotic
and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C
on serine-216. Science 277(5331), 1501-5.
Perry, M. E., Piette, J., Zawadzki, J. A., Harvey, D., and Levine, A. J. (1993). The mdm-2 gene is
induced in response to UV light in a p53-dependent manner. Proc Natl Acad Sci U S A 90(24),
11623-7.
Persengiev, S. P., Zhu, X., and Green, M. R. (2004). Nonspecific, concentration-dependent stimulation
and repression of mammalian gene expression by small interfering RNAs (siRNAs). Rna
10(1), 12-8.
Petitjean, A., Achatz, M. I., Borresen-Dale, A. L., Hainaut, P., and Olivier, M. (2007). TP53 mutations
in human cancers: functional selection and impact on cancer prognosis and outcomes.
Oncogene 26(15), 2157-65.
Pinhasi-Kimhi, O., Michalovitz, D., Ben-Zeev, A., and Oren, M. (1986). Specific interaction between
the p53 cellular tumour antigen and major heat shock proteins. Nature 320(6058), 182-4.
Poon, R. Y., Jiang, W., Toyoshima, H., and Hunter, T. (1996). Cyclin-dependent kinases are
inactivated by a combination of p21 and Thr-14/Tyr-15 phosphorylation after UV-induced DNA
damage. J Biol Chem 271(22), 13283-91.
Preuss, U., Kreutzfeld, R., and Scheidtmann, K. H. (2000). Tumor-derived p53 mutant C174Y is a
gain-of-function mutant which activates the fos Promotor and enhances colony formation. Int J
Cancer 88(2), 162-71.
Prives, C., and Hall, P. A. (1999). The p53 pathway. J Pathol 187(1), 112-26.
Literatur
116
Purdie, C. A., Harrison, D. J., Peter, A., Dobbie, L., White, S., Howie, S. E., Salter, D. M., Bird, C. C.,
Wyllie, A. H., Hooper, M. L., and et al. (1994). Tumour incidence, spectrum and ploidy in mice
with a large deletion in the p53 gene. Oncogene 9(2), 603-9.
Quackenbush, J. (2001). Computational analysis of microarray data. Nat Rev Genet 2(6), 418-27.
Rahman-Roblick, R., Roblick, U. J., Hellman, U., Conrotto, P., Liu, T., Becker, S., Hirschberg, D.,
Jornvall, H., Auer, G., and Wiman, K. G. (2007). p53 targets identified by protein expression
profiling. Proc Natl Acad Sci U S A 104(13), 5401-6.
Rastinejad, F., and Blau, H. M. (1993). Genetic complementation reveals a novel regulatory role for 3'
untranslated regions in growth and differentiation. Cell 72(6), 903-17.
Rastinejad, F., Conboy, M. J., Rando, T. A., and Blau, H. M. (1993). Tumor suppression by RNA from
the 3' untranslated region of alpha-tropomyosin. Cell 75(6), 1107-17.
Raycroft, L., Wu, H. Y., and Lozano, G. (1990). Transcriptional activation by wild-type but not
transforming mutants of the p53 anti-oncogene. Science 249(4972), 1049-51.
Reynolds, A., Anderson, E. M., Vermeulen, A., Fedorov, Y., Robinson, K., Leake, D., Karpilow, J.,
Marshall, W. S., and Khvorova, A. (2006). Induction of the interferon response by siRNA is cell
type- and duplex length-dependent. Rna 12(6), 988-93.
Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P., and Hay, R. T. (1999). SUMO1 modification activates the transcriptional response of p53. Embo J 18(22), 6455-61.
Rohaly, G., Chemnitz, J., Dehde, S., Nunez, A. M., Heukeshoven, J., Deppert, W., and Dornreiter, I.
(2005). A novel human p53 isoform is an essential element of the ATR-intra-S phase
checkpoint. Cell 122(1), 21-32.
Rotter, V., Wolf, D., Pravtcheva, D., and Ruddle, F. H. (1984). Chromosomal assignment of the murine
gene encoding the transformation-related protein p53. Mol Cell Biol 4(2), 383-5.
Rouault, J. P., Falette, N., Guehenneux, F., Guillot, C., Rimokh, R., Wang, Q., Berthet, C., MoyretLalle, C., Savatier, P., Pain, B., Shaw, P., Berger, R., Samarut, J., Magaud, J. P., Ozturk, M.,
Samarut, C., and Puisieux, A. (1996). Identification of BTG2, an antiproliferative p53dependent component of the DNA damage cellular response pathway. Nat Genet 14(4), 4826.
Rubbi, C. P., and Milner, J. (2003). p53 is a chromatin accessibility factor for nucleotide excision repair
of DNA damage. Embo J 22(4), 975-86.
Ryan, J. J., Danish, R., Gottlieb, C. A., and Clarke, M. F. (1993). Cell cycle analysis of p53-induced
cell death in murine erythroleukemia cells. Mol Cell Biol 13(1), 711-9.
Sadler, A. J., and Williams, B. R. (2007). Structure and function of the protein kinase R. Curr Top
Microbiol Immunol 316, 253-92.
Samad, A., and Carroll, R. B. (1991). The tumor suppressor p53 is bound to RNA by a stable covalent
linkage. Mol Cell Biol 11(3), 1598-606.
Sampath, J., Sun, D., Kidd, V. J., Grenet, J., Gandhi, A., Shapiro, L. H., Wang, Q., Zambetti, G. P.,
and Schuetz, J. D. (2001). Mutant p53 cooperates with ETS and selectively up-regulates
human MDR1 not MRP1. J Biol Chem 276(42), 39359-67. Epub 2001 Aug 1.
Schmitt, E., Paquet, C., Beauchemin, M., and Bertrand, R. (2007). DNA-damage response network at
the crossroads of cell-cycle checkpoints, cellular senescence and apoptosis. J Zhejiang Univ
Sci B 8(6), 377-97.
Schuler, M., Bossy-Wetzel, E., Goldstein, J. C., Fitzgerald, P., and Green, D. R. (2000). p53 induces
apoptosis by caspase activation through mitochondrial cytochrome c release. J Biol Chem
275(10), 7337-42.
Scian, M. J., Stagliano, K. E., Anderson, M. A., Hassan, S., Bowman, M., Miles, M. F., Deb, S. P., and
Deb, S. (2005). Tumor-derived p53 mutants induce NF-kappaB2 gene expression. Mol Cell
Biol 25(22), 10097-110.
Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D. N., and Fesik, S. W. (2003). Specificity of
short interfering RNA determined through gene expression signatures. Proc Natl Acad Sci U S
A 100(11), 6347-52.
Shabalina, S. A., and Spiridonov, N. A. (2004). The mammalian transcriptome and the function of noncoding DNA sequences. Genome Biol 5(4), 105.
Sharpless, N. E., and DePinho, R. A. (1999). The INK4A/ARF locus and its two gene products. Curr
Opin Genet Dev 9(1), 22-30.
Shaulsky, G., Goldfinger, N., and Rotter, V. (1991). Alterations in tumor development in vivo mediated
by expression of wild type or mutant p53 proteins. Cancer Res 51(19), 5232-7.
Shaulsky, G., Goldfinger, N., Tosky, M. S., Levine, A. J., and Rotter, V. (1991). Nuclear localization is
essential for the activity of p53 protein. Oncogene 6(11), 2055-65.
Shaw, P., Bovey, R., Tardy, S., Sahli, R., Sordat, B., and Costa, J. (1992). Induction of apoptosis by
wild-type p53 in a human colon tumor-derived cell line. Proc Natl Acad Sci U S A 89(10),
4495-9.
Literatur
117
Sherr, C. J. (1998). Tumor surveillance via the ARF-p53 pathway. Genes Dev 12(19), 2984-91.
Sherr, C. J. (2001). The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2(10), 7317.
Shetty, S., Velusamy, T., Idell, S., Shetty, P., Mazar, A. P., Bhandary, Y. P., and Shetty, R. S. (2007).
Regulation of urokinase receptor expression by p53: novel role in stabilization of uPAR
mRNA. Mol Cell Biol 27(16), 5607-18.
Shi, H., Hoffman, B. E., and Lis, J. T. (1999). RNA aptamers as effective protein antagonists in a
multicellular organism. Proc Natl Acad Sci U S A 96(18), 10033-8.
Shibue, T., Takeda, K., Oda, E., Tanaka, H., Murasawa, H., Takaoka, A., Morishita, Y., Akira, S.,
Taniguchi, T., and Tanaka, N. (2003). Integral role of Noxa in p53-mediated apoptotic
response. Genes Dev 17(18), 2233-8.
Shohat, O., Greenberg, M., Reisman, D., Oren, M., and Rotter, V. (1987). Inhibition of cell growth
mediated by plasmids encoding p53 anti-sense. Oncogene 1(3), 277-83.
Shyu, A. B., and Wilkinson, M. F. (2000). The double lives of shuttling mRNA binding proteins. Cell
102(2), 135-8.
Sjoblom, T., Jones, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., Mandelker, D., Leary, R. J.,
Ptak, J., Silliman, N., Szabo, S., Buckhaults, P., Farrell, C., Meeh, P., Markowitz, S. D., Willis,
J., Dawson, D., Willson, J. K., Gazdar, A. F., Hartigan, J., Wu, L., Liu, C., Parmigiani, G., Park,
B. H., Bachman, K. E., Papadopoulos, N., Vogelstein, B., Kinzler, K. W., and Velculescu, V. E.
(2006). The consensus coding sequences of human breast and colorectal cancers. Science
314(5797), 268-74.
Sledz, C. A., Holko, M., de Veer, M. J., Silverman, R. H., and Williams, B. R. (2003). Activation of the
interferon system by short-interfering RNAs. Nat Cell Biol 5(9), 834-9.
Slingerland, J. M., Jenkins, J. R., and Benchimol, S. (1993). The transforming and suppressor
functions of p53 alleles: effects of mutations that disrupt phosphorylation, oligomerization and
nuclear translocation. Embo J 12(3), 1029-37.
Smith, M. L., Chen, I. T., Zhan, Q., Bae, I., Chen, C. Y., Gilmer, T. M., Kastan, M. B., O'Connor, P. M.,
and Fornace, A. J., Jr. (1994). Interaction of the p53-regulated protein Gadd45 with
proliferating cell nuclear antigen. Science 266(5189), 1376-80.
Soussi, T. (2007). p53 alterations in human cancer: more questions than answers. Oncogene 26(15),
2145-56.
Soussi, T., and Beroud, C. (2001). Assessing TP53 status in human tumours to evaluate clinical
outcome. Nat Rev Cancer 1(3), 233-40.
Soussi, T., Ishioka, C., Claustres, M., and Beroud, C. (2006). Locus-specific mutation databases:
pitfalls and good practice based on the p53 experience. Nat Rev Cancer 6(1), 83-90.
Stein, C. A. (1995). Does antisense exist? Nat Med 1(11), 1119-21.
Steinmeyer, K., and Deppert, W. (1988). DNA binding properties of murine p53. Oncogene 3(5), 5017.
Steinmeyer, K., Maacke, H., and Deppert, W. (1990). Cell cycle control by p53 in normal (3T3) and
chemically transformed (Meth A) mouse cells. I. Regulation of p53 expression. Oncogene
5(11), 1691-9.
Stiewe, T. (2007). The p53 family in differentiation and tumorigenesis. Nat Rev Cancer 7(3), 165-8.
Stojdl, D. F., Lichty, B., Knowles, S., Marius, R., Atkins, H., Sonenberg, N., and Bell, J. C. (2000).
Exploiting tumor-specific defects in the interferon pathway with a previously unknown oncolytic
virus. Nat Med 6(7), 821-5.
Stott, F. J., Bates, S., James, M. C., McConnell, B. B., Starborg, M., Brookes, S., Palmero, I., Ryan,
K., Hara, E., Vousden, K. H., and Peters, G. (1998). The alternative product from the human
CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2.
Embo J 17(17), 5001-14.
Strano, S., and Blandino, G. (2003). p73-mediated chemosensitivity: a preferential target of oncogenic
mutant p53. Cell Cycle 2(4), 348-9.
Strano, S., Dell'Orso, S., Di Agostino, S., Fontemaggi, G., Sacchi, A., and Blandino, G. (2007). Mutant
p53: an oncogenic transcription factor. Oncogene 26(15), 2212-9.
Strano, S., Fontemaggi, G., Costanzo, A., Rizzo, M. G., Monti, O., Baccarini, A., Del Sal, G., Levrero,
M., Sacchi, A., Oren, M., and Blandino, G. (2002). Physical interaction with human tumorderived p53 mutants inhibits p63 activities. J Biol Chem 277(21), 18817-26.
Sturzbecher, H. W., Brain, R., Addison, C., Rudge, K., Remm, M., Grimaldi, M., Keenan, E., and
Jenkins, J. R. (1992). A C-terminal alpha-helix plus basic region motif is the major structural
determinant of p53 tetramerization. Oncogene 7(8), 1513-23.
Sugimura, T., Terada, M., Yokota, J., Hirohashi, S., and Wakabayashi, K. (1992). Multiple genetic
alterations in human carcinogenesis. Environ Health Perspect 98, 5-12.
Literatur
118
Susse, S., Janz, C., Janus, F., Deppert, W., and Wiesmuller, L. (2000). Role of heteroduplex joints in
the functional interactions between human Rad51 and wild-type p53. Oncogene 19(39), 450012.
Takekawa, M., Adachi, M., Nakahata, A., Nakayama, I., Itoh, F., Tsukuda, H., Taya, Y., and Imai, K.
(2000). p53-inducible wip1 phosphatase mediates a negative feedback regulation of p38
MAPK-p53 signaling in response to UV radiation. Embo J 19(23), 6517-26.
Takenaka, I., Morin, F., Seizinger, B. R., and Kley, N. (1995). Regulation of the sequence-specific
DNA binding function of p53 by protein kinase C and protein phosphatases. J Biol Chem
270(10), 5405-11.
Tamayo, P., Slonim, D., Mesirov, J., Zhu, Q., Kitareewan, S., Dmitrovsky, E., Lander, E. S., and
Golub, T. R. (1999). Interpreting patterns of gene expression with self-organizing maps:
methods and application to hematopoietic differentiation. Proc Natl Acad Sci U S A 96(6),
2907-12.
Tanikawa, C., Matsuda, K., Fukuda, S., Nakamura, Y., and Arakawa, H. (2003). p53RDL1 regulates
p53-dependent apoptosis. Nat Cell Biol 5(3), 216-23.
Thut, C. J., Chen, J. L., Klemm, R., and Tjian, R. (1995). p53 transcriptional activation mediated by
coactivators TAFII40 and TAFII60. Science 267(5194), 100-4.
Tsutsumi-Ishii, Y., Tadokoro, K., Hanaoka, F., and Tsuchida, N. (1995). Response of heat shock
element within the human HSP70 Promotor to mutated p53 genes. Cell Growth Differ 6(1), 18.
Ueba, T., Nosaka, T., Takahashi, J. A., Shibata, F., Florkiewicz, R. Z., Vogelstein, B., Oda, Y., Kikuchi,
H., and Hatanaka, M. (1994). Transcriptional regulation of basic fibroblast growth factor gene
by p53 in human glioblastoma and hepatocellular carcinoma cells. Proc Natl Acad Sci U S A
91(19), 9009-13.
Varley, J. M., McGown, G., Thorncroft, M., Santibanez-Koref, M. F., Kelsey, A. M., Tricker, K. J.,
Evans, D. G., and Birch, J. M. (1997). Germ-line mutations of TP53 in Li-Fraumeni families: an
extended study of 39 families. Cancer Res 57(15), 3245-52.
Venkatachalam, S., and Donehower, L. A. (1998). Murine tumor suppressor models. Mutat Res 400(12), 391-407.
Venkatachalam, S., Tyner, S. D., Pickering, C. R., Boley, S., Recio, L., French, J. E., and Donehower,
L. A. (2001). Is p53 haploinsufficient for tumor suppression? Implications for the p53+/- mouse
model in carcinogenicity testing. Toxicol Pathol 29 Suppl, 147-54.
Villunger, A., Michalak, E. M., Coultas, L., Mullauer, F., Bock, G., Ausserlechner, M. J., Adams, J. M.,
and Strasser, A. (2003). p53- and drug-induced apoptotic responses mediated by BH3-only
proteins puma and noxa. Science 302(5647), 1036-8.
Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura,
Y., White, R., Smits, A. M., and Bos, J. L. (1988). Genetic alterations during colorectal-tumor
development. N Engl J Med 319(9), 525-32.
Vogelstein, B., Lane, D., and Levine, A. J. (2000). Surfing the p53 network. Nature 408(6810), 307-10.
Waga, S., Hannon, G. J., Beach, D., and Stillman, B. (1994). The p21 inhibitor of cyclin-dependent
kinases controls DNA replication by interaction with PCNA. Nature 369(6481), 574-8.
Waldman, T., Kinzler, K. W., and Vogelstein, B. (1995). p21 is necessary for the p53-mediated G1
arrest in human cancer cells. Cancer Res 55(22), 5187-90.
Wallace-Brodeur, R. R., and Lowe, S. W. (1999). Clinical implications of p53 mutations. Cell Mol Life
Sci 55(1), 64-75.
Walter, K., Warnecke, G., Bowater, R., Deppert, W., and Kim, E. (2005). tumor suppressor p53 binds
with high affinity to CTG.CAG trinucleotide repeats and induces topological alterations in
mismatched duplexes. J Biol Chem 280(52), 42497-507.
Wang, X. J., Greenhalgh, D. A., Jiang, A., He, D., Zhong, L., Brinkley, B. R., and Roop, D. R. (1998a).
Analysis of centrosome abnormalities and angiogenesis in epidermal-targeted p53172H
mutant and p53-knockout mice after chemical carcinogenesis: evidence for a gain of function.
Mol Carcinog 23(3), 185-92.
Wang, X. J., Greenhalgh, D. A., Jiang, A., He, D., Zhong, L., Medina, D., Brinkley, B. R., and Roop, D.
R. (1998b). Expression of a p53 mutant in the epidermis of transgenic mice accelerates
chemical carcinogenesis. Oncogene 17(1), 35-45.
Waterman, M. J., Stavridi, E. S., Waterman, J. L., and Halazonetis, T. D. (1998). ATM-dependent
activation of p53 involves dephosphorylation and association with 14-3-3 proteins. Nat Genet
19(2), 175-8.
Waterston, R. H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P., Agarwala, R.,
Ainscough, R., Alexandersson, M., An, P., Antonarakis, S. E., Attwood, J., Baertsch, R., et al.
(2002). Initial sequencing and comparative analysis of the mouse genome. Nature 420(6915),
520-62.
Literatur
119
Wei, C. L., Wu, Q., Vega, V. B., Chiu, K. P., Ng, P., Zhang, T., Shahab, A., Yong, H. C., Fu, Y., Weng,
Z., Liu, J., Zhao, X. D., Chew, J. L., Lee, Y. L., Kuznetsov, V. A., Sung, W. K., Miller, L. D.,
Lim, B., Liu, E. T., Yu, Q., Ng, H. H., and Ruan, Y. (2006). A global map of p53 transcriptionfactor binding sites in the human genome. Cell 124(1), 207-19.
Weighardt, F., Biamonti, G., and Riva, S. (1996). The roles of heterogeneous nuclear
ribonucleoproteins (hnRNP) in RNA metabolism. Bioessays 18(9), 747-56.
Weinberg, R. A. (1989). Oncogenes, antioncogenes, and the molecular bases of multistep
carcinogenesis. Cancer Res 49(14), 3713-21.
Weissker, S. N., Muller, B. F., Homfeld, A., and Deppert, W. (1992). Specific and complex interactions
of murine p53 with DNA. Oncogene 7(10), 1921-32.
Weissman, I. (2005). Stem cell research: paths to cancer therapies and regenerative medicine. Jama
294(11), 1359-66.
Weisz, L., Oren, M., and Rotter, V. (2007). Transcription regulation by mutant p53. Oncogene 26(15),
2202-11.
Werner, H., Karnieli, E., Rauscher, F. J., and LeRoith, D. (1996). Wild-type and mutant p53
differentially regulate transcription of the insulin-like growth factor I receptor gene. Proc Natl
Acad Sci U S A 93(16), 8318-23.
White, R. J. (2005). RNA polymerases I and III, growth control and cancer. Nat Rev Mol Cell Biol 6(1),
69-78.
Will, K., Warnecke, G., Albrechtsen, N., Boulikas, T., and Deppert, W. (1998a). High affinity MAR-DNA
binding is a common property of murine and human mutant p53. J Cell Biochem 69(3), 26070.
Will, K., Warnecke, G., Wiesmuller, L., and Deppert, W. (1998b). Specific interaction of mutant p53
with regions of matrix attachment region DNA elements (MARs) with a high potential for baseunpairing. Proc Natl Acad Sci U S A 95(23), 13681-6.
Williams, B. R. (1999). PKR; a sentinel kinase for cellular stress. Oncogene 18(45), 6112-20.
Workman, J. L., and Kingston, R. E. (1998). Alteration of nucleosome structure as a mechanism of
transcriptional regulation. Annu Rev Biochem 67, 545-79.
Wu, X., Bayle, J. H., Olson, D., and Levine, A. J. (1993). The p53-mdm-2 autoregulatory feedback
loop. Genes Dev 7(7A), 1126-32.
Xiong, Y., Hannon, G. J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D. (1993). p21 is a
universal inhibitor of cyclin kinases. Nature 366(6456), 701-4.
Yamauchi, Y., Kobayashi, M., and Tanaka, A. (1996). Application of a dicistronic mRNA expression
vector to antisense RNA expression in mammalian cells. Antisense Nucleic Acid Drug Dev
6(4), 305-9.
Yang, X., Pater, A., and Tang, S. C. (1999). Cloning and characterization of the human BAG-1 gene
Promotor: upregulation by tumor-derived p53 mutants. Oncogene 18(32), 4546-53.
Yang, Z., Ro, S., and Rannala, B. (2003). Likelihood models of somatic mutation and codon
substitution in cancer genes. Genetics 165(2), 695-705.
Yang, Z., Tulu, U. S., Wadsworth, P., and Rieder, C. L. (2007). Kinetochore dynein is required for
chromosome motion and congression independent of the spindle checkpoint. Curr Biol 17(11),
973-80.
Yeh, T. Y., Chuang, J. Z., and Sung, C. H. (2005). Dynein light chain rp3 acts as a nuclear matrixassociated transcriptional modulator in a dynein-independent pathway. J Cell Sci 118(Pt 15),
3431-43.
Yin, Y., Liu, Y. X., Jin, Y. J., Hall, E. J., and Barrett, J. C. (2003). PAC1 phosphatase is a transcription
target of p53 in signalling apoptosis and growth suppression. Nature 422(6931), 527-31.
Yonish-Rouach, E., Resnitzky, D., Lotem, J., Sachs, L., Kimchi, A., and Oren, M. (1991). Wild-type
p53 induces apoptosis of myeloid leukaemic cells that is inhibited by interleukin-6. Nature
352(6333), 345-7.
Yoon, H., Liyanarachchi, S., Wright, F. A., Davuluri, R., Lockman, J. C., de la Chapelle, A., and
Pellegata, N. S. (2002). Gene expression profiling of isogenic cells with different TP53 gene
dosage reveals numerous genes that are affected by TP53 dosage and identifies CSPG2 as a
direct target of p53. Proc Natl Acad Sci U S A 99(24), 15632-7.
Yu, J., Zhang, L., Hwang, P. M., Kinzler, K. W., and Vogelstein, B. (2001). PUMA induces the rapid
apoptosis of colorectal cancer cells. Mol Cell 7(3), 673-82.
Zalcenstein, A., Stambolsky, P., Weisz, L., Muller, M., Wallach, D., Goncharov, T. M., Krammer, P. H.,
Rotter, V., and Oren, M. (2003). Mutant p53 gain of function: repression of CD95(Fas/APO-1)
gene expression by tumor-associated p53 mutants. Oncogene 22(36), 5667-76.
Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: double-stranded RNA directs
the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101(1), 25-33.
Literatur
120
Zerrahn, J., Deppert, W., Weidemann, D., Patschinsky, T., Richards, F., and Milner, J. (1992).
Correlation between the conformational phenotype of p53 and its subcellular location.
Oncogene 7(7), 1371-81.
Zhan, Q., Antinore, M. J., Wang, X. W., Carrier, F., Smith, M. L., Harris, C. C., and Fornace, A. J., Jr.
(1999). Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53regulated protein Gadd45. Oncogene 18(18), 2892-900.
Zhang, Y. F., Homer, C., Edwards, S. J., Hananeia, L., Lasham, A., Royds, J., Sheard, P., and
Braithwaite, A. W. (2003). Nuclear localization of Y-box factor YB1 requires wild-type p53.
Oncogene 22(18), 2782-94.
Zhang, Z., Weinschenk, T., Guo, K., and Schluesener, H. J. (2006). siRNA binding proteins of
microglial cells: PKR is an unanticipated ligand. J Cell Biochem 97(6), 1217-29.
Zhu, J., and Chen, X. (2000). MCG10, a novel p53 target gene that encodes a KH domain RNAbinding protein, is capable of inducing apoptosis and cell cycle arrest in G(2)-M. Mol Cell Biol
20(15), 5602-18.
Zink, D., Mayr, C., Janz, C., and Wiesmuller, L. (2002). Association of p53 and MSH2 with
recombinative repair complexes during S phase. Oncogene 21(31), 4788-800.
Anhang
121
7 Anhang
7.1 Liste der durch ChIP-Seq identifizierten DNA-Fragmente
154 DNA-Fragmente wurden mithilfe des Online-Programms Blat (http://genome.ucsc.edu/cgibin/hgBlat) auf Chromosomen (Mouse March 2005 (mm6) assembly) lokalisiert.
DNAFragment
XM3-40
SM2-27
XM3-5
XM2-32
SM2-40
XM2-21
SM2-32A
XM2-51
SM3-14
XM3-18
XM2-2B
XM2-26
SM2-47
SM3-1
SM3-10
SM3-28
SM2-36
SM2-32B
XM3-39
SM2-30
SM3-31
XM3-8
XM2-9
XM2-6
SM2-44
XM3-45
SM2-42
XM2-19
SM2-34
SM2-48
XM3-16
XM3-47
SM2-3A
XM2-17
SM3-18
XM2-16
SM3-19
XM3-48
XM2-39
XM3-14
SM2-19
XM3-33
Genomlokalisation
chr1:100922902-100923391
chr1:110872710-110873292
chr1:115904942-115905360
chr1:119281235-119281493
chr1:130301581-130302129
chr1:155072699-155072824
chr1:17263950-17264285
chr1:178802679-178803148
chr1:181243523-181243875
chr1:190421479-190421935
chr1:192831416-192831683
chr1:22107150-22107504
chr1:41822664-41822809
chr1:64950547-64950727
chr10:87923498-87924020
chr10:127283999-127284393
chr10:129672449-129672810
chr11:22916455-22916555
chr11:45404130-45404584
chr11:52949738-52950144
chr11:59090488-59090899
chr11:83968347-83968721
chr11:85870829-85871435
chr11:100270893-100271425
chr11:110063482-110063728
chr11:112419972-112420147
chr12:19071553-19071879
chr12:21006186-21006653
chr12:37063380-37063889
chr12:57831673-57831835
chr12:70088943-70089586
chr12:93111415-93112042
chr12:94692464-94692491
chr12:103669250-103669700
chr12:110370465-110504737
chr12:111777906-111778337
chr13:33235925-33236621
chr13:36574575-36574830
chr13:52461390-52461749
chr13:59882731-59883088
chr13:65841210-65841494
chr13:73935063-73935304
Genname
Cntnap5a
AK084486
Cd55
Stx6
Jph1
Kif26b
Kcnq5
AK149593
Lrp1
4930430E16Rik
Acaca
Brip1
Klhl10
Abca6/off
Dock4
Mnat1
Ccnk
F13a1
1110033M05Rik
Anhang
122
SM3-32
SM3-16
XM2-14
XM3-2
SM2-6
SM2-28A
SM2-22
XM2-49A
SM3-29
XM2-20
SM3-9
SM3-3
SM3-25
XM3-20
SM3-49
SM2-16
XM2-43
SM2-29
XM3-13
XM2-25
XM3-11
SM2-31A
XM2-48
SM2-9
SM2-46
SM2-2
XM3-50
SM2-25
SM2-24
SM3-43
SM3-2
SM3-13
SM2-35
XM2-5
XM3-21
SM2-49
SM2-23
XM3-6
XM3-24B
SM2-8
XM2-15
SM2-7
SM3-36
SM3-8
SM3-20
XM3-1A
XM3-31
SM2-3B
SM2-20
SM3-6
SM3-37
SM2-28B
XM2-33
chr13:99183842-99184372
chr13:99484189-99484451
chr14:18556719-18556933
chr14:41304927-41305522
chr14:70561352-70561670
chr14:81718208-81718611
chr14:93962705-93962839
chr14:97675635-97675817
chr15:55441132-55441619
chr15:95390735-95390803
chr16:14463415-14463718
chr16:20413303-20413763
chr16:21469874-21470035
chr16:29976600-299771811
chr16:41150667-41151214
chr16:43334385-43335011
chr16:47684430-47684631
chr16:49885647-49886087
chr16:89994660-89995158
chr16:96292955-96293051
chr17:23095666-23095840
chr17:23433193-23433639
chr17:23659512-23659900
chr17:23807121-23807745
chr17:26075811-26076300
chr17:32716443-32716740
chr17:40705500-40705658
chr17:51339139-51339504
chr17:65681089-65681236
chr17:76695094-76695486
chr17:77262413-77262638
chr18:36310385-36310898
chr18:43432621-43432771
chr18:61103095-61103692
chr18:66793900-66794078
chr18:79504146-79504337
chr19:50487835-50488031
chr2:28684414-28684952
chr2:54269521-54269698
chr2:81848523-81848834
chr2:91343830-91344348
chr2:93593947-93594281
chr2:103798804-103799270
chr2:112761956-112762402
chr2:125011710-125011984
chr2:141552919-141553521
chr2:158349510-158349845
chr2:170097661-170097691
chr3:7935448-7935490
chr3:10351205-10351848
chr3:22572702-22572955
chr3:37335515-37335694
chr3:59020429-59020912
Mast4
Mast4
Phr1
Col14a1
Nell2
Prkdc
Vps8
Centb2
Gap43
4931408A02Rik
Dscam
Tmem112
3230401M21Rik
Rab11fip3
Ppard
Vars2
Arhgap28
Eif2ak2
Stk32a
1190002A17Rik
Zfp804a
AK139637
Gm1967
Ryr3
Fbn1
Macrod2
4930470P17Rik
Zfand1
Anhang
123
SM2-31B
XM3-1B
XM3-37
SM2-18
SM2-43
XM2-45
SM3-39
XM3-29
XM2-35
XM2-18
XM3-32
SM2-5
SM2-26A
XM2-12
XM2-28
SM3-40
SM3-42
XM2-36
XM2-3
SM2-26B
XM3-10
XM2-29
SM3-21
XM3-54
SM2-37
SM3-48
XM2-54
XM3-24A
SM3-34
SM2-45
SM3-38
SM3-47
XM3-28
XM2-23
SM2-14
SM2-4
XM3-9
XM3-12
XM2-13
SM2-39
XM2-1
XM3-46
SM2-38
XM2-49B
SM2-21
SM2-33
XM2-31
XM2-41
SM3-17
XM2-38
XM3-43
XM2-22
XM2-40
chr3:68271901-68271922
chr3:110583558-110583969
chr3:116413732-116414222
chr3:130223865-130224157
chr3:133771697-133771845
chr3:146712687-146712847
chr3:149259554-149259772
chr4:33862664-33863277
chr4:37388347-37388539
chr4:48846906-48847447
chr4:81028054-81028404
chr4:84085681-84085709
chr4:118183799-118183925
chr4:141748092-141748350
chr4:143841892-143842147
chr5:14855819-14856121
chr5:44255409-44255887
chr5:83079137-83079379
chr5:112085370-112085401
chr5:117081602-117081804
chr5:141404703-141404954
chr6:44119030-44119215
chr6:85870980-85871662
chr6:121125643-121126279
chr6:125571415-125571732
chr6:129424841-129425110
chr6:132649697-132650127
chr7:6787507-6787697
chr7:15100441-15100895
chr7:47651282-47651384
chr7:76453009-76453459
chr7:93414748-93415141
chr7:134422660-134423340
chr8:7933235-7933539
chr8:69229997-69230738
chr8:77357904-77358458
chr8:79619235-79619428
chr8:86567305-86567499
chr8:88871928-88872302
chr8:106831030-106831354
chr8:112873278-112873554
chr8:119800638-119800809
chr8:125047080-125047469
chr9:8156438-8156768
chr9:35751586-35752301
chr9:42103352-42103813
chr9:42714403-42714691
chr9:49945382-49945695
chr9:52670176-52670736
chr9:70411728-70411955
chr9:79800284-79800580
chr9:118302228-118302411
chrX:7643781-7644305
4833424O15Rik
Cyp2u1
Tacr3
AK048554
AK036601
D530005L17Rik
BC035522
AK018156
Dhrs3
Lap3
Adrbk2
Nos1
Ptms
AK081635
Mtap6
Tubgcp2
Tm6sf2
Wwp2
Pcnxl2
AK020329
AK136151
Grik4
Myo1e
Anhang
124
SM3-22
SM2-10
SM2-50
XM2-37
SM3-23
SM3-45
chrX:44941502-44941638
chrX:47610410-47610561
chrX:52976999-52977187
chrX:119652483-119652726
chrX:123160783-123161294
chrX:137591759-137592048
Tabelle 8 Lokalisation der 154 sequenzierten mutp53-kopräzipitierten DNA-Fragmente im
Mausgenom. Nicht aufgeführt sind DNA Fragmente, die aufgrund ihrer repetitiven Sequenzen keinem
Chromosom zugeordnet werden konnten.
7.2 Liste der differentiell regulierten Gene zwischen mit pSUPscr und pSUPshp53
transfizierten MethA Zellen 24h nach Transfektion
Genname
1810073N04Rik
5830443L24Rik
Akt1
Azi2
Bcl2l1
Ccl4
Cdc23
Cdc42bpa
Chd3
Cxcl10
Dync1h1
Fut8
Galnt7
Ganab
Gbp1
Gbp5
Gtpbp1
Jub
Mgat1
Mtmr1
Mx1
Notch1
Oas2
Ogfr
Parp3
Rsad2
Sec15l2
Stat6
Tes
Tinagl
Trp53
U2af2
U59758
Proteinname
thymoma viral proto-oncogene 1
5-azacytidine induced gene 2
Bcl2-like 1
chemokine (C-C motif) ligand 4
cell division cycle 23, yeast, homolog
Cdc42 binding protein kinase alpha, transcript
variant 11
chromodomain helicase DNA binding protein 3
chemokine (C-X-C motif) ligand 10
dynein cytoplasmic 1 heavy chain 1
fucosyltransferase 8
UDP-N-acetyl-alpha-D-galactosamine:
polypeptide N-acetylgalactosaminyltransferase 7
alpha glucosidase 2 alpha neutral subunit
guanylate nucleotide binding protein 1
guanylate nucleotide binding protein 5
GTP binding protein 1
ajuba (Jub)
mannoside acetylglucosaminyltransferase 1
myotubularin related protein 1
myxovirus (influenza virus) resistance 1
notch-1
2'-5' oligoadenylate synthetase 2
opioid growth factor receptor
poly(ADP-ribose) polymerase 3
radical S-adenosyl methionine domain containing
2
SEC15-like 2 (S. cerevisiae)
signal transducer and activator of transcription 6
testis derived transcript
tubulointerstitial nephritis antigen-like
transformation related protein 53
U2 small nuclear ribonucleoprotein auxiliary
factor
p53-variant
24-Exp.1
-1,63
-1,63
-1,95
-1,53
-1,58
-1,62
-1,51
24h-Exp.2
-1.85
-1,70
-1,91
-1,51
-1,68
-1,57
-1,63
Mittelwert
-1,73
-1,66
-1,93
-1,52
-1,63
-1.60
-1,57
-1,56
-1,50
-1,69
-1,57
-1,51
-1,56
-1,60
-1,61
-2,15
-1,51
-1,56
-1,55
-1,65
-1,84
-1,51
-1,66
-2,17
-1,52
-1,63
-1,87
-1,55
-1,59
-1,77
-1,53
-1,55
-1,51
-1,71
-1,53
-1,75
-1,76
-1,68
-1,79
-1,98
-1,97
-1,62
-1.64
-1,61
-1,59
-1,74
-1,66
-1,97
-1,70
-1,97
-1,60
-1,71
-1,92
-1,75
-1,60
-1,70
-1,57
-1,57
-1,62
-1,68
-1,75
-1,58
-1,76
-2,13
-1,65
-1,96
-2,36
-1,71
-1,85
-2,21
-1,58
-1,75
-1,97
-1,64
-1,80
-2,17
-1,61
-1,86
-2,16
-1,54
-2,51
-1,80
-1,88
-1,67
-2,18
Anhang
Ube1x
Usp47
Zcchc11
Zfp180
Zfp445
1810026B05Rik
1810035L17Rik
2010109N14Rik
2810026P18Rik
4632404H12Rik
5832418A03Rik
Csnk1d
Ctnnb1
Cugbp2
Fhl1
Hmgcs1
Mitf
Myo1e
Olfr430
Rap1gap
Rpl41
Rpl5
Rps13
Runx1t1
Vps53
Wasf2
125
ubiquitin-activating enzyme E1, Chr X
ubiquitin specific peptidase 47
zinc finger, CCHC domain containing 11
zinc finger protein 180
zinc finger protein 445
-1,82
-1,66
-1,80
-1,60
-1,74
-1,71
-1,63
-1,55
-1,75
-1,51
-1,76
-1,64
-1,67
-1,67
-1,62
casein kinase 1, delta
catenin beta
CUG triplet repeat, RNA binding protein 2
four and a half LIM domains 1
hydroxymethylglutaryl-CoA synthase (EC 4.1.3.5)
microphthalmia-associated transcription factor
myosin IE
olfactory receptor 430
Rap1 GTPase-activating protein
ribosomal protein L41
ribosomal protein L5
ribosomal protein S13
runt-related transcription factor 1(cyclin D-related)
vacuolar protein sorting 53
WAS protein family, member 2
1,82
1,69
1,82
1,59
1,80
1,61
1,52
1,58
1,61
1,53
2,12
1,53
1,70
1,63
1,67
1,51
1,50
1,59
1,91
1,64
1,57
2,24
1,58
1,85
1,90
1,67
1,53
1,53
1,75
1,55
1,77
3,54
1,50
1,74
1,66
1,56
1,73
1,57
1,85
1,67
1,58
1,68
2,03
1,64
1,83
1,74
1,73
1,57
1,52
1,66
1,58
1,64
2,83
1,52
1,72
1,64
1,61
1,61
1,53
1,72
1,79
1,61
1,62
Tabelle 9 Liste der differentiell regulierten Gene. Für diese Analyse wurden Expressionsdaten aus 2
Experimenten 24 h nach Transfektion mit pSUPscr bzw pSUPshp53 Vektoren verwendet. Bei der
Auswertung der Daten wurden p<0,01; 1,5-fache Expressionsänderung und Hintergrundsubtraktion
von 50 als Filterkriterien verwendet. Die Expressionsänderung ist als Änderung des Ratios zwischen
scr und shp53 angegeben.
7.3 Liste der durch die RNA-IP identifizierten mutp53 gebundenen Transkripte
Lokalisation im Genom
chr1:130,104,527-130,105,138
Genname
Ubxd2
chr1:133,738,226-133,752,187
Nucks1
chr1:135,431,422-135,437,792
chr1:196,804,522-196,815,510
chr1:43,067,623-43,068,032
chr10:128,315,434-128,315,773
chr10:82,179,804-82,180,193
Snrpe
Crry
Fhl2
Cd63
Nfyb
chr11:120,421,651-120,421,769
Anapc11
chr11:22,902,173-22,903,335
chr11:78,008,211-78,008,383
chr11:80,287,654-80,288,129
Cct4
Cox7c
(pseudogene)
Rab34
Psmd11
chr11:83,322,777-83,322,934
Taf15
chr11:75,415,828-75,416,241
Proteinname
UBX domain containing 2
nuclear, casein kinase and cyclindependent
small nuclear ribonucleoprotein E
complement receptor related protein
four and a half LIM domains 2
Cd63 antigen
nuclear transcription factor-Y beta
anaphase promoting complex subunit 11
homolog
chaperonin subunit 4 (delta)
Cytochrome c oxidase polypeptide VIIc,
mitochondrial precursor
RAB34, member of RAS oncogene family
proteasome 26S non-ATPase subunit 11
TAF15 RNA polymerase II, TATA box
binding
Anhang
126
chr11:88,646,882-88,647,084
chr12:55,778,431-55,778,987
chr12:70,291,954-70,292,393
chr13:3,564,953-3,565,061
chr14:23,323,169-23,328,322
chr14:45,697,547-45,697,905
chr14:50,996,750-50,996,984
chr15:36,716,143-36,716,569
chr15:97,072,165-97,072,388
chr16:55,941,511-55,941,646
Akap1
Cfl2
Arf6
Gdi2
Rps24
Cnih
Hnrpc
Ywhaz
Amigo2
Pcnp (pseudogene)
chr16:91,814,080-91,820,421
Atp5o
chr17:33,606,490-33,606,636
chr17:34,604,781-34,604,964
chr17:34,875,046-34,875,406
chr17:45,610,971-45,611,214
H2-K1
RLTR11A
H2-D1
Mad2l1bp
chr19:43,553,063-43,553,355
Got1
chr19:45,803,573-45,803,779
Mgea5
chr19:60,823,467-60,827,632
chr19:7,265,255-7,265,529
chr2:152,583,594-152,585,360
chr2:25,565,064-25,565,561
chr2:29,892,509-29,893,438
chr2:32,056,394-32,056,534
chr3:103,307,446-103,307,889
chr3:135,403,120-135,403,448
chr3:138,388,383-138,392,708
Eif3s10
Otub1
TPX2
RLTR10C
Set (pseudogene)
5830434P21Rik
Bcas2
Ube2d3
Adh5
chr3:34,268,979-34,270,827
chr3:94,969,730-94,970,382
chr4:3,761,619-3,762,149
chr5:115,559,465-115,561,565
chr5:121,469,416-121,469,584
chr5:38,519,161-38,522,326
chr7:121,872,836-121,873,748
chr7:126,813,282-126,813,863
chr7:28,023,654-28,023,893
chr8:125,989,320-125,991,325
chr8:126,128,451-126,128,520
chr9:37,398,853-37,399,030
chr9:69,290,658-69,290,950
chrX:102,405,615-102,406,407
chrX:105,364,977-105,365,192
chrX:162,551,198-162,551,304
Akap1
cofilin 2, muscle
ADP-ribosylation factor 6
Rab GDP dissociation inhibitor beta
ribosomal protein S24 isoform 3
cornichon homolog
heterogeneous nuclear ribonucleoprotein C
14-3-3 protein zeta/delta
amphoterin induced gene 2
Pcnp
ATP synthase, H+ transporting,
mitochondrial F1
H-2 class I histocompatibility antigen
D17H6S56E-5
H-2 class I histocompatibility antigen
MAD2L1 binding protein
glutamate oxaloacetate transaminase 1,
soluble
meningioma expressed antigen 5
(hyaluronidase)
eukaryotic translation initiation factor 3
OTU domain, ubiquitin aldehyde binding 1
microtubule-associated protein homolog
Phosphatase 2A inhibitor
hypothetical protein LOC227723
breast carcinoma amplified sequence 2
ubiquitin-conjugating enzyme E2D 3
alcohol dehydrogenase 5 (class III), chi
translocase of the inner mitochondrial
Dnajc19
membrane
Psmb4
proteasome beta 4 subunit
Rps20
40S ribosomal protein S20
Dynll1
dynein, cytoplasmic, light peptide
Rpl6
60S ribosomal protein L6
Lyar
Ly1 antibody reactive clone
D7Wsu128e
ubiquitin-binding protein homolog
Maz
MYC-associated zinc finger protein
Supt5h
suppressor of Ty 5 homolog
Rpl13
60S ribosomal protein L13
BC057621
Protein C16orf7 homolog
transforming growth factor beta regulated
Tbrg1
gene
Anxa2
annexin A2
Pgk1 (pseudogene) phosphoglycerate kinase 1
SH3-binding domain glutamic acid-rich
Sh3bgrl
protein
Tmsb4x
thymosin, beta 4, X chromosome
Tabelle 10 Liste der durch die RIP identifizierten an MethA mutp53 gebundenen Transkripte (55). In
gelb sind die 3’ UTR Transkripte markiert. Nicht gezeigt sind 29 B2 und B1 SINE Sequenzen sowie 3
BC1 scRNA.
Anhang
127
7.4 Liste der in mit dsRNA Expressionsvektoren transfizierten im Vergleich zu
adhärenten MethA Zellen hochregulierten Gene
(mit den Filterkriterien 2 fache Hochregulation, p< 0,05 und Signal > 100 (insgesamt 376
Gene))
1110001D15Rik,
1110034B05Rik,
1700012H17Rik,
1700029F09Rik,
1810032O08Rik,
2010107E04Rik, 2010111I01Rik, 2010300C02Rik, 2310016F22Rik, 2410018M08Rik, 2410104I19Rik,
2610030H06Rik,
4921511I16Rik,
5730521K06Rik,
2610034N15Rik,
4930481A15Rik,
5730596K20Rik,
2610101N10Rik,
2810003C17Rik,
2810022L02Rik,
4930528F23Rik,
4933405A16Rik,
5430435G22Rik,
5830415L20Rik,
5830484A20Rik,
6330409N04Rik,
6330442E10Rik, 9230105E10Rik, 9330175B10Rik, 9630055N22Rik, 9830147J24Rik, Abhd2, Acsl4,
Adar, Ahnak, AI132487, AI451617, AI481105, AI607873, AI839735, AK008871, AK032921,
AK035950, AK038627, AK040334, AK053808, AK083076, AK162987, Ak3l1, Akap8, Alkbh1,
Ammecr1, Ankrd27, Ankrd37, Arhgap10, Arih1, Ascc3, Ash1l, Atm, AV030849, Axud1, Bach1, Baz1a,
BC003267, BC006779, BC013561, BC020489, BC050078, BC057170, Bcl2l11, Bst2, Bud31, Bxdc2,
C79267, Casp1, Casp12, Casp4, Cav2, Ccdc84, Ccdc88, Ccdc93, Ccl2, Ccl5, Ccl5, Ccl7, Ccne2,
Ccnt2, Cd274, Cebpz, Cflar, Chit1, Chmp4b, Clasp1, Col4a3bp, Col8a1, Commd2, Cpne3, Creb1,
Cxcl1, Cxcl5, Cyr61, D11Ertd759e, D11Lgp2e, D14Ertd668e, D17H6S56E-5, D330037H05Rik,
D630004A14Rik, Dbr1, Dcp2, Ddx21, Ddx23, Ddx24, Ddx46, Ddx58, Ddx6, Dicer1, Dnmt3a, Dusp4,
E430034L04Rik, Ehd4, Eif2ak2, Eif2c2, Eif2s1, Eif4g1, Eif5, Elf1, ENSMUST00000073378,
ENSMUST00000091560, Esco1, Esd, Etnk1, Ets1, F830028O17Rik, Fbxo33, Fbxo39, Fgfr1op, Fhl2,
Frap1, Fubp1, Fyb, Gadd45g, Gbp1, Gbp2, Gbp4, Gdap10, Ggps1, Gjb3, Gls, Gnl3, Golga1, Gprk6,
Gsta1, Gsta2, Gtf2f2, Herc5, Hist1h1d, Hnrpdl, Hspa1a, Hspa4l, Ier3, Ier5, Ifi202b, Ifi203, Ifi204,
Ifi205, Ifi35, Ifi44, Ifi47, Ifih1, Ifit1, Ifit2, Ifit3, Ifitm3, Ifitm7, Igtp, Iigp1, Iigp2, Il18rap, Il1rl1, Impad1,
Ireb2, Irf1, Irf7, Irgm, Isg15, Isg20, Isgf3g, Itgb4bp, Jarid2, Jmjd1a, Josd3, Kitl, Klhl25, Kpna6, Lamc2,
Lars2, Lats2, Lcor, Lgals3bp, Lgals9, Lmo7, Lmtk2, LOC382161, LOC545342, LOC545471,
LOC673334, LOC676640, Ly6e, Ly96, Mad2l1, Map3k10, Mapk8, Mast4, Mdn1, Med6, Mib1, Mier1,
Mitd1, Mpeg1, Mphosph10, Mrpl1, Mrpl46, Mtf2, NAP000727-001, NAP007796-001, NAP112463-1,
Narg1l, Ncoa6ip, Neo1, Nfkbiz, Ngfb, Nmb, Nmi, Nmnat1, Nmt2, Noc2l, Nup155, Nup50, Oas1a,
Oas1c, Oas1f, Oas3, Oasl1, Oasl2, Ogfr, Orc1l, Orc4l, Pabpc1, Parp12, Parp14, Parp9, Pbef1,
Pdcd10, Pdpn, Pfkfb1, Phf11, Phip, Pigt, Piwil4, Pkp3, Plaur, Plec1, Pnpla7, Pnpt1, Pomp, Pop1, Ppl,
Prkce, Prkrip1, Prss22, Psma3, Psmb10, Psmd1, Psmd7, Ptar1, Ptgs2, Rab30, Ramp3, Ranbp3,
Rasa2, Rbbp4, Rbm27, Rc3h1, Rnf4, Rpl11, Rpl27a, Rps12, Rsbn1, Rtp4, S100a3, S100pbp,
Samd9l, Samhd1, Scotin, Senp5, Sf3b1, Sfpq, Sh3gl3, Slc25a37, Slc30a1, Slc6a6, Slfn10, Slfn2,
Slfn3, Sltm, Smg7, Socs1, Sp100, Speer3, Speer6-ps1, Stat1, Stat2, Stat3, Stch, Stk4, Taf1a, Tap1,
Tapbp, Tardbp, TC1410591, TC1410711, TC1419321, TC1485374, TC1486081, Tfrc, Tgtp, Thrap3,
Tlr2, Tlr3, Tm4sf1, Tnfaip3, Tnfrsf26, Tnrc6b, Topors, Tor1aip1, Tor1aip2, Tor3a, Trafd1, Trex1,
Trim21, Trim25, Trim30, Trim34, Trip11, Trnt1, Troap, Tsc1, Ttll4, Ube1l, Ube2l6, Ube2v2, Ube3a,
Ugcg, Usp18, Usp19, Usp42, Wdfy1, Wdr43, Xpo4, Yars2, Zc3h12c, Zc3hav1, Zcchc2, Zcchc7,
Zfand2a, Zfp106, Zfp207, Zfp26, Zfp297b, Zfp367, Zfp386, Zfp451, Zfp472, Zfp606, Zfp672, Zranb2
Anhang
128
7.5 Liste der in mit dsRNA Expressionsvektoren transfizierten im Vergleich zu
adhärenten MethA Zellen herunterregulierten Gene
(mit den Filterkriterien 2 fache Hochregulation, p< 0,05 und Signal > 100 (insgesamt 403 Gene))
0610011I04Rik, 0610030E20Rik, 0710001D07Rik, 1110002H13Rik, 1110012J17Rik, 1110032A03Rik,
1110051M20Rik,
1110054M08Rik,
1190002C06Rik,
1190002F15Rik,
1500041N16Rik,
1700009P17Rik,
1700011J10Rik,
1700020I14Rik,
1700052K11Rik,
1700088E04Rik,
1810009M01Rik,
1810014B01Rik,
2010004M13Rik,
2010200O16Rik,
2210010N04Rik,
2310004I03Rik, 2310010J17Rik, 2310039H08Rik, 2310043N10Rik, 2310047A01Rik, 2310067B10Rik,
2410127E16Rik,
2510048L02Rik,
2600003E23Rik,
2700007P21Rik,
2700046G09Rik,
2810004A10Rik,
2810007J24Rik,
2810422J05Rik,
3110062M04Rik,
4631423F02Rik,
4733401H18Rik,
4833409A17Rik,
4921511K06Rik,
4922501C03Rik,
4930579G22Rik,
4930579K19Rik,
4933439F18Rik,
5330426P16Rik,
5430420C16Rik,
5430440L12Rik,
5530400B01Rik,
5730470L24Rik,
5730494N06Rik,
5830408C22Rik,
5830434P21Rik,
6030465E24Rik,
6330403L08Rik,
6330509M05Rik,
6330549H03Rik,
6430567E01Rik,
6530401C20Rik,
9330129D05Rik,
9530077C05Rik,
A_51_P256798,
A_51_P426986,
A230083H22Rik, A730011L01Rik, A930034L06Rik, AA536743, Abca3, Abhd14b, Acad10, Acot2,
Acss2, Acyp1, Adam15, Adam9, Adra1b, Adssl1, Aebp1, Agtpbp1, AI316807, AK038845, AK041861,
AK076876, AK084660, AK087041, Aldh1l2, Aldh3b1, Aldh6a1, Alg9, Angptl6, Antxr1, Aox1, Ap3b2,
Apob48r,
Arhgef2,
Arntl,
Asahl,
Atf3,
Atf5,
Atoh8,
Atp6v0a1,
Atp8a1,
AU040320,
Azi1,
B230219D22Rik, Bbc3, BC003940, BC008155, BC010787, BC018371, BC027382, BC038156,
BC046404, Bcl2, Bphl, Braf, Btbd2, C1s, Calm1, Camk2n2, Carkl, Cbr2, Cbx6, Ccbl1, Ccdc85b,
Cdc42ep1, Cdc42ep1, Cds2, Cebpg, Cenpm, Cetn4, Ches1, Cic, Cit, Ckb, Clpb, Cmkor1, Cnih4,
Col16a1, Col2a1, Col5a3, Crim1, Crocc, Cth, Cyb5r1, Cyp27a1, Cyp39a1, Cyp4f13, D10Ucla1,
D11Ertd333e, D16Ertd472e, D8Ertd354e, D930010J01Rik, Dbp, Dcxr, Ddef2, Ddit3, Dgka, Dhrs7,
Dip2c, Dnajc10, Dnalc4, Dscr1l2, Dync1li2, Dynlt1, E130307M08Rik, Egfl7, ENSMUST00000049389,
ENSMUST00000055502, Entpd2, Ext2, F730047E07Rik, Fads1, Fads2, Fads3, Fah, Fancl, Fbxw4,
Flot1, Flywch1, Fn1, Foxp1, Fts, Fyn, Gadd45a, Galc, Gamt, Glb1, Glce, Glipr2, Gosr1, Gphn,
Gpr124, Gpt2, Gramd1b, Grcc10, Gsto2, Gstt2, Gstt3, Gtpbp2, Hcfc1r1, Hdac4, Hdac5, Hddc3, Hexa,
Hexb, Hic1, Hip1, Hoxb9, Hs2st1, Ica1l, Ick, Id1, Id2, Id3, Ids, Ier5l, Ift122, Ift172, Ift80, Il4i1, Itgb5,
Jund1, Jundm2, Kazald1, Kctd15, Khk, Kif21b, Klf4, Klhdc8a, Lamb2, Leprotl1, Lmo6, Lrrc61, Lrrcc1,
Ltbp3, Ltbp4, Man2a2, Mapbpip, Mapk1, Mapk3, Mib2, Mical1, Mknk2, Mocs1, Mrgpre, Mst1, Mtap4,
Mtmr11, Mxra8, Myh14, Nadsyn1, NAP030253-1, NAP098046-001, Nat9, Nedd4, Nexn, Nicn1,
Nkiras2, Nnmt, NP064425, Nrbp2, Nrm, Nt5dc2, Nudt14, Nupr1, Nutf2, Odz4, Ogfod1, Olfr1221,
Osgep, Otub2, Paox, Paqr4, Pcbd2, Pck2, Pcmtd1, Pctk3, Pex11c, Pld1, Pltp, Plxnb2, Polr3e, Polr3gl,
Ppapdc2, Ppp2r5b, Ppp3cc, Praf2, Pros1, Prpf40b, Prss16, Psrc1, Ptprs, Ptrh2, Pycr1, R3hdm2,
Rab23, Rab3d, Rab3gap2, Rag1ap1, Rb1, Rfxank, Rgma, Rhoj, Rnaset2, Rnf157, Rpl22, Rps6ka2,
Rras, Rsrc1, Samd14, Scap2, Scd1, Scd2, Scly, Scpep1, Sdsl, Sec22c, Selenbp1, Selenbp2, Sepn1,
Serpinf1, Sertad2, Sesn2, Sfi1, Sft2d2, Sgsh, Sirt5, Six1, Slc22a18, Slc2a8, Slc39a3, Slc41a3,
Slc6a9, Slc7a5, Snai2, Snapap, Snrpa, Sox21, Spsb2, Srr, Ssr1, St3gal5, Stau2, Steap2, Tbc1d5,
Tbpl1, TC1499901, Tcfcp2, Tcta, Tenc1, Terf2ip, Tgfb1, Tgfb1i1, Timp2, Tinagl, Tle2, Tle6, Tm7sf2,
Anhang
129
Tmem151, Tmem53, Tnrc6b, Tpcn1, Trappc1, Trappc6a, Trib3, Trp53inp2, Trpm4, Tsc22d3,
Tspan17, Tst, Ttc7, Twsg1, Ube2h, Ube3b, Ubl3, Ugt1a6b, Ulbp1, Usp11, Vamp5, Vegfa, Wars,
Wasf1, Wdr5b, Wdr67, Wfs1, Whsc1l1, Wwp1, X83328, Xpr1, Yif1b, Yipf2, Zbtb4, Zdhhc24, Zfand1,
Zfp580, Zfp704, Zfpn1a4, Zmat3, Zmym3, Zmym6, Zranb3
7.6 Vektorkarten
7.6.1 pBluescript II sk (+)
7.6.2 pENTR/H1/TO
Anhang
7.6.3 pSuperior.neo.GFP
130
Anhang
131
7.7 SICHERHEITSTECHNISCHE DATEN
7.7.1 Gefahrenstoffe
Die folgende Liste beinhaltet sämtliche Verbindungen und Lösungsmittel, mit denen während
dieser Arbeit umgegangen wurde. Die Gefahrstoffe sind, soweit vorhanden, mit den
jeweiligen Gefahrensymbolen, R- und S-Sätzen versehen worden.
Substanzname
Gefahrensymbol
R-Sätze
S-Sätze
2-Mercaptoethanol
T, N
R 22-24-34-51/53
S 26-36/37/39-4561
2-Propanol
F, Xi
R 11-36-67
S 7-16-24-26
3-Aminophthalhydrazid
Xi
R 36/37/38-20/21
S 24/25
22-40-50/53
4-Cumarsäure
Xi
R 36/37/38
S 24/25-22-2636/37/39
Aceton
F, Xi
R 11-36-66-67
S 9-16-26
Acetonitril
Xn, F
R 11-20/21/22-36
S 16-36/37
Acrylamid
T
R 45-46-20/21-
S 53-45-24-36/37
25-36/38-43-48
23/24/25-62
Ammonium-
O, Xn
R 8-22-36/37/38
S 22-24-26-37
peroxodisulfat
-42/43
Ampicillin
R 42/43
S 23-26
Bisacrylamid
Xn
R 22-20/21/22
S 24/25-36/37
Cetavlon/CTAB
Xn, N
R 22-37/38-41-50
S 26-36-61
Chloroform
Xn
R 22-38-40-48
S 36/37
20/22
Diethylether
F+, Xn
R 12-19-22-66-67
S 9-16-29-33
Diethylpyrocarbonat
Xn
R 22-36/37/38
S 26-37/39
2, 5 Dihydroxy-
Xn
-
S 24/25
Dimethylformamid
T
R 61-20/21-36
S 53-45
Dithiothreitol
Xn
R 22-36/38
S 24/25
Essigsäure 100 %
C
R 10-35
S 23.2-26-45
Ethanol
F
R 11
S 7-16
Ethidiumbromid
T+
R 22-26-36/37
S 26-28.2-36/37
benzoesäure
38-68
Anhang
Ethylendiamin-
132
Xi
R 22-36/37/38
S 26-36
Formaldehyd
T
R 23/24/25
S 2-28
Iodoacetamid
T
R 25-42/43
S 22-36/37-45
Isoamylalkohol
Xn
R 10-20
S 24/25
Kanamycinsulfat
T
R 61
S 45-36/37/39
Methanol
F, T
R 11-23/24/25-
S 7-16-36/37-45
tetraessigsäure
39/23-24/25
N,N,N’,N’-Tetramethyl-
F, C
R 11-20/22-34
ethylendiamin
S 16-26-36/37/
39- 45
Natriumazid
T+, N
R 28-32-50/53
S 28.1-45-60-61
Natriumdeoxycholat
Xn, Xi
R 22-37
S 22-36
Natriumdodecylsulfat
Xn
R 21/22-36/37/38
S 26-36/37
Natriumhydroxid
C
R 35
S 26-37/39-45
Neomycinsulfat
T, Xi
R 63-42/43-36
S 45-26-36/37/39
37/38
Nonidet P-40
Xi
R 36/38
S 23
Phenol
T
R 24/25-34
S 28.6-45
Phosphorsäure
C
R 34
S 26
Proteinase K
Xn, Xi
R 36/37/38-42
S 22-24-26-36/37
Salzsäure 37 %
C
R 34-37
S 26-36/37/39-45
Trichloressigsäure
C
R 35
S 24/25-26
Xi
R 36/38
S 24/25
Triton X-100
Xi
R 36/37/38
S 26-36
Trypsin
Xi
R 36/37/38-42
S 22-24-26-36/37
Wasserstoffperoxid 30 %
C
R 34
S 3-26-36/37/39-45
Picogreen
Tetradecanoylamidopropyldimethylammoniobutansulfonat (Asb-14)
Amidosulfobetain
Trishydroxymethylaminomethan
Anhang
133
7.7.2 Verzeichnis der Gefahrensymbole
O
C
E
F
F+
T
T+
Xn
Xi
N
Brandfördernd
Ätzend
Explosionsgefährlich
Leichtentzündlich
Hochentzündlich
Giftig
Sehr giftig
Gesundheitsschädlich
Reizend
Umweltgefährlich
7.7.3 Verzeichnis der R- und S- Sätze
Gefahrenhinweise (R-Sätze)
R 8 Feuergefahr bei Berührung mit brennbaren Stoffen
R 10 Entzündlich
R 11 Leichtentzündlich
R 12 Hoch entzündlich
R 19 Kann explosionsfähige Peroxide bilden
R 20 Gesundheitsschädlich beim Einatmen
R 21 Gesundheitsschädlich bei Berührung mit der Haut
R 22 Gesundheitsschädlich beim Verschlucken
R 24 Giftig bei Berührung mit der Haut
R 25 Giftig beim Verschlucken
R 26 Sehr giftig beim Einatmen
R 28 Sehr giftig beim Verschlucken
R 32 Entwickelt bei Berührung mit Säure sehr giftige Gase
R 34 Verursacht Verätzungen
R 35 Verursacht schwere Verätzungen
R 36 Reizt die Augen
R 37 Reizt die Atmungsorgane
R 38 Reizt die Haut
R 40 Verdacht auf krebserzeugende Wirkung
R 41 Gefahr ernster Augenschäden
R 42 Sensibilisierung durch Einatmen möglich
R 43 Sensibilisierung durch Hautkontakt möglich
R 45 Kann Krebs erzeugen
R 46 Kann vererbbare Schäden verursachen
R 50 Sehr giftig für Wasserorganismen
R 61 Kann das Kind im Mutterleib schädigen
R 62 Kann möglicherweise die Fortpflanzungsfähigkeit beeinträchtigen
R 63 Kann das Kind im Mutterleib möglicherweise schädigen
R 66 Wiederholter Kontakt kann zu spröder oder rissiger Haut führen
R 67 Dämpfe können Schläfrigkeit und Benommenheit verursachen
R 68 Irreversibler Schaden möglich
Kombination der R-Sätze
R 20/21 Gesundheitsschädlich beim Einatmen und bei Berührung mit der Haut
R 20/22 Gesundheitsschädlich beim Einatmen und Verschlucken
R 20/21/22 Gesundheitsschädlich beim Einatmen, Verschlucken und Berührung mit der Haut
R 21/22 Gesundheitsschädlich bei Berührung mit der Haut und beim Verschlucken
R 23/24/25 Giftig beim Einatmen, Verschlucken und Berührung mit der Haut
R 24/25 Giftig bei Berührung mit der Haut und beim Verschlucken
R 36/38 Reizt die Augen und die Haut
Anhang
134
R 36/37/38 Reizt die Augen, Atmungsorgane und die Haut
R 39/23/24/25 Giftig: ernste Gefahr irreversiblen Schadens durch Einatmen, Berührung mit
der Haut und durch Verschlucken
R 42/43 Sensibilisierung durch Einatmen und Hautkontakt möglich
R 48/20/22 Gesundheitsschädlich: Gefahr ernster Gesundheitsschäden bei längerer
Exposition durch Einatmen und durch Verschlucken
R 48/23/24/25 Giftig: Gefahr ernster Gesundheitsschäden bei längerer Exposition
durch Einatmen, Berührung mit der Haut und durch Verschlucken
R 50/53 Sehr giftig für Wasserorganismen, kann in Gewässern längerfristig schädliche
Wirkungen haben
R 51/53 Giftig für Wasserorganismen, kann in Gewässern längerfristig schädliche Wirkungen
haben
Sicherheitsratschläge (S-Sätze)
S 2 Darf nicht in die Hände von Kindern gelangen
S 3 Kühl aufbewahren
S 7 Behälter dicht geschlossen halten
S 9 Behälter an einem gut gelüfteten Ort aufbewahren
S 16 Von Zündquellen fernhalten - nicht rauchen
S 22 Staub nicht einatmen
S 23 Gas/Rauch/Dampf/Aerosol nicht einatmen
S 23.2 Dampf nicht einatmen
S 24 Berührung mit der Haut vermeiden
S 26 Bei Berührung mit den Augen gründlich mit Wasser abspülen und Arzt konsultieren
S 28 Bei Berührung mit der Haut sofort abwaschen mit viel …
S 28.1 Bei Berührung mit der Haut sofort abwaschen mit viel Wasser
S 28.2 Bei Berührung mit der Haut sofort abwaschen mit viel Wasser und Seife
S 28.6 Bei Berührung mit der Haut sofort abwaschen mit viel Polyethylenglycol 400 und
anschließende Reinigung mit viel Wasser
S 29 Nicht in die Kanalisation gelangen lassen
S 33 Maßnahmen gegen elektrostatische Aufladung treffen
S 36 Bei der Arbeit geeignete Schutzkleidung tragen
S 37 Geeignete Schutzhandschuhe tragen
S 45 Bei Unfall oder Unwohlsein sofort Arzt zuziehen (wenn möglich, dieses Etikett
vorzeigen)
S 53 Exposition vermeiden - vor Gebrauch bes. Anweisungen einholen
S 60 Dieser Stoff und sein Behälter sind als gefährlicher Abfall zu entsorgen
S 61 Freisetzung in die Umwelt vermeiden. Besondere Anweisungen
einholen/Sicherheitsdatenblatt zu Rate ziehen
Kombination der S-Sätze
S 24/25 Berührung mit den Augen und der Haut vermeiden
S 36/37 Bei der Arbeit geeignete Schutzhandschuhe und Schutzkleidung tragen
S 36/37/39 Bei der Arbeit geeignete Schutzkleidung, Schutzhandschuhe und
Schutzbrille/Gesichtsschutz tragen
S 37/39 Bei der Arbeit geeignete Schutzhandschuhe und Schutzbrille/Gesichtsschutz tragen
Anhang
135
EIDESSTATTLICHE ERKLÄRUNG
Hiermit versichere ich, dass ich die vorliegende Arbeit selbstständig verfasst und nur
mit den angegebenen Methoden und Hilfsmitteln angefertigt habe. Wörtlich oder
inhaltlich aus anderen Quellen entnommene Stellen sind als solche kenntlich
gemacht, und die Inanspruchnahme fremder Hilfen ist namentlich aufgeführt.
Hamburg, Januar 2008
(Annette März)
Anhang
136
DANKSAGUNG
An erster Stelle bedanke ich mich bei Hr. Prof. Dr. Wolfgang Deppert für die Möglichkeit in
der Abteilung Tumorvirologie an diesem interessanten Thema forschen zu können und sein
stetes Interesse an meiner Arbeit, seine Diskussionsbereitschaft sowie die Begutachtung der
Arbeit.
Besonders dankbar bin ich für die exzellente Betreuung durch Hr. Dr. Genrich V. Tolstonog,
der immer Hilfs- und Diskussionsbereitschaft zeigte. Durch sein Wissen und seine Ideen
konnte sich sowohl die Arbeit als auch ich mich stetig weiterentwickeln.
Die Betreuung des proteinchemischen Teils der Arbeit durch Hr. Dr. Jochen Heukeshoven
wird trotz seines Todes nicht in Vergessenheit geraten. Dafür möchte ich mich ganz herzlich
bedanken.
Herrn Prof. Dr. Ulrich Hahn möchte ich für seine Bereitschaft danken, das Dissertationsgutachten zu dieser Arbeit anzufertigen, Herrn Prof. Dr. Bernd Meyer und Dr. Patrick
Ziegelmüller danke ich für die Begutachtung der Disputation.
Mein herzlicher Dank geht an alle Mitarbeiter der Abteilung Tumorvirologie, die durch ihre
liebevolle Unterstützung und Hilfsbereitschaft für ein angenehmes Arbeitsklima und sehr viel
Spaß gesorgt haben. Besonders danke ich meinen Laborkollegen Gabriele Warnecke, Lars
Tögel und Sathish Babu Hunsur Nayaran. Außerdem möchte ich mich bei Hr. Arne Düsedau
für die Hilfe bei der FACS Analyse und Dr. Christina Heinlein für die Injektion der Mäuse
bedanken.
Bei der bioinformatischen Auswertung wurde ich durch Simon Hess und Benjamin Otto
sowie von Tal Shay und Eytan Domany vom Weizmann Institute of Science, Israel
unterstützt.
Ganz besonders danke ich meinen Eltern Hildegard und Willi, meinen Geschwistern André
und Angelika und meinen Freunden für deren liebevolle Unterstützung, ohne die diese Arbeit
nicht möglich gewesen wäre.
Für die finanzielle Förderung dieser Arbeit bedanke ich mich bei der Deutschen Krebshilfe
e.V.
Herunterladen
Random flashcards
lernen

2 Karten oauth2_google_6c83f364-3e0e-4aa6-949b-029a07d782fb

Erstellen Lernkarten