Dissertation, 29.5.07 - E-LIB

Aus dem Zentrum für Humangenetik und Genetische Beratung der Universität Bremen
Vergleichende Tumorgenetik:
Der Hund (Canis familiaris) als Modelltier für
die humane Tumorgenese
Dissertation
Zur Erlangung des Grades eines Doktors der Naturwissenschaften
-Dr. rer. nat. –
Dem Promotionsausschuss Dr. rer. nat
im Fachbereich Biologie / Chemie der Universität Bremen
vorgelegt von Susanne Winkler
1. Gutachter: Prof. Dr. J. Bullerdiek
2. Gutachter: Prof. Dr. I. Nolte
I
Hiermit erkläre ich, Susanne Winkler, geboren am 21.09.1973, dass für das Verfassen der vorliegenden Dissertation „Vergleichende Tumorgenetik: Der Hund (Canis
familiaris) als Modelltier für die humane Tumorgenese“ folgende drei Aussagen zutreffen:
1. Ich habe die Arbeit ohne unerlaubte fremde Hilfe angefertigt.
2. Ich habe keine anderen als die von mir angegebenen Quellen und Hilfsmittel benutzt
3. Ich habe die den benutzten Werken wörtlich oder inhaltlich entnommenen Stellen
als solche kenntlich gemacht.
Bremen, 2007
Susanne Winkler
II
Not failure, but low aim, is crime.
J. R. Lowell
III
Inhaltsverzeichnis
ABKÜRZUNGSVERZEICHNIS.................................................................................. VII
1.
EINLEITUNG ........................................................................................................ 1
2.
MATERIAL UND METHODEN.............................................................................. 7
2.1.
Primärzellkultur von Adhäsionskulturen.................................................................... 7
2.2.
Primärzellkultur von Suspensionskulturen ................................................................. 7
2.2.1.
Zellkultur von Knochenmarkaspiraten ............................................................................... 7
2.2.2.
Zellkultur von Lymphozyten .............................................................................................. 7
2.3.
Kultivierung von Zelllinien ........................................................................................... 8
2.4.
Kryokonservierung von Zellkulturen .......................................................................... 8
2.4.1.
Einfrieren lebender Zellen .................................................................................................. 8
2.4.2.
Auftauen gefrorener Zellen................................................................................................. 8
2.5.
Zytogenetische Methoden .............................................................................................. 9
2.5.1.
Chromosomen-Präparation von Adhäsionskulturen........................................................... 9
2.5.2.
Chromosomenpräparation von Suspensionskulturen.......................................................... 9
2.5.3.
GTG-Färbung ..................................................................................................................... 9
2.5.4.
Karyotypanalyse ............................................................................................................... 10
2.6.
Molekular-zytogenetische Methoden.......................................................................... 10
2.6.1.
DNA-Isolierung aus caninem Vollblut............................................................................. 10
2.6.2.
Fluoreszenz-in-situ-Hybridisierung (FISH)...................................................................... 11
2.6.2.1. Markierung der Sonden DNA durch Nick-Translation .................................................... 11
2.6.2.2. Herstellung von ultraschall-behandelter Hunde DNA (sdDNA) ...................................... 11
2.6.2.3. Hybridisierung .................................................................................................................. 11
2.6.2.4. Auswertung....................................................................................................................... 12
2.6.3.
Erzeugung Adeno-assoziierter Viren................................................................................ 12
2.6.4.
2.7.
Proliferationsassays mit Adeno-assoziierten Viren und CT 1258 .................................... 12
Erstellen der Gewebebank........................................................................................... 13
2.7.1.
Entnahme von Gewebeproben.......................................................................................... 13
2.7.2.
Lagerung der Gewebeproben............................................................................................ 14
2.7.3.
Katalogisieren der Gewebeproben.................................................................................... 14
2.8.
Molekulargenetische Methoden .................................................................................. 14
2.8.1.
RNA-Isolierung aus Gewebe............................................................................................ 14
2.8.2.
RNA-Isolierung aus der Zell-Linie CT 1258.................................................................... 15
2.8.3.
DNase Verdau................................................................................................................... 15
2.8.4.
cDNA-Synthese ................................................................................................................ 15
IV
Inhaltsverzeichnis
2.8.5.
Amplifikation von DNA-Fragmenten durch Polymerase-Kettenreaktion (PCR)............. 16
2.8.6.
Gelelektrophoretische Auftrennung der PCR-Fragmente................................................. 16
2.8.7.
Real-Time PCR (Quantitativ) ........................................................................................... 17
3.
ERGEBNISSE..................................................................................................... 18
3.1.
Zytogenetische Ergebnisse........................................................................................... 18
3.1.1.
Cytogenetic investigations in four canine lymphomas ..................................................... 18
3.1.2.
Establishment of a cell line derived from a canine prostate carcinoma with a highly
rearranged karyotype ........................................................................................................ 18
3.1.3.
Polysomy 13 in a canine prostate carcinoma underlining its significance in the
development of prostate cancer ........................................................................................ 19
3.2.
Molekular-zytogenetische Ergebnisse ........................................................................ 19
3.2.1.
Molecular characterization and mapping of the canine KRAB zinc finger gene ZNF331 ..... 20
3.2.2.
The protein kinase B, gamma (AKT3) gene maps to canine chromosome 7 .................... 21
3.2.3.
Molecular characterization and mapping of the canine cyclin D1 (CCND1) gene .... 21
3.2.4.
The canine NRAS gene maps to CFA 17 .......................................................................... 22
3.2.5.
The canine KRAS2 gene maps to chromosome 22 .......................................................... 22
3.2.6.
Cloning and characterization of the canine receptor for advanced glycation end products .... 23
3.3.
Erstellen der Gewebebank........................................................................................... 23
3.4.
Molekulargenetische Ergebnisse................................................................................. 24
3.4.1.
Absence of ras-gene hot-spot mutations in canine fibrosarcomas and melanomas.......... 24
3.4.2.
RAS gene hot-spot mutations in canine neoplasias.......................................................... 25
3.4.3.
Expression pattern of the HMGB1 gene in sarcomas of the dog. ..................................... 25
3.4.4.
The canine HMGA1. ......................................................................................................... 26
3.4.5.
"Best friends" sharing the HMGA1 gene: comparison of the human and canine
HMGA1 to orthologous other species............................................................................... 27
3.4.6.
HMGA2 Expression in a Canine Model of Prostate Cancer ............................................. 28
3.4.7.
Inhibitory effect of antisense HMGA AAV-mediated delivery suppresses cell
proliferation in canine carcinoma cell line ....................................................................... 28
4.
DISKUSSION...................................................................................................... 30
5.
ZUSAMMENFASSUNG ...................................................................................... 40
6.
SUMMARY.......................................................................................................... 42
7.
LITERATUR ........................................................................................................ 44
V
Inhaltsverzeichnis
8.
DANKSAGUNG .................................................................................................. 61
9.
PUBLIKATIONSÜBERSICHT............................................................................. 63
VI
Abkürzungsverzeichnis
Abkürzungsverzeichnis
µ
Abb.
AGE
AK
AKT3
ALL
AML
AP2
AS
as
bp, kb
°C
CCND1
cDNA
CDS
CFA
CML
Da
dNTP
dH2O
DMSO
DNA / DNase
ds
EDTA
ER
EST
et al.
FAB-Klassifikation
FISH
FKS
g
GAPDH
GCGTG
HCl
HMG
HMGA1/HMGA2
HSA
ISCN
k
KCl
kDa
KM
KRAS2
LB
LHCGR
ceptor Gen
Mikro- (10-6)
Abbildung
Advanced glycation endproducts
Antikörper
Protein Kinase B, gamma Gen
akute lymphatische Leukämie
akute myeloische Leukämie
Poly(A)-Adapter-Primer
Aminosäure
antisense
Basenpaare, kilobasenpaare
Grad Celsius
Cyclin D1 Gen
copy DNA
coding Sequence
Canis Familiaris
chronische myeloische Leukämie
Dalton
desoxynukleosid-5’-triphosphat
bidestilliertes Wasser
Dimethylsulfoxid
Desoxiribonukleinsäure / Desoxiribonuklease
doppelsträngig
Ethylendiamintetraacetat
estrogen receptor
expressed sequence tag, cDNA Fragment
et altera
French-American-British-Klassifikation
Fluoreszenz in situ Hybridisierung
fetales Kälberserum
Erdbeschleunigung
Glyceraldehyd-3-phosphat dehydrogenase
Guanin- bzw. Cytosin
G-Bänderung mit Trypsin und Giemsa
Salzsäure
High mobility Group
High mobility Group A1/A2 Gen
Homo sapiens
An International System for Human Cytogenetic
Nomenclature
kilo (103)
Kaliumchlorid
Kilo Dalton
Knochenmark
v-Ki-ras2 Kirsten rat sarcoma viral Onkogene
homolog
Luria-Bertani
luteinizing hormone/choriogonadotropin reVII
Abkürzungsverzeichnis
LTR
Lsg
m
M
MAP
min
MgCl2
M-MLV
mRNA
NCBI
NFDM
NRAS
ORF
OT
PBS
PCR
rAAV
RAGE
RNA
rpm
RT
sdDNA
ssDNA
sec
SSC
T4
TAE
Taq Polymerase
TE
U
UTR
UV
V
vg
Vol
ZNF331
Long Terminal Repeat
Lösung
milli (10-3)
Molar
Mitogen activated protein
Minute
Magnesiumchlorid
Moloney murine leukemia virus
messenger-RNA
National Center for Biotechnology Information
non fat dried milk
Neuroblastoma RAS viral (v-ras) Oncogene
homolog
open reading frame
Objektträger
phosphate buffered saline
polymerase chain reaction
rekombinante Adeno-assoziierte Viren
receptor for advanced glycation end products
Ribonukleinsäure
rounds per minute
Raumtemperatur
sonicated Dog-DNA
salmon-sperm-DNA
Sekunde
sodium-saline Citrat
Bakteriophage T4
Tris-Acetat-EDTA-Puffer
Thermus aquaticus DNA Polymerase
Tris-EDTA
Unit
Untranslatierte Region
Ultraviolett
Volt
virus genome titer
Volumen
Zinc finger protein 331 Gen
VIII
1. Einleitung
1.
Einleitung
Für die Erforschung der genetischen Grundlagen von Krebserkrankungen werden
schon seit geraumer Zeit Tiermodelle verwendet. Allerdings wurde dabei bisher zum
großen Teil auf Nagetiermodelle zurückgegriffen, bei denen die Tumoren unter Suppression des Immunsystems induziert oder transplantiert wurden. Erst in den letzten
Jahren ist der Hund als Modelltier in den Mittelpunkt des Interesses gerückt. Hund
und Mensch teilen den gleichen Lebensraum, haben eine ähnliche Ernährung und
sind somit in der Regel den gleichen Lebensbedingungen ausgesetzt. Umwelteinflüsse, die unter Umständen kanzerogen wirken können, betreffen daher beide Spezies
in ähnlicher Weise (Vail and MacEwen, 2000). Im Falle einer Erkrankung steht dem
Tier bzw. seinem Halter die moderne Tiermedizin auf hohem Niveau zur Verfügung,
bei der die Behandlung und der Krankheitsverlauf von spezialisierten Tierärzten zumeist lückenlos dokumentiert werden (Ostrander et al., 2000). Die Bereitschaft der
Tierhalter, an Studien teilzunehmen und dem Tier die bestmögliche Behandlung zukommen zu lassen, ist in den meisten Fällen sehr hoch. Verschiedene Untersuchungen haben gezeigt, dass der Hund etwa doppelt so häufig an Krebs erkrankt wie der
Mensch, wobei einige Krebsarten eine höhere Inzidenz aufweisen als andere
(Withrow and MacEwen, 1989; Nolte and Nolte, 2000; Vail and MacEwen, 2000;
Withrow and MacEwen, 2001). Die überwiegende Zahl der Tumoren des Hundes entsteht spontan, d.h. die Tumoren müssen – im Gegensatz zu den häufig verwendeten
Nagetiermodellen – nicht künstlich induziert oder transplantiert werden (Mayr et al.,
1991a; Bartnitzke et al., 1992a; Bartnitzke et al., 1992b; Mayr et al., 1992b; Mayr et
al., 1993; Nolte et al., 1993; Hahn et al., 1994; Reimann et al., 1996b; Reimann et al.,
1999b; Thomas et al., 2003; Meyer et al., 2004a; Murua Escobar et al., 2004a). Sie
zeigen in vielen Fällen eine ähnliche Biologie und Histopathologie wie Tumorerkrankungen beim Menschen, bedingt durch die kürzere Lebensspanne des Hundes entwickeln sie sich jedoch in weitaus kürzerer Zeit. Für die Forschung ist dieser Umstand
insofern von Vorteil, als er die Beobachtung der Tumorentwicklung und der Wirksamkeit der gewählten Therapie vereinfacht (Withrow and MacEwen, 1989; MacEwen,
1990; Hahn et al., 1994). Man geht davon aus, dass eine randomisierte klinische Studie für ein neues Medikament am Hundemodell in ca. 1 – 3 Jahren abgeschlossen
sein kann, während eine vergleichbare Studie am Menschen etwa 5 – 15 Jahre in
Anspruch nimmt (Hansen and Khanna, 2004). Dabei erlauben die Anatomie und die
Physiologie des Hundes eine größere Übertragbarkeit der gewonnenen Erkenntnisse
1
1. Einleitung
auf den Menschen als dies zwischen Nagern und Menschen der Fall ist (Kirkness et
al., 2003). Die Anatomie von Hunden zeigt gegenüber der Anatomie von Nagetieren
deutliche Vorteile im Hinblick auf die Evaluierung verschiedener therapeutischer Methoden und deren Übertragbarkeit auf den Menschen. Diese Methoden beinhalten z.
B. Operationstechniken, Chemotherapie, Bestrahlung, Hyperthermie aber auch Gentherapie. So dienten z.B. Hunde mit Osteosarkomen als Modell für die Entwicklung
neuer Operationstechniken, die heute in der Versorgung kindlicher und adulter Knochentumoren eingesetzt werden (Withrow et al., 1993; Hansen and Khanna, 2004).
Das canine Osteosarkom zeigt viele Gemeinsamkeiten mit dem menschlichen kindlichen Osteosarkom bezüglich z.B. der Histologie des Primärtumors, Mikrometastasierung und Ansprechen auf Chemotherapeutika wie Cisplatin und Anthracycline. Andere canine Tumorerkrankungen, die große Ähnlichkeiten bezüglich der Tumorbiologie
zu ihrem menschlichen Pendant aufweisen sind z.B. das canine Non-HodgkinLymphom (NHL), welches ein gutes Modell für das humane NHL und andere spontan
auftretende Neoplasien des lymphatischen Systems darstellt, sowie das canine Prostatakarzinom (Hansen and Khanna, 2004). Hunde sind neben dem Menschen die
einzigen Säugetiere, bei denen das Prostatakarzinom spontan auftritt. In beiden Spezies handelt es sich um eine invasive Erkrankung mit einer Neigung zur Metastasierung in Knochen oder Lunge durch das Blut oder das lymphatische System. Dabei
sind vorrangig ältere Individuen betroffen, mit einem durchschnittlichen Erkrankungsalter von 10 Jahren bei Hunden und 71 Jahren beim Menschen (MacEwen, 1990;
Switonski et al., 1996; Boutemmine et al., 2002; Bertz et al., 2004). Die Verwendung
des Hundemodells erlaubt Biopsien von betroffenem und nicht betroffenem Gewebe
sowie die wiederholte Untersuchung von Körperflüssigkeiten wie Serum, Blut und Urin. Dabei werden Studien, die letztlich auch dem behandelten Tier zu Gute kommen,
besser von der Öffentlichkeit akzeptiert als Studien an eigens gezüchteten Labortieren (Hansen and Khanna, 2004). Die gesammelten Proben von betroffenen Tieren
ermöglichen schließlich eine Vielzahl verschiedener Studien wie z.B. Untersuchungen
zur Molekulargenetik und Molekularbiologie der Erkrankungen.
Sowohl die Tumoren des Hundes als auch des Menschen weisen verschiedene
chromosomale Aberrationen auf, die in die Tumorgenese involviert sind. Im Menschen sind eine Vielzahl verschiedener numerischer Aberrationen, wie Tri- und Monosomien (Anastasi et al., 1992; Bullerdiek et al., 1993; Banerjee et al., 1997; Mitel2
1. Einleitung
man et al., 1997; Czepulkowski et al., 2002), aber auch chromosomale Rearrangierungen (Collins et al., 1987; Ashar et al., 1995; Petit et al., 1996; Dal Cin et al., 1998;
Tallini and Dal Cin, 1999; Ligon and Morton, 2000; Lemke et al., 2001) bekannt. Der
im Vergleich zum Menschen äußerst komplexe Karyotyp des Hundes macht zytogenetische Untersuchungen an caninen Tumoren ungleich schwerer. Der Hund besitzt
76 akrozentrische Autosomen, die sich in der Größe nur gering unterscheiden, sowie
metazentrische X- und Y-Chromosomen. Bedingt durch diesen komplexen Karyotyp
kam es erst spät zur Erstellung einer einheitlichen Nomenklatur für canine Chromosomen (Selden et al., 1975; Manolache et al., 1976; Stone et al., 1991; Graphodatsky
et al., 1995; Reimann et al., 1996a; Breen et al., 1999a). Im Vergleich zu der Situation
beim Menschen, sind Berichte über chromosomale Veränderungen im Hund immer
noch rar. Dennoch fielen verschiedene, numerische und strukturelle, chromosomale
Aberrationen auf, die als Ursache für verschiedene Krankheitsbilder beim Menschen
schon seit geraumer Zeit bekannt sind. Darunter befinden sich Mono- oder Trisomien
der X-Chromosomen, zentrische Fusionen und reziproke Translokationen, wobei letztere jedoch einen sehr geringen Anteil darstellen (Switonski et al., 2004). In caninen
Neoplasien finden sich überwiegend Trisomien, welche als dritte Kopie eines Chromosoms oder als Isochromosomen auftreten können (Bartnitzke et al., 1992b; Nolte
et al., 1993; Mayr et al., 1994; Reimann et al., 1996b; Reimann et al., 1998), aber
auch verschiedene strukturelle Veränderungen wie Translokationen (Mayr et al.,
1990a; Hahn et al., 1994) derivative Chromosomen (Reimann et al., 1999b) oder
zentrische Fusionen (Mayr et al., 1991b; Horsting et al., 1999) wurden häufiger beobachtet. Monosomien caniner Chromosomen werden hier eher selten beschrieben
(Mayr et al., 1991a). In einer Studie, in der 270 canine Tumoren verschiedenen histologischen Ursprungs untersucht wurden, konnten in 23% der Fälle klonale zytogenetische Veränderungen sowohl in benignen, als auch in malignen Tumoren gefunden
werden. Beide Gruppen zeigten einer höhere Inzidenz für klonale Veränderungen bei
den mesenchymalen Tumoren, wie Sarkome und Lipome, als bei den epithelialen
Tumoren. Diese Erkenntnis ist vergleichbar zu den Verhältnissen beim Menschen
(Reimann et al., 1999a).
Durch die Verwendung von Painting-Sonden (reciprocal Zoo-FISH) konnte gezeigt
werden, dass die caninen Chromosomen in weiten Abschnitten Homologien zu den
Chromosomen des Menschen aufweisen, so dass verschiedene Abschnitte der cani3
1. Einleitung
nen Chromosomen bestimmten Regionen der menschlichen Chromosomen zugeordnet werden konnten (Breen et al., 1999b; Yang et al., 1999). Ähnlich wie beim Menschen ist auch für den Hund zwischenzeitlich die Genomsequenz bekannt
(McPherson et al., 2001b; Venter et al., 2001; Lindblad-Toh et al., 2005). Den Nachweis einzelner Gene, die Homologien zwischen beiden Spezies aufweisen liefert die
sog. Fluoreszenz in situ Hybridisierung (FISH). Im Gegensatz zu den PaintingSonden, welche relativ große Bereiche (bis zu 2000 kb) überspannen können, werden für das Mapping bestimmter Gene relativ kleine, genspezifische Sonden (100 –
300 kb) verwendet. Im Jahr 2001 waren bereits etwa 1246 Gene (McPherson et al.,
2001a) und im März 2006 bereits etwa 11000 Gene im menschlichen Genom lokalisiert (NCBI, 2006). Mit Hilfe des sog. physikalischen Mappings war es bis 2004 gelungen, ca. 70 verschiedene (krankheitsrelevanter) Gene im Genom des Hundes zu
lokalisieren (Switonski et al., 2004), darunter zum Beispiel das hypocretin (orexin)
receptor 2 Gene (Hcrtr2), welches im Zusammenhang mit caniner Narkolepsie steht,
auf dem Chromosom 12 des Hundes (Lin et al., 1999), das canine Her2 /neu
(ERBB2) auf Chromosom 1q13.1 des Hundes (Murua Escobar et al., 2001) sowie die
caninen High mobility Group Proteine HMGA1 und HMGB1 auf den Chromosomen 23
bzw. 25 des Hundes (Becker et al., 2003; Murua Escobar et al., 2003).
Viele dieser Gene wie z.B. die Mitglieder der HMG-Proteinfamilie sind evolutionär
hochkonserviert. So weist z.B. das canine HMGB1 für das vollständige Gen eine Sequenzhomologie von 90,8% zum Menschen auf. Betrachtet man nur die codierenden
Sequenzen, so ist diese Homologie noch höher und beträgt 95,4 %. Das daraus resultierende Protein ist zu 100% identisch zu seinem menschlichen Gegenstück
(Murua Escobar et al., 2003). Die HMGB1 Proteine spielen eine wichtige Rolle bei der
Organisation der Chromatinstruktur (Wolffe, 1994). Mit ihren DNA-Bindungsdomänen,
den sog. HMG-Boxen binden sie mit hoher Affinität sequenzunspezifisch an die kleine
Furche doppelsträngiger DNA, was zu einer Aufbiegung in Richtung der großen Furche führt. Diese partielle Biegung der DNA beeinflusst die Bindung von Transkriptionsfaktoren, indem deren Bindungsaffinität herauf- oder herabgesetzt wird (Bustin
and Reeves, 1996).
Schwerpunkt der vorliegenden Arbeit waren die Untersuchungen caniner HMGA Proteine. Die evolutionär ebenfalls hochkonservierten HMGA Proteine werden von zwei
verschiedenen Genen, die als HMGA1 und HMGA2 bezeichnet werden, codiert. Dabei verfügt HMGA1 über zwei Splicevarianten, die wiederum als HMGA1a und
4
1. Einleitung
HMGA1b bezeichnet werden. Alle drei Proteine stellen wichtige architektonische
Transkriptionsfaktoren dar. Die HMGA Proteine verfügen über drei DNA-bindende
Domänen, die sog. AT-Hooks, mit denen sie an AT-reiche Sequenzen in der kleinen
Furche der DNA-Doppelhelix binden und bedeutende Funktionen in der GenRegulation und Chromatin-Organisation übernehmen: Es wird angenommen, dass
HMGA Proteine in chromosomale Rearrangierungen in verschiedenen Tumoren involviert sind und die Bildung von Multi-Protein-Komplexen, den sog. Enhanceosomen
in Promoterregionen fördern und dadurch das Expressionsmuster einer Vielzahl von
Genen, sowohl in positiver, als auch in negativer Weise beeinflussen (Friedmann et
al., 1993; Schoenmakers et al., 1995; Reeves, 2000; Reeves et al., 2001).
Für den Menschen ist eine Vielzahl maligner Neoplasien bekannt, deren Entstehung
mit der Überexpression von HMG-Genen assoziiert zu sein scheint (Chiappetta et al.,
1995; Fedele et al., 1996; Rogalla et al., 1997; Xiang et al., 1997; Tallini and Dal Cin,
1999; Abe et al., 2000; Fedele et al., 2001; Flohr et al., 2001; Brezniceanu et al.,
2003; Czyz et al., 2004; Miyazawa et al., 2004; Takaha et al., 2004; Ishiguro et al.,
2005; Sarhadi et al., 2006). Die Überexpression von HMGA Proteinen ist charakteristisch für eine Vielzahl maligner Tumoren, was auf eine Verbindung zwischen einem
hohen Titer des Proteins und der neoplastischen Veränderung hinweist (Tamimi et
al., 1993; Chiappetta et al., 1995; Fedele et al., 1996; Bandiera et al., 1998; Chiappetta et al., 1998; Abe et al., 1999; Abe et al., 2000; Czyz et al., 2004). Insbesondere in
menschlichen Prostatakarzinomen ist die Überexpression von HMGA Proteinen mit
dem Auftreten eines hochmalignen Phänotyps assoziiert, daher wird die HMGAExpression in (Prostata-)Tumoren als molekularer Marker diskutiert (Tamimi et al.,
1993; Scala et al., 2000; Takaha et al., 2002). Diese Vermutung wird durch die Befunde von Scala et al. unterstützt, die im Jahr 2000 nachweisen konnten, dass eine
Antisense Therapie mit Hilfe adenoviraler Vektoren in Nacktmäusen mit induzierten
HMGA2 positiven Tumoren zu einer deutlichen Verkleinerung der Tumoren führte,
ohne dabei die gesunden Zellen zu beeinflussen.
Die vorliegende Arbeit gliedert sich im Wesentlichen in fünf Abschnitte: Zunächst
wurden verschiedene canine Neoplasien zytogenetisch untersucht und auf das Vorhandensein wiederkehrender chromosomaler Aberrationen, wie sie vom Menschen
bereits bekannt sind, untersucht. Anschließend erfolgte die molekular-zytogenetische
Lokalisation verschiedener tumorrelevanter Gene im caninen Genom (FISH5
1. Einleitung
Mapping). Für die weitere molekulargenetische Untersuchung einzelner tumorrelevanter Gene wurde zunächst eine Gewebebank für canine Tumoren und Normalgewebe aufgebaut. Verschiedene Proben aus dieser Gewebebank, sowie Zellen aus
einer im Rahmen der vorliegenden Arbeit neu etablierten, spontan immortalisierten
Zell-Linie wurden anschließend auf die Expression von HMGA Proteinen untersucht.
Zusätzlich wurde die Zell-Linie für die Entwicklung von Modellen zur Gentherapie mit
Hilfe von Adeno-assoziierten Viren verwendet.
6
Material und Methoden
2.
Material und Methoden
2.1. Primärzellkultur von Adhäsionskulturen
Gewebeproben verschiedener Tumoren zur zytogenetischen Untersuchung wurden
entweder in der Tierärztlichen Hochschule Hannover oder an der Medizinischen
Hochschule Hannover entnommen und in 13 ml-Röhrchen mit Hanks-Lösung (200
IU/ml Penicillin, 200µg/ml Streptomycin) an das Zentrum für Humangenetik geschickt.
Jede Probe wurde mit Hilfe einer Pinzette und einer Pinzettenschere zerkleinert und
mit 4 ml 0,35% Collagenase (200 U/ml, Serva) versetzt. Die Suspension mit den vereinzelten Tumorzellen wurde in ein bis drei 50 ml-Zellkulturflaschen mit jeweils 5 ml
Medium 199 (Earle’s Salze, 20% fötales Kälberserum, 2% Antibiotika) bei 37°C, 5%
CO2 und 95%iger Luftfeuchte inkubiert. Nach 24 Stunden wurde die Anheftung der
Zellen im Phasenkontrastmikroskop (Zeiss) kontrolliert. Bei angewachsenen Zellen
wurde zweimal pro Woche ein Mediumwechsel durchgeführt. Die Subkultivierung
dicht gewachsener Zellschichten erfolgte durch Inkubation mit 1 ml Trypsin/EDTA Lösung (Biochrom) bei 37°C und Verteilen der Zellen auf zwei bis drei neue mit Medium 199 gefüllte 50 ml-Zellkulturflaschen. Das Zellwachstum wurde im Phasenkontrastmikroskop überprüft, bei hohem Mitoseindex wurden von verschieden Passagen
der Kultur Chromosomen präpariert.
2.2. Primärzellkultur von Suspensionskulturen
2.2.1. Zellkultur von Knochenmarkaspiraten
Knochenmarkaspirate wurden in der Tierärztlichen Hochschule Hannover entnommen, mit 1 ml Heparin (Roche) versetzt und an das Zentrum für Humangenetik geschickt. Jeweils ca. 1 ml des Aspirates wurden semisteril in 50 ml-Zellkulturflaschen
gegeben, die zuvor mit je 10 ml Chromosomenmedium A (Biochrom), RPMI 1640(Gibco), und McCoy-Medium (Biochrom) versehen worden waren. Die Zellkulturflaschen wurden für 48 Stunden im Wärmeschrank bei 37°C inkubiert. Nach 48 Stunden
wurden Metaphase-Chromosomen präpariert.
2.2.2. Zellkultur von Lymphozyten
Für die Durchführung der FISH-Untersuchungen wurden Präparate aus caninen Lymphozyten hergestellt. Hierzu wurde in der Tierärztlichen Hochschule Hannover von
7
Material und Methoden
gesunden Hunden 10 ml venöses Blut in 1 ml Heparin (Roche) aufgenommen und
zugeschickt. Jeweils 1 ml dieses Vollblutes wurden für 4 Tage in 10 ml Chromosomenmedium B (Biochrom) bei 37°C semisteril kultiviert und anschließend MetaphaseChromosomen präpariert.
2.3. Kultivierung von Zelllinien
Für die Erzeugung Adeno-Assoziierter Viren für die Gentherapie mit Hilfe des AAVHelper-Free Sytems (Stratagene) wurden die Zelllinien „AAV-293“ und „HT 1080“
nach Herstellerangaben im „Instruction Manual“ kultiviert.
2.4. Kryokonservierung von Zellkulturen
2.4.1. Einfrieren lebender Zellen
Von den Primärzellkulturen sowie von den Zelllinien erfolgte in verschiedenen Passagen eine Kryokonservierung. Hierzu wurden Zellen in dicht gewachsenen Monolayern
trypsiniert, in ca. 2 ml eiskaltem Medium-DMSO-Gemisch (10% DMSO, Janssen)
aufgenommen, in ein Kryo-Röhrchen überführt und auf Eis gelagert. Das schrittweise
Einfrieren der Zellen erfolgte durch ein Einfriergerät für biologisches Material. Das
Gerät verfügt über eine programmierbare Einheit und einen daran gekoppelten CTEMessfühler, welcher die aktuelle Temperatur misst. Das Programm (0,7°C/min bis –
12°C und 1°C/min bis –120°C) wurde gestartet, nach Ablauf wurden die KryoRöhrchen in flüssigem Stickstoff gelagert.
2.4.2. Auftauen gefrorener Zellen
Das Auftauen gefrorener Zellen erfolgte durch Entnahme des Röhrchens aus dem
Stickstoff und Inkubation bei 37°C im Wasserbad. Die aufgetaute Zellsuspension
wurde mit 8 ml Medium gewaschen und in eine mit Medium gefüllte Kulturflasche überführt. Die Kultivierung erfolgte unter den in Kapitel 2.1. genannten Bedingungen.
Nach 24 Stunden wurde ein Mediumwechsel durchgeführt.
8
Material und Methoden
2.5. Zytogenetische Methoden
2.5.1. Chromosomen-Präparation von Adhäsionskulturen
In dicht bewachsene Kulturflaschen mit einem hohen Mitose-Index wurden 60 µl Colcemid (0,1µg/ml, Biochrom) gegeben und weitere 90 bis 120 min inkubiert. Das Medium/Colcemid-Gemisch wurde abgesogen, die Zellen mit ca. 5 ml PBS gewaschen
und trypsiniert. Die abgelösten Zellen mit den darin enthaltenen Metaphasen wurden
anschließend mit 5 ml, hypotoner Medium 199-Lösung (1:6, Medium 199:Aqua bidest) für 25 min bei RT auf dem Schüttler inkubiert. Die so freigelegten Zellkerne
wurden mit einem 3:1 Methanol/Eisessig-Gemisch fixiert und anschließend über
Nacht bei -20°C gelagert. Diese Suspension wurde auf 4°C gekühlte, in dH2O gewässerte Objektträger getropft. Die so entstandenen Präparate mit MetaphaseChromosomen wurden für mindestens sechs Tage bei 37°C getrocknet.
2.5.2. Chromosomenpräparation von Suspensionskulturen
Nach Ablauf der jeweiligen Kultivierungszeiten wurden in die Suspensionskulturen
jeweils 100 µl Colcemid (0,1µg/ml, Biochrom) gegeben und für weitere zwei Stunden
bei 37°C inkubiert. Die hypotone Behandlung erfolgte mit 37°C warmer 1/15 M KCl für
15 (Knochenmark) bzw. 20 min (Lymphozyten). Nach der Fixierung mit Methanol/Eisessig erfolgte die Lagerung über Nacht bei –20°C. Am nächsten Tag erfolgte
die in Kapitel 2.5.1 beschriebene Herstellung der Chromsomen-Präparate.
2.5.3. GTG-Färbung
Zur Erstellung von Karyogrammen wurde an den auf die Objektträger aufgebrachten
und getrockneten Metaphase-Chromosomen eine GTG-Banding (modifiziert nach
Seabright, 1971) durchgeführt. Hierzu wurden 15 mg Trypsin-Trockensubstanz (Difco) in 50 ml auf 37°C vorgewärmten Sörensen-Puffer (pH 6,8) für mind. 6 min gelöst.
In diese Lösung wurden die Präparate für 6 sec eingetaucht, anschließend in einer
2%igen Giemsa-Lösung (Merck) für 10 min gefärbt. Nach dreimaligem Spülen in dH20
wurden die Präparate luftgetrocknet. Für eine dauerhafte Lagerung wurden die Präparate mit Entellan (Merck) eingedeckt.
Für den Einsatz der Präparate in der FISH wurde die GTG-Banding weiter modifiziert.
Um ein zu starkes Angreifen der Metaphase-Chromosomen zu verhindern, wurden
9
Material und Methoden
die chromosomalen Proteine lediglich mit 1,2 mg Trypsin-Trockensubstanz in Sörensen-Puffer für nur 6 sec verdaut und anschließend für 7 min in einer 1%igen GiemsaLösung gefärbt. Für die Karyotypanalyse geeignete Metaphase-Chromosomen wurden aufgenommen (siehe Kapitel 2.5.4), die Objektträger mit einer 70%igen EthanolLösung für 15 min bei RT auf dem Schüttler entfärbt und anschließend luftgetrocknet.
2.5.4. Karyotypanalyse
Es wurden Karyotypanalysen für canine Tumoren und Knochenmarksaspirate durchgeführt, indem geeignete GTG-gefärbte Metaphase-Chromosomen an einem Durchlichtmikroskop mit Hilfe einer digitalen Aufsatz-Kamera (Neuberger) und der PSISoftware (Perceptive Scientific Instruments) „MacKType, Version 5.5.1“ aufgenommen wurden. Die Karyogramme wurden am Computer nach der Nomenklatur von
Reimann et al. (1996a) erstellt. Für jedes Chromosomen-Mapping wurden zehn gut
gespreitete Metaphasen wie oben aufgenommen und bearbeitet. Gegebenenfalls
wurden von den Chromosomen dieser Metaphasen ebenfalls Karyogramme nach der
oben genannten Nomenklatur erstellt.
2.6. Molekular-zytogenetische Methoden
2.6.1. DNA-Isolierung aus caninem Vollblut
Aus ca. 10 ml Vollblut wurde gesamt genomische Hunde DNA isoliert. Die Isolierung
erfolgte mit Hilfe des DNA-Isolation Kits der Firma Puregene wie folgt: Lyse der Erythrozyten durch Zugabe des dreifachen Volumen RBC-Lysis Solution und Inkubation für 10 min bei +4°C. Zentrifugation für 10 min bei 2000 xg und 4°C, Resuspendieren der Lymphozyten, Zugabe der Cell lysis Solution und Inkubation über Nacht bei
4°C. Am nächsten Tag erfolgte die Zugabe der Protein Precipitation-Solution und erneute Zentrifugation für 10 min bei 2000 xg sowie die Fällung der DNA durch Zugabe
von Isopropanol (Roth) zum Überstand und erneute Zentrifugation für 10 min bei
2000xg. Das DNA-Pellet wurde mit Ethanol (Riedel del Haen) gewaschen anschließend getrocknet und in 50 µl DNA Hydration Solution aufgenommen.
10
Material und Methoden
2.6.2. Fluoreszenz-in-situ-Hybridisierung (FISH)
FISH Experimente wurden zum chromosomalen Mapping verschiedener, PCR gescreenter BAC-Klone durchgeführt. Als Präparate dienten dabei Objektträger mit fixierten Metaphase-Chromosomen caniner Lymphozyten (siehe Kapitel 2.5.2)
2.6.2.1. Markierung der Sonden DNA durch Nick-Translation
Die Sonden bestanden aus der isolierten DNA verschiedener BAC-Klone, die zu
menschlichen Genen homologe Sequenzen enthielten. In diese DNA wurden mittels
Nick-Translation Digoxigenin markierte Nukleotide (DIG-11-UTPs) eingefügt. Das Labelling wurde nach dem Protokoll des Herstellers „Dig-Nick-Translation-Mix for in situ
probes“ (Roche Diagnostics) durchgeführt. Die Lösung wurde mit 19 µl TE-Puffer
verdünnt und bis zur Verwendung bei +4°C gelagert.
2.6.2.2. Herstellung von ultraschall-behandelter Hunde DNA (sdDNA)
Die in Kapitel 2.6.1 isolierte DNA wurde 3 mal für 45 sec mit Ultraschall behandelt.
Die Länge der so entstandenen DNA-Fragmente wurde mit Hilfe einer Gelelektrophorese überprüft, erfahrungsgemäß liefern Fragmentlängen von ca. 100 –300 bp die
besten Ergebnisse.
2.6.2.3. Hybridisierung
Die vorbereiteten Präparate wurden bei Bedarf mit Pepsin-Lösung (Merck) verdaut, in
2xSSC gewaschen, in einer –20°C kalten, aufsteigenden Ethanolreihe (70%, 80%,
90%, 100%) dehydriert und anschließend getrocknet. Die Präparate wurden zur Denaturierung der Chromosomen in einer 70°C heißen 70% Formamid/ 2xSSC-Lösung
inkubiert, anschließend in eiskaltem 2 x SSC gewaschen, abermals entwässert und
getrocknet. Für den Hybridisierungsmix wurden pro OT 8µl markierte Sonden-DNA
mit 4 µl ssDNA (Sigma), 1µg sd-DNA, 25µl Formamid (Fluka), 10 µl Dextransulfat
(Oncor), 2,5µl 20 x SSC und 2,5 µl SSPE vermischt, denaturiert und prähybridisiert.
Die Hybridisierung erfolgte über Nacht bei 37°C. Für die Posthybridisierung wurden
die Präparate in 42°C warmer 50% Formamid/ 2 x SSC-Lösung für 15 min, 42°C
warmen 2 x SSC-Lösung für 8 und in 1 x PBS gewaschen. Die Präinkubation erfolgte
mit jeweils 100 µl 5% NFDM/ 4 x SSC für 10 min bei 37°C. Zur Färbung der SondenDNA wurden die OTs mit 100 µl Anti-Dig-Lösung für 20 min inkubiert, nicht gebundene Anti-Dig-Lösung wurde durch dreimaliges Spülen mit 1 x PBS wieder abgewa11
Material und Methoden
schen. Die Präparate wurden getrocknet und durch Auftragen von Antifade-Solution
gegengefärbt. Die Auswertung erfolgte an Mikroskop und Computer.
2.6.2.4. Auswertung
Die Auswertung der FISH-Versuche erfolgte an den zuvor ausgesuchten Metaphasen
(siehe Kapitel 2.5.3) an einem UV- Durchlichtmikroskop mit Hilfe einer digitalen Aufsatz-Kamera (Neuberger) und der PSI-Software (Perceptive Scientific Instruments)
„MacProbe, Version 4.0“.
2.6.3. Erzeugung Adeno-assoziierter Viren
Zur Erzeugung von Adeno-assoziierten Viren, welche das gewünschte Gen als Insert
tragen, wurden die kultivierten AAV-293 Zellen mit den drei Plasmiden pHelper, pAAV
RC und pAAV MCS nach Anleitung im „AAV Helper-Free System instruction manual“
(Stratagene) transfiziert. Es wurden verschiedenartige Viren erzeugt, indem das gewünschte Gen in sense (Lac Z) oder antisense Richtung (HMGA1 und HMGA2) in
das pAAV MCS Plasmid kloniert wurde. Zusätzlich wurden Viren ohne Insert erzeugt,
welche in späteren Untersuchungen als Negativkontrollen dienen sollten. Eine Negativkontrolle für die Virusproduktion wurde durchgeführt, indem mindestens eines der
drei Plasmide durch Puffer ersetzt wurde. Die Virusernte wurde nach 72 Stunden ebenfalls nach dem „AAV Helper-Free System instruction manual“ (Stratagene) durchgeführt. Der so gewonnene primäre Virusstock wurde zunächst bei 37°C einem DNAse I (Sigma) Verdau unterzogen und anschließend nach Herstellerangaben im „ViraKit AAV-Instruction Booklet for Purification Kit (Virapur)“ aufgereinigt. Abschließend
wurde der Virustiter mit Hilfe einer universellen Real-Time PCR für Adeno-assoziierte
Viren bestimmt.
2.6.4. Proliferationsassays mit Adeno-assoziierten Viren und CT
1258
Der Effekt von Adeno-assoziierten Viren, welche HMGA1 und HMGA2 in Antisense
Orientierung tragen, auf HMGA überexprimierende Zellen wurde mit Hilfe der spontan
immortalisierten Zell-Linie CT1258 überprüft. Hierzu wurden CT1258 Zellen in einer
Dichte von 2.500 Zellen in 96-well Platten mit 100 µl 20% Medium 199 ausgesät und
über Nacht bei 37°C, 5% CO2 und 95%iger Luftfeuchte inkubiert. Das Medium wurde
12
Material und Methoden
abgesogen und durch 50µl L-199 Medium (Earle’s Salze, 2% fötales Kälberserum,
2% Antibiotika) ersetzt. Die Zellen wurden in unterschiedliche Gruppen geteilt: 1. Zugabe von 50 vg/Zelle rAAV as-HMGA (25/25 vg/Zelle rAAV-asHMGA1a/rAAVasHMGA2), 2. Zugabe von 50 vg/Zelle rAAV-LacZ und 3. keine Zugabe von Viren.
Die Gruppen 2 und 3 dienten als Kontrollen. Um Kreuzkontaminationen zu vermeiden, wurden alle Experimente auf separaten Platten durchgeführt. Während der folgenden 90 min. Inkubation bei 37°C wurden die Platten alle 30 min. vorsichtig geschwenkt, anschließend wurden jeweils 50 µl H-199 Medium (Earle’s Salze, 18% fötales Kälberserum, 2% Antibiotika) in die Wells gegeben. Nach einer Inkubationszeit
von 60 Stunden bei 37°C, 5% CO2 und 95%iger Luftfeuchte, erfolgte die Zugabe von
BrdU in die Wells und eine weitere Inkubation von 12 Stunden unter gleichen Bedingungen. Die weitere Behandlung des Assays erfolgte nach Herstellerangaben der
„General Assay Procedure, Cell Proliferation ELISA BrdU (colorimetric)“(Roche). Die
Messung der Absorption wurde im Multidetection Microplate Reader „Synergy“ (Biotek) bei einer Wellenlänge von 370 nm durchgeführt.
2.7. Erstellen der Gewebebank
2.7.1. Entnahme von Gewebeproben
Die canine Gewebebank soll als Grundlage weitgehender molekularbiologischer Untersuchungen dienen. Die Gewebesammlung wurde in Kooperation mit der Klinik für
kleine Haustiere der Tierärztlichen Hochschule Hannover entwickelt und aufgebaut.
Die Entnahme von Gewebeproben erfolgte während der chirurgischen Versorgung
der Tiere oder direkt nach deren Euthanasie unter sterilen OP-Bedingungen. Gewebeproben von Tumoren und Normalgeweben wurden mit sterilen Instrumenten zerkleinert um mehrere Proben in geeigneter Größe herzustellen. Diese wurden in sterile
Kryogefäße mit Schraubgewinde gegeben und mit der Angabe der hausinternen Kliniknummer des jeweiligen Patienten und des Inhalts des Röhrchens beschriftet. Die
Gefäße wurden dicht verschlossen und schnellstmöglich in flüssigen Stickstoff überführt um das Gewebe Schock zu gefrieren. Von allen Geweben wurde eine Probe zur
histopathologischen Untersuchung in Formalin eingelegt. Zusätzlich zu den Gewebeproben wurden den jeweiligen Hunden routinemäßig verschiedene Blut- (EDTAVollblut, Heparin-Plasma, EDTA-Plasma, Serum) und Urinproben entnommen und
nach analoger Beschriftung ebenfalls tiefgefroren.
13
Material und Methoden
2.7.2. Lagerung der Gewebeproben
Die weitere Lagerung der schockgefrorenen Gewebeproben erfolgte bei –80°C. Die
Kryogefäße wurden dazu aus dem flüssigen Stickstoff entnommen und schnellstmöglich in Polypropylenboxen mit 10 x 10 Raster überführt, welche wiederum in Metallracks einsortiert und in einem –80°C Gefrierschrank gelagert wurden. Das 10 x 10
Raster und die Nummerierung der Boxen ermöglichte die Zuordnung einer bestimmten Probe zu einem bestimmten Lagerort, um die Wiederauffindbarkeit der Proben zu
gewährleisten.
2.7.3. Katalogisieren der Gewebeproben
Es wurde eine Datenbank unter Verwendung des Programms Microsoft Access programmiert. In diese Datenbank wurden die Patientendaten des jeweiligen Tieres, also
Namen des Besitzers und die hausinterne Kliniknummer, Angaben über Rasse, Alter
und Geschlecht des Tieres sowie über Art der Erkrankung und den histopathologischen Befund eingegeben. Zusätzlich erfolgte eine Verknüpfung dieser Daten mit den
Daten über die Art und den Lagerort der dem Hund zugehörigen Proben.
2.8. Molekulargenetische Methoden
2.8.1. RNA-Isolierung aus Gewebe
Zur Lyse der Zellen wurden ca. 500 mg Gewebe mit 3,75 ml Trizol LS (Gibco BRL)
versetzt. Das Gewebe wurde mit einem Skalpell möglichst fein zerkleinert, der Ansatz
in ein steriles Sarstedt-Röhrchen überführt und 5 min bei RT inkubiert. Zur Fällung
der Proteine wurden 750 µl Chloroform (Fluka) zugegeben, alles für 15 sec. gut gemischt und der Ansatz für 2-3 min bei RT inkubiert. Die Suspension wurde für 15 min
bei 4500 xg und 4°C zentrifugiert, der wässrige, RNA-haltige Überstand in ein neues
Röhrchen überführt und mit 1 Vol. 70% Ethanol vermischt. Dieser Ansatz wurde vollständig auf eine RNeasy midi Säule (Qiagen, Hilden) aufgetragen. Die weiteren
Schritte erfolgten nach Herstellerangaben im „RNeasy midi/maxi Protocol for the Isolation of total RNA from animal tissue“ (Qiagen, Hilden). Nach der Aufreinigung wurde
die enthaltene RNA-Menge im Photometer bei 260 nm quantifiziert.
14
Material und Methoden
2.8.2. RNA-Isolierung aus der Zell-Linie CT 1258
Zur Vorbereitung wurde der Zellrasen jeder Flasche mit 5 ml PBS gewaschen und
durch Zugabe von 500µl Trypsin/EDTA-Lösung (Biochrom) vom Boden abgelöst. Es
folgte eine Zentrifugation für 5 min bei 400 xg und 4°C. Der Überstand wurde verworfen und das Pellet durch Zugabe von 1 ml PBS, Resuspendieren und erneute Zentrifugation für 5 min bei 4500 xg und 4°C gewaschen. Das Zellpellet wurde in 350 µl
RLT-Puffer (Qiagen, Hilden) aufgenommen, mit Hilfe des QIAshredder (Qiagen, Hilden) homogenisiert und mit 1 Vol. 70% Ethanol versetzt. Das Lysat wurde vollständig
auf eine RNeasy mini Säule gegeben und die RNA nach Herstellerangaben im
„RNeasy mini Protocol for the Isolation of total RNA from animal cells“ (Qiagen, Hilden) isoliert. Nach der Aufreinigung wurde die enthaltene RNA-Menge im Photometer
bei 260 nm quantifiziert.
2.8.3. DNase Verdau
Um eine Kontamination der isolierten RNA mit DNA auszuschließen, wurde vor der
Verwendung der RNA für die cDNA-Synthese (siehe Kapitel 2.8.4) ein DNase I –
Verdau durchgeführt. Jeweils 5 µg der isolierten RNA (siehe Kapitel 2.8.1 und 2.8.2)
wurden auf ein Reaktionsvolumen von 87,5 µl gebracht, und mit 10µl RDD-Puffer
(Qiagen, Hilden) und 2,5 µl DNase I stock solution (Qiagen, Hilden) für 10 min bei RT
inkubiert. Anschließend wurde der Ansatz mit Hilfe des „RNeasy miniprotocol for
Cleanup“ (Qiagen, Hilden) nach Angabe des Herstellers aufgereinigt. Der DNase I
Verdau sowie der RNeasy mini clean-up wurden wiederholt und die enthaltene RNAMenge im Photometer bei 260 nm quantifiziert.
2.8.4. cDNA-Synthese
Die cDNA-Erststrangsynthese wurde mit Hilfe von 200 U M-MLV reverser Transkriptase (Invitrogen) nach Herstellerangaben durchgeführt. Im Einzelnen: Mischen von
250 ng der DNase I verdauten RNA in einem Volumen von 10µl mit 1 µl AP2 Primer
AAGGATCCGTCGACATC(17)T (50µM) und 1 µl dNTP-Mix (10mM) und Inkubation
für 5 min bei 65°C. Zugabe von 4 µl 5 x 1st Strand Buffer, 2 µl DTT (0,1M) 1µl RNase
Out und 1 µl M-MLV Reverser Transkriptase (200U/µl) und Inkubation für 50 min bei
37°C. Abbruch der enzymatischen Reaktion durch Inkubation bei 70°C für 15 min.
15
Material und Methoden
2.8.5. Amplifikation von DNA-Fragmenten durch PolymeraseKettenreaktion (PCR)
Zur Etablierung der HMGA2-spezifischen PCR wurden zunächst die ersten bzw. letzten 25 Basen der gewählten Sequenzen als upper bzw. lower Primer eingesetzt. Als
Basis für das Reaktionsschema dienten das „Basic PCR Protokoll“ der Firma Invitrogen und das Protokoll „Taq DNA Polymerase and Q-Solution“ der Firma Qiagen. Als
Template diente die zuvor hergestellte cDNA. Als Template für die positiv-Kontrolle
diente HMGA1- bzw. HMGA2-Plasmid-DNA. Der Reaktionsansatz wurde wie folgt
pipettiert:
Aqua bidest
12,75 µl
10 x PCR-Puffer
2,50 µl
dNTP-Mix je 10 mM
0,50 µl
MgCl2 50 mM
0,75 µl
Q-Solution
5,00 µl
Upper Primer 10 mM
1,25 µl
Lower Primer 10 mM
1,25 µl
cDNA (70 ng/µl)
0,50 µl
Taq DNA Polmerase 5U/µl
0,50 µl
Gesamtvolumen
25,0 µl
Die Amplifikation erfolgte nach einer initialen Denaturierung für 5 min bei 95°C in 35
Zyklen (Denaturierung für 45 sec. 94°C, Annealing für 45 sec. bei 61°C, Elongation
für 45 sec. bei 72°C). Sie endete mit einer finalen Elongation für 10 min bei 72°C.
2.8.6. Gelelektrophoretische Auftrennung der PCR-Fragmente
Für die gelelektrophoretische Auftrennung von DNA-Fragmenten wurden 1,5% Agarosegele (Promega) mit 1 x TAE-Puffer gekocht. Für die Detektion der DNA wurden in
das noch flüssige Gel 1,5 µl Ethidumbromid-Lösung (Oncor) pro 100 ml Gel pipettiert.
DNA-Marker und –Proben wurden jeweils mit 6xGelbeladungspuffer im Verhältnis 5:1
vermischt, in die Geltaschen pipettiert und für 1 h bei 120 Volt in 1xTAE-Puffer aufgetrennt. Der Nachweis der aufgetrennten DNA erfolgte im UV-Durchlicht bei 254 nm
und wurde mit dem Programm ArgusX1 fotografiert.
16
Material und Methoden
2.8.7. Real-Time PCR (Quantitativ)
Für die HMGA2-spezifische Real-Time PCR wurde zunächst wieder eine cDNASynthese durchgeführt (siehe Kapitel 2.8.4), allerdings wurde statt des AP2-Primers
der genspezifische Reverse-Primer eingesetzt. Zusätzlich wurden eine cDNASynthese an einem synthetischen Oligonukleotid, dem sog. Standard, mit definierter
Menge an Transkripten pro 10µl unter den gleichen Bedingungen durchgeführt. Die
eigentliche Real-Time PCR erfolgte im Taq-Man nach folgendem Schema:
Aqua bidest
7,25 µl
2x TaqMan Universal PCR Master Mix
12,50 µl
Upper Primer (10 µM)
1,50 µl
Lower Primer (10 µM)
1,50 µl
Sonde (20µM)
0,25 µl
cDNA (12,5ng/µl)
2,00 µl
Gesamtvolumen
25,0 µl
Die Amplifikation erfolgte nach einer initialen Denaturierung für 10 min bei 95°C in 50
Zyklen (Denaturierung für 15 sec. 95°C, Annealing für 60 sec. bei 60°C).
17
Ergebnisse
3.
Ergebnisse
3.1. Zytogenetische Ergebnisse
Ein Teilaspekt der vorliegenden Arbeit war die zytogenetische Untersuchung verschiedener caniner Neoplasien. Der Hund zeigt einen komplexen Karyotyp mit 76
akrozentrischen Chromosomen, die in ihrer Länge nur wenig variieren und zwei metazentrischen Geschlechtschromosomen, X und Y.
3.1.1. Cytogenetic investigations in four canine lymphomas
I. Winkler S et al., Anticancer Res. 2005
Aus 30 verschiedenen Knochenmarkaspiraten konnten erfolgreich Chromosomen
präpariert werden. Die zytogenetische Analyse von durchschnittlich 10 Metaphasen
pro Fall zeigte in vier Fällen klonale Aberrationen. Der erste Patient, ein fünfjähriger
männlicher Münsterländer (KM15) zeigte ein derivatives Chromosom 13. Während
der zweite Patient, ein sechsjähriger männlicher Münsterländer eine klonale Trisomie
8 aufwies. Der dritte Patient, ein vierjähriger männlicher Deutscher Schäferhund zeigte wiederum eine klonale Trisomie 13 mit zusätzlichen Trisomien der Chromosomen
20, 30 und 37 sowie einer nicht klonalen Tetrasomie 9. Während der vierte Patient,
ein vierjähriger, weiblicher Berner Sennenhund eine einfache Trisomie 2 zeigte. Ein
Vergleich dieser Ergebnisse mit humanen hämatopoetischen Erkrankungen zeigt
bemerkenswerte Übereinstimmungen zwischen beiden Spezies. Berücksichtigt man
die von Yang et al. gefundenen Homologien zwischen menschlichen und caninen
Chromosomen, scheinen in beiden Spezies vergleichbare Regionen von den chromosomalen Aberrationen betroffen zu sein.
Nicht nur das canine Non-Hodgkin-Lymphom, sondern insbesondere auch das canine
Prostatakarzinom zeige große Ähnlichkeiten bezüglich der Tumorbiologie zu ihrem
jeweiligen menschlichen Pendant, daher wurden im folgenden insbesondere canine
Prostata-Karzinome zytogenetisch untersucht.
3.1.2. Establishment of a cell line derived from a canine prostate
carcinoma with a highly rearranged karyotype
II. Winkler S et al., J Hered. 2005
Canine Prostatakarzinome zeigen viele Übereinstimmungen zu ihrem menschlichen
Gegenstück, wie zum Beispiel durchschnittliches Erkrankungsalter und Metastasie18
Ergebnisse
rungsverhalten. Zytogenetische Untersuchungen an humanen Prostatakarzinomen
zeigten eine Reihe von chromosomalen Aberrationen. Zur Überprüfung, ob sich auch
in caninen Tumoren vergleichbare zytogenetische Aberrationen finden lassen, wurde
ein Prostatatumor eines 10-jährigen Briards zytogenetisch untersucht. Die Kultivierung von Zellen des Tumors mit der Nummer CT 1258 resultierte in gut wachsenden
Zellen mit einer hohen Mitoserate. Zum Zeitpunkt der Publikation befanden sich die
Zellen in der 55. Passage der Zellkultur, was auf eine spontane Immortalisierung der
Zellen hinweist. Die zytogenetische Untersuchung der Zellen ergab einen annähernd
tetraploiden Karyotyp mit vielen zentrischen Fusionen und den daraus resultierenden
zweiarmigen Markerchromosomen. Die Chromosomenanzahl reichte von 81 bis 131.
Der stark rearrangierte Karyotyp machte eine genaue Identifikation aller Chromosomen unmöglich, jedoch konnten zentrische Fusionen der Chromosomen vier und fünf
in ca. der Hälfte aller untersuchten Metaphasen und zentrische Fusionen der Chromosomen eins und fünf sowie ein Markerchromosom, bestehend aus Material der
Chromosomen eins und zwei in allen untersuchten Metaphasen gezeigt werden.
3.1.3. Polysomy 13 in a canine prostate carcinoma underlining its
significance in the development of prostate cancer
III. Winkler S et al., Cancer Genet Cytogenet. 2006
Zur weiteren Überprüfung ob sich in caninen Prostatakarzinomen ähnliche Chromosomenaberrationen wie in menschlichen Tumoren der Prostata zeigen, wurde ein
Tumoraspirat eines caninen Prostatakarzinoms zytogenetisch untersucht. Die Zellkultur dieses Tumoraspirates resultierte in gut wachsenden Zellen mit einer mittleren
Mitoserate. Die zytogenetische Untersuchung der Zellen ergab das Vorhandensein
eines Fusionschromosoms 13 in unterschiedlichen Anzahlen zusätzlich zu einem
normalen caninen Chromosom 13, woraus eine Polysomie resultiert. Die Chromosomenanzahl reichte von 72 bis 78, wobei die Mehrzahl der Metaphasen 78 Chromosomen zeigte. Keine der Metaphasen hatte mehr als 78 Chromosomen. Fusionen der
Chromosomen 13 wurden in allen Metaphasen beobachtet, dabei traten die Fusionschromosomen in unterschiedlicher Anzahl auf.
3.2. Molekular-zytogenetische Ergebnisse
Das Auftreten bestimmter, wiederkehrender chromosomaler Veränderungen in caninen Tumoren lässt vermuten, dass wichtige, Tumor-assoziierte Gene in diese Aberra19
Ergebnisse
tionen involviert sind. Daher bestand ein weiterer Teilaspekt der vorliegenden Arbeit
aus der Lokalisation verschiedener Tumor-relevanter Gene im caninen Genom. Aufgrund des bereits erwähnten komplexen caninen Karyotyps gibt es nur wenige Arbeiten, die sich mit dem FISH-Mapping also der direkten Lokalisation von Genen auf
dem Genom des Hundes befassen. Mit Hilfe der von Reimann et al. (1996) erstellten
Nomenklatur, welche die eindeutige Zuordnung von caninen Chromosomenpaaren
ermöglicht, war es in der vorliegenden Arbeit möglich, mit Hilfe des FISH-Mappings
verschiedene canine Gene im Karyotyp des Hundes zu lokalisieren.
3.2.1. Molecular characterization and mapping of the canine KRAB
zinc finger gene ZNF331
IV. Meiboom M et al., Anim Genet. 2004
Das KRAB Zinkfinger-Gen ZNF331 ist in humanen Schilddrüsenadenomen häufig in
chromosomale Aberrationen involviert, daher wurde es als Kandidatengen für die
Entwicklung dieser Tumoren beschrieben. Für die Charakterisierung des ZNF331
Gens des Hundes wurde eine canine cDNA Library mit Primern für das humane ZNF
331 Homolog gescreent. Eine 5’ Race PCR mit spezifischen Primern an der cDNA
führte zu einem vollständigen cDNA Klon. Aus den ermittelten Daten wurde die
mRNA Sequenz für das canine ZNF 331 erstellt. Demnach besteht das Gen, inklusive
ORF, aus 2148 bp und zeigt in der kodierenden Sequenz eine Homologie von 85,3%
zwischen Hund und Mensch. Northern Blot Analysen an mRNA verschiedener caniner Gewebeproben zeigten eine nur schwache Expression des Gens.
Anhand der gewonnenen Sequenzinformationen wurde eine Primerpaar generiert, mit
dem ein 300 bp großes Fragment aus der Spacerregion des ZNF331 Gens amplifiziert und durch Sequenzanalyse verifiziert wurde. Mit diesem Fragment wurde ein
caniner BAC/PAC Filter auf positive Klone gescreent. Der verifizierte Klon wurde in
die FISH eingesetzt. Das FISH-Mapping zeigte eine Lokalisation des caninen ZNF331
auf CFA1q33.
Ein weiterer Ansatzpunkt für die Untersuchung der Tumorenstehung sind (Cyclin abhängige) Kinasen, die eine wichtige Rolle in der Regulation des Zellzyklus spielen.
Daher wurden im Folgenden sowohl die intrazelluläre Proteinkinase AKT3 als auch
das regulatorisch wirksame Cyclin D1 (CCND1) im Genom des Hundes lokalisiert.
20
Ergebnisse
3.2.2. The protein kinase B, gamma (AKT3) gene maps to canine
chromosome 7
V. Murua Escobar H et al., Anim Genet. 2004
Die Proteinkinase B, gamma (AKT3) ist eine intrazelluläre Proteinkinase, die unter
anderem die Überlebensdauer der Zelle reguliert. Sie reguliert die Funktion vieler zellulärer Prozesse, zu denen sowohl die Apoptose, aber auch die Proliferation gehören
(Masure et al., 1999; Nicholson and Anderson, 2002). Für die Herstellung einer FISHSonde für das canine AKT3 Gen wurde der entsprechende Bereich gesamt genomischer DNA eines zweijährigen golden Retrievers mittels PCR amplifiziert. Dazu wurden Primer verwendet, die einen Teil des Exon 13 umfassen und welche zu 80,3 %
identisch mit menschlicher AKT3 mRNA sind. Aus dieser PCR resultierte eine PCR
Fragment von 303 bp, welches durch Sequenzanalyse verifiziert wurde. Mit Hilfe dieser Primer wurde eine canine BAC Library auf positive Klone gescreent. Das mit den
verifizierten Klonen durchgeführte FISH-Mapping ergab ein Lokalisation des caninen
AKT3 Gens auf CFA 7.
3.2.3. Molecular characterization and mapping of the canine cyclin
D1 (CCND1) gene
VI. Meyer B et al., Anim Genet. 2004
Die Deregulierung der Cyclin D1 Synthese erlaubt das fortschreiten des Zellzyklus in
der Abwesenheit von Wachstumsfaktoren und könnte somit zur Entstehung von Tumoren beitragen. Zur Charakterisierung des caninen Cyclin D1-Gens und des dazugehörigen Proteins wurde cDNA aus einem caninen Osteosarkom mit Primern, spezifisch für den humanen ORF des CCND1-Gens, gescreent. Das resultierende PCRProdukt wurde anschließend kloniert und sequenziert und der vollständige ORF mit
Hilfe von zwei zusätzlichen Primern amplifiziert. Die Sequenzanalyse ergab ein 1246
bp langes cDNA Fragment, welches für den caninen ORF eine 90,4% Sequenz Übereinstimmung zu seinem menschlichen Homolog zeigte. Das daraus resultierende canine Protein besteht aus 295 Aminosäuren und zeigt eine Ähnlichkeit von 93,3% zwischen beiden Spezies. Anhand der menschlichen Sequenzdaten wurde ein weiteres
Primerpaar hergestellt, mit dem eine canine BAC Library auf positive Klone gescreent
wurde. Der hieraus resultierende positive Klon wurde in die FISH eingesetzt. Das
FISH-Mapping ergab eine Lokalisation des caninen CCND1-Gens auf CFA 17.
21
Ergebnisse
Des Weiteren spielen auch die RAS Gene eine wichtige Rolle in der menschlichen
Tumorentwicklung Die Bindung von Wachstumsfaktoren aktiviert die RAS Proteine
und initiiert so die Zellteilung. Mutationen in den RAS Genen führen zur andauernden
Aktivierung von Signalwegen, welche die Zellteilung anregen und schließlich zur unkontrollierten Zellteilung führen (Park, 1995). Im Rahmen der vorliegenden Arbeit
wurden zwei Mitglieder der RAS Proteinfamilie, NRAS und KRAS, im caninen Genom
lokalisiert.
3.2.4. The canine NRAS gene maps to CFA 17
VII. Richter A et al., Anim Genet. 2004
Für die Lokalisation des caninen NRAS-Gens wurden anhand der caninen mRNA
Sequenz Datenbank PCR-Primer hergestellt. Die PCR wurde an caninem Blut etabliert, das resultierende PCR-Fragment wurde durch Sequenzanalyse verifiziert. Mit
den gleichen Primern wurde die canine BAC Library auf positive Klone gescreent. Der
verifizierte, positive Klon wurde für das FISH-Mapping verwendet, welches eine Lokalisation des caninen NRAS auf CFA 17 ergab.
3.2.5. The canine KRAS2 gene maps to chromosome 22
VIII. Winkler S et al., Anim Genet. 2004
Um das KRAS Homolog im caninen Genom zu lokalisieren, wurde zunächst an caniner gesamt genomischer DNA ein Primerpaar generiert, dass einen Teil des Exons 2
umfasst. Das daraus resultierende PCR-Produkt wurde zur Verifizierung kloniert und
sequenziert. Das etablierte Primerpaar wurde verwendet um die canine BAC Library
auf positive Klone zu screenen. Der verifizierte Klon wurde in die FISH eingesetzt,
welche eine Lokalisation von KRAS2 auf dem caninen Chromosom 22 ergab.
Der Schwerpunkt der vorliegenden Arbeit lag auf den Untersuchungen der caninen
HMG-Proteine. Ein Rezeptor für HMGB1, ein Mitglied der HMG-Proteinfamilie ist
RAGE (receptor for advanced glycation end products) ein Transmembranrezeptor aus
der Immunglobulinfamilie, an den extrazelluläres HMGB1 als Ligand binden kann.
Diese Bindung führt zur Aktivierung verschiedener Signalkaskaden, welche wiederum
Einfluss auf das Wachstum und die Beweglichkeit von Zellen nehmen. Im Rahmen
der Charakterisierung des caninen RAGE wurde das Gen im Genom des Hundes lokalisiert.
22
Ergebnisse
3.2.6. Cloning and characterization of the canine receptor for advanced glycation end products
IX. Murua Escobar H et al., Gene. 2006
Zur Charakterisierung des caninen RAGE-Gens und des dazugehörigen Proteins
wurde cDNA aus caninem Lungengewebe mit Primern, spezifisch für die humane
cDNA des RAGE-Gens, gescreent. Das resultierende PCR-Produkt wurde anschließend kloniert und sequenziert. Das vollständige Gen wurde mit Hilfe zweier weiterer
Primerpaare amplifiziert und umfasst 2835 bp. Die vollständige canine RAGE cDNA
besteht aus 11 Exons die insgesamt 1384 Basenpaare umfassen. Die Exongröße
schwankt zwischen 27 und 254 bp. Alles in allem besteht die cDNA aus einem 5’ UTR
von 18 bp, einem cds von 1215 bp, und einem 3’ UTR von 151 bp. Die Sequenzhomologie zwischen Hund und Mensch beträgt insgesamt 80,9% und variiert für die
verschiedenen Exons zwischen 73,9% (Exon 11) und 86,7% (Exon 2). Das abgeleitete canine Protein weist für die extrazelluläre Domäne eine Übereinstimmung von
78,2%, für die Transmembran Domäne eine Übereinstimmung von 78,9% und für die
cytosolische Domäne eine Übereinstimmung von 72,7% mit dem menschlichen Protein auf, was einer Homologie von insgesamt 77,6% zwischen beiden Spezies entspricht.
Die Expression des caninen RAGE-Gens wurde in verschiedenen Geweben mittels
Northern Blot und Hybridisierung mit einer
32
P markierten RAGE cDNA Sonde unter-
sucht. Bis auf das Lungengewebe zeigte keine der untersuchten Gewebeproben die
spezifische Bande von 1,4 kb. Diese Ergebnisse decken sich mit denen für die
RAGE-Expression in humanen Geweben. Für die Lokalisation des Gens im caninen
Genom wurde eine genomische DNA Sonde hergestellt und für das Screening des
caninen RPCI 81 BAC/PAC Filters eingesetzt. Der verifizierte positive Klon wurde in
die FISH eingesetzt. Das FISH-Mapping ergab die Lokalisation des caninen RAGE
auf CFA 12.
3.3. Erstellen der Gewebebank
Molekulargenetische Untersuchungen z.B. zur Genexpression erfordern adäquate
Gewebeproben. Aus diesem Grund wurde im Rahmen der vorliegenden Arbeit damit
begonnen, eine Gewebebank für canine und feline Tumoren und Normalgewebe zu
erstellen. Dazu wurden 8408 Proben von Hunden und Katzen verschiedener Rassenzugehörigkeiten genommen und katalogisiert. Dabei entfallen 4286 Proben auf Tumo23
Ergebnisse
ren und 4122 auf Normalgewebe. Zusätzlich wurden zu den meisten Tumorgeweben
auch verschiedene Blutproben genommen, eingefroren und katalogisiert, so dass die
gesamte Gewebebank aus über 10.000 Proben bestand. Der Ausbau der Gewebebank erfolgte über den Rahmen der vorliegenden Arbeit hinaus. Die Gewebebank
umfasste im Frühjahr 2007 21.100 Proben, der überwiegende Anteil (67,9%) besteht
dabei aus Tumorproben. Die Proben aus dieser Gewebebank stellten die Grundlage
dar, für eine Vielzahl molekulargenetischer Untersuchungen. Daher werden die Ergebnisse dieser Untersuchungen im Kapitel 3.4. dargestellt.
3.4. Molekulargenetische Ergebnisse
Das Ziel, den Hund als Modell für die Krebsentstehung beim Menschen zu nutzen,
um sowohl die Diagnose als auch die Therapie in beiden Spezies zu verbessern und
damit die Lebenserwartung zu erhöhen, kann nur durch ein Verständnis der molekularen Grundlagen und Wirkweise der untersuchten Gene erreicht werden. In der vorliegenden Arbeit wurden daher verschiedene tumorrelevante Gene molekulargenetisch untersucht.
3.4.1. Absence of ras-gene hot-spot mutations in canine fibrosarcomas and melanomas.
X. Murua Escobar H et al., Anticancer Res. 2004
Für die Untersuchung auf hot-spot Mutationen in RAS Genen wurden 13 canine
Fibrosarkome, 11 canine Melanome und 2 feline Fibrosarkome aus der caninen Gewebebank verwendet. Unter den untersuchten Rassen befanden sich Mischlinge sowie reinrassige Tiere wie Irish Terrier, Fox Terrier, Schnauzer, Kuvasz, Briard, Deutscher Schäferhund, Rottweiler, Beagle und Pudel. Die DNA wurde isoliert und mit
spezifischen Primern für die Exons 1 und 2 von KRAS und NRAS amplifiziert und sequenziert. Vier der sechsundzwanzig untersuchten Gewebeproben zeigten NukleotidVeränderungen in den caninen Exons. Keine dieser Veränderungen lag in den RAS
hot-spot Codons 12, 13 und 61. Ein canines Fibrosarkom zeigte drei Veränderungen:
KRAS Exon 1 Codon 23 (CTA → TTA, keine Aminosäureveränderung), Exon 2, Codon 53 (TTG → TAG, Leu → Stopp codon) und NRAS Exon 1, Codon 10, GGA →
GAA, Gly → Glu). Zwei andere Fibrosarkome (Kuvasz und Pudel) zeigen jeweils einen Nukleotidaustausch in KRAS, Exon 2, welche die Codons 48 (GGA → GAA, Gly
24
Ergebnisse
→ Glu) und 70 (CAG → CTG, Gln → Leu) betreffen. In einer Probe eines Melanoms
aus einem Mischling wurde ein Nukleotidaustausch in NRAS Exon 1 Codon 22 (CAG
→ CTG, Gln → Leu) gefunden. Die Untersuchung des NRAS Exon 2 zeigte keine
Nukleotid-Veränderungen innerhalb der caninen Sequenzen.
3.4.2. RAS gene hot-spot mutations in canine neoplasias.
XI. Richter A et al., J Hered. 2005
Für den Vergleich mit bereits vorliegenden Daten aus anderen Studien wurden 13
canine Fibrosarkome und 11 canine Melanome aus der caninen Gewebebank auf
Punktmutationen in den Ras-Gen Hot-Spot Mutationen untersucht. Dieser Vergleich
ergab, dass K-Ras und N-Ras Mutationen in den Hot-Spot Loci offenbar nur sehr selten in caninen Fibrosarkomen und Melanomen vorkommen. Von den insgesamt untersuchten 31 caninen Fibrosarkomen und 17 caninen Melanomen waren nur zwei
Melanomproben von einer Mutation im Exon 61 des N-Ras Gens betroffen. Für das
K-Ras Gen wurden keinerlei Mutationen in den Hot-Spot Codons der untersuchten
Proben gefunden. Um einen aussagekräftigen Vergleich der Daten dieser caninen
Tumorentitäten mit den vorliegenden Forschungsergebnissen von z. B. Menschen
und Mäusen vornehmen zu können bedarf es jedoch der Untersuchung größerer Anzahlen an caninen Tumorproben.
3.4.3. Expression pattern of the HMGB1 gene in sarcomas of the
dog.
XII. Meyer B et al., Anticancer Res. 2004
Für die Expressionsanalyse von HMGB1 in caninen Sarkomen wurden 5 Osteosarkome, ein Fibrosarkom und ein Leiomyosarkom aus der caninen Gewebebank verwendet. RNA wurde isoliert und einerseits für die Synthese von cDNA, andererseits
für die mRNA Isolierung zum Einsatz in einem Northern Blot verwendet. Der Northern
Blot zeigte zwei HMGB1 mRNA Transkripte von 1,4 und 2,4 kb, die vergleichbar zu
denen in menschlichen und verschiedenen caninen Geweben sind. Die Intensität der
Signale wurde zusammengefasst und mit der Intensität der GAPDH-Bande der gleichen Proben verglichen. Die untersuchten Proben caniner Tumoren zeigten starke
Unterschiede in der Stärke der Expression von HMGB1. Die Werte, welche als Quotient zwischen HMGB1 und GAPDH ermittelt wurden, variierten zwischen 0,52 und
25
Ergebnisse
1.31 für Osteosarkome, während das Fibrosarkom und das Leiomyosarkom Werte
von 0,52 und 1,31 zeigten. Um diese Ergebnisse zu verifizieren wurde eine semiquantitative Duplex-PCR mit HMGB1 und GAPDH durchgeführt. Die Werte für die
caninen Osteosarkom-Proben variierten zwischen 0,72 und 1,28, während das Fibrosarkom und das Leiomyosarkom Werte von 0,73 bzw. 0,42 aufwiesen. Die statistische Analyse zeigte einen signifikanten Zusammenhang zwischen dem HMGB1 Expressionslevel, welcher mittels Northern Blot ermittelt wurde und dem Level aus der
etablierten RT-PCR.
3.4.4. The canine HMGA1.
XIII. Murua Escobar H et al., Gene. 2004
Für die Charakterisierung des caninen HMGA1 wurde Hodengewebe von verschiedenen Hunderassen aus der caninen Gewebebank verwendet. Darunter befanden
sich u. a. Bullterrier, Dackel, Dobermann, Münsterländer und Yorkshire Terrier. Aus
der gewonnenen RNA wurde mit Hilfe der 3’ Race PCR cDNA synthetisiert. Anhand
der humanen cDNA-Sequenz wurden Primer hergestellt, mit deren Hilfe das canine
HMGA1 synthetisiert und sequenziert wurde. Das vollständige canine HMGA1 umfasst sechs Exons und codiert für zwei Spleißvarianten, HMGA1a mit 1836 Basenpaaren und HMGA1b mit 1803 Basenpaaren, welche den humanen Transkripten entsprechen. Diese Spleißvarianten zeigen die bekannte 33 bp Deletion in HMGA1b,
welche zwischen verschiedenen Spezies, wie Mensch, Maus, Hamster und Ratte
stark konserviert ist. Die Homologie für beide Spleißvarianten zu ihren menschlichen
Gegenstücken liegt bei 80,6%. Dabei zeigen der 5’UTR, CDS und 3’ UTR unterschiedliche Homologien von 95,6%, 95,1% und 74,7%. Die abgeleiteten Proteinsequenzen ergeben für HMGA1a ein 107 Aminosäuren großes Protein mit einem geschätzten Gewicht von 11674,97 Da, während HMGA1b 96 Aminosäuren und Gewicht von geschätzten 10677,85 Da aufweist. Die Homologie zwischen caninen und
humanen Proteinen beträgt 100%, inklusive der drei „AT-Hooks“ und der carboxyterminalen Domäne. Der Vergleich der Spleißvarianten zwischen den verschiedenen
Rassen ergab nur einen einzigen Aminosäureaustausch der ersten Base des Codons
64 in der Gewebeprobe eines Dackels (A → G, Thr → Ala). Dieser Austausch fehlt im
korrespondierenden HMGA1a-Transkript des zweiten Allels des gleichen Tieres, was
auf einen Heterozygotie schließen lässt. Für die Expressionsanalyse des caninen
HMGA1 wurden canines Herz- Lungen-, Milz- Nieren- und Muskelgewebe aus der
caninen und felinen Gewebebank verwendet. Die RNA wurde isoliert und die Expres26
Ergebnisse
sion mittels Northern Blot überprüft. Bis auf die gesamt RNA des Nierengewebes
zeigten alle Proben ein schwaches Signal, welches einer Größe von ca. 1,8 kb entspricht. Dies lässt auf eine geringe Expression des Gens in diesen Geweben schließen.
3.4.5. "Best friends" sharing the HMGA1 gene: comparison of the
human and canine HMGA1 to orthologous other species.
XIV: Murua Escobar H et al., J Hered. 2005
Die Charakterisierung der caninen HMGA-Gene ermöglicht neue Strategien für experimentelle und therapeutische Ansätze. Daher wurden unter Verwendung von Proben
aus der neu etablierten Gewebebank die caninen HMGA1a und HMGA1b Transkripte
charakterisiert, die Proteine hergeleitet und ihr Potenzial als Ziel für therapeutische
Ansätze eingeschätzt. Der Sequenzvergleich ergab eine 100% Homologie zwischen
dem caninen und dem menschlichen Protein, trotzdem unterscheidet sich die Anzahl
der gefundenen cDNAs: Für den Menschen sind sieben verschiedene cDNATranskripte bekannt, von denen die Splicevarianten 1 und 2 am häufigsten vorkommen. Die charakterisierten caninen Varianten zeigen die gleiche Zusammensetzung
wie diese. Canine Entsprechungen zu den menschlichen Varianten der Splicevarianten 3 bis 7 konnten mittels PCR nicht nachgewiesen werden. Der Vergleich der humanen cDNA mit den bekannten Transkripten anderer Spezies zeigte, dass der Hund
die einzige Spezies ist, die im Bezug auf Exon-Struktur und Verteilung Übereinstimmungen zu den häufig gefundenen Transkripten des Menschen zeigt. Die Homologie
der CDS des caninen HMGA1 zu der anderer Spezies variiert zwischen 72% (Huhn)
und 95,7% (Pferd, Schwein). Der Homologie-Vergleich der abgeleiteten Proteine liegt
zwischen 67,7% (Huhn) und 100% (Mensch). Die Proteine aller Spezies zeigten einen hohen Konservierungsgrad in ihrer funktionellen DNA-bindenden Domäne, den
sog. AT-Hooks. Alle untersuchten Spezies haben gemeinsam, dass die CDS aus vier
Exons besteht. Die beschriebenen Proteine aller untersuchten Spezies bestehen aus
107 bzw. 96 Aminosäuren für HMGA1a und HMGA1b. Alle Spezies zeigen die für das
HMGA1b Protein typische Deletion von 33 bp, die in dem Fehlen von 11 Aminosäuren in der Splicevariante resultiert.
Der Schwerpunkt der vorliegenden Arbeit lag auf der molekulargenetischen Untersuchung der HMGA2 Expression in caninen Prostata-Geweben. Hierfür wurden im Folgenden wiederum Proben aus der caninen Gewebebank verwendet
27
Ergebnisse
3.4.6. HMGA2 Expression in a Canine Model of Prostate Cancer
XV. Winkler S et al., (zur Publikation angenommen)
Zur Bestimmung der tatsächlichen Transkriptmengen in caninen Prostata-Geweben
wurden quantitative Real Time PCR Untersuchungen durchgeführt. Diese ergaben
deutlich unterschiedliche Mengen an HMGA2 Transkripten in den untersuchten gesamt-RNAs in Abhängigkeit vom jeweiligen Patho-Histologischen Befund. So zeigten
die untersuchten Normalgewebe, Hyperplasien und Zysten deutlich geringere Mengen an HMGA2 Transkripten als Karzinome. Alle sechs Karzinome zeigten
Transkriptmengen über einem Wert von 23086 Transkripten pro 250 ng gesamt RNA.
Alle gutartigen Gewebe blieben unter diesem Wert, dabei zeigten die Normalgewebe
einen maximalen Wert von 1433 Transkripten pro 250 ng gesamt RNA. Die statistische Analyse zeigte, dass es sich bei den ermittelten Werten nicht um Zufallsergebnisse handelt (p < 0,001), somit kann der HMGA2 mRNA Level zur Unterscheidung
zwischen malignen und benignen Geweben verwendet werden. Bei der KarzinomProbe mit dem höchsten gemessenen HMGA2 Transkriptlevel handelt es sich um das
korrespondierende Gewebe zu der bereits zuvor etablierten caninen Prostatakarzinom Zell-Linie (Siehe Kapitel 3.1.2).
Weiterführende Untersuchungen sollten klären, ob eine antisense Strategie mit Hilfe
von adenoviralen Vektoren einen Einfluss auf die Proliferation der im Rahmen der
zytogenetischen Untersuchungen neu etablierten, spontan immortalisierten Zell-Linie
ausübt.
3.4.7. Inhibitory effect of antisense HMGA AAV-mediated delivery
suppresses cell proliferation in canine carcinoma cell line
XVI. Soller JT et al., (in Vorbereitung)
Für die Herstellung Adeno-assoziierter Viren, welche das gewünschte Gen als Insert
tragen, wurde zunächst die codierende Sequenz des caninen HMGA2 charakterisiert.
Mit Hilfe dieser Sequenzdaten wurden rekombinante Adeno-assoziierte Viren (rAAV)
hergestellt, die HMGA1 und HMGA2 in antisense bzw. LacZ in sense Orientierung
enthielten. Zusätzlich hergestellte rAAVs ohne Insert dienten als Negativkontrolle. Der
Effekt, den diese Adeno-assoziierten Viren auf die HMGA überexprimierenden Zellen
ausüben, wurde mit Hilfe der spontan immortalisierten Zell-Linie CT1258 überprüft.
Demnach induzieren Viruspartikel, die HMGA1 und HMGA2 in antisense Orientierung
tragen, mit hoher statistischer Signifikanz eine Inhibition der Proliferation von Zellen
28
Ergebnisse
des caninen Prostata-Karzinoms in vitro. Im Vergleich dazu wird das Wachstum der
Tumorzellen durch Viren, welche LacZ in sense Orientierung tragen (Kontrolle) nicht
signifikant beeinflusst.
29
Diskussion
4.
Diskussion
Bereits gegen Ende das letzten Jahrhunderts war nach Meinung einer steigenden
Anzahl von Wissenschaftlern davon auszugehen, dass im kommenden 21sten Jahrhundert der Hund als Modelltier in der Erforschung der Grundlagen genetischer Erkrankungen den gleichen Stellenwert wie die Maus einnehmen oder sie sogar ersetzen könnte (Kuska, 1999). Ca. sieben Jahre später bleibt festzustellen, dass diese
Einschätzung richtig war, wie eine Fülle von Publikationen zum Thema bestätigt. Die
Menschheit zeigt eine Vielzahl von krankheitsassoziierten Genen, zu denen sich ein
Ortholog im caninen Genom wiederfindet und in beiden Spezies haben das Auftreten
und der Verlauf der Erkrankung viele Gemeinsamkeiten (Lin et al., 1999; Rawle and
Lillicrap, 2004). Ziel der vorliegenden Arbeit war der Vergleich der caninen Tumorgenese mit der Tumorentstehung beim Menschen zunächst auf zytogenetischer, aber
auch auf molekularbiologischer Ebene. Auf zytogenetischer Ebene wurden insbesondere Prostatatumoren, aber auch Neoplasien des blutbildenden Systems mit Hilfe der
etablierten Routine-Methoden untersucht und auf Ähnlichkeiten zu zytogenetischen
Befunden im Menschen überprüft. Im Bereich der molekular-zytogenetischen Methoden konnten mit Hilfe der Fluoreszenz in situ Hybridisierung verschiedene Tumorassoziierte Gene im caninen Genom lokalisiert werden. Für die anschließende molekulargenetische Untersuchung dieser Gene sowie für Expressionsanalysen verschiedener Gene wurde zunächst eine canine Gewebebank für Tumor- und Normalgewebe
erstellt. In der vorliegenden Arbeit wurden durch den Einsatz verschiedener molekulargenetischer Methoden die Expression des HMGA2-Proteins in caninen ProstataGeweben und in einer, im Rahmen der eigenen Arbeit neu etablierten, immortalisierten Zell-Linie untersucht. Dieselbe Zell-Linie wurde schließlich verwendet, um ein in
vitro Modell zur Gentherapie mit Hilfe von Adeno-assoziierten Viren zu entwickeln.
Die zytogenetischen Untersuchungen caniner Prostatatumoren zeigten interessante
klonale Veränderungen. So zeigten die Zellen eines caninen Adenokarzinoms der
Prostata (CT 1258) einen stark rearrangierten, annähernd tetraploiden Karyotyp mit
zahlreichen klonalen Fusionen. Das Auftreten von zweiarmigen Chromosomen ist ein
häufiges Ereignis in der Tumorgenese caniner Neoplasien. Es wird angenommen,
dass die durch die erhöhte Zellteilung verkürzten Telomerenden ein höheres Potential
für Fusionen aufweisen (Harley, 1991). Fusionschromosomen können grundsätzlich
in zwei Kategorien unterschieden werden: Isochromosomen, die aus der Verdopplung
30
Diskussion
des langen Arms des selben caninen Chromosoms bestehen und TranslokationsChromosomen, die auf der Verschmelzung zweier akrozentrischer Chromosomen im
Sinne einer Robertson-Translokation beruhen (Reimann et al., 1994; Slijepcevic,
1998). Der genannte Fall (CT 1258) weist überwiegend Robertson-Translokationen
auf, wobei die Translokationspartner dieser Fusionen unterschiedlich sein können.
Die als klonal identifizierten Fusionschromosomen bestanden zum einen aus einem
großen Markerchromosom bestehend aus Material der Chromosomen 1 und 2 und
zum anderen aus einer zentrischen Fusion der Chromosomen 1 und 5 (Winkler et al.,
2005a). Diese klonalen Aberrationen konnten in den Zellen der spontan immortalisierten Zell-Linie des caninen Primärtumors in nahezu allen untersuchten Metaphasen
nachgewiesen werden. Diese Ergebnisse legen die Vermutung nahe, dass es sich bei
diesen Veränderungen um die primären Aberrationen innerhalb der transformierten
Zellen handelt. Zytogenetische Veränderungen, die insbesondere die Chromosomen
1 und 5 beinhalten, sind nicht unbekannt. Eine zytogenetische Studie an caninen soliden Tumoren hat gezeigt, dass die caninen Chromosomen 1, 2, 4, 5 und 25 häufig
sowohl von numerischen als auch von strukturellen Aberrationen betroffen sind
(Reimann et al., 1999a). Hörsting et al. (1999) haben die Theorie aufgestellt, dass
das canine Chromosom 1 ein Gen enthalten könnte, dass verantwortlich für die Tumorentwicklung sein könnte. Fusionen, die das canine Chromosom 1 beinhalten,
könnten demnach der ausschlaggebende Faktor sein, der zu einem instabilen Karyotyp und zu komplexen Karyotyp-Veränderungen führen könnte. In diesem Fall wäre
der stark rearrangierte Karyotyp in CT 1258 also entweder durch die Beteiligung des
Chromosoms 1 an der Fusion an sich, oder durch das daraus resultierende vermehrte
Vorhandensein von Chromosomenmaterial des Chromosoms 1, woraus eine Trisomie
oder auch Polysomie resultiert, zu erklären. Obwohl Robertson-Translokationen zu
den häufigsten, meist harmlosen Chromosomenaberrationen beim Menschen gehören (Nielsen and Wohlert, 1991), findet man sie eher selten in humanen Tumoren
(Hecht et al., 1988). Es wird angenommen, das Robertson-Translokationen durch
Rekombination entstehen, ein Ereignis, das häufig in der Meiose, aber nur selten in
der Mitose vorkommt (Hecht et al., 1988). Nichts desto trotz konnte das Auftreten von
Robertson-Translokationen vor allem in menschlichen Leukämien nachgewiesen
werden, was auf die Beteiligung dieser Chromosomenaberration auch in menschlichen Neoplasien hinweist (Chinnappan et al., 1998; Chinnappan et al., 2001).
31
Diskussion
Die zytogenetische Untersuchung eines weiteren Adenokarzinoms der Prostata
(CT1266) ergab das Vorhandensein eines Fusionschromosom 13, also die Verschmelzung zweier akrozentrischer Chromosomen 13 des Hundes. Dieses Fusionschromosom trat in unterschiedlichen Anzahlen zusätzlich zu einem normalen Chromosom 13 auf, wodurch das Material dieses Chromosoms innerhalb der einzelnen
Zelle überwiegt (Winkler et al., 2006). Trisomien sind sowohl in soliden als auch in
hämatopoetischen caninen Neoplasien relativ häufig beschrieben (Mayr et al., 1990b;
Mayr et al., 1991a; Bartnitzke et al., 1992b; Mayr et al., 1992a; Mayr et al., 1993;
Nolte et al., 1993; Mayr et al., 1995; Reimann et al., 1996b; Nolte et al., 1997; Reimann et al., 1998; Mayr et al., 1999). Das vergleichsweise häufige Auftreten von Trisomien in caninen Tumoren unterstützt die Annahme, dass Trisomien die primäre
Veränderung auf dem Weg einer normalen Zellen hin zu einer entarteten Zelle sein
können (Bartnitzke et al., 1992b). Möglicherweise verfügen Zellen mit einer Trisomie
über einen Selektionsvorteil und charakterisieren somit ein frühes Entwicklungsstadium der Karyotyp-Evolution (Bullerdiek et al., 1993). Dem Auftreten dieses Fusionschromosoms 13 in diesem Fall kommt eine besondere Bedeutung zu, denn insbesondere über den Zugewinn chromosomalen Materials von CFA 13 ist in der Literatur
schon mehrfach berichtet worden. Mayr et al. haben bereits 1992 ein Isochromosom
13 in einem Osteoidsarkom sowie in einem Osteoidchondrosarkom beschrieben
(Mayr et al., 1992b). In einer großen Studie an caninen Lymphosarkomen, einer häufigen hämatopoetischen Erkrankung des Hundes, wurde in 15 von 61 Fällen eine Trisomie des Chromosoms 13 gezeigt. Aufgrund der Häufigkeit dieser Aberration haben
die Autoren versucht, einen Zusammenhang zwischen dem Auftreten der Trisomie 13
und der Dauer der ersten Remission und der Überlebensdauer der erkrankten Tiere
herzuleiten. Tatsächlich konnte gezeigt werden, dass bei Tieren, die eine Trisomie 13
als primäre Aberration aufwiesen, die Dauer der ersten Remission und die Überlebensdauer signifikant höher waren, als bei Tieren mit anderen chromosomalen Veränderungen, da diese Tiere besser auf eine verabreichte Chemotherapie ansprachen
(Hahn et al., 1994). In neueren Untersuchungen, die mit Hilfe der comparative genomic hybridisation (CGH) durchgeführt worden waren, konnte die Trisomie 13 sogar in
12 der 25 untersuchten caninen Tumorproben gezeigt werden (Thomas et al., 2003).
Die im Rahmen der vorliegenden Arbeit durchgeführten zytogenetischen Untersuchungen an verschiedenen Knochenmarkproben von Hunden, die wegen Erkrankungen des blutbildenden Systems in Behandlung waren, zeigten ebenfalls klonale Aber32
Diskussion
rationen der Chromosomen 13, die sich zum einen als Trisomie 13, zum anderen als
eine partielle Trisomie in einem derivativen Chromosom 13 (Winkler et al., 2005b).
Alle Ergebnisse zusammen lassen vermuten, dass CFA 13 zum einen ein oder mehrere wichtige Onkogene enthalten könnte und zum anderen Aberrationen dieses
Chromosoms für die Diagnose und die Prognose sowohl im caninen Lymphosarkom,
als auch in caninen Prostatakarzinomen herangezogen werden könnten. Interessanterweise haben Yang et al. (1999) gezeigt, dass das canine Chromosom 13 Homologien zum menschlichen Chromosom 8q aufweist (HSA8q – qter). Diese chromosomale Region ist häufig in die Entwicklung verschiedener humaner hämatopoetischer Erkrankungen wie akute Leukämien und Lymphome involviert (Lepretre et al., 2000;
Wolman et al., 2002), aber insbesondere auch an der Entstehung und dem Fortschreiten von humanen Mamma- und Prostatakarzinomen beteiligt (Bullerdiek et al.,
1993; Mark et al., 1999; Steiner et al., 2002). Wegen der häufigen Rezidivbildung und
der generell schlechten Prognose von Prostatatumoren die eine Amplifikation von 8q
aufweisen, wurde eine detaillierte Analyse der Gene auf dem langen Arm von Chromosom 8 vorgenommen (van Duin et al., 2005). Dabei wurden 16 Gene, inklusive des
c-myc Onkogens in fünf Regionen mit einer mutmaßlichen Bedeutung in der Krebsentstehung eingehend untersucht. Drei dieser Gene zeigten im Vergleich zu normalem Prostata-Gewebe in Prostatakarzinomen eine signifikante Überexpression. Diese
Gene, bezeichnet als PDP (8q22.1), PABPCI (8q22.3) und KIAA0196 (8q24.13) werden daher als mögliche Progressions-Marker für humane Prostatakarzinome erwogen
(van Duin et al., 2005). Diese Untersuchungen unterstützen die Annahme, dass in
beiden Spezies die Amplifikation eines Teils des Genoms, dass beim Menschen auf
Chromosom 8 und auf Chromosom 13 des Hundes lokalisiert ist mit der Entstehung
und dem Fortschreiten von Tumoren der gleichen Organe assoziiert ist. Es wäre daher interessant, die durch die Arbeit von Van Duin et al. detektierten potentiellen Progressionsmarker im caninen Genom zu lokalisieren. Eine solche Lokalisation von Genen wird z.B. durch das sog. physikalische Mapping mit Hilfe der Fluoreszenz in situ
Hybridisierung (FISH-Mapping) ermöglicht.
Das wiederholte Auftreten bestimmter chromosomaler Veränderungen in der caninen
Tumorgenese lässt vermuten, dass wichtige, tumor-assoziierte Gene in diese Aberrationen involviert sind. Daher wurden im Rahmen der vorliegenden Arbeit ausgewählte, tumor-relevante Gene mit Hilfe des FISH-Mappings im caninen Genom lokalisiert
33
Diskussion
(Meiboom et al., 2004; Meyer et al., 2004b; Murua Escobar et al., 2004b; Richter et
al., 2004; Winkler et al., 2004; Murua Escobar et al., 2006).
Für weitere molekulargenetische Untersuchungen dieser und anderer tumorrelevanter Gene wurde im Rahmen der vorliegenden Arbeit eine Gewebebank für canine Tumoren und Normalgewebe etabliert. Unter Verwendung von Proben aus dieser Gewebebank war es u. a. möglich, verschiedene canine Tumoren auf das Vorhandensein von Punkmutationen in Genen der RAS Proteinfamilie zu überprüfen.
Diese Punktmutationen finden sich unter den wichtigsten Veränderungen in der
menschlichen Tumorentwicklung (Almoguera et al., 1988; Bos, 1989; Shukla et al.,
1989; Arber, 1999; Belly et al., 2001; Spandidos et al., 2002). RAS Proteine spielen
eine wichtige Rolle als Signaltransmitter. Die Bindung von Wachstumsfaktoren aktiviert die RAS Proteine und initiiert so die Zellteilung. Es wird angenommen, dass Mutationen in den RAS Genen zur andauernden Aktivierung von Signalwegen führt, welche die Zellteilung anregen, was wiederum zur unkontrollierten Zellteilung führt (Park,
1995). Von den Punktmutationen sind insbesondere die sogenannten hot-spot Loci in
den Codons 12, 13, und 61 der Exons 1 bzw. 2 betroffen (Park, 1995). Von den im
Rahmen dieser Arbeit auf das Vorhandensein von Punkmutationen in den hot-spot
loci der RAS Gene untersuchten 13 caninen Fibrosarkomen und 11 caninen Melanomen zeigte keine Probe Nukleotidveränderungen in den betreffenden Codons (Murua
Escobar et al., 2004a; Richter et al., 2005). Diese Ergebnisse lassen annehmen, dass
RAS Mutationen in der Pathogenese zumindest der spontanen auftretenden caninen
Melanome und Fibrosarkome keine große Rolle spielen.
Aufgrund ihres hohen Grades der evolutionären Konservierung und der vergleichsweise hohen Homologie zwischen Mensch und Hund (unveröffentlichte Daten, Murua
Escobar et al., 2003; Murua Escobar et al., 2004c; Murua Escobar et al., 2005; Murua
Escobar et al., 2006) wurden im Rahmen der vorliegenden Arbeit insbesondere die so
genannten High Mobility Group Protein Gene, zu denen unter anderem HMGB1,
HMGA1 und HMGA2 gehören, näher untersucht (Meyer et al., 2004a; Murua Escobar
et al., 2004c; Murua Escobar et al., 2005; Winkler et al., accepted for publication).
Unter Verwendung von Gewebeproben aus der neu etablierten Gewebebank konnten
im Rahmen der vorliegenden Arbeit Expressionsanalysen für z.B. das canine HMGB1
in caninen Osteosarkomen durchgeführt werden (Meyer et al., 2004a). Namensgebend für die HMGB-Proteine war nach der 2001 geänderten Nomenklatur ihr funktionelles Motiv in Form von zwei DNA bindenden Domänen, die als A-Box und B-Box
34
Diskussion
bezeichnet werden (Landsman and Bustin, 1993; Bustin, 2001). Das menschliche
HMGB1-Protein, welches auf Chromosom 13q12 lokalisiert ist, kann zwei unterschiedliche Funktionen in der Zelle übernehmen, weswegen Müller et al. (2001) auch
von einem „Doppelleben“ dieses Proteins sprechen. Parallel zu der Fähigkeit, als extrazellulärer Ligand (der häufig auch als Amphoterin bezeichnet wird) an seinen Rezeptor zu binden, übernimmt HMGB1 in seiner Lokalisation im Zellkern eine Rolle als
architektonischer Transkriptionsfaktor, indem es mit der DNA interagiert. Zusätzlich ist
HMGB1 in der Lage, Tumorzellen gegenüber dem Chemotherapeutikum Cisplatin zu
sensitivieren, indem es an Cisplatin-DNA-Addukte bindet und sie vor der Reparatur
durch zelleigene Reparaturmechanismen (nucleotide excision repair) schützt (Pil and
Lippard, 1992; He et al., 2000). Einer der Rezeptoren für HMGB1 ist RAGE (receptor
for advanced glycation end products), ein Transmembranrezeptor aus der Immunglobulinfamilie, an den die so genannten advanced glycation end products (AGEs)
(Neeper et al., 1992), aber auch extrazelluläres HMGB1 als Liganden binden können
(Hori et al., 1995). RAGE ist an einer großen Zahl pathophysiologischer Prozesse wie
z.B. Entzündungen (Hofmann et al., 1999) und Diabetes-bedingten Veränderungen
von Blutgefässen beteiligt (Park et al., 1998) und ist auch in die Tumorgenese involviert (Taguchi et al., 2000; Huttunen et al., 2002). Die Bindung spezifischer Liganden
an RAGE führt zur Aktivierung verschiedener Signalkaskaden wie z.B. MAP Kinasen
und NF-kappa-B, welche wiederum Einfluss auf das Wachstum und die Beweglichkeit
von Zellen nehmen (Taguchi et al., 2000). Neben dem vollständigen Rezeptor existieren noch verkürzte und dadurch lösliche Varianten von RAGE, die als sRAGE bezeichnet werden (Schmidt et al., 1994; Schlueter et al., 2003). Versuche zur Hemmung der RAGE-HMGB1-Signalkaskade durch z. B. die Zugabe von RAGE, AntiRAGE-Antikörpern aber auch Anti-HMGB1-Antikörpern ergaben sowohl in vitro, als
auch im Tiermodell der Krebsentstehung eine signifikante Unterdrückung des Wachstums, der Beweglichkeit und der lokalen Invasion von Tumorzellen und auch die Metastasierung der Tumoren in die Lungen war deutlich gehemmt (Liotta and Clair,
2000). Die Blockierung der Wechselwirkungen zwischen RAGE und HMGB1 stellen
einen interessanten Ansatz für die Entwicklung einer wirkungsvollen Krebstherapie
dar, daher wurde in der vorliegenden Arbeit das canine RAGE Gen näher charakterisiert (Murua Escobar et al., 2006).
Der Schwerpunkt der vorliegenden Arbeit lag aber auf der Untersuchung der Expression von HMGA2 in caninen Prostata-Geweben. HMGA-Proteine sind weitere Mitglie35
Diskussion
der der HMG-Proteinfamilie, denen eine wichtige Rolle in der Entstehung von Tumoren zukommt. HMGA2 Proteine werden normalerweise in embryonalen Geweben
verschiedener Säuger-Spezies exprimiert und sind in adulten Geweben nicht mehr
detektierbar (Chiappetta et al., 1996; Rogalla et al., 1996). Erst die Entwicklung sensitiverer Nachweismethoden wie z. B. die Real-Time PCR erlaubte den Nachweis auch
von geringen Mengen an HMGA2 mRNA in adulten Geweben (Sarhadi et al., 2006;
Meyer et al., in press). Im Gegensatz dazu ist die Überexpression von HMGAProteinen in einer Vielzahl humaner Tumoren nachweisbar. In benignen mesenchymalen Tumoren wie z.B. Uterusleiomyomen kann die aberrante Expression von
HMGA1 auf chromosomalen Rearrangierungen beruhen die das Chromosom 6
betreffen (Williams et al., 1997; Sornberger et al., 1999). Aber auch in malignen Tumoren kommt es zu einer Expression von HMGA1, die im Vergleich zu nicht neoplastischen adulten Zellen aussergewöhnlich hoch ist. So konnte für HMGA1 eine positive
Korrelation zwischen einer erhöhten Expressionsrate des Proteins und einem
schlechten Differenzierungsgrad der Tumoren und/oder einem erhöhten Metastasierungspotential in einer Vielzahl humaner maligner Tumoren wie z. B. Schilddrüsenkarzinomen, kolorektalen Karzinomen, Pankreaskarzinomen, Zervixkarzinom, Ovarialkarzinom, Plattenepithelkarzinomen, Magenkarzinom und Prostatakarzinom nachgewiesen werden (Tamimi et al., 1993; Chiappetta et al., 1995; Fedele et al., 1996;
Bandiera et al., 1998; Chiappetta et al., 1998; Abe et al., 1999; Abe et al., 2000; Chiappetta et al., 2001; Masciullo et al., 2003; Nam et al., 2003; Rho et al., 2007). Untersuchungen zum onkogenen Potential des HMGA1-Proteins in vivo haben gezeigt,
dass eine erhöhte HMGA1 Expression in verschiedenen Zell-Linien zur neoplastischen Transformation der Zellen führt (Wood et al., 2000a; Wood et al., 2000b; Reeves et al., 2001). Eine erhöhte HMGA1 Expression wird daher als diagnostischer
Marker für die neoplastische Transformation der Zellen und ihr Metastasierungspotential in malignen Tumoren (Bussemakers et al., 1991; Tamimi et al., 1993; Fedele et
al., 1996; Bandiera et al., 1998; Chiappetta et al., 1998) oder auch für die Unterscheidung zwischen follikulären Karzinomen und Adenomen (Czyz et al., 2004) diskutiert.
Die (Re)Expression des menschlichen HMGA2 Gens wird ebenfalls sowohl in benignen, als auch in malignen Tumoren gefunden. Dabei ist das menschliche HMGA2
in benignen Tumoren mesenchymalen Ursprungs häufig von chromosomalen Translokationen betroffen, die zu aberranten Transkripten führen. Bei diesen Translokationen kommt es häufig zu Brüchen im verhältnismäßig großen Intron 3 des HMGA236
Diskussion
Gens und zur Fusion mit ektopischen Sequenzen (Kazmierczak et al., 1998a). An der
Entstehung dieser Fusionsgene können verschiedene bekannte Partner, wie z. B. das
LPP-Gen (Petit et al., 1996), ALDH2 (Kazmierczak et al., 1995), RAD51L1
(Schoenmakers et al., 1999) oder COX6C (Kurose et al., 2000) beteiligt sein, sie können aber auch Anteile unbekannter Herkunft enthalten (Schoenmakers et al., 1995;
Kazmierczak et al., 1996; Kurose et al., 2001; Mine et al., 2001). Die Fusionen führen
in der Regel zum Erhalt der drei DNA-bindenden Domänen von HMGA2 bei gleichzeitigem Verlust seines sauren C-terminalen Endes und des 3’ UTRs. Transgene Mäuse, welche eine 3’ trunkierte Variante von HMGA2 exprimieren, zeigen einen gegenüber dem Wildtyp veränderten Phänotyp mit Riesenwuchs und überwiegend abdominaler Lipomatose (Battista et al., 1999). Auf der Grundlage der vorliegenden Daten
wird in der Literatur diskutiert, ob die Trunkierung von HMGA2, seine transkriptionelle
Reaktivierung oder die Fusion mit ektopischen Sequenzen das molekulare Schlüsselereignis in der Tumorgenese darstellen (Kazmierczak et al., 1995; Ashar et al., 1996;
Kazmierczak et al., 1998b; Battista et al., 1999). Im Vergleich dazu beruht die
(Re)Expression in malignen Tumoren nicht auf Chromosomenaberrationen, sondern
auf Mechanismen der Genregulation. Die Überexpression von HMGA2 wurde in verschiedenen malignen Tumoren wie nicht-kleinzelligen Lungenkarzinomen, Mammakarzinomen und Plattenepithelkarzinomen der Mundhöhle nachgewiesen, wo sie mit
dem Tumorgrading zu korrelieren scheint (Rogalla et al., 1997; Rogalla et al., 1998;
Miyazawa et al., 2004; Sarhadi et al., 2006). Die so genannten „atypischen lipomähnlichen Liposarkome“ sind zytogenetisch durch das Vorhandensein von überzähligen
Ring- und/oder langen Markerchromsomen charakterisiert, die mehrere Kopien der
chromosomalen Region 12q13-15 enthalten. Es wird angenommen, dass diese
Amplifikation die genetische Grundlage für die Überexpression von HMGA2 in diesen
Tumoren darstellt (Tallini et al., 1997; Pentimalli et al., 2003).
In der vorliegenden Arbeit wurde das canine HMGA1 charakterisiert (Murua Escobar
et al., 2004c; Murua Escobar et al., 2005). Diese Untersuchungen ergaben eine hohe
Homologie der codierenden Sequenz, bzw. eine 100% Homologie des korrespondierenden Proteins zwischen beiden Spezies. Ähnliche Untersuchungen für das canine
HMGA2 ergaben ebenfalls eine Homologie von 97% zwischen der caninen und der
humanen HMGA2 cDNA. So zeigen die Exons 2, 3 und 4 Homologien von 98,8%,
100% und 97 %. Die Exons 1 und 5 konnten bisher nur partiell charakterisiert werden
und zeigen in den bereits ermittelten Bereichen Homologien von 94,3% bzw. 92,3%.
37
Diskussion
Daraus resultiert eine Homologie für das canine Protein-Fragment von 98,8% im Vergleich zum humanen HMGA2 Protein (unveröffentlichte Ergebnisse).
Auf der Grundlage dieser Sequenzdaten wurden Primer hergestellt um mit Hilfe der
quantitativen real-time PCR canine Gewebeproben von fünf Adenokarzinomen –
darunter auch Tumormaterial von CT 1258- und einem anaplastischen Karzinom der
Prostata auf ihre HMGA2-Expression zu untersuchen und mit den Ergebnissen der
ebenfalls untersuchten Proben von 3 Hyperplasien, 3 Zysten und 4 Normalgeweben
der Prostata zu vergleichen. Diese Untersuchungen zeigten deutlich eine geringe Expression in caninen Normalgeweben, eine gegenüber diesen Normalgeweben leicht
erhöhte Expression von HMGA2 in den gutartigen Veränderungen der Prostata und
eine im Vergleich zum Normalgewebe teils starke Erhöhung der Expression in Karzinomen der Prostata. Die statistische Analyse dieser Ergebnisse machte deutlich,
dass es sich hierbei nicht um ein Zufallsergebnis handelt (p < 0,001) sondern das der
Grad der HMGA2 Expression verwendet werden kann, um benigne und maligne Gewebe voneinander zu unterscheiden (Winkler et al., zur Veröffentlichung angenommen). Auch in caninen Prostata-Tumoren korreliert also die Überexpression von
HMGA2 mit dem Malignitätsgrad. Durch die Verwendung eines relativ kurzen
HMGA2-spezifischen Abschnitts als Sonde in der quantitativen real-time PCR, lässt
sich jedoch nicht rückschließen, ob es sich bei dem über- bzw. re-exprimierten
HMGA2 um das vollständige Protein, ein verkürtes Protein oder um ein ähnlich wie in
humanen Tumoren beschriebenes Fusions-Protein handelt. Interessant ist dabei,
dass die Tumorprobe mit der höchsten HMGA2 Expression zur Etablierung der spontan immortalisierten Zell-Linie CT 1258 führte, welche gegenüber dem UrsprungsTumorgewebe nochmals eine gesteigerte HMGA2 Expression aufweist.
HMGA-Proteine spielen also in beiden Spezies eine wichtige Rolle in der Tumorgenese hinsichtlich der neoplastischen Transformation, Progression und Metastasierung. Ein Ansatz der Entwicklung einer wirkungsvollen Krebstherapie stellt der Versuch dar, die Menge an HMGA-Proteinen innerhalb der neoplastischen Zellen herunter zu regulieren. In diesem Zusammenhang war es Scala et al. (2000) z. B. möglich
zu zeigen, dass eine HMGA1 Antisense-Strategie unter Verwendung eines adenoviralen Vektors in humanen Schilddrüsen Zell-Linien zum Tod der Zellen in zwei Karzinom Zell-Linien, jedoch nicht in normalen Schilddrüsen-Zellen führte. Die Anwendung
desselben Vektors in vivo führte zu einer drastischen Größenreduktion von Tumoren,
die zuvor in immunsupprimierten Mäusen induziert worden waren. Aufgrund dieser
38
Diskussion
Ergebnisse gehen die Forscher davon aus, dass die Unterdrückung der HMGA1 Expression mit Hilfe dieser Antisense-Strategie eine wirksame Methode in der Behandlung von Tumoren sein kann, in denen allgemein eine erhöhte HMGA1 Expression
beobachtet wird. Ähnliche Ansätze wurden für HMGA1-exprimierende PankreasTumoren sowie für HMGA2-exprimierende gut differenzierte Liposarkome bereits beschrieben (Pentimalli et al., 2003; Trapasso et al., 2004). Im Rahmen der vorliegenden Arbeit wurden Andeno-assoziierte Viren erzeugt, die sowohl HMGA1 als auch
HMGA2 in antisense Orientierung enthielten. In vitro Experimente in denen Zellen der
spontan immortalisierten Zell-Linie CT1258 mit diesen Viren infiziert wurden, zeigten
eine statistisch signifikante Abnahme des Zellwachstums und der Viabilität, während
Zellen die entweder mit einem Virus der das LacZ-Gen als Insert trug oder mit einem
Virus ohne Insert infiziert worden waren, keine statistisch signifikante Reduktion des
Zellwachstums zeigten (Soller et al., in Vorbereitung). Es ist also davon auszugehen,
dass die Antisense Strategie zur Unterdrückung von HMGA2 auch in Tumoren, die
dieses Protein exprimieren, eine wirksame Behandlungsmethode darstellen kann.
Dabei sind für diese Therapie nur sehr geringe Nebenwirkungen zu erwarten, da
HMGA2 im adulten Organismus normalerweise nicht oder nur in sehr geringem Maß
z.B. in der Lunge oder im Myometrium exprimiert wird (Rogalla et al., 1996; Gattas et
al., 1999).
Für die Entwicklung wirksamer Medikamente und Therapie-Strategien sind jedoch
weitere Forschungen erforderlich. Aufgrund der vergleichsweise niedrigen Inzidenz
caniner Prostata-Tumoren könnte es von Nutzen sein Xenograft-Modelle, Beispielsweise unter Verwendung von immundefizienten Mäusen zu entwickeln und zu etablieren, hierbei könnte die im Rahmen der vorliegenden Arbeit etablierte Zell-Linie, welche eine stark erhöhte HMGA2 Expression aufweist eine Rolle spielen. Mit Hilfe solcher induzierter Tumoren könnte zunächst im Mausmodell eine Tendenz ermittelt
werden, ob die in vitro gewonnen Erkenntnisse zur Regulation der HMGA2 Expression auf die Verhältnisse in vivo übertragbar sind. Therapeutische Ansätze, die unter
Verwendung dieses Modells entwickelt würden, kämen nicht nur dem Hund, sondern
gegebenenfalls auch dem Menschen zugute.
39
Zusammenfassung
5.
Zusammenfassung
Schon seit einiger Zeit werden Tiermodelle in der Erforschung der genetischen
Grundlagen der Krebsentstehung verwendet. Dabei wird in den letzten Jahren immer
häufiger auch der Hund als Tiermodell genutzt. Der Hund scheint als Modelltier besonders geeignet, da Hund und Mensch vergleichbaren Lebens- und Umweltbedingungen ausgesetzt sind. Zusätzlich zeigen die spontan auftretenden Tumoren des
Hundes eine ähnliche Biologie und Histopathologie wie Tumoren des Menschen. Kürzere Generationszeiten und die höhere Zahl an Nachkommen erlauben jedoch die
Beobachtung größerer Fallzahlen in kürzerer Zeit und auch die Tumorentwicklung
und die Wirksamkeit der gewählten Therapie lassen sich so einfacher kontrollieren.
Die vorliegende Arbeit befasst sich mit verschiedenen Aspekten der Tumorentstehung im Modelltier Hund und gliederte sich im wesentlichen in fünf Abschnitte: Die
zytogenetischen
Untersuchungen
an
caninen
Neoplasien,
die
molekular-
zytogenetische Lokalisation verschiedener tumor-assoziierter Gene im caninen Genom, den Aufbau einer Gewebebank, die molekulargenetischen Expressionsanalysen
von HMGA-Proteinen in Prostata-Geweben und Zellkultur sowie die Entwicklung von
Modellen zur Gentherapie mit Hilfe von Adeno-assoziierten Viren.
Die zytogenetischen Untersuchungen an caninen Neoplasien zeigten das Auftreten
von klonalen Veränderungen wie Trisomien und zentrische Fusionen von caninen
Chromosomen. Letztere werden beim Menschen eher selten beobachtet, während sie
in der caninen Tumorgenese ein häufiges Ereignis darstellen. Auffällig ist auch das
wiederholte Auftreten von Aberrationen (numerisch und strukturell), die das canine
Chromosom 13 betreffen. Das canine Chromosom 13, welches Homologien zum
menschlichen Chromosom 8 aufweist, scheint demnach ein oder mehrere wichtige
Gene zu enthalten, die mit der Entstehung von Tumoren assoziiert sind.
Die Kenntnis von der Lokalisation und dem Aufbau verschiedener tumor-assoziierter
Gene ist eine unabdingbare Voraussetzung für ein besseres Verständnis der Wirkweise dieser Gene. Dieses Verständnis ist wiederum die Grundvoraussetzung für die
Entwicklung neuer Therapieansätze und Medikamente. Im Rahmen der vorliegenden
Arbeit konnten insgesamt sechs ausgewählte, tumor-assoziierte Gene mit Hilfe der
Fluoreszenz in situ Hybridisierung im caninen Genom lokalisiert werden. Unter Verwendung von Gewebeproben aus der im Rahmen der Arbeit neu erstellten Gewebebank für Tumoren und Normalgewebe war es möglich, einige dieser Gene auch hin-
40
Zusammenfassung
sichtlich ihrer cDNA Struktur, partieller DNA Struktur und Protein Expression zu untersuchen.
Ein besonderes Augenmerk galt dabei der Expression von HMGA2 in caninen Prostata-Geweben. Zur Klärung der Frage, ob HMGA-Proteine in caninen Prostatatumoren
überexprimiert sind, wurden sechs canine Prostatakarzinome, drei canine Prostatahyperplasien, drei canine Prostatazysten und vier canine Prostata-Normalgewebe,
sowie Zellen der im Rahmen der Arbeit neu etablierten Prostatakarzinom Zell-Linie
mit Hilfe der real-time PCR auf ihren Gehalt an HMGA2 untersucht. Die durchgeführten Experimente zeigten deutlich einen Zusammenhang zwischen histologischem
Befund des Gewebes und HMGA2-Expression.
Des Weiteren wurden Adeno-assoziierte Viren erzeugt, die sowohl HMGA1 als auch
HMGA2 in antisense Orientierung enthielten. Die Infektion von Zellen der spontan
immortalisierten Zell-Linie CT1258 mit diesen Viren führte zu einer statistisch signifikanten Abnahme des Zellwachstums und der Viabilität, während Zellen die entweder
mit einem Virus welches das LacZ-Gen als Insert oder mit einem Virus ohne Insert
infiziert worden waren, keine statistisch signifikante Reduktion des Zellwachstums
zeigten. Diese Antisense Strategie zur Unterdrückung der HMGA2 Expression scheint
also ein mögliches Target für die Behandlung sowohl des caninen als auch des humanen Prostatakarzinom, aber auch für andere Tumoren beider Spezies die mit einer
Erhöhung der HMGA2-Expression einhergehen darzustellen. Aufgrund der Tatsache
das HMGA2 im adulten Organismus nicht oder in nur sehr geringem Maß exprimiert
wird, wären für eine solche Therapie nur sehr geringe Nebenwirkungen zu erwarten.
41
Summary
6.
Summary
Animal models have been used in cancer research for a long time. Due to the similarities of human and canine cancer the dog has gained importance as the animal of
choice for therapeutic and preclinical studies. Dogs and humans are exposed to comparable life- and environmental conditions. Tumours in dogs occur spontaneously and
show similar biological behaviour and pathohistological findings. However, by using
the the dog as an animal model it is easier to observe large quantities of tumours in
less time, because of the faster progression of the tumours and the larger numbers of
descendants compared to their human counterparts. Even cancer progression as well
as effectiveness of the therapy of choice can be more easily observed.
This thesis is addressed to different aspects of canine tumour development and is
divided into five sections: Cytogenetic investigations in canine neoplasias, physical
mapping of different tumour-associated genes in the canine genome, establishment of
a tissue bank, HMGA2 expression in different canine prostatic tissues and cell culture,
as well as the development of new therapeutic approaches using adeno-associated
viruses.
Cytogenetic investigation of canine neoplasias showed clonal aberrations like
trisomies or centric fusions of canine chromosomes. The latter is rarely seen in man,
while it is a frequent event in canine tumourigenesis. The frequent appearance of aberrations (numeric as well as structural) affecting the canine chromosome 13 is of notable interest, as CFA13, which shares homology with human chromosome 8, seems
to contain important genes associated with the development of cancer.
Knowledge about localisation and structure of several tumour-associated genes is
precondition for better understanding of the function of these genes. This again is basic requirement for the development of new therapeutic approaches. Herein a subset
of six selected tumour associated genes have been physically mapped by fluorescence in situ hybridization. By using tissue samples of the newly established tissue
bank for tumours and non neoplastic tissues, some of these genes were further investigated with respect to cDNA-structure, partial DNA-structure and protein-expression.
Special attention was called on HMGA2 Expression in canine prostatic tissues. To
elucidate the question if HMGA2 proteins are overexpressed in canine prostate carcinomas, four non-neoplastic tissues of the canine prostate, three prostatic cysts, three
canine prostatic hyperplasias and six canine carcinomas of the prostate as well as
cells of the newly established prostate carcinoma cell-line were examined by quantita42
Summary
tive real time PCR in respect to HMGA2 expression. Those investigations clearly
showed a correlation between pathohistological findings and HMGA2 expression.
Furthermore, adeno-associated viruses were generated, carrying HMGA1 and
HMGA2 in antisense orientation. The infection of cells of the spontaneously immortalized cell-line CT1258 with those viruses lead to a statistically significant reduction of
cell growth and viabilitiy, whereas the infection of cells with viruses carrying LacZ or
no insert at all did not show any statistically significant reduction of cell growth. This
antisense strategy for suppression of HMGA2 expression seems to be an effective
target for the treatment of both, canine and human prostate carcinoma as well as any
other tumour showing overexpression of HMGA2. Due to the fact of the very low or
even absent expression of HMGA2 in adult organisms, very little side effects are to be
expected.
43
Literatur
7.
Literatur
National Center for Biotechnology Information; Object Count: Cytogenetic Maps,
http://www.ncbi.nlm.nih.gov/mapview/stats/BuildStats.cgi?taxid=9606&build=3
6&ver=1 2006.
Abe, N., Watanabe, T., Masaki, T., Mori, T., Sugiyama, M., Uchimura, H., Fujioka, Y.,
Chiappetta, G., Fusco, A. and Atomi, Y.: Pancreatic duct cell carcinomas express high levels of high mobility group I(Y) proteins. Cancer Res 60 (2000)
3117-22.
Abe, N., Watanabe, T., Sugiyama, M., Uchimura, H., Chiappetta, G., Fusco, A. and
Atomi, Y.: Determination of high mobility group I(Y) expression level in colorectal neoplasias: a potential diagnostic marker. Cancer Res 59 (1999) 1169-74.
Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N. and Perucho, M.:
Most human carcinomas of the exocrine pancreas contain mutant c-K-ras
genes. Cell 53 (1988) 549-54.
Anastasi, J., Le Beau, M.M., Vardiman, J.W., Fernald, A.A., Larson, R.A. and Rowley,
J.D.: Detection of trisomy 12 in chronic lymphocytic leukemia by fluorescence
in situ hybridization to interphase cells: a simple and sensitive method. Blood
79 (1992) 1796-801.
Arber, N.: Janus faces of ras: anti or pro-apoptotic? Apoptosis 4 (1999) 383-8.
Ashar, H.R., Cherath, L., Przybysz, K.M. and Chada, K.: Genomic characterization of
human HMGIC, a member of the accessory transcription factor family found at
translocation breakpoints in lipomas. Genomics 31 (1996) 207-14.
Ashar, H.R., Fejzo, M.S., Tkachenko, A., Zhou, X., Fletcher, J.A., Weremowicz, S.,
Morton, C.C. and Chada, K.: Disruption of the architectural factor HMGI-C:
DNA-binding AT hook motifs fused in lipomas to distinct transcriptional regulatory domains. Cell 82 (1995) 57-65.
Bandiera, A., Bonifacio, D., Manfioletti, G., Mantovani, F., Rustighi, A., Zanconati, F.,
Fusco, A., Di Bonito, L. and Giancotti, V.: Expression of HMGI(Y) proteins in
squamous intraepithelial and invasive lesions of the uterine cervix. Cancer Res
58 (1998) 426-31.
Banerjee, S.K., Weston, A.P., Persons, D.L. and Campbell, D.R.: Non-random loss of
chromosome 3 during transition of Helicobacter pylori-associated gastric MALT
44
Literatur
to B-cell MALT lymphoma revealed by fluorescence in situ hybridization. Cancer Lett 121 (1997) 83-90.
Bartnitzke, S., Motzko, H., Caselitz, J., Kornberg, M., Bullerdiek, J. and Schloot, W.: A
recurrent marker chromosome involving chromosome 1 in two mammary tumors of the dog. Cytogenet Cell Genet 60 (1992a) 135-7.
Bartnitzke, S., Motzko, H., Rosenhagen, C. and Bullerdiek, J.: Benign mixed tumor of
canine mammary gland showing an r(X) and trisomy 5 as the only clonal abnormalities. Cancer Genet Cytogenet 62 (1992b) 29-31.
Battista, S., Fidanza, V., Fedele, M., Klein-Szanto, A.J., Outwater, E., Brunner, H.,
Santoro, M., Croce, C.M. and Fusco, A.: The expression of a truncated HMGIC gene induces gigantism associated with lipomatosis. Cancer Res 59 (1999)
4793-7.
Becker, K., Murua Escobar, H., Richter, A., Meyer, B., Nolte, I. and Bullerdiek, J.: The
canine HMGA1 gene maps to CFA 23. Anim Genet 34 (2003) 68-9.
Belly, R.T., Rosenblatt, J.D., Steinmann, M., Toner, J., Sun, J., Shehadi, J., Peacock,
J.L., Raubertas, R.F., Jani, N. and Ryan, C.K.: Detection of mutated K12-ras in
histologically negative lymph nodes as an indicator of poor prognosis in stage
II colorectal cancer. Clin Colorectal Cancer 1 (2001) 110-6.
Bertz, J., Hentschel, S., Hundsdörfer, G., Kaatsch, P., Katalinic, A., Lehnert, M.,
Schön, D., Stegmaier, C. and Ziegler, H.: Krebs in Deutschland. Arbeitsgemeinschaft Bevölkerungsbezogener Krebsregister in Deutschland, Saarbrücken, 2004.
Bos, J.L.: ras oncogenes in human cancer: a review. Cancer Res 49 (1989) 4682-9.
Boutemmine, D., Bouchard, N., Boerboom, D., Jones, H.E., Goff, A.K., Dore, M. and
Sirois, J.: Molecular characterization of canine prostaglandin G/H synthase-2
and regulation in prostatic adenocarcinoma cells in vitro. Endocrinology 143
(2002) 1134-43.
Breen, M., Bullerdiek, J. and Langford, C.F.: The DAPI banded karyotype of the domestic dog (Canis familiaris) generated using chromosome-specific paint
probes. Chromosome Res 7 (1999a) 401-6.
Breen, M., Thomas, R., Binns, M.M., Carter, N.P. and Langford, C.F.: Reciprocal
chromosome painting reveals detailed regions of conserved synteny between
the karyotypes of the domestic dog (Canis familiaris) and human. Genomics 61
(1999b) 145-55.
45
Literatur
Brezniceanu, M.L., Volp, K., Bosser, S., Solbach, C., Lichter, P., Joos, S. and Zornig,
M.: HMGB1 inhibits cell death in yeast and mammalian cells and is abundantly
expressed in human breast carcinoma. Faseb J 17 (2003) 1295-7.
Bullerdiek, J., Leuschner, E., Taquia, E., Bonk, U. and Bartnitzke, S.: Trisomy 8 as a
recurrent clonal abnormality in breast cancer? Cancer Genet Cytogenet 65
(1993) 64-7.
Bussemakers, M.J., van de Ven, W.J., Debruyne, F.M. and Schalken, J.A.: Identification of high mobility group protein I(Y) as potential progression marker for prostate cancer by differential hybridization analysis. Cancer Res 51 (1991) 606-11.
Bustin, M.: Revised nomenclature for high mobility group (HMG) chromosomal proteins. Trends Biochem Sci 26 (2001) 152-3.
Bustin, M. and Reeves, R.: High-mobility-group chromosomal proteins: architectural
components that facilitate chromatin function. Prog Nucleic Acid Res Mol Biol
54 (1996) 35-100.
Chiappetta, G., Avantaggiato, V., Visconti, R., Fedele, M., Battista, S., Trapasso, F.,
Merciai, B.M., Fidanza, V., Giancotti, V., Santoro, M., Simeone, A. and Fusco,
A.: High level expression of the HMGI (Y) gene during embryonic development.
Oncogene 13 (1996) 2439-46.
Chiappetta, G., Bandiera, A., Berlingieri, M.T., Visconti, R., Manfioletti, G., Battista,
S., Martinez-Tello, F.J., Santoro, M., Giancotti, V. and Fusco, A.: The expression of the high mobility group HMGI (Y) proteins correlates with the malignant
phenotype of human thyroid neoplasias. Oncogene 10 (1995) 1307-14.
Chiappetta, G., Manfioletti, G., Pentimalli, F., Abe, N., Di Bonito, M., Vento, M.T., Giuliano, A., Fedele, M., Viglietto, G., Santoro, M., Watanabe, T., Giancotti, V. and
Fusco, A.: High mobility group HMGI(Y) protein expression in human colorectal
hyperplastic and neoplastic diseases. Int J Cancer 91 (2001) 147-51.
Chiappetta, G., Tallini, G., De Biasio, M.C., Manfioletti, G., Martinez-Tello, F.J., Pentimalli, F., de Nigris, F., Mastro, A., Botti, G., Fedele, M., Berger, N., Santoro,
M., Giancotti, V. and Fusco, A.: Detection of high mobility group I HMGI(Y) protein in the diagnosis of thyroid tumors: HMGI(Y) expression represents a potential diagnostic indicator of carcinoma. Cancer Res 58 (1998) 4193-8.
Chinnappan, D., Philip, A., Wu, X., Pan, A. and Wyandt, H.E.: Acquired Robertsonian
translocations in two leukemia patients. Cancer Genet Cytogenet 131 (2001)
104-8.
46
Literatur
Chinnappan, D., Verma, I.C., Arya, L.S. and Choudry, V.P.: Rare constitutional
Robertsonian translocation in a childhood acute lymphoblastic leukemic patient. Cancer Genet Cytogenet 102 (1998) 151-2.
Collins, S., Coleman, H. and Groudine, M.: Expression of bcr and bcr-abl fusion transcripts in normal and leukemic cells. Mol Cell Biol 7 (1987) 2870-6.
Czepulkowski, B., Powell, A.R., Pagliuca, A. and Mufti, G.J.: Trisomy 10 and acute
myeloid leukemia. Cancer Genet Cytogenet 134 (2002) 81-3.
Czyz, W., Balcerczak, E., Jakubiak, M., Pasieka, Z., Kuzdak, K. and Mirowski, M.:
HMGI(Y) gene expression as a potential marker of thyroid follicular carcinoma.
Langenbecks Arch Surg 389 (2004) 193-7.
Dal Cin, P., Timmerman, D., Van den Berghe, I., Wanschura, S., Kazmierczak, B.,
Vergote, I., Deprest, J., Neven, P., Moerman, P., Bullerdiek, J. and Van den
Berghe, H.: Genomic changes in endometrial polyps associated with tamoxifen
show no evidence for its action as an external carcinogen. Cancer Res 58
(1998) 2278-81.
Fedele, M., Bandiera, A., Chiappetta, G., Battista, S., Viglietto, G., Manfioletti, G.,
Casamassimi, A., Santoro, M., Giancotti, V. and Fusco, A.: Human colorectal
carcinomas express high levels of high mobility group HMGI(Y) proteins. Cancer Res 56 (1996) 1896-901.
Fedele, M., Battista, S., Manfioletti, G., Croce, C.M., Giancotti, V. and Fusco, A.: Role
of the high mobility group A proteins in human lipomas. Carcinogenesis 22
(2001) 1583-91.
Flohr, A.M., Rogalla, P., Meiboom, M., Borrmann, L., Krohn, M., Thode-Halle, B. and
Bullerdiek, J.: Variation of HMGB1 expression in breast cancer. Anticancer Res
21 (2001) 3881-5.
Friedmann, M., Holth, L.T., Zoghbi, H.Y. and Reeves, R.: Organization, inducibleexpression and chromosome localization of the human HMG-I(Y) nonhistone
protein gene. Nucleic Acids Res 21 (1993) 4259-67.
Gattas, G.J., Quade, B.J., Nowak, R.A. and Morton, C.C.: HMGIC expression in human adult and fetal tissues and in uterine leiomyomata. Genes Chromosomes
Cancer 25 (1999) 316-22.
Graphodatsky, A.S., Beklemisheva, V.R. and Dolf, G.: High-resolution GTG-banding
patterns of dog and silver fox chromosomes: description and comparative
analysis. Cytogenet Cell Genet 69 (1995) 226-31.
47
Literatur
Hahn, K.A., Richardson, R.C., Hahn, E.A. and Chrisman, C.L.: Diagnostic and prognostic importance of chromosomal aberrations identified in 61 dogs with lymphosarcoma. Vet Pathol 31 (1994) 528-40.
Hansen, K. and Khanna, C.: Spontaneous and genetically engineered animal models;
use in preclinical cancer drug development. Eur J Cancer 40 (2004) 858-80.
Harley, C.B.: Telomere loss: mitotic clock or genetic time bomb? Mutat Res 256
(1991) 271-82.
He, Q., Liang, C.H. and Lippard, S.J.: Steroid hormones induce HMG1 overexpression and sensitize breast cancer cells to cisplatin and carboplatin. Proc Natl
Acad Sci U S A 97 (2000) 5768-72.
Hecht, F., Morgan, R. and Hecht, B.K.: Robertsonian chromosome recombinants are
rare in cancer. Cancer Genet Cytogenet 35 (1988) 79-81.
Hofmann, M.A., Drury, S., Fu, C., Qu, W., Taguchi, A., Lu, Y., Avila, C., Kambham,
N., Bierhaus, A., Nawroth, P., Neurath, M.F., Slattery, T., Beach, D., McClary,
J., Nagashima, M., Morser, J., Stern, D. and Schmidt, A.M.: RAGE mediates a
novel proinflammatory axis: a central cell surface receptor for S100/calgranulin
polypeptides. Cell 97 (1999) 889-901.
Hori, O., Brett, J., Slattery, T., Cao, R., Zhang, J., Chen, J.X., Nagashima, M., Lundh,
E.R., Vijay, S., Nitecki, D. and et al.: The receptor for advanced glycation end
products (RAGE) is a cellular binding site for amphoterin. Mediation of neurite
outgrowth and co-expression of rage and amphoterin in the developing nervous system. J Biol Chem 270 (1995) 25752-61.
Horsting, N., Wohlsein, P., Reimann, N., Bartnitzke, S., Bullerdiek, J. and Nolte, I.:
Cytogenetic analysis of three oropharyngeal malignant melanomas in dogs.
Res Vet Sci 67 (1999) 149-51.
Huttunen, H.J., Fages, C., Kuja-Panula, J., Ridley, A.J. and Rauvala, H.: Receptor for
advanced glycation end products-binding COOH-terminal motif of amphoterin
inhibits invasive migration and metastasis. Cancer Res 62 (2002) 4805-11.
Ishiguro, H., Nakaigawa, N., Miyoshi, Y., Fujinami, K., Kubota, Y. and Uemura, H.:
Receptor for advanced glycation end products (RAGE) and its ligand, amphoterin are overexpressed and associated with prostate cancer development.
Prostate 64 (2005) 92-100.
Kazmierczak, B., Bullerdiek, J., Pham, K.H., Bartnitzke, S. and Wiesner, H.: Intron 3
of HMGIC is the most frequent target of chromosomal aberrations in human
48
Literatur
tumors and has been conserved basically for at least 30 million years. Cancer
Genet Cytogenet 103 (1998a) 175-7.
Kazmierczak, B., Dal Cin, P., Wanschura, S., Bartnitzke, S., Van den Berghe, H. and
Bullerdiek, J.: Cloning and molecular characterization of part of a new gene
fused to HMGIC in mesenchymal tumors. Am J Pathol 152 (1998b) 431-5.
Kazmierczak, B., Hennig, Y., Wanschura, S., Rogalla, P., Bartnitzke, S., Van de Ven,
W. and Bullerdiek, J.: Description of a novel fusion transcript between HMGI-C,
a gene encoding for a member of the high mobility group proteins, and the mitochondrial aldehyde dehydrogenase gene. Cancer Res 55 (1995) 6038-9.
Kazmierczak, B., Rosigkeit, J., Wanschura, S., Meyer-Bolte, K., Van de Ven, W.J.,
Kayser, K., Krieghoff, B., Kastendiek, H., Bartnitzke, S. and Bullerdiek, J.:
HMGI-C rearrangements as the molecular basis for the majority of pulmonary
chondroid hamartomas: a survey of 30 tumors. Oncogene 12 (1996) 515-21.
Kirkness, E.F., Bafna, V., Halpern, A.L., Levy, S., Remington, K., Rusch, D.B., Delcher, A.L., Pop, M., Wang, W., Fraser, C.M. and Venter, J.C.: The dog genome: survey sequencing and comparative analysis. Science 301 (2003) 1898903.
Kurose, K., Mine, N., Doi, D., Ota, Y., Yoneyama, K., Konishi, H., Araki, T. and Emi,
M.: Novel gene fusion of COX6C at 8q22-23 to HMGIC at 12q15 in a uterine
leiomyoma. Genes Chromosomes Cancer 27 (2000) 303-7.
Kurose, K., Mine, N., Iida, A., Nagai, H., Harada, H., Araki, T. and Emi, M.: Three aberrant splicing variants of the HMGIC gene transcribed in uterine leiomyomas.
Genes Chromosomes Cancer 30 (2001) 212-7.
Kuska, B.: Sit, DNA, sit: cancer genetics going to the dogs. J Natl Cancer Inst 91
(1999) 204-6.
Landsman, D. and Bustin, M.: A signature for the HMG-1 box DNA-binding proteins.
Bioessays 15 (1993) 539-46.
Lemke, I., Rogalla, P. and Bullerdiek, J.: A novel LPP fusion gene indicates the crucial role of truncated LPP proteins in lipomas and pulmonary chondroid hamartomas. Cytogenet Cell Genet 95 (2001) 153-6.
Lepretre, S., Buchonnet, G., Stamatoullas, A., Lenain, P., Duval, C., d'Anjou, J., Callat, M.P., Tilly, H. and Bastard, C.: Chromosome abnormalities in peripheral Tcell lymphoma. Cancer Genet Cytogenet 117 (2000) 71-9.
49
Literatur
Ligon, A.H. and Morton, C.C.: Genetics of uterine leiomyomata. Genes Chromosomes
Cancer 28 (2000) 235-45.
Lin, L., Faraco, J., Li, R., Kadotani, H., Rogers, W., Lin, X., Qiu, X., de Jong, P.J., Nishino, S. and Mignot, E.: The sleep disorder canine narcolepsy is caused by a
mutation in the hypocretin (orexin) receptor 2 gene. Cell 98 (1999) 365-76.
Lindblad-Toh, K., Wade, C.M., Mikkelsen, T.S., Karlsson, E.K., Jaffe, D.B., Kamal, M.,
Clamp, M., Chang, J.L., Kulbokas, E.J., 3rd, Zody, M.C., Mauceli, E., Xie, X.,
Breen, M., Wayne, R.K., Ostrander, E.A., Ponting, C.P., Galibert, F., Smith,
D.R., DeJong, P.J., Kirkness, E., Alvarez, P., Biagi, T., Brockman, W., Butler,
J., Chin, C.W., Cook, A., Cuff, J., Daly, M.J., DeCaprio, D., Gnerre, S., Grabherr, M., Kellis, M., Kleber, M., Bardeleben, C., Goodstadt, L., Heger, A., Hitte,
C., Kim, L., Koepfli, K.P., Parker, H.G., Pollinger, J.P., Searle, S.M., Sutter,
N.B., Thomas, R., Webber, C., Baldwin, J., Abebe, A., Abouelleil, A., Aftuck, L.,
Ait-Zahra, M., Aldredge, T., Allen, N., An, P., Anderson, S., Antoine, C., Arachchi, H., Aslam, A., Ayotte, L., Bachantsang, P., Barry, A., Bayul, T., Benamara,
M., Berlin, A., Bessette, D., Blitshteyn, B., Bloom, T., Blye, J., Boguslavskiy, L.,
Bonnet, C., Boukhgalter, B., Brown, A., Cahill, P., Calixte, N., Camarata, J.,
Cheshatsang, Y., Chu, J., Citroen, M., Collymore, A., Cooke, P., Dawoe, T.,
Daza, R., Decktor, K., DeGray, S., Dhargay, N., Dooley, K., Dooley, K., Dorje,
P., Dorjee, K., Dorris, L., Duffey, N., Dupes, A., Egbiremolen, O., Elong, R.,
Falk, J., Farina, A., Faro, S., Ferguson, D., Ferreira, P., Fisher, S., FitzGerald,
M., et al.: Genome sequence, comparative analysis and haplotype structure of
the domestic dog. Nature 438 (2005) 803-19.
Liotta, L.A. and Clair, T.: Cancer. Checkpoint for invasion. Nature 405 (2000) 287-8.
MacEwen, E.G.: Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer Metastasis Rev 9 (1990) 125-36.
Manolache, M., Ross, W.M. and Schmid, M.: Banding analysis of the somatic chromosomes of the domestic dog (Canis familiaris). Can J Genet Cytol 18 (1976)
513-8.
Mark, H.F., Feldman, D., Das, S., Samy, M., Sun, C.L. and Mark, S.: Assessment of
chromosomal trisomies in prostate cancer using fluorescent in situ hybridization. Exp Mol Pathol 67 (1999) 109-17.
Masciullo, V., Baldassarre, G., Pentimalli, F., Berlingieri, M.T., Boccia, A., Chiappetta,
G., Palazzo, J., Manfioletti, G., Giancotti, V., Viglietto, G., Scambia, G. and Fu50
Literatur
sco, A.: HMGA1 protein over-expression is a frequent feature of epithelial ovarian carcinomas. Carcinogenesis 24 (2003) 1191-8.
Masure, S., Haefner, B., Wesselink, J.J., Hoefnagel, E., Mortier, E., Verhasselt, P.,
Tuytelaars, A., Gordon, R. and Richardson, A.: Molecular cloning, expression
and characterization of the human serine/threonine kinase Akt-3. Eur J Biochem 265 (1999) 353-60.
Mayr, B., Eschborn, U., Loupal, G. and Schleger, W.: Trisomy 1 in a canine mammary
tubular adenocarcinoma, complex type. Vet Pathol 30 (1993) 311-3.
Mayr, B., Furtmueller, G., Schleger, W. and Reifinger, M.: Trisomy 2 in three cases of
canine haemangiopericytoma. Br Vet J 148 (1992a) 113-8.
Mayr, B., Gilli, H., Schleger, W., Reifinger, M. and Burtscher, H.: Cytogenetic characterization of mammary tumors in two domestic dogs. Zentralbl Veterinarmed A
38 (1991a) 141-7.
Mayr, B., Kramberger-Kaplan, E., Loupal, G. and Schleger, W.: Analysis of complex
cytogenetic alterations in three canine mammary sarcomas. Res Vet Sci 53
(1992b) 205-11.
Mayr, B., Reifinger, M., Brem, G., Feil, C. and Schleger, W.: Cytogenetic, ras, and
p53: studies in cases of canine neoplasms (hemangiopericytoma, mastocytoma, histiocytoma, chloroma). J Hered 90 (1999) 124-8.
Mayr, B., Reifinger, M., Weissenbock, H., Schleger, W. and Eisenmenger, E.: Cytogenetic analyses of four solid tumours in dogs. Res Vet Sci 57 (1994) 88-95.
Mayr, B., Scheller, M., Reifinger, M. and Loupal, G.: Cytogenetic characterization of a
fibroma and three haemangiopericytomas in domestic dogs. Br Vet J 151
(1995) 433-41.
Mayr, B., Schleger, W., Kalat, M., Schweiger, P., Reifinger, M. and Eisenmenger, E.:
Cytogenetic studies in a canine mammary tumor. Cancer Genet Cytogenet 47
(1990a) 83-7.
Mayr, B., Schleger, W., Loupal, G. and Burtscher, H.: Characterisation of complex
karyotype changes in a canine thyroid adenoma. Res Vet Sci 50 (1991b) 298300.
Mayr, B., Wagner, B., Schleger, W. and Reifinger, M.: Cytogenetic studies in a canine
neurofibroma. Br Vet J 146 (1990b) 500-3.
McPherson, J.D., Marra, M., Hillier, L., Waterston, R.H., Chinwalla, A., Wallis, J.,
Sekhon, M., Wylie, K., Mardis, E.R., Wilson, R.K., Fulton, R., Kucaba, T.A.,
51
Literatur
Wagner-McPherson, C. and Barbazuk, W.B.: A physical map of the human genome. Macmillan Magazines Ltd (2001a).
McPherson, J.D., Marra, M., Hillier, L., Waterston, R.H., Chinwalla, A., Wallis, J.,
Sekhon, M., Wylie, K., Mardis, E.R., Wilson, R.K., Fulton, R., Kucaba, T.A.,
Wagner-McPherson, C., Barbazuk, W.B., Gregory, S.G., Humphray, S.J.,
French, L., Evans, R.S., Bethel, G., Whittaker, A., Holden, J.L., McCann, O.T.,
Dunham, A., Soderlund, C., Scott, C.E., Bentley, D.R., Schuler, G., Chen,
H.C., Jang, W., Green, E.D., Idol, J.R., Maduro, V.V., Montgomery, K.T., Lee,
E., Miller, A., Emerling, S., Kucherlapati, Gibbs, R., Scherer, S., Gorrell, J.H.,
Sodergren, E., Clerc-Blankenburg, K., Tabor, P., Naylor, S., Garcia, D., de
Jong, P.J., Catanese, J.J., Nowak, N., Osoegawa, K., Qin, S., Rowen, L., Madan, A., Dors, M., Hood, L., Trask, B., Friedman, C., Massa, H., Cheung, V.G.,
Kirsch, I.R., Reid, T., Yonescu, R., Weissenbach, J., Bruls, T., Heilig, R.,
Branscomb, E., Olsen, A., Doggett, N., Cheng, J.F., Hawkins, T., Myers, R.M.,
Shang, J., Ramirez, L., Schmutz, J., Velasquez, O., Dixon, K., Stone, N.E.,
Cox, D.R., Haussler, D., Kent, W.J., Furey, T., Rogic, S., Kennedy, S., Jones,
S., Rosenthal, A., Wen, G., Schilhabel, M., Gloeckner, G., Nyakatura, G., Siebert, R., Schlegelberger, B., Korenberg, J., Chen, X.N., Fujiyama, A., Hattori,
M., Toyoda, A., Yada, T., Park, H.S., Sakaki, Y., Shimizu, N., Asakawa, S., et
al.: A physical map of the human genome. Nature 409 (2001b) 934-41.
Meiboom, M., Murua Escobar, H., Winkler, S., Nolte, I. and Bullerdiek, J.: Molecular
characterization and mapping of the canine KRAB zinc finger gene ZNF331.
Anim Genet 35 (2004) 262-3.
Meyer, B., Loeschke, S., Schultze, A., Weigel, T., Sandkamp, M., Goldmann, T.,
Vollmer, E. and Bullerdiek, J.: HMGA2 Overexpression in Non-Small Cell Lung
Cancer. Molecular Carcinogenesis
(in press).
Meyer, B., Murua Escobar, H., Hauke, S., Richter, A., Winkler, S., Rogalla, P., Flohr,
A.M., Bullerdiek, J. and Nolte, I.: Expression pattern of the HMGB1 gene in
sarcomas of the dog. Anticancer Res 24 (2004a) 707-10.
Meyer, B., Murua Escobar, H., Winkler, S., Dolf, G., Schelling, C., Bullerdiek, J. and
Nolte, I.: Molecular characterization and mapping of the canine cyclin D1
(CCND1) gene. Anim Genet 35 (2004b) 413.
52
Literatur
Mine, N., Kurose, K., Nagai, H., Doi, D., Ota, Y., Yoneyama, K., Konishi, H., Araki, T.
and Emi, M.: Gene fusion involving HMGIC is a frequent aberration in uterine
leiomyomas. J Hum Genet 46 (2001) 408-12.
Mitelman, F., Johansson, B., Mandahl, N. and Mertens, F.: Clinical significance of
cytogenetic findings in solid tumors. Cancer Genet Cytogenet 95 (1997) 1-8.
Miyazawa, J., Mitoro, A., Kawashiri, S., Chada, K.K. and Imai, K.: Expression of mesenchyme-specific gene HMGA2 in squamous cell carcinomas of the oral cavity.
Cancer Res 64 (2004) 2024-9.
Muller, S., Scaffidi, P., Degryse, B., Bonaldi, T., Ronfani, L., Agresti, A., Beltrame, M.
and Bianchi, M.E.: New EMBO members' review: the double life of HMGB1
chromatin protein: architectural factor and extracellular signal. Embo J 20
(2001) 4337-40.
Murua Escobar, H., Becker, K., Bullerdiek, J. and Nolte, I.: The canine ERBB2 gene
maps to a chromosome region frequently affected by aberrations in tumors of
the dog (Canis familiaris). Cytogenet Cell Genet 94 (2001) 194-5.
Murua Escobar, H., Gunther, K., Richter, A., Soller, J.T., Winkler, S., Nolte, I. and
Bullerdiek, J.: Absence of ras-gene hot-spot mutations in canine fibrosarcomas
and melanomas. Anticancer Res 24 (2004a) 3027-8.
Murua Escobar, H., Meyer, B., Richter, A., Becker, K., Flohr, A.M., Bullerdiek, J. and
Nolte, I.: Molecular characterization of the canine HMGB1. Cytogenet Genome
Res 101 (2003) 33-8.
Murua Escobar, H., Meyer, J., Winkler, S., Schelling, C., Dolf, G., Nolte, I. and Bullerdiek, J.: The protein kinase B, gamma (AKT3) gene maps to canine chromosome 7. Anim Genet 35 (2004b) 354-5.
Murua Escobar, H., Soller, J.T., Richter, A., Meyer, B., Winkler, S., Bullerdiek, J. and
Nolte, I.: "Best friends" sharing the HMGA1 gene: comparison of the human
and canine HMGA1 to orthologous other species. J Hered 96 (2005) 777-81.
Murua Escobar, H., Soller, J.T., Richter, A., Meyer, B., Winkler, S., Flohr, A.M., Nolte,
I. and Bullerdiek, J.: The canine HMGA1. Gene 330 (2004c) 93-9.
Murua Escobar, H., Soller, J.T., Sterenczak, K.A., Sperveslage, J.D., Schlueter, C.,
Burchardt, B., Eberle, N., Fork, M., Nimzyk, R., Winkler, S., Nolte, I. and
Bullerdiek, J.: Cloning and characterization of the canine receptor for advanced
glycation end products. Gene 369 (2006) 45-52.
53
Literatur
Nam, E.S., Kim, D.H., Cho, S.J., Chae, S.W., Kim, H.Y., Kim, S.M., Han, J.J., Shin,
H.S. and Park, Y.E.: Expression of HMGI(Y) associated with malignant phenotype of human gastric tissue. Histopathology 42 (2003) 466-71.
Neeper, M., Schmidt, A.M., Brett, J., Yan, S.D., Wang, F., Pan, Y.C., Elliston, K.,
Stern, D. and Shaw, A.: Cloning and expression of a cell surface receptor for
advanced glycosylation end products of proteins. J Biol Chem 267 (1992)
14998-5004.
Nicholson, K.M. and Anderson, N.G.: The protein kinase B/Akt signalling pathway in
human malignancy. Cell Signal 14 (2002) 381-95.
Nielsen, J. and Wohlert, M.: Chromosome abnormalities found among 34,910 newborn children: results from a 13-year incidence study in Arhus, Denmark. Hum
Genet 87 (1991) 81-3.
Nolte, I. and Nolte, M.: Praxis der Onkologie bei Hund und Katze. Enke, Stuttgart,
2000.
Nolte, I., Reimann, N., Bullerdiek, J., Bartnitzke, S., Mischke, R. and Nolte, M.: [Importance of cytogenetic investigations in canine leukemias]. Tierarztl Prax 25
(1997) 393-7.
Nolte, M., Werner, M., Nolte, I. and Georgii, A.: Different cytogenetic findings in two
clinically similar leukaemic dogs. J Comp Pathol 108 (1993) 337-42.
Ostrander, E.A., Galibert, F. and Patterson, D.F.: Canine genetics comes of age.
Trends Genet 16 (2000) 117-24.
Park, L., Raman, K.G., Lee, K.J., Lu, Y., Ferran, L.J., Jr., Chow, W.S., Stern, D. and
Schmidt, A.M.: Suppression of accelerated diabetic atherosclerosis by the
soluble receptor for advanced glycation endproducts. Nat Med 4 (1998) 102531.
Park, M.: Genetic abnormalities of cell growth. In: Scriver (Ed.), The Metabolic and
Molecular Basis of Inherited Diseases. McGraw-Hill, New York, 1995.
Pentimalli, F., Dentice, M., Fedele, M., Pierantoni, G.M., Cito, L., Pallante, P.,
Santoro, M., Viglietto, G., Dal Cin, P. and Fusco, A.: Suppression of HMGA2
protein synthesis could be a tool for the therapy of well differentiated liposarcomas overexpressing HMGA2. Cancer Res 63 (2003) 7423-7.
Petit, M.M., Mols, R., Schoenmakers, E.F., Mandahl, N. and Van de Ven, W.J.: LPP,
the preferred fusion partner gene of HMGIC in lipomas, is a novel member of
the LIM protein gene family. Genomics 36 (1996) 118-29.
54
Literatur
Pil, P.M. and Lippard, S.J.: Specific binding of chromosomal protein HMG1 to DNA
damaged by the anticancer drug cisplatin. Science 256 (1992) 234-7.
Rawle, F.E. and Lillicrap, D.: Preclinical animal models for hemophilia gene therapy:
predictive value and limitations. Semin Thromb Hemost 30 (2004) 205-13.
Reeves, R.: Structure and function of the HMGI(Y) family of architectural transcription
factors. Environ Health Perspect 108 Suppl 5 (2000) 803-9.
Reeves, R., Edberg, D.D. and Li, Y.: Architectural transcription factor HMGI(Y) promotes tumor progression and mesenchymal transition of human epithelial cells.
Mol Cell Biol 21 (2001) 575-94.
Reimann, N., Bartnitzke, S., Bullerdiek, J., Mischke, R. and Nolte, I.: Trisomy 1 in a
canine acute leukemia indicating the pathogenetic importance of polysomy 1 in
leukemias of the dog. Cancer Genet Cytogenet 101 (1998) 49-52.
Reimann, N., Bartnitzke, S., Bullerdiek, J., Schmitz, U., Rogalla, P., Nolte, I. and
Ronne, M.: An extended nomenclature of the canine karyotype. Cytogenet Cell
Genet 73 (1996a) 140-4.
Reimann, N., Nolte, I., Bartnitzke, S. and Bullerdiek, J.: Re: Sit, DNA, sit: cancer genetics going to the dogs. J Natl Cancer Inst 91 (1999a) 1688-9.
Reimann, N., Nolte, I., Bonk, U., Bartnitzke, S. and Bullerdiek, J.: Cytogenetic investigation of canine lipomas. Cancer Genet Cytogenet 111 (1999b) 172-4.
Reimann, N., Nolte, I., Bonk, U., Werner, M., Bullerdiek, J. and Bartnitzke, S.: Trisomy
18 in a canine thyroid adenoma. Cancer Genet Cytogenet 90 (1996b) 154-6.
Reimann, N., Rogalla, P., Kazmierczak, B., Bonk, U., Nolte, I., Grzonka, T., Bartnitzke, S. and Bullerdiek, J.: Evidence that metacentric and submetacentric
chromosomes in canine tumors can result from telomeric fusions. Cytogenet
Cell Genet 67 (1994) 81-5.
Rho, Y.S., Lim, Y.C., Park, I.S., Kim, J.H., Ahn, H.Y., Cho, S.J. and Shin, H.S.: High
mobility group HMGI(Y) protein expression in head and neck squamous cell
carcinoma. Acta Otolaryngol 127 (2007) 76-81.
Richter, A., Murua Escobar, H., Gunther, K., Meyer, B., Winkler, S., Dolf, G., Schelling, C., Nolte, I. and Bullerdiek, J.: The canine NRAS gene maps to CFA 17.
Anim Genet 35 (2004) 355-6.
Richter, A., Murua Escobar, H., Gunther, K., Soller, J.T., Winkler, S., Nolte, I. and
Bullerdiek, J.: RAS gene hot-spot mutations in canine neoplasias. J Hered 96
(2005) 764-5.
55
Literatur
Rogalla, P., Drechsler, K., Frey, G., Hennig, Y., Helmke, B., Bonk, U. and Bullerdiek,
J.: HMGI-C expression patterns in human tissues. Implications for the genesis
of frequent mesenchymal tumors. Am J Pathol 149 (1996) 775-9.
Rogalla, P., Drechsler, K., Kazmierczak, B., Rippe, V., Bonk, U. and Bullerdiek, J.:
Expression of HMGI-C, a member of the high mobility group protein family, in a
subset of breast cancers: relationship to histologic grade. Mol Carcinog 19
(1997) 153-6.
Rogalla, P., Drechsler, K., Schroder-Babo, W., Eberhardt, K. and Bullerdiek, J.:
HMGIC expression patterns in non-small lung cancer and surrounding tissue.
Anticancer Res 18 (1998) 3327-30.
Sarhadi, V., Wikman, H., Salmenkivi, K., Kuosma, E., Sioris, T., Salo, J., Karjalainen,
A., Knuutila, S. and Anttila, S.: Increased expression of high mobility group A
proteins in lung cancer. J Pathol (2006).
Scala, S., Portella, G., Fedele, M., Chiappetta, G. and Fusco, A.: Adenovirusmediated suppression of HMGI(Y) protein synthesis as potential therapy of
human malignant neoplasias. Proc Natl Acad Sci U S A 97 (2000) 4256-61.
Schlueter, C., Hauke, S., Flohr, A.M., Rogalla, P. and Bullerdiek, J.: Tissue-specific
expression patterns of the RAGE receptor and its soluble forms--a result of
regulated alternative splicing? Biochim Biophys Acta 1630 (2003) 1-6.
Schmidt, A.M., Hori, O., Brett, J., Yan, S.D., Wautier, J.L. and Stern, D.: Cellular receptors for advanced glycation end products. Implications for induction of oxidant stress and cellular dysfunction in the pathogenesis of vascular lesions. Arterioscler Thromb 14 (1994) 1521-8.
Schoenmakers, E.F., Huysmans, C. and Van de Ven, W.J.: Allelic knockout of novel
splice variants of human recombination repair gene RAD51B in t(12;14) uterine
leiomyomas. Cancer Res 59 (1999) 19-23.
Schoenmakers, E.F., Wanschura, S., Mols, R., Bullerdiek, J., Van den Berghe, H. and
Van de Ven, W.J.: Recurrent rearrangements in the high mobility group protein
gene, HMGI-C, in benign mesenchymal tumours. Nat Genet 10 (1995) 436-44.
Seabright, M.: A rapid banding technique for human chromosomes. Lancet 2 (1971)
971-2.
Selden, J.R., Moorhead, P.S., Oehlert, M.L. and Patterson, D.F.: The Giemsa banding pattern of the canine karyotype. Cytogenet Cell Genet 15 (1975) 380-7.
56
Literatur
Shukla, V.K., Hughes, D.C., Hughes, L.E., McCormick, F. and Padua, R.A.: ras mutations in human melanotic lesions: K-ras activation is a frequent and early event
in melanoma development. Oncogene Res 5 (1989) 121-7.
Slijepcevic, P.: Telomeres and mechanisms of Robertsonian fusion. Chromosoma
107 (1998) 136-40.
Soller, J.T., Murua Escobar, H., Winkler, S., Fork, M., Pöhler, C., Bünger, S.,
Sterenczak, K.A., Willenbrock, S., Nolte, I. and Bullerdiek, J.: Inhibitory effect
of antisense HMGA AAV-mediated delivery suppresses cell proliferation in canine carcinoma cell line. (in Vorbereitung).
Sornberger, K.S., Weremowicz, S., Williams, A.J., Quade, B.J., Ligon, A.H.,
Pedeutour, F., Vanni, R. and Morton, C.C.: Expression of HMGIY in three uterine leiomyomata with complex rearrangements of chromosome 6. Cancer
Genet Cytogenet 114 (1999) 9-16.
Spandidos, D.A., Sourvinos, G., Tsatsanis, C. and Zafiropoulos, A.: Normal ras
genes: their onco-suppressor and pro-apoptotic functions (review). Int J Oncol
21 (2002) 237-41.
Steiner, T., Junker, K., Burkhardt, F., Braunsdorf, A., Janitzky, V. and Schubert, J.:
Gain in chromosome 8q correlates with early progression in hormonal treated
prostate cancer. Eur Urol 41 (2002) 167-71.
Stone, D.M., Jacky, P.B. and Prieur, D.J.: The giemsa banding pattern of canine
chromosomes, using a cell synchronization technique. Genome 34 (1991) 40712.
Switonski, M., Reimann, N., Bosma, A.A., Long, S., Bartnitzke, S., Pienkowska, A.,
Moreno-Milan, M.M. and Fischer, P.: Report on the progress of standardization
of the G-banded canine (Canis familiaris) karyotype. Committee for the Standardized Karyotype of the Dog (Canis familiaris). Chromosome Res 4 (1996)
306-9.
Switonski, M., Szczerbal, I. and Nowacka, J.: The dog genome map and its use in
mammalian comparative genomics. J Appl Genet 45 (2004) 195-214.
Taguchi, A., Blood, D.C., del Toro, G., Canet, A., Lee, D.C., Qu, W., Tanji, N., Lu, Y.,
Lalla, E., Fu, C., Hofmann, M.A., Kislinger, T., Ingram, M., Lu, A., Tanaka, H.,
Hori, O., Ogawa, S., Stern, D.M. and Schmidt, A.M.: Blockade of RAGEamphoterin signalling suppresses tumour growth and metastases. Nature 405
(2000) 354-60.
57
Literatur
Takaha, N., Hawkins, A.L., Griffin, C.A., Isaacs, W.B. and Coffey, D.S.: High mobility
group protein I(Y): a candidate architectural protein for chromosomal rearrangements in prostate cancer cells. Cancer Res 62 (2002) 647-51.
Takaha, N., Resar, L.M., Vindivich, D. and Coffey, D.S.: High mobility group protein
HMGI(Y) enhances tumor cell growth, invasion, and matrix metalloproteinase-2
expression in prostate cancer cells. Prostate 60 (2004) 160-7.
Tallini, G. and Dal Cin, P.: HMGI(Y) and HMGI-C dysregulation: a common occurrence in human tumors. Adv Anat Pathol 6 (1999) 237-46.
Tallini, G., Dal Cin, P., Rhoden, K.J., Chiapetta, G., Manfioletti, G., Giancotti, V.,
Fusco, A., Van den Berghe, H. and Sciot, R.: Expression of HMGI-C and
HMGI(Y) in ordinary lipoma and atypical lipomatous tumors: immunohistochemical reactivity correlates with karyotypic alterations. Am J Pathol 151
(1997) 37-43.
Tamimi, Y., van der Poel, H.G., Denyn, M.M., Umbas, R., Karthaus, H.F., Debruyne,
F.M. and Schalken, J.A.: Increased expression of high mobility group protein
I(Y) in high grade prostatic cancer determined by in situ hybridization. Cancer
Res 53 (1993) 5512-6.
Thomas, R., Smith, K.C., Ostrander, E.A., Galibert, F. and Breen, M.: Chromosome
aberrations in canine multicentric lymphomas detected with comparative genomic hybridisation and a panel of single locus probes. Br J Cancer 89 (2003)
1530-7.
Trapasso, F., Sarti, M., Cesari, R., Yendamuri, S., Dumon, K.R., Aqeilan, R.I., Pentimalli, F., Infante, L., Alder, H., Abe, N., Watanabe, T., Viglietto, G., Croce, C.M.
and Fusco, A.: Therapy of human pancreatic carcinoma based on suppression
of HMGA1 protein synthesis in preclinical models. Cancer Gene Ther 11
(2004) 633-41.
Vail, D.M. and MacEwen, E.G.: Spontaneously occurring tumors of companion animals as models for human cancer. Cancer Invest 18 (2000) 781-92.
van Duin, M., van Marion, R., Vissers, K., Watson, J.E., van Weerden, W.M.,
Schroder, F.H., Hop, W.C., van der Kwast, T.H., Collins, C. and van Dekken,
H.: High-resolution array comparative genomic hybridization of chromosome
arm 8q: Evaluation of genetic progression markers for prostate cancer. Genes
Chromosomes Cancer 44 (2005) 438-49.
58
Literatur
Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith,
H.O., Yandell, M., Evans, C.A., Holt, R.A., Gocayne, J.D., Amanatides, P.,
Ballew, R.M., Huson, D.H., Wortman, J.R., Zhang, Q., Kodira, C.D., Zheng,
X.H., Chen, L., Skupski, M., Subramanian, G., Thomas, P.D., Zhang, J., Gabor
Miklos, G.L., Nelson, C., Broder, S., Clark, A.G., Nadeau, J., McKusick, V.A.,
Zinder, N., Levine, A.J., Roberts, R.J., Simon, M., Slayman, C., Hunkapiller,
M., Bolanos, R., Delcher, A., Dew, I., Fasulo, D., Flanigan, M., Florea, L.,
Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S., Mobarry, C., Reinert, K.,
Remington, K., Abu-Threideh, J., Beasley, E., Biddick, K., Bonazzi, V., Brandon, R., Cargill, M., Chandramouliswaran, I., Charlab, R., Chaturvedi, K.,
Deng, Z., Di Francesco, V., Dunn, P., Eilbeck, K., Evangelista, C., Gabrielian,
A.E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., Heiman, T.J., Higgins,
M.E., Ji, R.R., Ke, Z., Ketchum, K.A., Lai, Z., Lei, Y., Li, Z., Li, J., Liang, Y., Lin,
X., Lu, F., Merkulov, G.V., Milshina, N., Moore, H.M., Naik, A.K., Narayan,
V.A., Neelam, B., Nusskern, D., Rusch, D.B., Salzberg, S., Shao, W., Shue, B.,
Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J., Wei, M., Wides, R., Xiao, C.,
Yan, C., et al.: The sequence of the human genome. Science 291 (2001) 130451.
Williams, A.J., Powell, W.L., Collins, T. and Morton, C.C.: HMGI(Y) expression in human uterine leiomyomata. Involvement of another high-mobility group architectural factor in a benign neoplasm. Am J Pathol 150 (1997) 911-8.
Winkler, S., Murua Escobar, H., Eberle, N., Reimann-Berg, N., Nolte, I. and Bullerdiek, J.: Establishment of a Cell Line Derived from a Canine Prostate Carcinoma with a Highly Rearranged Karyotype. J Hered (2005a).
Winkler, S., Murua Escobar, H., Meyer, B., Simon, D., Eberle, N., Baumgartner, W.,
Loeschke, S., Nolte, I. and Bullerdiek, J.: HMGA2 Expression in a Canine
Model of Prostate Cancer. Cancer genetics and cytogenetics (accepted for
publication).
Winkler, S., Murua Escobar, H., Gunther, K., Richter, A., Dolf, G., Schelling, C.,
Bullerdiek, J. and Nolte, I.: The canine KRAS2 gene maps to chromosome 22.
Anim Genet 35 (2004) 350-1.
Winkler, S., Murua Escobar, H., Reimann-Berg, N., Bullerdiek, J. and Nolte, I.: Cytogenetic Investigations in Four Canine Lymphomas. Anticancer Res 25 (2005b)
3995-8.
59
Literatur
Winkler, S., Reimann-Berg, N., Murua Escobar, H., Loeschke, S., Eberle, N., Hoinghaus, R., Nolte, I. and Bullerdiek, J.: Polysomy 13 in a canine prostate carcinoma underlining its significance in the development of prostate cancer. Cancer Genet Cytogenet 169 (2006) 154-8.
Withrow, S.J. and MacEwen, E.G.: Clinical Veterinary Oncology. J.B. Lippincott, Co.,
1989.
Withrow, S.J. and MacEwen, E.G.: Small Animal Clinical Oncology. WB Saunders
Company, 2001.
Withrow, S.J., Thrall, D.E., Straw, R.C., Powers, B.E., Wrigley, R.H., Larue, S.M.,
Page, R.L., Richardson, D.C., Bissonette, K.W., Betts, C.W. and et al.: Intraarterial cisplatin with or without radiation in limb-sparing for canine osteosarcoma. Cancer 71 (1993) 2484-90.
Wolffe, A.P.: Architectural transcription factors. Science 264 (1994) 1100-1.
Wolman, S.R., Gundacker, H., Appelbaum, F.R. and Slovak, M.L.: Impact of trisomy 8
(+8) on clinical presentation, treatment response, and survival in acute myeloid
leukemia: a Southwest Oncology Group study. Blood 100 (2002) 29-35.
Wood, L.J., Maher, J.F., Bunton, T.E. and Resar, L.M.: The oncogenic properties of
the HMG-I gene family. Cancer Res 60 (2000a) 4256-61.
Wood, L.J., Mukherjee, M., Dolde, C.E., Xu, Y., Maher, J.F., Bunton, T.E., Williams,
J.B. and Resar, L.M.: HMG-I/Y, a new c-Myc target gene and potential oncogene. Mol Cell Biol 20 (2000b) 5490-502.
Xiang, Y.Y., Wang, D.Y., Tanaka, M., Suzuki, M., Kiyokawa, E., Igarashi, H., Naito,
Y., Shen, Q. and Sugimura, H.: Expression of high-mobility group-1 mRNA in
human gastrointestinal adenocarcinoma and corresponding non-cancerous
mucosa. Int J Cancer 74 (1997) 1-6.
Yang, F., O'Brien, P.C., Milne, B.S., Graphodatsky, A.S., Solanky, N., Trifonov, V.,
Rens, W., Sargan, D. and Ferguson-Smith, M.A.: A complete comparative
chromosome map for the dog, red fox, and human and its integration with canine genetic maps. Genomics 62 (1999) 189-202.
60
Danksagung
8.
Danksagung
Herrn Prof. Bullerdiek danke ich für die Überlassung des Themas und die Möglichkeit,
diese Arbeit in seinem Institut durchführen zu können, sowie für die damit verbundene
wissenschaftliche Betreuung
Herrn Prof. Nolte danke ich für zwei lehrreiche Jahre in seiner Klinik, sowie für die
Übernahme des Koreferates
Herrn Dr. Murua Escobar -DEM Hugo- danke ich für seine unzähligen Tipps, Anregungen und Hilfestellungen im Bezug auf meine Arbeit, fürs Zuhören und das geduldige Ertragen meines Dickschädels (manchmal sind wir auch einer Meinung)
Frau Dr. Reimann-Berg -DER Nicola- danke ich ebenfalls für zahlreiche Tipps und
Hilfestellungen insbesondere im Bereich der Zytogenetik (Nein, das ist kein Fliegendreck und ja, man kann die Dinger sortieren) und für die jederzeit offenen Ohren
Den „Hunde“ Kollegen Andreas „Trendy Andy“ Richter, Saskia „Cpt. Chaos“ Willenbrock“, Katharina „dem Kati“ Sterenczak, Miriam „Mi-Ma-Miri“ Janssen und Jan
Soller; aber auch Norbert Drieschner, Martina Lübbing, Markus Klemke, Jan Sperveslage, Britta Meyer, Maren Meiboom, Cornelia Blank, Sven Hauke und Claudia Schlüter ein herzliches Dankeschön für den Spaß bei der Arbeit
Den Hannoveraner Kollegen, insbesondere Nina Eberle und Ruth Höinghaus vielen
Dank für Verständnis und Unterstützung in der Klinik, sowie für die geduldige Nachsorge in Form der Erfüllung von Sonderwünsche (Die Bremer schon wieder...)
Bettina „Lotta“ Weniger und ihrer Familie vielen Dank für ihre Freundschaft und die
zurückhaltenden Nachfragen (wann ist es denn soweit?)
Ein Dankeschön geht auch an alle Freunde, die in irgendeiner Form Anteil am entstehen dieser Arbeit genommen haben, sei es durch offene Ohren, aktiven Stressabbau
(Zappelhalle, Sport), Daumen drücken etc.
61
Danksagung
Last but not least die beiden wichtigsten Menschen in meinem Leben:
Vielen Dank an meine Mutter Hermanne Winkler, die einen großen Anteil daran trägt,
dass ich die bin, die ich bin und die mir alles zutraut
und
Vielen Dank an meinen Freund und Lebensgefährten Frank Kruse, der alle Höhen
und Tiefen mit mir durchlebt
62
Publikationsübersicht
9.
Publikationsübersicht
In der folgenden Übersicht sind die der vorliegenden Arbeiten zugrunde liegenden
Arbeiten in der Reihenfolge, in der sie im Ergebnisteil erscheinen, aufgeführt:
I. Winkler S, Murua Esobar H., Reimann-Berg N, Nolte I, Bullerdiek J.
Cytogenetic Investigations in four canine Lymphomas
Anticancer Res. 2005 Nov-Dec;25(6B):3995-8.
II. Winkler S, Murua Escobar H, Eberle N, Reimann-Berg N, Nolte I, Bullerdiek J.
Establishment of a cell line derived from a canine prostate carcinoma with a
highly rearranged karyotype
J Hered. 2005 Nov-Dec;96(7):782-5
III. Winkler S, Reimann-Berg N, Murua Escobar H., Loeschke S., Eberle N, Höinghaus R, Nolte I and Bullerdiek J.
Polysomy 13 in a Canine Prostate Carcinoma Underlining its Significance in the
Development of Prostate Cancer
Cancer Genet Cytogenet. 2006 Sep;169(2):154-8.
IV. Meiboom M, Murua Escobar H, Winkler S, Nolte I, Bullerdiek J.
Molecular characterization and mapping of the canine KRAB zinc finger gene
ZNF331.
Anim Genet. 2004 Jun;35(3):262-3.
V. Murua Escobar H, Meyer J, Winkler S, Schelling C, Dolf G, Nolte I, Bullerdiek J.
The protein kinase B, gamma (AKT3) gene maps to canine chromosome 7.
Anim Genet. 2004 Aug;35(4):354-5.
VI. Meyer B, Murua Escobar H, Winkler S, Dolf G, Schelling C, Bullerdiek J, Nolte I.
Molecular characterization and mapping of the canine cyclin D1 (CCND1) gene.
Anim Genet. 2004 Oct;35(5):413.
63
Publikationsübersicht
VII. Richter A, Murua Escobar H, Gunther K, Meyer B, Winkler S, Dolf G, Schelling C,
Nolte I, Bullerdiek J.
The canine NRAS gene maps to CFA 17.
Anim Genet. 2004 Aug;35(4):355-6.
VIII. Winkler S, Murua Escobar H, Gunther K, Richter A, Dolf G, Schelling C, Bullerdiek J, Nolte I.
The canine KRAS2 gene maps to chromosome 22.
Anim Genet. 2004 Aug;35(4):350-1.
IX. Murua Escobar H, Soller JT, Sterenczak KA, Sperveslage JD, Schlueter C,
Burchardt B, Eberle N, Fork M, Nimzyk R, Winkler S, Nolte I, Bullerdiek J.
Cloning and characterization of the canine receptor for advanced glycation end
Products
Gene. 2006 Mar 15;369:45-52
X. Murua Escobar H, Gunther K, Richter A, Soller JT, Winkler S, Nolte I, Bullerdiek J.
Absence of ras-gene hot-spot mutations in canine fibrosarcomas and melanomas.
Anticancer Res. 2004 Sep-Oct;24(5A):3027-8.
XI. Richter A, Murua Escobar H, Gunther K, Soller JT, Winkler S, Nolte I,
Bullerdiek J.
RAS gene hot-spot Mutations in canine neoplasias.
J Hered. 2005 Nov-Dec;96(7):764-5.
XII: Meyer B, Murua Escobar H, Hauke S, Richter A, Winkler S, Rogalla P, Flohr AM,
Bullerdiek J, Nolte I.
Expression pattern of the HMGB1 gene in sarcomas of the dog.
Anticancer Res. 2004 Mar-Apr;24(2B):707-10.
64
Publikationsübersicht
XIII. Murua Escobar H, Soller JT, Richter A, Meyer B, Winkler S, Flohr AM, Nolte I,
Bullerdiek J.
The canine HMGA1.
Gene. 2004 Apr 14;330:93-9.
XIV. Murua Escobar H, Soller JT, Richter A, Meyer B, Winkler S, Bullerdiek J,
Nolte I.
"Best Friends" Sharing the HMGA1 Gene: Comparison of the Human and Canine HMGA1 to Orthologous Other Species.
J Hered. 2005 Nov-Dec;96(7):777-81.
XV. Winkler S, Murua Escobar H, Meyer B, Simon D, Eberle N, Baumgartner W,
Loeschke S, Nolte I und Bullerdiek, J..
HMGA2 Expression in a Canine Model of Prostate Cancer
Zur Veröffentlichung angenommen
XVI. Soller JT, Murua Escobar H, Winkler S, Fork M, Pöhler C, Bünger S, Sterenczak
KA, Willenbrock S, Nolte I and Bullerdiek J
Inhibitory effect of antisense HMGA AAV-mediated delivery suppresses cell
proliferation in canine carcinoma cell line
in Vorbereitung
Folgende zusätzliche Publikationen erscheinen nicht im Ergebnisteil, sind jedoch der
vorliegenden Arbeit beigefügt:
XVII. Santos SE, Murua Escobar H, Sider LH, Winkler S, Aoki SM, Milazzotto MP,
Campagnari F, Vannucchi CI, Bullerdiek J, Nolte I, Garcia JF.
DNA sequence, polymorphism, and mapping of luteinizing hormone receptor
fragment (LHCGR) gene in Great Dane dogs.
Anim Genet. 2004 Feb;35(1):74-5.
65
I.
Cytogenetic investigations in four canine lymphomas.
Winkler S, Murua Escobar H, Reimann-Berg N, Bullerdiek J, Nolte I.
Anticancer Res. 2005 Nov-Dec;25(6B):3995-8.
Eigenanteil:
• Kultivierung der Zellen
• Erstellen der caninen Karyogramme
• Verfassen des Artikels
ANrrcaNcBR
(2005)
RESEARCH 25: 3995-3998
CytogeneticInvestigationsin Four CanineLymphomas
SUSANNE WINKLERI, HUGO MURUA ESCOBAR2,
NICOLA REIMANN-BBRG1. TÖnN BULLERDIEK1 and INGO NOTTE2
lCenter
for Human Genetics, University of Bremen, Leobener StrasseZHG, 28359Bremen;
2SmallAnimal Clinic, School of VeterinaryMedicine, BischofsholerDamm 15,30173 Hannover, Germany
Four cases of canine lymphoma are presented,
including histological examination and cytogeneticinvestigation.
The first case showed a derivative chromosome 13, the second
Abstract.
case showed a clonal tisomy 8 and the third case showed a
complex karyotype with a clonal trisomy 13 and additional
clonal trisomies of the chromosomes 20, 30 and 37, as well as a
non-clonal tetrasomy 9. Case four showed a single tisomy 2.
these results with human
hematopoietic
Comparing
by Hahn et al. (I5) on canine lymphosarcomas, trisomies of
chromosomes 13, 34 and 36 were found. In previous
investigations, we were able to show two cases of leukemia
in which trisomy L was present. One case consisted of a
simple trisomy of chromosome 1, and the other case of
centric fusion of two additional chromosomes l- (8-10).
Herein, the karyotypic alterations detected in four dogs with
different types of lymphomas are described.
malignancies, there are notable similaities between both species.
CaseReport
A number of genetic alterations for hematopoietic diseases
in humans have been described. Often. these alterations are
specific chromosomal abnormalities, making cytogenetic
analyses on outstanding tool for the diagnosis of these
diseases.To date, only a few reports exist about cytogenetic
investigations of hematopoietic diseases in dogs. This is
certainly due to the difficult karyotype of the dog, which is
Fourdogs,admittedto the Clinicfor SmallAnimals,School
of Veterinary Medicine, Hannover, Germany, were
clinically, cytologically and cytogenetically examined in
detail. They included a 5-year-old male Munsterlander
(Case KM 15) and a 4-year-old female Bernese Mountain
Dog (case KM 115) both with centroblastic lymphomas
stage IV, a 4-year-old male German Shepherd dog (case
KM 39) with a centroblastic lymphoma stage V and a 6-
comprised of 76 small acrocentric autosomes. However,
there are some papers describing cytogenetic changes in
canine cancers (1-13). On the one hand, these investigations
provide a comparison with corresponding findings in
year-old male Golden Retriever (case KM 29) with an
immunoblastic B-cell lymphoma stage V.
humans and, on the other hand, they can help to improve
diagnosis in veterinary medicine and facilitate prognosis
Materials and Methods
about progress of the disease. Diseases of the hematopoietic
and the lymphatic system, in particular, are among the most
frequently observed malignant neoplasms in dogs (14).
Thus, canine lymphosarcomas, the clinical appearance,
histopathology and treatment of which are comparable to
human
non-Hodgkin's
lymphomas,
are
found
in
approximately 036% of all dogs receiving veterinary care.
Thus, the canine lymphosarcoma accounts for about 83Vo of
all hematological malignancies of the dog (15). In a study
to: Prof. Dr. Jörn Bullerdiek, Center for Human
Correspondence
Genetics,University of Bremen, Leobener StrasseZHG, D-28359
Bremen, Germany. Tel: + 49-(0)421-218-4239,F ax: + 49-(Q)42I-
Bone marrow sampleswere taken from the iliac crest of the dogs
and immediatelytransferredto 1 ml sodium heparin. The marrow
cells were centrifuged at I35 x g and incubated for 48 hours in
McCoy's medium. Subsequently,colcemide(0.1 pglml) was added
for 2 hours. The cells were centrifuged again at 135 x g for 10
minutes and incubatedfor 15 minutes in 0.05 M KCl. Finally, the
cells were fixed overnight with methanol/glacialacetic acid. This
suspensionwas dropped on ice-cold slidesand dried for at least 7
daysat 37'C. The chromosomeswere stainedby GTG banding,
and the karyotype was describedfollowing the nomenclature of
Reimannet al. (1,6).The descriptionof the cytogeneticaberrations
was carried out accordingto the instructionsof the "International
Systemfor Human CytogeneticNomenclature(1995)" (I7).
Results
21,8-4239,
e-mail: [email protected]
Key Words:Canisfamiliais, cytogenetics,lymphoma.
0250-700512005
$2.00+ .40
As listed in Table I, cytogenetic investigation of the bone
marrow showed a derivative chromosome L3 in case KM 15.
3995
ANrrcaNcpR
(2005)
RSSEARCH 25: 3995-3998
Table I. Karyotype description of the four cases of canine lymphomas
examined. Brackets show the number of metaphaseswith similar findings,
bold type summarizes clonal changes.
KM 15
KM 29
KM 39
KM 115
Histological
diagnosis
Karyotype
Centroblastic
lymphoma
stage IV
78,XY [1]
78, XY, der (13) [2]
7 7 , X Y , - 3 6[ 1 ]
78,XY, -13, +mar [1]
78 [3]
7s [1]
77 l2l
Immunoblastic 7 9 , X Y , + 8 [ 3 ]
B-cell
79,XY, der(4),der(7),+8 [2]
lymphoma
79,Xy l3l
stage V
Centroblastic
lymphoma
stage V
Centroblastic
lymphoma
stage IV
84,XY, +9, +9, +13, +20, +30, +37 [3]
84,XY, +9, +9, +13, +16, +24, +31 lll
84,XY, +9, +13, +20, +30, +36, +37 [1]
82,XY, +9, +13, +20, +37 lll
84 [1]
86 [1]
87 [1]
78,XX [1]
78, XX, +2, -29 [l]
79,){X,+2lll
77 l2l
78 [3]
7e l4l
80 [1]
Aberrations of chromosome 13 were found in two cases
of the present study (KM 15, KM 39), including one case
with trisomy L3 (Figure 1, Figure 2B). Concerning canine
lymphosarcomas, trisomy 13 has been described earlier.
In a study of 61 dogs with lymphosarcoma, trisomy 13 was
found in 15 cases (15). Cytogenetic changes with
involvement of chromosome L3 were even considered the
most frequent clonal changes in canine lymphosarcomas.
Dogs that exhibited trisomy 13 as the primary aberration
in a lymphosarcoma showed a significantly longer
duration of the first remission and of survival compared
to animals with other chromosomal changes, because they
responded better to a given chemotherapy (15). Thus,
changes of the canine chromosome 13 may turn out to be
a suitable marker for diagnosis and prognosis of canine
lymphosarcomas. With regard to homology to human
chromosomes, Yang et al. (18) showed homologies
between CFA L3 and a comparatively long segment of
HSA
8 and two small segments on HSA 4. The
appearance of trisomy 8 in human lymphomas and
myeloid leukemias, as well as the appearance of trisomy 4
in acute myeloid leukemias, supports the assumption that,
in both species, the generation of cancer is comparable,
even though there is a lack of structural chromosomal
aberrations in canine hematopoietic neoplasias. Up to
now, chromosomal fusions as well as translocations have
not been found frequently in dogs. However, in addition
to aberrations of chromosome 13, other aberrations
detected in the present study are similar to those
described earlier in solid or hematopoietic tumors of the
dog. The clonal trisomy 2 of case KM 115 shows
similarities to cases already described in the literature. In
solid canine tumors, aberrations of chromosome 2 have
that was present in 2 out of 5 metaphases for which
karyotype descriptions were performed, representing the
primary aberration. In this case, the derivative chromosome
been reported repeatedly (I9,20). Again, compared to
human chromosomes, Yang et al. (1S) showed
homologies of CFA 2 to a relatively long segment on
13 obviously shows an increase of chromosomal material. In
case KM 39, a clonal trisomy 13 was observed as well, in
conjunction with a complex karyotype showing additional
clonal trisomies of chromosomes 20,30 and 37 and a clonal
HSA 10 and a smaller segment on HSA 1. In human
leukemia and lymphoma, trisomy 10 is sometimes
observed in myeloid leukemia.
tetrasomy 9. Case KM 115 showed a clonal trisomy 2. Case
KM 29 showed a clonal trisomy 8, that was found in all
metaphases investigated. Additionally, two derivative
chromosomes, 4 and 7, were present in two metaphases,
indicating another clonal aberration.
Discussion
Although
to date little is known about chromosomal
changes in hematopoietic diseases and solid tumors of the
dog, some differences in comparison to those found in
humans are remarkable, such as the overall low frequency
of
specific translocations in
canine neoplasias.
3996
The fourth case in the present study resembles the cases
described earlier in this paper. In case KM 29, a clonal
trisomy 8 was found (Figure 2A). According to Yang et al.
(18), CFA 8 was nearly identical to human chromosome 14.
Again, trisomy L4 often occurs in human myeloid leukemias
and malignant lymphomas, with a main focus in myeloid
disorders. Some cases arö reported in which trisomy 14 is
due to an isochromosome 14 (21). The human oncogene
BCL-L is located on the long arm of chromosome 14 at
band q32. Translocations affecting this chromosomal region
represent a common mechanism of oncogene activation in
human malignant lymphoid malignancies, whereas in
human multiple myeloma, the most frequent chromosomal
aberration is a 14q+ marker (22).
Winkler et al: Cytogenetic Investigations in Four Canine Lymphomas
ffiffiffiffiffiffiffiffi.ffif
1
ä
s
4
"
.
S
1
ffiffi@ffiffiffiffi
ffiffi
s
ü
ltt
&
WW
tß
,#*"
ffiw
iiwe"
f f i f f i
qiw ffi
@
ffingi
ffiffi
ryf
t2
g4
44
E,'
|
ts
l?
-
" l
t
.
3tt
.
ts
@
M
wsf "{tr"
M
W
3tt
äl
#s,
".Wi
ffi
3ü
wffi
sg
,,Ä:
@
ffi
z7
z&
t
4l ,
ml
ffiffi
35
3{
ffi
3fi
3?
l{
@
ffiffi Il f f 'i f f i-M l l f f i w
f;6
I
ffiffi ffiffi Wffi
3r
*t
6
ffiffi.
Wffi ##
r r &
ffiffi
ffiffi |l @ffiffi1
- " - ' l
*s
rg
35
ffi
W f f iq+t:
|
w"w 1ffi*ffiffi
l W w wI Äw.
ffiffi
wi*ffi
@i&ü
ffi:
@ffi
|----;l
lä
ffi;tu,
iffi
@
. w w
ffi:ffi'
t5
1l
#,ffi
ffiffi
ww
ffi
ffi
H
Y
ffi
Figure 1..Thecomplexkaryotypeof KM 39: 84,XY, +9, +9, +13, +20, +30, +37.
A
wffiw
z
I
ffiffiffiffi ffiffiffiffi ffiffi
3
4
\
5
6
?
\
ffiw ffiffi ffi# ffiffi ffiffi W,ffi
@
g
ft
II
1l
1t
ts
t{
8ffiffi
l
3
\
\
Figure 2. Partial karyotypes.A: representativechromosomes I - 14 of KM 29. B: representativechromosome 13 of KM 15.
Comparing the resultsof the presentstudywith findings in
human hematopoieticdiseases,
there are striking similarities
in both speciesregardingcytogeneticalterationsinvolvedin
the development of cancer. Thus, the dog may serve as an
animal model for cancer research and drug discovery, thereby
also taking advantage of improved therapy.
ANucaNcnR
(2005)
RBSEARCH 25: 3995-399s
References
I
Bafinitzke S, Motzko H, Caselitz J, Kornberg M, Bullerdiek J
and Schloot W: A recurrent marker chromosome involving
chromosome1 in two mammary tumors of the dog. Cytogenet
Cell Genet 60: 135-137,1.992.
2 Bartnitzke S, Motzko H, Rosenhagen C and Bullerdiek J:
Benign mixed tumor of canine mammary gland showingan r(X)
and trisomy 5 as the only clonal abnormalities.Cancer Genet
Cytogenet62: 29-31,1992.
3 Mayr B, Eschborn IJ, Loupal G and Schleger W:
Characterisationof complex karyotype changesin two canine
bonetumours.Res Vet Sci 51:34I-343,1991,.
4 Mayr B, Kramberger-Kaplan E, Loupal G and Schleger W:
Analysis of complex cytogenetic alterations in three canine
mammary sarcomas.Res Vet Sci 53: 205-211,1992.
5 Mayr B, Reifinger M, Weissenbock H, Schleger W and
EisenmengerE: Cytogeneticanalysesof four solid tumours in
dogs.Res Vet Sci57:88-95,1.994.
6 Mayr B, SchlegerW, Kalat M, SchweigerP, Reifinger M and
Eisenmenger E: Cytogenetic studies in a canine mammary
tumor. Cancer Genet Cytogenet47: 83-87,1.990.
'W,
7 Mayr B, Schleger
Loupal G and Burtscher H:
Characterisation of cornplex karyotype changesin a canine
thyroid adenoma.Res Vet Sci 50: 298-300,I99I.
8 Nolte I, Reimann N, Bullerdiek J, Bartnitzke S, Mischke R and
Nolte M: Importance of cytogeneticinvestigationsin canine
leukemias.Tieraztl Prax 25: 393-397,1997.
9 Nolte M, Werner M, Nolte I and Georgii A: Different
cytogeneticfindings in two clinically similar leukaemicdogs.J
Comp Pathol 108:337-342,1993.
10 Reimann N, Bartnitzke S, Bullerdiek J, Mischke R and Nolte
I: Trisomy 1 in a canine acute leukemia indicating the
pathogeneticimportanceof polysomy1 in leukemiasof the dog.
Cancer Genet Cltogenet 101: 49-52,1998.
11 Reimann N, Nolte I, Bonk U,Bartnitzke S and Bullerdiek J:
Cytogenetic investigation of canine lipomas. Cancer Genet
Cytogenet111: 172-17
4, 1999.
12 Reimann N, Nolte I, Bonk IJ, Werner M, Bullerdiek J and
Bartnitzke S: Trisomy 18 in a canine thyroid adenoma.Cancer
Genet Cytogenet90: 1,54-156,
1996.
3998
13 Reimann N, Rogalla P, Kazmierczak B, Bonk U, Nolte I,
Grzonka T, Bartnitzke S and Bullerdiek J: Evidence that
metacentricand submetacentricchromosomesin caninetumors
can result from telomericfusions.Cltogenet Cell Genet 67: 8195, lgg4.
14 MacEwen EG: Spontaneoustumors in dogs and cats: models
for the study of cancer biology and treatment. Cancer
MetastasisRev 9: I25-L36.1990.
15 Hahn KA, Richardson RC, Hahn EA and Chrisman CL:
Diagnostic and prognostic importance of chromosomal
aberrations identified in 61 dogs with lymphosarcoma.Vet
Pathol31: 528-540,1994.
16 Reimann N, Bartnitzke S, Bullerdiek J, SchmitzU, Rogalla P,
Nolte I and Ronne M: An extendednomenclatureof the canine
karyotype.CytogenetCell Genet 73: 140-144,1996.
L7 Mitelman F: An International Systemfor Human Cytogenetic
Nomenclature(1995).Basel:S. Karger, 1995.
18 Yang F, O'Brien PC, Milne BS, GraphodatskyAS, SolankyN,
Trifonov V, Rens W, Sargan D and Ferguson-SmithMA: A
complete comparativechromosomemap for the dog, red fox,
and human and its integration with canine genetic maps.
Genomics62: 189-202.1999.
19 Mayr B, Furtmueller G, SchlegerW and Reifinger M: Trisomy
2 in three casesof caninehaemangiopericytoma.
Br Vet J 148:
II3-t18, 1992.
20 Reimann N, Nolte I, Bartnitzke S and Bullerdiek J: Re: Sit,
DNA, sit: cancergeneticsgoing to the dogs.J Natl CancerInst
91:1688-1689,1999.
21 Reddy KS: Trisomy 14 and leukemia.CancerGenet Cytogenet
106:144-1.51,
L998.
22 Richelda R, Ronchetti D, Baldini L, Cro L, Viggiano L,
Marzella R, Rocchi M, Otsuki T, Lombardi L, Maiolo AT and
Neri A: A novel chromosomaltranslocationt(4; M)(p16.3; q32)
in multiple myeloma involves the fibroblast growth-factor
receptor3 gene.Blood 90:4062-4070,1997.
ReceivedApril 25, 2005
Acceptedlune 30, 2005
II.
Establishment of a cell line derived from a canine prostate carcinoma with a highly rearranged karyotype.
Winkler S, Murua Escobar H, Eberle N, Reimann-Berg N, Nolte I, Bullerdiek J.
J Hered. 2005;96(7):782-5.
Eigenanteil:
• Etablierung der Zell-Linie
• Zytogenetische Auswertung
• Verfassen des Artikels
Journal of Heredity 2005:96(7):782–785
doi:10.1093/jhered/esi085
Advance Access publication June 30, 2005
ª The American Genetic Association. 2005. All rights reserved.
For Permissions, please email: [email protected].
Establishment of a Cell Line Derived
from a Canine Prostate Carcinoma with
a Highly Rearranged Karyotype
S. WINKLER, H. MURUA ESCOBAR, N. EBERLE, N. REIMANN-BERG, I. NOLTE,
AND
J. BULLERDIEK
From the Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen, Germany
(Winkler, Reimann-Berg, Bullerdiek) and Small Animal Clinic, School of Veterinary Medicine, Bischofsholer Damm 15,
30173 Hanover, Germany (Murua Escobar, Eberle, Nolte).
Address correspondence to Jörn Bullerdiek at the address above, or e-mail: [email protected].
Abstract
Akin to the situation in humans, dogs are frequently affected by tumors of the prostate. The malignancies share many
similarities between both species, for example, median age at the onset of the disease and metastatic behavior. In human
prostatic tumor samples, investigations of prepared metaphase spreads showed a variety of chromosomal aberrations, with
trisomies of chromosomes 7, 8, and 17 as the leading cytogenetic abnormalities. In this article we present one case of
a canine adenocarcinoma of the prostate, including clinical examination and establishment of a cell line from a tumor sample
obtained from the affected 10-year-old male Briard. Searching for similarities between both species in respect to
chromosomal changes within the tumor samples, we investigated prepared metaphases of the canine cell line cytogenetically.
These investigations presented a highly rearranged karyotype showing a large biarmed marker consisting of material from
chromosomes 1 and 2 in addition to centromeric fusions between dog chromosomes 1 and 5 that both could be identified
in every metaphase investigated, while centric fusions of chromosomes 4 and 5 occurred in up to 50% of the metaphases.
The cell line grew very well and showed evidence of being spontaneously immortalized when it crossed the 20th passage.
Introduction
Cytogenetic investigations of human malignancies look back
on a long history. They revealed different chromosomal
aberrations including mono- or trisomies, translocations, and
isochromosomes. Some of them are known to be characteristic, for example, trisomy 12 in chronic lymphatic leukaemia
(Anastasi et al. 1992) or the Philadelphia chromosome
and/or isochromosome 17 in chronic myeloid leukaemia
(Fioretos et al. 1999; Reid et al. 2003). However, centric
fusions have only very rarely been described in human
neoplasias. In most cases, the altered expression or fusion
transcripts of tumor-associated genes are associated with
tumor formation and progression. Thus chromosome
analysis of solid tumors as well as hematopoietic malignancies has become an important tool to help establish a
correct diagnosis and/or to decide between benign or
malignant tumors of various origins (Mitelman 1998;
Mitelman et al. 1997).
Over the past few years, the dog has become an
increasingly important model for genetic diseases. Dogs and
humans share the same environment, have access to qualified
medical care, and last but not least share a variety of genetic
782
diseases, including cancer (Withrow and MacEwen 1989,
2001). Compared to the situation in humans, cytogenetic
studies in tumors of the dog are rare. This is certainly due to
the difficult karyotype of the dog with its 76 small acrocentric autosomes and metacentric X- and Y-chromosomes
(Reimann et al. 1996a). The existing reports showed that, akin
to human tumors, malignant as well as benign canine tumors
show an apparently higher incidence of clonal aberrations in
mesenchymal tumors (lipomas and sarcomas) compared to
epithelial neoplasms (Reimann et al. 1999a). As for the type of
aberrations in canine tumors, numerical changes were found
most frequently (Mayr et al. 1994; Reimann et al. 1996b, 1998,
1999a), followed by centric fusions (Mayr et al. 1991a,b, 1992).
Another step forward in cytogenetic investigations of
canine tumors was taken when fluorescence in situ
hybridization (FISH) was used for assignment of canine
cancer-related genes and for comparative genomic hybridization (CGH) (Murua Escobar et al. 2001; Richter et al.
2004; Thomas et al. 2003a,b; Winkler et al. 2004). By the use
of CGH analysis Thomas et al. (2003b) were able to show
that in canine multicentric lymphoma gains of chromosome
material were significantly more common than losses.
Winkler et al. Cell Line Derived from Canine Prostate Carcinoma
Carcinomas of the prostate are the third leading cause of
death in human male patients, with an incidence of 193,000
deaths in 1990 and an expected number of cancer-related
deaths of 393,000 by 2020 (Brundtland 2001). Besides
humans, the dog is the only mammalian species that
spontaneously develops tumors of the prostate (Boutemmine et al. 2002). Even though they show a lower incidence
than their human counterparts, there is an increasing number
of dogs developing tumors of the prostate. These tumors
may present different histology, but adenocarcinomas predominate, and all of them are likely to metastasize (Nolte and
Nolte 2000). In this article we present a case of prostate
carcinoma in a dog, including clinical examination, establishment of a cell line, and cytogenetic analyses, the latter
revealing a highly rearranged karyotype.
Case Report
In February 2003, a 10-year-old male Briard was presented at
the Clinic for Small Animals Hanover with the following
symptoms. The dog had troubles of defecation and gain of
abdominal girth with reduced ingestion and increased
drinking. Clinical examination showed no abnormalities in
heart, lung, testicles, and lymph nodes; the body temperature
was about 38.78C. The abdomen was strained; X-ray
examination revealed only reduced perceptibility of details.
On diagnostic laparatomy, enlargement of the prostate and
several small metastases in the mesentery were visible. The
tumor was removed surgically, and pathohistological examination revealed a highly malignant adenocarcinoma of the
prostate. Because of poor prognosis the dog was euthanized
during surgical treatment.
Materials and Methods
For establishment of the cell line, tumor samples were minced
into small fragments followed by collagenase treatment
(0.35%) for 2 h at 378C. The dissociated cells were transferred
into sterile flasks containing 5 ml medium 199. The cultures
were incubated in 5% CO2/air at 378C for 3 days. Well-grown
culture flasks were subcultivated. For chromosome preparation colcemid was added at a final concentration of 0.1 lg/ml
for 1.5 h before harvesting. The preparation of cell cultures for chromosome analyses followed routine methods
(Bartnitzke et al. 1992). The cell suspension was dropped
onto ice-cold slides, which were then allowed to age for 7 days
at 378C followed by GTG-banding according to a modification (Bartnitzke et al. 1992) of the protocol described by
Seabright (1971). Karyotype description followed the nomenclature proposed by Reimann et al. (1996a).
Results
Cell culture resulted in well growing cells with a high mitotic
rate. The cells were subcultivated about once every 10 days.
Cytogenetic investigation of 30 metaphases revealed the
presence of a hyperdiploid karyotype (Figure 1). The
chromosome number ranged between 81 and 131, with
various centromeric fusions and several biarmed markers.
Centromeric fusions between dog chromosomes 1 and 5
were observed in every metaphase investigated, whereas
centric fusions of chromosomes 4 and 5 occurred in up to
50%. Additionally, a large biarmed marker was found in
every metaphase investigated, consisting of material from
chromosomes 1 and 2. It is thus likely to assume that chromosome material deriving from chromosome 1 is overrepresented in the presented cell line.
Discussion
In human prostate cancers, a variety of genetic aberrations is
known to occur. Aneuploidia in the form of trisomies has
frequently been described, in most cases trisomies of chromosomes 7, 8, and 17 (Liu et al. 2001; Mark et al. 1999;
Skacel et al. 2001).
In the present case, canine chromosome 1 is the
chromosome affected in several ways, leading to the overrepresentation of chromosome material deriving from CFA 1.
Previous publications dealing with canine tumors showed
interesting cytogenetic abnormalities, including centric fusions involving chromosome 1 (Mayr et al. 1990, 1991a; Nolte
et al. 1993), a third copy of chromosome 4 involved in tandem
translocation (Mayr et al. 1994), or derivative chromosomes 4
and 7 (Reimann et al. 1999b). In a cytogenetic study investigating 270 canine solid tumors, it was shown that chromosomes
1, 2, 4, 5, and 25 are frequently involved in numerical changes
as well as in structural aberrations (Reimann et al. 1999a).
Horsting et al. (1999) speculated that chromosome 1 might
contain a gene responsible for tumor development and that
chromosome fusions involving chromosome 1 might be an
initiating factor leading to karyotype instability and complex
karyotype changes, respectively. In fact, all metaphases
investigated in our study showed a highly rearranged
karyotype with several centric fusions. This finding corresponds to the assumption that aneuploidy caused by failures
of accuracy of chromosome disjunction is common in tumor
cells and is assumed to be a general feature (Holliday 1989).
The appearance of biarmed chromosomes is also
a frequent event during tumorigenesis in the dog (Reimann
et al. 1994). They can be divided into two categories:
isochromosomes, consisting of two arms of the same
chromosome and translocation chromosomes, consisting
of two acrocentric chromosomes. Both of them are present
in the metaphase spreads of the canine prostatic cell line.
Compared to each other, all results together strengthen the
speculation that humans and dog often share the same
genetic pathways in generation of cancer.
To the best of our knowledge, up to now there are only
three well-known human prostate carcinoma cell lines and
their various sublines, which are frequently used for prostate
cancer research: DU-145, established from the tumor tissue
removed from the metastatic central nervous system lesion
of a 69-year-old man with prostate carcinoma in 1975
(Mickey 1980); PC-3, established from the bone marrow
783
Journal of Heredity 2005:96(7)
Figure 1.
Metaphase spread from cells derived from the canine prostate carcinoma.
metastasis isolated postmortem from a 62-year-old Caucasian man with grade IV prostate cancer (poorly differentiated
adenocarcinoma) after androgen suppression therapy
(Kaighn et al. 1979); and LNCaP, established from the left
supraclavicular lymph node metastasis from a 50-year-old
man with prostate carcinoma in 1977 (Horoszewicz 1981).
These cell lines are used in cancer research and drug
discovery to test the effects of various agents on, for
example, gene expression, cell proliferation, apoptosis, and
metastatic behavior. With the newly established canine
prostate carcinoma cell line presented herein, there is now
another tool available for the research in prostate cancer.
Due to the above-mentioned similarities seen in canine and
human cancer genetics, the availability of the new canine
prostate carcinoma cell line could open new fields in terms of
comparison of this kind of neoplasia in both species.
by fluorescence in situ hybridization to interphase cells: a simple and
sensitive method. Blood 79:1796–1801.
Bartnitzke S, Motzko H, Caselitz J, Kornberg M, Bullerdiek J, and
Schloot W, 1992. A recurrent marker chromosome involving chromosome
1 in two mammary tumors of the dog. Cytogenet Cell Genet 60:135–137.
Boutemmine D, Bouchard N, Boerboom D, Jones HE, Goff AK, Dore M,
and Sirois J, 2002. Molecular characterization of canine prostaglandin G/H
synthase-2 and regulation in prostatic adenocarcinoma cells in vitro.
Endocrinology 143:1134–1143.
Brundtland GH, 2001. Men, ageing and health—achieving health across the
life span. Geneva: World Health Organization.
Fioretos T, Strombeck B, Sandberg T, Johansson B, Billstrom R, Borg A,
Nilsson PG, Van Den Berghe H, Hagemeijer A, Mitelman F, and Hoglund M,
1999. Isochromosome 17q in blast crisis of chronic myeloid leukemia and in
other hematologic malignancies is the result of clustered breakpoints in
17p11 and is not associated with coding TP53 mutations. Blood 94:225–232.
Holliday R, 1989. Untwisting B-Z DNA. Trends Genet 5:355–356.
Acknowledgments
This paper was delivered at the 2nd International Conference on the
‘‘Advances in Canine and Feline Genomics: Comparative Genome Anatomy
and Genetic Disease,’’ Universiteit Utrecht, Utrecht, The Netherlands,
October 14–16, 2004.
References
Anastasi J, Le Beau MM, Vardiman JW, Fernald AA, Larson RA, and
Rowley JD, 1992. Detection of trisomy 12 in chronic lymphocytic leukemia
784
Horoszewicz JS, 1981. Models for prostate cancer (Murphy GP, ed).
New York: Alan R. Liss; 115–132.
Horsting N, Wohlsein P, Reimann N, Bartnitzke S, Bullerdiek J, and Nolte I,
1999. Cytogenetic analysis of three oropharyngeal malignant melanomas in
dogs. Res Vet Sci 67:149–151.
Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, and Jones LW, 1979.
Establishment and characterization of a human prostatic carcinoma cell line
(PC-3). Invest Urol 17:16–23.
Liu HL, Gandour-Edwards R, Lara PN Jr., de Vere White R, and LaSalle
JM, 2001. Detection of low level HER-2/neu gene amplification in prostate
cancer by fluorescence in situ hybridization. Cancer J 7:395–403.
Winkler et al. Cell Line Derived from Canine Prostate Carcinoma
Mark HF, Feldman D, Das S, Samy M, Sun CL, and Mark S, 1999.
Assessment of chromosomal trisomies in prostate cancer using fluorescent
in situ hybridization. Exp Mol Pathol 67:109–117.
Reimann N, Bartnitzke S, Bullerdiek J, Schmitz U, Rogalla P, Nolte I, and
Ronne M, 1996a. An extended nomenclature of the canine karyotype.
Cytogenet Cell Genet 73:140–144.
Mayr B, Schleger W, Kalat M, Schweiger P, Reifinger M, and Eisenmenger E,
1990. Cytogenetic studies in a canine mammary tumor. Cancer Genet
Cytogenet 47:83–97.
Reimann N, Nolte I, Bonk U, Werner M, Bullerdiek J, and Bartnitzke S,
1996b. Trisomy 18 in a canine thyroid adenoma. Cancer Genet Cytogenet
90:154–156.
Mayr B, Eschborn U, Loupal G, and Schleger W, 1991a. Characterisation of
complex karyotype changes in two canine bone tumours. Res Vet Sci
51:341–343.
Reimann N, Bartnitzke S, Bullerdiek J, Mischke R, and Nolte I, 1998.
Trisomy 1 in a canine acute leukemia indicating the pathogenetic
importance of polysomy 1 in leukemias of the dog. Cancer Genet
Cytogenet 101:49–52.
Mayr B, Schleger W, Loupal G, and Burtscher H, 1991b. Characterisation
of complex karyotype changes in a canine thyroid adenoma. Res Vet Sci
50:298–300.
Mayr B, Kramberger-Kaplan E, Loupal G, and Schleger W, 1992. Analysis
of complex cytogenetic alterations in three canine mammary sarcomas. Res
Vet Sci 53:205–211.
Mayr B, Reifinger M, Weissenbock H, Schleger W, and Eisenmenger E,
1994. Cytogenetic analyses of four solid tumours in dogs. Res Vet Sci
57:88–95.
Mickey DD, 1980. Models for prostate cancer (Murphy GP, ed). New York:
Alan R. Liss; 67–84.
Mitelman F, ed., 1998. Catalog of chromosome aberrations in cancer
(CD-ROM). New York: John Wiley & Sons.
Mitelman F, Johansson B, Mandahl N, and Mertens F, 1997. Clinical
significance of cytogenetic findings in solid tumors. Cancer Genet
Cytogenet 95:1–8.
Murua Escobar H, Becker K, Bullerdiek J, and Nolte I, 2001. The canine
ERBB2 gene maps to a chromosome region frequently affected by
aberrations in tumors of the dog (Canis familiaris). Cytogenet Cell Genet
94:194–195.
Nolte I and Nolte M, 2000. Praxis der Onkologie bei Hund und Katze.
Stuttgart: Enke Verlag.
Nolte M, Werner M, Nolte I, and Georgii A, 1993. Different cytogenetic
findings in two clinically similar leukaemic dogs. J Comp Pathol 108:
337–342.
Reid AG, Tarpey PS, and Nacheva EP, 2003. High-resolution analysis of
acquired genomic imbalances in bone marrow samples from chronic
myeloid leukemia patients by use of multiple short DNA probes. Genes
Chrom Cancer 37:282–290.
Reimann N, Rogalla P, Kazmierczak B, Bonk U, Nolte I, Grzonka T,
Bartnitzke S, and Bullerdiek J, 1994. Evidence that metacentric and
submetacentric chromosomes in canine tumors can result from telomeric
fusions. Cytogenet Cell Genet 67:81–85.
Reimann N, Nolte I, Bartnitzke S, and Bullerdiek J, 1999a. Re: Sit,
DNA, sit: cancer genetics going to the dogs. J Natl Cancer Inst 91:
1688–1689.
Reimann N, Nolte I, Bonk U, Bartnitzke S, and Bullerdiek J, 1999b.
Cytogenetic investigation of canine lipomas. Cancer Genet Cytogenet
111:172–174.
Richter A, Murua Escobar H, Gunther K, Meyer B, Winkler S, Dolf G,
Schelling C, Nolte I, and Bullerdiek J, 2004. The canine NRAS gene maps
to CFA 17. Anim Genet 35:355–356.
Seabright M, 1971. A rapid banding technique for human chromosomes.
Lancet 2:971–972.
Skacel M, Ormsby AH, Pettay JD, Tsiftsakis EK, Liou LS, Klein EA, Levin
HS, Zippe CD, and Tubbs RR, 2001. Aneusomy of chromosomes 7, 8, and
17 and amplification of HER-2/neu and epidermal growth factor receptor
in Gleason score 7 prostate carcinoma: a differential fluorescent in situ
hybridization study of Gleason pattern 3 and 4 using tissue microarray.
Hum Pathol 32:1392–1397.
Thomas R, Bridge W, Benke K, and Breen M, 2003a. Isolation and
chromosomal assignment of canine genomic BAC clones representing 25
cancer-related genes. Cytogenet Genome Res 102:249–253.
Thomas R, Smith KC, Ostrander EA, Galibert F, and Breen M, 2003b.
Chromosome aberrations in canine multicentric lymphomas detected with
comparative genomic hybridisation and a panel of single locus probes. Br J
Cancer 89:1530–1537.
Winkler S, Murua Escobar H, Gunther K, Richter A, Dolf G, Schelling C,
Bullerdiek J, and Nolte I, 2004. The canine KRAS2 gene maps to
chromosome 22. Anim Genet 35:350–351.
Withrow SJ and MacEwen EG, 1989. Clinical veterinary oncology.
Philadelphia: JB Lippincott.
Withrow SJ and MacEwen EG, 2001. Small animal clinical oncology.
Philadelphia: WB Saunders.
Corresponding Editor: Elaine Ostrander
785
III.
Polysomy 13 in a canine prostate carcinoma underlining its significance in the development of prostate cancer.
Winkler S, Reimann-Berg N, Murua Escobar H, Loeschke S, Eberle
N, Höinghaus R, Nolte I, Bullerdiek J.
Cancer Genet Cytogenet. 2006 Sep;169(2):154-8.
Eigentanteil:
• Kultivierung der Zellen
• Erstellen der caninen Karyogramme
• Verfassen des Artikels
Cancer Genetics and Cytogenetics 169 (2006) 154e158
Short communication
Polysomy 13 in a canine prostate carcinoma underlining
its significance in the development of prostate cancer
Susanne Winklera, Nicola Reimann-Berga, Hugo Murua Escobara,b,
Siegfried Loeschkea, Nina Eberleb, Ruth Höinghausb, Ingo Nolteb, Jörn Bullerdieka,*
b
a
Center for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen, Germany
Small Animal Clinic, University of Veterinary Medicine, Bischofsholer Damm 15, 30173 Hannover, Germany
Received 23 January 2006; received in revised form 22 March 2006; accepted 29 March 2006
Abstract
The dog is a well-accepted model for prostate cancer in man because of the striking similarities
between both species with respect to the clinical course of the disease as well as to its similar histopathology. Cytogenetic investigations of human prostate cancers has revealed the frequent occurrence of trisomies 7, 8, and 17. In this report, we present a case of prostate carcinoma in a dog
characterized by polysomy 13 as the sole cytogenetic abnormality. Along with the known homology
between canine chromosome 13 and human chromosome 8 these findings suggest that a homologous
area on both chromosomes plays a crucial role in subsets of prostate cancer in both species. Ó 2006 Elsevier Inc. All rights reserved.
1. Introduction
Over the last decade, a growing number of scientists have
used the dog as the species of choice to unravel the genetic
mechanisms of a variety of diseases occurring in dog and
man [1]. The dog could serve as a genetic model, for example
in cancer predisposition, development, and progression. For
instance, beside man the dog is the only known mammalian
species that frequently develops carcinomas of the prostate
[2], showing clear similarities to its human counterpart in
terms of development and progression of the disease. In both
species, adenocarcinomas of the prostate represent a locally
invasive cancer and are likely to metastasize to the same distant regions as, for example lung and bones by blood or the
lymphatic system. Older individuals are predominantly affected with an average age of 10 years in dogs and 71 years
in humans [3,4]. Akin to their human counterparts canine
prostatic cancers vary over a broad range with respect to their
clinical behavior [5].
Cytogenetic investigations in human prostate cancers revealed a variety of genetic aberrations. Recurrent trisomies
have been described frequently, i.e., those of chromosomes
7, 8, and 17 [6e8]. By the use of comparative genome hybridization it was possible to determine gain of 8q as a potential marker of aggressiveness in prostate cancer [9].
* Corresponding author. Tel.: þ49-0-421-218-4239; fax: þ49-0-421218-4239.
E-mail address: [email protected] (J. Bullerdiek).
0165-4608/06/$ e see front matter Ó 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.cancergencyto.2006.03.015
To the best of our knowledge, there is currently only one
publication dealing with cytogenetic investigations in canine prostate carcinomas [10]. Analysis of cells of a cellline derived from a canine prostate carcinoma revealed
the existence of several centric fusions. Among others these
fusions led to the formation of a large bi-armed marker consisting of chromosome material from chromosomes 1 and
2. Thus, chromosome material deriving from these chromosomes was assumed to be overrepresented in the cell-line
and to be involved in initiation of tumor development
[10]. In the following report we present a case of prostate
carcinoma in a dog revealing polysomy 13 emphasizing
the importance of chromosome 13 in canine carcinogenesis.
2. Case report
A 10-year-old male Deutsch Drahthaar was admitted to
the Clinic of Small Animals, School of Veterinary Medicine,
Hannover, Germany, because of progressive hematuria and
apathia of 3 weeks duration. No abnormalities were found
during rectal palpation of the prostate. X-ray examination
showed liquidothorax and ascites. Sonographic examination
of the prostate revealed multiple intra- and paraprostatic
cysts. Fine needle aspiration of liquidothorax, ascites, and
the prostate was done. Cytological examination of the cells
of the tumor as well as of exfoliated cells from both body
cavity effusions revealed a prostatic carcinoma (Fig. 1).
Due to the poor prognosis, the dog was euthanised.
S. Winkler et al. / Cancer Genetics and Cytogenetics 169 (2006) 154e158
3. Material and methods
Samples of liquidothorax and ascites were washed with
Hanks’ solution. After centrifugation, the cells were resuspended and transferred into sterile flasks containing 5 mL
medium 199 (Earle’s salts, 2 % penicillin/streptomycin,
20% fetal bovine serum). The cultures were incubated in
5% CO2/air at 37 C. For chromosome preparation, Colcemid (Biochrom, Berlin, Germany) was added at a final concentration of 0.1 mg/mL for 1.5 hours before harvesting.
The preparation of cell cultures for chromosome analyses
followed routine methods [11]. The cell suspension was
dropped onto ice cold slides which were then allowed to
air dry for 5 days before GTG-banding [12]. Karyotype description followed the nomenclature proposed by Reimann
et al. [13].
4. Results
Cell culture resulted in well-growing cells with a moderate
mitotic rate. The cells were subcultivated about once every 20
days. They reached the 5th passage before they deteriorated
and died. A total of 30 metaphase cells in the 1st passage were
analyzed. Cytogenetic investigation revealed the presence of
a nearly diploid karyotype, with the majority of metaphases
exhibiting 78 chromosomes. However, in 90% of the investigated metaphases, centric fusions of additional copies of
chromosome 13 were found in varying numbers (Fig. 2).
No other clonal aberration was detected.
5. Discussion
Fusion between acrocentric chromosomes based on
head-to-head telomeric associations or centric fusions appears to be a frequent event during tumorigenesis in the
155
dog [14]. It has been assumed that shortening of telomeric
repeats due to increased cell-proliferation is responsible for
an increased fusigenic behavior [15]. Fusion chromosomes
can be divided into 2 categories: 1) translocation chromosomes, consisting of two acrocentric chromosomes; and
2) isochromosomes, consisting of 2 identical chromosome
arms [16]. In a frequent number of cytogenetically investigated neoplasias, isochromosomes occurred along with the
normal homologue of the same chromosome, leading to
a gain of chromosomal material [17e19]. Trisomies of canine chromosomes have been reported in a variety of canine
neoplasias, e.g., leukemia, hemangiopericytomas, and tumors of the thyroid and mammary gland [20e29].
In the present case, we were able to demonstrate the existence of centric fusions involving chromosome 13 in varying
numbers leading to a gain of material from chromosome 13.
This is of notable importance because polysomies of canine
chromosome 13 have been described before.
Cytogenetic investigations of a canine osteoid sarcoma
and a canine mammary carcinoma both revealed the existence
of isochromosome 13 accompanied by other chromosomal
aberrations, whereas in a canine osteoid chondrosarcoma,
isochromosome 13 was the sole cytogenetic abnormality
[17,30]. In 61 dogs with lymphosarcoma examined by Hahn
et al. [31], trisomy 13 was found in 15 cases. In addition, dogs
with tumors showing trisomy 13 as the primary aberration had
a clearly longer duration of first remission and survival
compared to dogs possessing other chromosome aberrations.
Dogs with trisomy 13 responded better to a therapy consisting
of at least 5 treatments with either adriamycin or epirubicin
[31].
In a recent study, we were able to describe a trisomy 13
in a complex karyotype with several chromosomal aberrations and a partial trisomy 13 as the sole abnormality both
occurring in canine lymphomas [32]. Using CGH analysis,
Fig. 1. (a) Fine needle aspiration cytology of the prostate. The neoplastic epithelial cells in typical clusters are showing distinct criteria of malignancy.
Erythrocytes are in the background (Pappenheim stain). (b) Fine needle aspiration cytology of the ascites. Exfoliated cells or cells in clusters. Large cells
with distinct criteria of malignancy are present. The carcinoma cells are morphologically similar to cells of mesothelial origin. Granulocytes are in the
background (Pappenheim stain).
156
S. Winkler et al. / Cancer Genetics and Cytogenetics 169 (2006) 154e158
Fig. 2. (a) Metaphase derived from ascites showing one centric fusion of chromosomes 13. Karyotype analyses revealed the following karyotype:
78,XY,der(13;13) (b) Part of a metaphase derived from ascites showing two centric fusions leading to a gain of chromosome 13 material. Chromosome analyses revealed the following karyotype: 78, XY,þder(13;13),þder(13;13),-19,-20. Monosomy 19 and 20 were not clonal. (c) Karyogram of a third metaphase
derived from ascites revealing 2 centric fusions leading to a gain of chromosomes 13 material, showing the following karyotype: 78,XY,-4,der(13;13),
þder(13;13). Monosomy 4 was not clonal.
Thomas et al. [33] were able to show that the gain of canine
chromosome 13 was the most commonly observed aberration in canine multicentric lymphomas. Thus, combining
the results in the literature with the results presented in this
study it is likely to assume that the canine chromosome 13
(CFA 13) might contain a gene or a group of genes, which
could be involved in tumor development. Interestingly,
canine chromosome 13 shares homology to the terminal
region of human chromosome 8q (HSA 8q22.1~qter)
[34,35]. This is a chromosomal region frequently involved
S. Winkler et al. / Cancer Genetics and Cytogenetics 169 (2006) 154e158
in the onset of several human hematopoietic malignancies,
e.g., acute leukemia and lymphoma [36,37], but is also involved in growth and progression of human breast and
prostate cancer [7,9,38]. As for the latter, gain of 8q is
one of the most frequent alterations in prostate cancer
and is thought to promote the progression of the disease
[9,39,40]. Because of the poor clinical outcome and tumor
recurrence associated with copy number increase of 8q in
patients with prostate cancer, a detailed analysis of genes
on the long arm of human chromosome 8 has been performed by van Duin et al [41].
Sixteen genes, including the MYC oncogene, in 5
regions with putative relevance to cancer were subject of
detailed investigations. Three of the 16 genes were
significantly overexpressed in prostate cancer compared
to normal prostate tissue specimens: PDP (8q22.1), PABPCI (8q22.3), and KIAA0196 (8q24.13), thus considered being putative progression markers for prostate cancer [41].
This again confirms the assumption that in both species trisomy of a similar part of the genome located on chromosome 13 and 8, respectively, is associated with tumor
formation and progression at similar sites.
References
[1] Ostrander EA, Galibert F, Patterson DF. Canine genetics comes of
age. Trends Genet 2000;16:117e24.
[2] Boutemmine D, Bouchard N, Boerboom D, Jones HE, Goff AK,
Dore M, Sirois J. Molecular characterization of canine prostaglandin
G/H synthase-2 and regulation in prostatic adenocarcinoma cells in
vitro. Endocrinology 2002;143:1134e43.
[3] Nolte I, Nolte M. Praxis der Onkologie bei Hund und Katze. Stuttgart: Enke, 2000.
[4] Bertz J, Hentschel S, Hundsdörfer G, Kaatsch P, Katalinic A, Lehnert
M, Schön D, Stegmaier C, Ziegler H. Krebs in Deutschland. Arbeitsgemeinschaft Bevölkerungsbezogener Krebsregister in Deutschland,
Saarbrücken, 2004.
[5] MacEwen EG. Spontaneous tumors in dogs and cats: models for the
study of cancer biology and treatment. Cancer Metastasis Rev 1990;
9:125e36.
[6] Liu HL, Gandour-Edwards R, Lara PN Jr, de Vere White R,
LaSalle JM. Detection of low level HER-2/neu gene amplification
in prostate cancer by fluorescence in situ hybridization. Cancer J
2001;7:395e403.
[7] Mark HF, Feldman D, Das S, Samy M, Sun CL, Mark S. Assessment
of chromosomal trisomies in prostate cancer using fluorescent in situ
hybridization. Exp Mol Pathol 1999;67:109e17.
[8] Skacel M, Ormsby AH, Pettay JD, Tsiftsakis EK, Liou LS, Klein EA,
Levin HS, Zippe CD, Tubbs RR. Aneusomy of chromosomes 7, 8,
and 17 and amplification of HER-2/neu and epidermal growth factor
receptor in Gleason score 7 prostate carcinoma: a differential fluorescent in situ hybridization study of Gleason pattern 3 and 4 using
tissue microarray. Hum Pathol 2001;32:1392e7.
[9] Steiner T, Junker K, Burkhardt F, Braunsdorf A, Janitzky V,
Schubert J. Gain in chromosome 8q correlates with early progression
in hormonal treated prostate cancer. Eur Urol 2002;41:167e71.
[10] Winkler S, Murua Escobar H, Eberle N, Reimann-Berg N, Nolte I,
Bullerdiek J. Establishment of a cell line derived from a canine
prostate carcinoma with a highly rearranged karyotype. J Hered
2005;96:782e5.
157
[11] Bartnitzke S, Motzko H, Caselitz J, Kornberg M, Bullerdiek J,
Schloot W. A recurrent marker chromosome involving chromosome
1 in two mammary tumors of the dog. Cytogenet Cell Genet 1992;
60:135e7.
[12] Seabright M. A rapid banding technique for human chromosomes.
Lancet 1971;2:971e2.
[13] Reimann N, Bartnitzke S, Bullerdiek J, Schmitz U, Rogalla P,
Nolte I, Ronne M. An extended nomenclature of the canine karyotype. Cytogenet Cell Genet 1996;73:140e4.
[14] Reimann N, Rogalla P, Kazmierczak B, Bonk U, Nolte I, Grzonka T,
Bartnitzke S, Bullerdiek J. Evidence that metacentric and submetacentric chromosomes in canine tumors can result from telomeric fusions. Cytogenet Cell Genet 1994;67:81e5.
[15] Slijepcevic P, Hande MP, Bouffler SD, Lansdorp P, Bryant PE. Telomere length, chromatin structure and chromosome fusigenic potential. Chromosoma 1997;106:413e21.
[16] Slijepcevic P. Telomeres and mechanisms of Robertsonian fusion.
Chromosoma 1998;107:136e40.
[17] Mayr B, Kramberger-Kaplan E, Loupal G, Schleger W. Analysis of
complex cytogenetic alterations in three canine mammary sarcomas.
Res Vet Sci 1992;53:205e11.
[18] Mayr B, Eschborn U, Schleger W, Loupal G, Burtscher H. Cytogenetic studies in a canine malignant melanoma. J Comp Pathol
1992;106:319e22.
[19] Anand M, Kumar R, Kumar L, Barge S, Singh S. Chronic myeloid
leukemia presenting with absence of basophils and marked dyspoiesis. Indian J Cancer 2003;40:144e7.
[20] Mayr B, Eschborn U, Loupal G, Schleger W. Trisomy 1 in a canine
mammary tubular adenocarcinoma, complex type. Vet Pathol
1993;30:311e3.
[21] Mayr B, Furtmueller G, Schleger W, Reifinger M. Trisomy 2 in three
cases of canine haemangiopericytoma. Br Vet J 1992;148:113e8.
[22] Mayr B, Gilli H, Schleger W, Reifinger M, Burtscher H. Cytogenetic
characterization of mammary tumors in two domestic dogs. Zentralbl
Veterinarmed A 1991;38:141e7.
[23] Mayr B, Reifinger M, Brem G, Feil C, Schleger W. Cytogenetic, ras,
and p53: studies in cases of canine neoplasms (hemangiopericytoma,
mastocytoma, histiocytoma, chloroma). J Hered 1999;90:124e8.
[24] Mayr B, Scheller M, Reifinger M, Loupal G. Cytogenetic characterization of a fibroma and three haemangiopericytomas in domestic
dogs. Br Vet J 1995;151:433e41.
[25] Mayr B, Swidersky W, Schleger W, Reifinger M. Cytogenetic
characterization of a canine haemangiopericytoma. Br Vet J 1990;
146:260e3.
[26] Nolte I, Reimann N, Bullerdiek J, Bartnitzke S, Mischke R, Nolte M.
[Importance of cytogenetic investigations in canine leukemias]. Tierarztl Prax 1997;25:393e7.
[27] Nolte M, Werner M, Nolte I, Georgii A. Different cytogenetic
findings in two clinically similar leukaemic dogs. J Comp Pathol
1993;108:337e42.
[28] Reimann N, Bartnitzke S, Bullerdiek J, Mischke R, Nolte I. Trisomy
1 in a canine acute leukemia indicating the pathogenetic importance
of polysomy 1 in leukemias of the dog. Cancer Genet Cytogenet
1998;101:49e52.
[29] Reimann N, Nolte I, Bonk U, Werner M, Bullerdiek J, Bartnitzke S.
Trisomy 18 in a canine thyroid adenoma. Cancer Genet Cytogenet
1996;90:154e6.
[30] Mayr B, Reifinger M, Weissenbock H, Schleger W, Eisenmenger E.
Cytogenetic analyses of four solid tumours in dogs. Res Vet Sci
1994;57:88e95.
[31] Hahn KA, Richardson RC, Hahn EA, Chrisman CL. Diagnostic and
prognostic importance of chromosomal aberrations identified in 61
dogs with lymphosarcoma. Vet Pathol 1994;31:528e40.
[32] Winkler S, Murua Escobar H, Reimann-Berg N, Bullerdiek J, Nolte I.
Cytogenetic Investigations in Four Canine Lymphomas. Anticancer
Research 2005;25:3995e8.
158
S. Winkler et al. / Cancer Genetics and Cytogenetics 169 (2006) 154e158
[33] Thomas R, Smith KC, Ostrander EA, Galibert F, Breen M. Chromosome aberrations in canine multicentric lymphomas detected with
comparative genomic hybridisation and a panel of single locus
probes. Br J Cancer 2003;89:1530e7.
[34] Yang F, O’Brien PC, Milne BS, Graphodatsky AS, Solanky N,
Trifonov V, Rens W, Sargan D, Ferguson-Smith MA. A complete
comparative chromosome map for the dog, red fox, and human and
its integration with canine genetic maps. Genomics 1999;62:189e202.
[35] Yang F, Graphodatsky AS, O’Brien PC, Colabella A, Solanky N,
Squire M, Sargan DR, Ferguson-Smith MA. Reciprocal chromosome
painting illuminates the history of genome evolution of the domestic
cat, dog and human. Chromosome Res 2000;8:393e404.
[36] Lepretre S, Buchonnet G, Stamatoullas A, Lenain P, Duval C,
d’Anjou J, Callat MP, Tilly H, Bastard C. Chromosome abnormalities
in peripheral T-cell lymphoma. Cancer Genet Cytogenet 2000;117:
71e9.
[37] Wolman SR, Gundacker H, Appelbaum FR, Slovak ML. Impact of
trisomy 8 (þ8) on clinical presentation, treatment response, and
survival in acute myeloid leukemia: a Southwest Oncology Group
study. Blood 2002;100:29e35.
[38] Bullerdiek J, Leuschner E, Taquia E, Bonk U, Bartnitzke S. Trisomy
8 as a recurrent clonal abnormality in breast cancer? Cancer Genet
Cytogenet 1993;65:64e7.
[39] van Dekken H, Alers JC, Damen IA, Vissers KJ, Krijtenburg PJ,
Hoedemaeker RF, Wildhagen MF, Hop WC, van der Kwast TH,
Tanke HJ, Schroder FH. Genetic evaluation of localized prostate
cancer in a cohort of forty patients: gain of distal 8q discriminates
between progressors and nonprogressors. Lab Invest 2003;83:
789e96.
[40] Alers JC, Krijtenburg PJ, Rosenberg C, Hop WC, Verkerk AM,
Schroder FH, van der Kwast TH, Bosman FT, van Dekken H. Interphase cytogenetics of prostatic tumor progression: specific
chromosomal abnormalities are involved in metastasis to the bone.
Lab Invest 1997;77:437e48.
[41] van Duin M, van Marion R, Vissers K, Watson JE, van
Weerden WM, Schroder FH, Hop WC, van der Kwast TH,
Collins C, van Dekken H. High-resolution array comparative genomic hybridization of chromosome arm 8q: evaluation of genetic
progression markers for prostate cancer. Genes Chromosomes Cancer 2005;44:438e49.
IV.
Molecular characterization and mapping of the canine KRAB zinc
finger gene ZNF331
Meiboom M, Murua Escobar H, Winkler S, Nolte I, Bullerdiek J
Anim Genet. 2004 Jun;35(3):262-3.
Eigenanteil:
• Hilfestellung bei der FISH
• Erstellung der caninen Karyogramme
262
Brief notes
10 McNatty K. P. et al. (2003) Reprod Suppl 61, 339–51.
11 Bidanel J. P. & Rothschild M. (2002) Pig News Info 23,
39N–54N.
Correspondence: S. Čepica ([email protected])
doi:10.1111/j.1365-2052.2004.01146.x
Molecular characterization and mapping of the
canine KRAB zinc finger gene ZNF331
M. Meiboom*, H. Murua Escobar†,*, S. Winkler*,
I. Nolte† and J. Bullerdiek*
*Center for Human Genetics, University of Bremen, Bremen,
Germany. †Small Animal Clinic, Hannover School of Veterinary
Medicine, Hannover, Germany
Accepted for publication 12 April 2004
Figure 2 Radiation hybrid map of porcine chromosome 28 showing
position of GDF9 gene.
524/01/0903). We thank Mrs Markéta Hančová for technical
assistance.
References
1 Bodensteiner K. J. et al. (1999) Biol Reprod 60, 381–6.
2 Committee for Standardized Karyotype of the Domestic Pig
(1988) Hereditas 109, 151–7.
3 Trask B. J. (1991) Meth Cell Biol 35, 3–35.
4 NCBI database, Gene ID: 2661 (URL ¼ http://www.ncbi.
nlm.nih.gov/LocusLink/LocRptcgi?l¼2661).
5 Goureau A. et al. (1996) Genomics 36, 252–62.
6 Yerle M. et al. (1998) Cytogenet Cell Genet 82, 182–8.
7 Milan D. et al. (2000) Bioinformatics 16, 558–9.
8 Hawken R. J. et al. (1999) Mamm Genome 10, 824–30.
9 Dong J. et al. (1996) Nature 383, 531–5.
Source/description: ZNF331 is a KRAB zinc finger protein gene
consisting of a KRAB-A box and a zinc finger domain with
12 zinc fingers and has recently been identified as putative
target gene in thyroid tumorigenesis.1,2 For characterization of
canine ZNF331, a canine testis cDNA library (Center for Human Genetics, Bremen, Germany) was screened with primers
specific for human ZNF331 (acc.-no. NM_018555; Primer Up:
GTA AAT CCC TTG GCC GTA ACT G; Lo: AGG CCT TCC CAC
ATT CTT GAC). To obtain a full-length cDNA clone 5¢RACEPCRs with a vector-specific primer [Primer Up: AGC GGA TAA
CAA TTT CAC ACA GG (M13rev)] and a gene-specific primer
(Primer Lo: TAT TTT CTC TAC AAG TGG GCG TTT T) were
performed using the cDNA library as template. Sequence analysis of the isolated clone and the 5¢ RACE products allowed the
assembling of the mRNA sequence of ZNF331. The composed
canine ZNF331 cDNA (GenBank acc. no. AY375188) consists
of 2148 bp including the full ORF and shows 85.3% sequence
identity in the cds to the human ZNF331 gene.
Expression studies using Northern blots containing mRNA
from several canine tissues including testis and a canine
ZNF331 spacer-specific probe did not reveal transcripts of
canine ZNF331 which points to a very low expression level of
this gene (data not shown).
Fluorescent in situ hybridization: A cDNA probe representing the
spacer region of canine ZNF331 was used to screen the canine
RCPI 81 BAC/PAC filter (BACPAC RESOURCES, Childrens
Hospital, Oakland, CA, USA). The probe was generated by
EcoRI digestion of a PCR product of primers CTG TAC TGG GAC
GTG ATG TTG GAG AA and AGA GTA AAG AGG TGG GAT
GGT GAT GG resulting in a 300-bp fragment. The fragment
was cloned and sequenced for verification. Hybridization was
performed as previously described.3 BAC 138K24 gave a positive signal which was verified by ZNF331-specific PCR, and
sequence analysis of the PCR product. A 4 ng/ll volume of diglabelled BAC 138K24 DNA (Dig-Nick-Translation-Kit; Roche
Diagnostics, Mannheim, Germany) was used as probe for
fluorescence in situ hybridization (FISH) in a hybridization
2004 International Society for Animal Genetics, Animal Genetics, 35, 245–264
Brief notes
Figure 1 Canine metaphase spread after GTG-banding (a) and the same metaphase after FISH with BAC 138K24 showing signal on both
chromosomes 1q33 (b).
mixture also containing 1 lg/ll salmon sperm DNA, 20 ng/ll
sonicated dog DNA, 1 · SSC, 1· SSPE, 50% formamide and
10% dextran sulphate. FISH was performed using the protocol
of Fischer et al.4 with some modifications5 on metaphase
preparations obtained from blood samples of different dogs.
FISH analyses were performed after GTG banding of the same
metaphase cells. Counterstaining of the chromosomes was
carried out using propidium iodide/antifade solution. G-banded
chromosomes were identified according to Reimann et al.6
Sixteen metaphases were examined and all showed a signal on
CFA1q33 on both chromatids of both chromosomes 1 (Fig. 1).
According to previous mapping data,7 this region is homologous to HSA19q13. Furthermore, two genes, i.e. CRX and
GRLF1, located on HSA19q13.3, recently have been mapped to
the telomeric region of CFA1.8,9
7
8
9
10
11
12
13
Comments: During the past few years, the dog has become
an interesting model organism for several human diseases
and tumours. Cytogenetic hotspots in canine tumours that
have been found in the dog genome so far include chromosomes 1, 19 and 25 which are preferentially involved in
chromosomal fusions.10 Aberrations in tumours of the dog
involving chromosome 1 were described earlier by several
authors in various tumours of the dog such as leukaemias,
melanomas and breast cancer.11–14 With the assignment of
ZNF331 to CFA1q33, a region of frequent breaks in human
follicular thyroid adenomas has been mapped in the canine
genome.
doi:10.1111/j.1365-2052.2004.01147.x
Accession numbers: human ZNF331: NM_018555; canine
ZNF331: AY375188.
References
1 Rippe V. et al. (1999) Genes Chromosomes Cancer 26,
229–36.
2 Meiboom M. et al. (2003) Cytogenet Genome Res 101,
113–7.
3 Murua Escobar H. et al. (2001) Cytogenet Cell Genet 94,
194–5.
4 Fischer P. et al. (1996) Mamm Genome 7, 37–41.
5 Murua Escobar H. et al. (2003) Cytogenet Genome Res 101,
33–8.
6 Reimann N. et al. (1996) Cytogenet Cell Genet 73, 140–4.
Yang F. et al. (1999) Genomics 62, 189–202.
Akhmedov N.B. et al. (2002) Mol Vis 8, 79–84.
Zangerl B. et al. (2002) Gene 294, 167–76.
Reimann N. et al. (1999) J Natl Cancer Inst 91, 1688–9.
Bartnitzke S. et al. (1992) Cytogenet Cell Genet 60, 135–7.
Mayr B. et al. (1993) Vet Pathol 30, 311–3.
Reimann N. et al. (1998) Cancer Genet Cytogenet 101,
49–52.
14 Horsting N. et al. (1999) Res Vet Sci 67, 149–51.
Correspondence: Dr J. Bullerdiek ([email protected])
Linkage mapping of ovine cysteine and
histidine-rich protein gene (CYHR1)
to chromosome 9
J. H. Calvo*, S. Marcos*, A. E. Beattie†, J. J. Jurado*
and M. Serrano*
*Departamento de Mejora Genètica Animal, INIA, Madrid, Spain.
†
AgResearch Molecular Biology Unit, Department of Biochemistry
and Centre for Gene Research, University of Otago, Dunedin, New
Zealand. Present address: J. H. Calvo, Unidad de Tecnologia en
Produccion Animal, CITA-Gobierno de Aragon, Zaragoza, Spain
Accepted for publication 12 April 2004
Source/description: Cysteine and histidine-rich cytoplasmic
protein (CYHR1) is involved in cellular trafficking transport of
galectin 3.1 Furthermore, CYHR1 has a broad range of biological activities including DNA and RNA binding, enzyme
catalysis, protein–protein interactions, and signal transduction,
because it contributes a metal-binding domain multimeric
protein. In cattle, the gene encoding this protein has been
mapped in the centromeric region of BTA14 (at 8 cM proximal
to CSSM66) and linkage disequilibrium between the bovine
CYHR1 gene and a QTL with significant effects on milk, fat and
protein yield has been demonstrated.2
2004 International Society for Animal Genetics, Animal Genetics, 35, 245–264
263
V.
The protein kinase B, gamma (AKT3) gene maps to canine chromosome 7.
Murua Escobar H, Meyer J, Winkler S, Schelling C, Dolf G, Nolte I,
Bullerdiek J.
Anim Genet. 2004 Aug;35(4):354-5.
Eigenanteil:
• Anleitung zur Durchführung der FISH
• Erstellen der caninen Karyogramme
354
Brief notes
and 82% similarity to the above mentioned species, respectively.
Chromosomal location: Chromosomal localization was determined using a porcine-rodent somatic cell hybrid panel.4
Primers CCS-RHAF and CCS-RHAR were designed to amplify an
approximately 400 bp genomic fragment spanning part of
exon 6, exon 7 and part of exon 8 of the porcine CCS. Statistical evaluation using the ÔInterpreting PCR dataÕ program
(http://www.toulouse.inra.fr/lgc/pig/pcr/pcr.htm) suggested a
chromosome probability and correlation of 1.00 to the short
arm of chromosome 2. The most likely localization for porcine
CCS was 2p14-p17 with a probability of 0.7929 and a correlation of 0.8748. CCS is localized to human 11q13 and in
mouse to the centromeric end of chromosome 19.5,6 Human
chromosome 11q13 shows conservation of synteny with the
centromere of mouse chromosome 19 and porcine 2p14-17.
The localization of markers flanking CCS is also conserved in pig
and human, which supports the CCS mapping data and confirms that the gene described here is the pig orthologue of
human CCS.
PCR conditions: For somatic cell hybridization – PCR was performed in 10 ll of reaction containing 10 ng DNA, 1X PCR
buffer, 2.5 mM of each dNTP, 5 pmol of each primer, 3 ll 2%
cresol red loading buffer and 0.5 U of Taq polymerase (Bioline,
London, UK) under the following conditions: 95 C for 5 min;
40 cycles of 95 C for 30 s, 60 C for 20 s and 72 C for 20 s;
72 C for 5 min.
For cloning and sequencing – PCR was performed using 3 ll
cDNA (corresponding to 50 ng RNA) in a 15 ll reaction mixture containing 1X PCR buffer, 2.5 mM of each dNTP, 12 pmol
of each primer and 0.1 U of Taq DNA polymerase (Amersham
Biosciences, Hillerod, Denmark) in a thermal cycler (MJ
Research, Waltham, MA, USA). The cycling conditions were
94 C for 5 min; 40 cycles of 94 C for 20 s, annealing temperature (indicated after primer sequences) for 20 s, 72 C for
20 s; 72 C for 10 min. Gel-purified amplification products
were sequenced using Thermo Sequenase Terminator Cycle
Sequencing kit (Amersham Life Science Inc.) in a thermal
cycler (MJ research).
Primers (5¢–>3¢):
HS-CCS1244: CTCGGGGTGGTGACTG
(55 C)
HS-CCS1944: TCTGCTTGGGGTTCTGG (55 C)
Pig-CCS2085: TAACCCTGATGGGATG (58 C)
Poly-A 1576: AGCAGTGGTAACAACGCAGAGTACTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTVN (58 C)
CCS-RHAF: GGGGACCTAGGGAATGTCTGTG
CCS-RHAR: TCTGCTTGGGGTTCTGGAAGA
Acknowledgements: We gratefully acknowledge M. Yerle (INRA,
Toulouse) for the pig–rodent panel. The Wilhelm Johannsen
Centre for Functional Genome Research is established by the
Danish National Research Foundation. A. N. Silahtaroglu is
supported by Danish Research Agency (project no: 2013-010033).
References
1 Culotta V. C. et al. (1997) J Biol Chem 272, 23469–72.
2 Rosen D. R. et al. (1993) Nature 362, 59–62.
3
4
5
6
Silahtaroglu A. N. et al. (2002) BMC Genet 19, 5.
Yerle M. et al. (1996) Cytogenet Cell Genet 73, 194–202.
Bartnikas T. B. et al. (2000) Mamm Genome 11, 409–11.
Moore S. D. P. et al. (2000) Cytogenet Cell Genet 88, 35–7.
Correspondence: Asli N. Silahtaroglu MSc., PhD
([email protected])
doi:10.1111/j.1365-2052.2004.01153.x
The protein kinase B, gamma (AKT3) gene maps
to canine chromosome 7
H. Murua Escobar*,†, J. Meyer*,†, S. Winkler*,
C. Schelling‡, G. Dolf§, I. Nolte† and J. Bullerdiek*
*Center for Human Genetics, University of Bremen, Leobener Strasse
ZHG, 28359 Bremen, Germany. †Small Animal Clinic, School for
Veterinary Medicine, Bischofsholer Damm 15, D-30173 Hannover,
Germany. ‡Department of Animal Science, Swiss Federal Institute of
Technology Zurich and Faculty of Veterinary Medicine, University of
Zurich, 8092 Zurich, Switzerland. §Institute of Animal Genetics,
Nutrition and Housing, University of Berne, Bremgartenstrasse 109a,
3012 Berne, Switzerland
Accepted for publication 19 April 2004
Introduction: The protein kinase B, gamma (AKT3) protein is an
intracellular serine/threonine kinase involved in regulating cell
survival. This protein phosphorylates and regulates the function of many cellular proteins involved in processes that include
metabolism, apoptosis and proliferation,1,2 making it a promising target for drug discovery to treat cancer. Expression of the
human gene is found in normal and tumour tissues. Prior to
this study, the assignment of the canine AKT3 gene was
unknown. Herein, we report the assignment of the AKT3 gene
to canine chromosome (CFA) 7q17 by FISH.
BAC clone and probe: In order to generate an AKT3 DNA probe,
polymerase chain reaction (PCR) amplification of genomic DNA
from a 2-year-old Golden retriever was performed using primers
that spanned part of exon 13 (primer up: AGA CAG TAG CAG
CAG CAG CA and dn: ATG ACG AGG ACG GTA TGG AC).
Primers were designed using NCBI Sequence AY575066,
which shows 80.3% identity to human AKT3 mRNA
(NM_005465).
PCR conditions: The total volume of 50 ll included 34.5 ll
Aqua Bidest, 1x Buffer, 3 mM MgCl2, 2 mM dNTPs, 2 lM of each
primer, approximately 50 ng genomic DNA and 2.5 U TaqPolymerase. Thermocycler conditions were as follows: 10 min
at 94 C, 35 cycles of 1 min 94 C, 1 min at 75 C, 2 min at
72 C and a final extension of 10 min at 72 C. The resulting
amplicon of 303 bp was verified by sequencing (GenBank
accession no. AY575065). These PCR primers and conditions
were also used to screen a canine BAC library3 (URL: http://
www.dogmap.ch) for AKT3 positive clones. To rule out falsepositive BAC screening results, the initial PCR was repeated,
2004 International Society for Animal Genetics, Animal Genetics, 35, 350–359
Brief notes
canine AKT3 gent to CFA 7q17 and defined the chromosomal band following the nomenclature established by
Reimann et al.6
References
1 Masure S. et al. (1999) Eur J Biochem 265, 353–60.
2 Nicholson K. M. et al. (2002) Cell Signal 14, 381–95.
3 Schelling C. et al. (2002) J Anim Breed Genet 119, 400–1.
4 Murua Escobar H. et al. (2001) Cytogenet Cell Genet 94, 194–5.
5 Yang F. et al. (1999) Genomics 62, 189–202.
6 Reimann N. et al. (1996) Cytogenetics Cell Genetics 73, 140–4.
Correspondence: J. Bullerdiek ([email protected])
doi:10.1111/j.1365-2052.2004.01158.x
The canine NRAS gene maps to CFA 17
A. Richter*, H. Murua Escobar*,†, K. Günther*,
B. Meyer*, S. Winkler*, G. Dolf‡, C. Schelling§,
I. Nolte† and J. Bullerdiek*
*Centre for Human Genetics, University of Bremen, Bremen,
Germany. †Small Animal Clinic, School of Veterinary Medicine
Hanover, Hanover, Germany. ‡Institute of Animal Genetics,
Nutrition and Housing, University of Berne, Berne, Switzerland.
§
Department of Animal Science, Swiss Federal Institute of Technology Zurich, Faculty of Veterinary Medicine, University of Zurich,
ETH-Zentrum, Zurich, Switzerland
Accepted for publication 1 May 2004
Figure 1 Metaphase spread after fluorescence in situ hybridization
with signals on both chromosome 7s (above) and GTG- banding
(below).
cloned and sequenced for verification of AKT3 with BAC clone
10C05-4.
Fluorescence in situ hybridization: Metaphase preparations and
fluorescence in situ hybridization (FISH) were performed as
described previously.4 Ten metaphases were examined and all
demonstrated hybridization of the AKT3 probe on both
chromatids of canine chromosome 7 (Fig. 1).
Comments: It has been reported that canine chromosome 7
shares homology with human chromosomes (HSA) 1 and 18.
The long (q) arm of CFA7 corresponds to the homologous
region on HSA1, whereas the homologous regions with HSA18
are distributed over both arms of CFA7.5 The human AKT3
gene is located at HSA 1q43–44. According to Yang et al.,5
this region shares homology with CFA7. We mapped the
Introduction: The dog is an emerging model organism for the
investigation of mechanisms involved in human disease,
including cancer. Several parallels in human and canine
tumours have been described, with comparable environmental
living conditions and age of tumour onset in both human and
canine patients as well as similarities in development and histology of tumours in both species.1 NRAS is a member of the ras
proto-oncogene family of proteins that act in growth-related
signal transduction and are frequently involved in the development of human tumours, with ras point mutations being one
of the most important alterations in the onset of malignancies.2
Ras genes show high sequence similarity across different
mammalian species such as human, cat, dog, cattle and
rodents, with most nucleotide differences representing synonymous changes not affecting the amino acid sequence.3 In
malignancies, most amino acid exchanges in ras genes are
caused by alterations of the so-called hot spot codons 12, 13,
and 61 in exons 1 and 2, respectively, leading to constitutively
active ras proteins that bring about constant signal transduction, facilitating uncontrolled cell division. These hot-spot
codons have been described to be affected in other mammalian
species as well. In dogs, NRAS mutations were found in
lymphomas4 and malignant melanomas.5
The canine NRAS gene had not been mapped so far, therefore, in this study we localized the chromosomal location of the
canine NRAS gene by fluorescence in situ hybridization (FISH).
2004 International Society for Animal Genetics, Animal Genetics, 35, 350–359
355
VI.
Molecular characterization and mapping of the canine cyclin D1
(CCND1) gene.
Meyer B, Murua Escobar H, Winkler S, Dolf G, Schelling C, Bullerdiek J, Nolte I.
Anim Genet. 2004 Oct;35(5):413.
Eigenanteil:
• Durchführung der FISH
• Erstellen der caninen Karyogramme
Brief notes
doi:10.1111/j.1365-2052.2004.01172.x
Molecular characterization and mapping of the
canine cyclin D1 (CCND1) gene
B. Meyer*, H. Murua Escobar*,†, S. Winkler*, G.
Dolf‡, C. Schelling§, J. Bullerdiek* and I. Nolte†
*Center for Human Genetics, University of Bremen, Bremen,
Germany. †Small Animal Clinic, School of Veterinary Medicine,
Hanover, Germany. ‡Institute of Animal Genetics, Nutrition and
Housing, University of Berne, Berne, Switzerland. §Department of
Animal Science, Swiss Federal Institute of Technology Zurich and
Faculty of Veterinary Medicine, University of Zurich, Zurich,
Switzerland
Accepted for publication 23 June 2004
Introduction: Cyclin D1, also known as PRAD1 or BCL-1, acts
as regulator of progression through the G1 phase during the
cell cycle by activation of cyclin-dependent kinases CDK4 and
CDK6. In humans overexpression of cyclin D1, partially due to
gene amplification, has been found in a wide variety of cancers,
including breast cancer.1
Sequence analysis: For characterization of the canine CCND1
gene and the corresponding protein, cDNA from a canine osteosarcoma was screened with primers specific for the ORF of
human cyclin D1 (GenBank accession no. NM_053056; primer
pair CYCup: CGA TGC CAA CCT CCT CAA CGA, CYClo: TGT
GGC ACA AGA GGC AAC GAA). After cloning and sequencing
of the amplification product two additional primer sets were
used to amplify the complete ORF (primer pairs Cyc1up: CAC
ACG GAC TAC AGG GGA GT, Cyc333doglo: GCA CAC ACT
TGA AGT AGG ACA C and Cyc695dogup: ACA CTT CCT CTC
CAA GAT GCC, AP2: AAG GAT CCG TCG ACA TCT TTT TTT
TTT TTT TTT T). Sequence analyses allowed the composition of
a 1246 bp cDNA contig (GenBank accession no. AY620434),
showing 90.4% sequence identity of the canine ORF compared
with the human counterpart. In accordance with the human
orthologue the deduced canine protein comprises 295 AA with
93.3% similarity between the two species.
BAC library screening: For use as FISH probe, a BAC clone was
PCR-screened from the DogBAC library (http://www.dogmap.ch)
with primers designed using human CCND1 DNA sequence
GenBank accession no. L09054 (primer pair CYCup: CGA TGC
CAA CCT CCT CAA CGA, CYCint1lo: GAA ACG TGG GTC TGG
GCA ACA). The obtained positive BAC clone (DogBAC library
ID S041P23D08) was verified by PCR, cloning and subsequent
sequencing.
Gene mapping: For mapping of the chromosomal location of the
canine CCND1 gene, metaphase preparations and fluorescence
in situ hybridization (FISH) were performed as described previously.2 G-banded chromosomes were identified according to
Reimann et al.3 Ten well-spread metaphases were analysed
exhibiting a signal on CFA17 on both chromatids of both
chromosomes (Fig. 1).
Comments: During the last decade the dog has gained in
importance as a model organism for the investigation of
mechanisms underlying human genetic disease, including
cancer. Immunohistochemical analyses of cyclin D1 expression
in canine mammary tumours using a polyclonal antibody
against human cyclin D1 revealed contradictory data. Murakami et al.4 found cyclin D1 expression in only two adenocarcinomas of 75 mammary lesions tested whereas Sfacteria et al.5
detected cyclin D1 in 60% of pre-cancerous lesions and 44% of
cancerous lesions of the canine mammary gland with correlation of proliferative ratio and cyclin D1 expression. Mapping
and sequencing of the canine CCND1 gene and corresponding
protein could help to elucidate the role of cyclin D1 in dogs and
its usefulness as model organism concerning this matter. Yang
et al.6 found no conservation of synteny between HSA11,
where the human CCND1 maps, and CFA17. This discordance
could be due to small rearrangements, deletions and insertions
existing in the dog.7
References
1 Ormandy C. J. et al. (2003) Breast Cancer Res Treat 78, 323–
35.
2 Murua Escobar H. et al. (2001) Cytogenet Cell Genet 94,
194–5.
3 Reimann N. et al. (1996) Cytogenet Cell Genet 73, 140–4.
4 Murakami Y. et al. (2000) J Vet Med Sci 62, 743–50.
5 Sfacteria A. et al. (2003) J Comp Pathol 128, 245–51.
6 Yang F. et al. (1999) Genomics 62, 189–202.
7 Guyon R. et al. (2003) Cold Spring Harb Symp Quant Biol 68,
171–8.
Correspondence: Prof. Dr Ingo Nolte (inolte@klt.
tiho-hannover.de)
Figure 1 Canine metaphase spread after GTGbanding (a) and the same metaphase after
FISH with BAC S041P23D08 showing signals
on both chromosomes 17 (b).
2004 International Society for Animal Genetics, Animal Genetics, 35, 408–423
413
VII.
The canine NRAS gene maps to CFA 17.
Richter A, Murua Escobar H, Gunther K, Meyer B, Winkler S, Dolf G,
Schelling C, Nolte I, Bullerdiek J.
Anim Genet. 2004 Aug;35(4):355-6.
Eigentanteil:
• Durchführung der FISH
• Erstellen der caninen Karyogramme
Brief notes
canine AKT3 gent to CFA 7q17 and defined the chromosomal band following the nomenclature established by
Reimann et al.6
References
1 Masure S. et al. (1999) Eur J Biochem 265, 353–60.
2 Nicholson K. M. et al. (2002) Cell Signal 14, 381–95.
3 Schelling C. et al. (2002) J Anim Breed Genet 119, 400–1.
4 Murua Escobar H. et al. (2001) Cytogenet Cell Genet 94, 194–5.
5 Yang F. et al. (1999) Genomics 62, 189–202.
6 Reimann N. et al. (1996) Cytogenetics Cell Genetics 73, 140–4.
Correspondence: J. Bullerdiek ([email protected])
doi:10.1111/j.1365-2052.2004.01158.x
The canine NRAS gene maps to CFA 17
A. Richter*, H. Murua Escobar*,†, K. Günther*,
B. Meyer*, S. Winkler*, G. Dolf‡, C. Schelling§,
I. Nolte† and J. Bullerdiek*
*Centre for Human Genetics, University of Bremen, Bremen,
Germany. †Small Animal Clinic, School of Veterinary Medicine
Hanover, Hanover, Germany. ‡Institute of Animal Genetics,
Nutrition and Housing, University of Berne, Berne, Switzerland.
§
Department of Animal Science, Swiss Federal Institute of Technology Zurich, Faculty of Veterinary Medicine, University of Zurich,
ETH-Zentrum, Zurich, Switzerland
Accepted for publication 1 May 2004
Figure 1 Metaphase spread after fluorescence in situ hybridization
with signals on both chromosome 7s (above) and GTG- banding
(below).
cloned and sequenced for verification of AKT3 with BAC clone
10C05-4.
Fluorescence in situ hybridization: Metaphase preparations and
fluorescence in situ hybridization (FISH) were performed as
described previously.4 Ten metaphases were examined and all
demonstrated hybridization of the AKT3 probe on both
chromatids of canine chromosome 7 (Fig. 1).
Comments: It has been reported that canine chromosome 7
shares homology with human chromosomes (HSA) 1 and 18.
The long (q) arm of CFA7 corresponds to the homologous
region on HSA1, whereas the homologous regions with HSA18
are distributed over both arms of CFA7.5 The human AKT3
gene is located at HSA 1q43–44. According to Yang et al.,5
this region shares homology with CFA7. We mapped the
Introduction: The dog is an emerging model organism for the
investigation of mechanisms involved in human disease,
including cancer. Several parallels in human and canine
tumours have been described, with comparable environmental
living conditions and age of tumour onset in both human and
canine patients as well as similarities in development and histology of tumours in both species.1 NRAS is a member of the ras
proto-oncogene family of proteins that act in growth-related
signal transduction and are frequently involved in the development of human tumours, with ras point mutations being one
of the most important alterations in the onset of malignancies.2
Ras genes show high sequence similarity across different
mammalian species such as human, cat, dog, cattle and
rodents, with most nucleotide differences representing synonymous changes not affecting the amino acid sequence.3 In
malignancies, most amino acid exchanges in ras genes are
caused by alterations of the so-called hot spot codons 12, 13,
and 61 in exons 1 and 2, respectively, leading to constitutively
active ras proteins that bring about constant signal transduction, facilitating uncontrolled cell division. These hot-spot
codons have been described to be affected in other mammalian
species as well. In dogs, NRAS mutations were found in
lymphomas4 and malignant melanomas.5
The canine NRAS gene had not been mapped so far, therefore, in this study we localized the chromosomal location of the
canine NRAS gene by fluorescence in situ hybridization (FISH).
2004 International Society for Animal Genetics, Animal Genetics, 35, 350–359
355
356
Brief notes
Figure 1 Metaphase spread after fluorescence
in situ hybridization showing signals on both
chromosomes 17 (right) and the same metaphase after GTG-banding (left).
BAC library screening: In order to isolate a FISH probe, the
DogBAC canine BAC library6 (http://www.dogmap.ch/) was
polymerase chain reaction (PCR)-screened. Primers were
designed using canine mRNA sequence GenBank accession no.
U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer
LO: GGGCCTCACCTCTATGGTG). The PCR conditions were
established on canine blood genomic DNA, the corresponding
PCR product cloned and verified by sequencing. The positive
BAC clone (DogBAC library ID S050P24H09) was verified by
PCR and sequencing.
Gene mapping: For mapping the chromosomal location of the
canine NRAS gene, metaphase preparations and FISH were
performed as described previously.7 Ten well spread metaphases
exhibited a signal on CFA 17 on both chromatids of both
chromosomes (Fig. 1), following the nomenclature of the canine
karyotype as established by Reimann et al.8
Comments: NRAS mutations in humans have been found in
30% of liver tumours, 40% of myelodysplastic syndrome, 30%
of acute myelogenous leukaemia, 13% of brain tumours and in
53% of follicular and 60% of undifferentiated papillary thyroid
tumours.9 In dogs, depending on tumour type, comparable
occurrences exist in malignant melanomas,5 while fibrosarcomas showed no amino acid alteration of the NRAS protein
(H. Murua Escobar, K. Günther, A. Richter, J. T. Soller,
S. Winkler, I. Nolte & J. Bullerdiek 2004, personal communication). Overall, data available on involvement of ras protooncogenes in tumours of dogs are still insufficient. Knowledge
of the cytogenetic properties of NRAS will further the understanding of this important gene. The mapping results obtained
in this study are in accordance with the known homology between canine chromosome 17 and the centromer-proximal
regions 11.1–13.3 of the p-arm of human chromosome 1.10
References
1 Hahn K A. et al. (1994) In Vivo 8, 133–43.
2 Arber N. (1999) Apoptosis 4, 383–8.
3 Watzinger F. et al. (1998) Mamm Genome 9, 214–9.
4
5
6
7
8
9
10
Mayr B. et al. (2003) Acta Vet Hung 51, 91–4.
Mayr B. et al. (2003) Vet J 165, 169–71.
Schelling C. et al. (2002) J Anim Breeding Genet 119, 400–1.
Becker K. et al. (2003) Anim Genet 34, 68–9.
Reimann N. et al. (1996) Cytogenet Cell Genet 73, 140–4.
Spandidos D. A. et al. (2002) Int J Oncol 21, 237–41.
Yang F. et al. (1999) Genomics 62, 189–202.
Correspondence: J. Bullerdiek ([email protected])
doi:10.1111/j.1365-2052.2004.01159.x
Linkage mapping of chicken ovoinhibitor and
ovomucoid genes to chromosome 13
K. Kinoshita*, T. Shimogiri†, S. Okamoto†, K. Yoshizawa‡, H. Mannen‡, H. R. Ibrahim†, H. H Cheng§
and Y. Maeda†
*The United Graduate School of Agricultural Sciences, Kagoshima
University, Korimoto, Kagoshima 890-0065, Japan. †Faculty of
Agriculture, Kagoshima University, Korimoto, Kagoshima 8900065, Japan. ‡Faculty of Agriculture, Kobe University, Nada-ku,
Kobe 657-8501, Japan. §United States Department of Agriculture,
Agriculture Research Service, East Lansing, MI 48823, USA
Accepted for publication 10 May 2004
Source/description: Ovoinhibitor (OIH) and ovomucoid (OVM)
are the major proteinase inhibitors constituting 1.5 and 11% of
the total proteins in hen egg white, respectively. Although OVM
exerts its antiprotease activity only against trypsin, OIH has a
wide spectrum of inhibitory activity for other proteinases that
occur in chicken egg white and blood plasma.1 They are
functionally similar proteins and having multiple domains with
a characteristic pattern of disulphide bridges.1 From the analysis of DNA sequences and the positions of exons and introns, it
2004 International Society for Animal Genetics, Animal Genetics, 35, 350–359
VIII.
The canine KRAS2 gene maps to chromosome 22.
Winkler S, Murua Escobar H, Gunther K, Richter A, Dolf G, Schelling
C, Bullerdiek J, Nolte I.
Anim Genet. 2004 Aug;35(4):350-1.
Eigenanteil:
• Durchführung der FISH
• Erstellen der caninen Karyogramme
• Verfassen des Artikels
BRIEF NOTES
doi:10.1111/j.1365-2052.2004.01136.x
The canine KRAS2 gene maps to chromosome
22
S. Winkler*, H. Murua Escobar*,†, K. Günther*,
A. Richter*, G. Dolf‡, C. Schelling§, J. Bullerdiek*
and Ingo Nolte†
*Center for Human Genetics, University of Bremen, Bremen,
Germany. †Small Animal Clinic, School of Veterinary Medicine,
Hannover, Germany. ‡Institute of Animal Genetics, Nutrition and
Housing, University of Berne, Berne, Switzerland. §Department of
Animal Science, Swiss Federal Institute of Technology Zürich and
Faculty of Veterinary Medicine, University of Zürich, Zürich,
Switzerland
Accepted for publication 20 March 2004
Introduction: Dogs and human beings often share the same
genetic pathways in development of cancer. Point mutations
affecting genes of the ras family are assumed to be among the
most important alterations in human tumourigenesis.1 Ras
proteins play an important role as signal transmitters. The
binding of growth factors activate the ras protein and thus
initiates cell division. Mutations in ras genes are assumed to
remove the time limit of the cell stimulating signals which
results in uncontrolled cell division.2 Mutations in KRAS2 have
been described in human pancreatic cancers and tumours of
the gastrointestinal tract as well as in tumours of the skin.3–5
Hot spot point mutations in KRAS2 described in different types
of human lung tumours and breast cancers are also present in
the corresponding canine gene.6 For further characterization of
the gene, we have mapped the canine KRAS2 gene.
BAC clone and probe: A KRAS2 DNA probe was generated
by polymerase chain reaction (PCR) spanning part of
the exon 2 (primer up: 5¢-caggattcctacaggaaaca-3¢/lo:
5¢-aacccacctataatggtgaa-3¢ based on NCBI sequence M54968)
using genomic canine DNA. The resulting amplicon was
cloned and sequenced for verification. These PCR conditions
were also used to screen a canine BAC library7 (URL: http://
www.dogmap.ch). To rule out false-positive BAC screening
results, a PCR using the initial primer pair was performed,
and the resulting amplicon cloned and sequenced for verification. BAC S069P22D02 was positive for KRAS2 and was
used for fluorescence in situ hybridization (FISH) analysis.
FISH: Metaphase preparations and FISH were performed as
described previously.8 Ten well spread metaphases were
examined and all showed a signal on both chromatids of
chromosome 22s (CFA 22) (Fig. 1).
Comments: Different investigations show that 30% of human
lung tumours, 90% of human pancreatic tumours and 50%
of tumours of the gastrointestinal tract depend on specific
point mutations in genes of the ras gene family.9–11
Molecular investigations of the ras family are rare in dogs,
but existing publications point to the fact that there are the
same point mutations affecting hotspot codons 12, 13 and
61, as they are in human malignancies.6 Up to 24% of cases
investigated in dogs showed point mutations in those codons.
The canine chromosome to which KRAS2 was mapped has
been involved in a centric fusion of CFA 8/22.12 According
to Yang et al.13 the canine chromosome 22 shares homology with HSA13, whereas the human KRAS2 gene is located
on HSA12. In our FISH studies, there were no metaphase
signals on the corresponding canine chromosomes, 29
and 10.
Acknowledgements: We thank Norbert Drieschner for his helpful
advice in FISH techniques.
References
1 Arber N. (1999) Apoptosis 4, 383–8.
2 Scriver et al. eds (1995) The Metabolic and Molecular Bases of
Inherited Disease, McGraw-Hill, New York, 7th edn, pp.
589–611.
3 Almoguera C. et al. (1988) Cell 53, 549–54.
4 Belly R. T. et al. (2001) Clin Colorectal Cancer 1, 110–6.
5 Shukla V. K. et al. (1989) Oncogene Res 5, 121–7.
6 Watzinger F. et al. (2001) Mol Carcinog 30, 190–8.
7 Schelling C. et al. (2002) J Anim Breeding Genet 119, 400–1.
8 Murua Escobar H. et al. (2001) Cytogenet Cell Genet 94,
M194–5.
9 Bos J. L. et al. (1989) Cancer Res 50, 1352.
10 Tang E. M. et al. (2002) J Natl Cancer Inst 94, 1527–36.
Figure 1 Metaphase spread after fluorescence in situ hybridization with signals on both chromosomes 22 (right) and the same metaphase after GTG
banding (left).
2004 International Society for Animal Genetics Animal Genetics, 35, 350–359
Brief notes
11 Knapp D. W. & Waters D. J. (1997) Mol Med Today 3, 8–11.
12 Mayr B. et al. (1991) Br Vet J 6, 545–8.
13 Yang F. et al. (1999) Genomics 62, 189–202.
Correspondence: Prof. Dr Jörn Bullerdiek (bullerd@
uni-bremen.de)
doi:10.1111/j.1365-2052.2004.01148.x
Genomic localization and SNP discovery in the
bovine melanocortin receptor 4 gene (MC4R)
E. Valle*, F. A. Habermann†, S. S. Moore‡,
D. H. Crews* and B. F. Benkel*
*Agriculture and Agri-Food Canada, Lethbridge Research Centre,
Lethbridge, Alberta, Canada. †Chair of Animal Breeding, Technical
University of Munich, Freising-Weihenstephan, Germany.
‡
Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada
Accepted for publication 12 April 2004
Source/description: MC4R is a G-protein-coupled receptor that is
implicated in the control of food intake and energy expenditure.
In mice, knock out of the Mc4r gene results in a maturity-onset
obesity syndrome which is due primarily to leptin-resistant
hyperphagia.1,2 Moreover, a significant association has been
reported between MC4R genotypes and backfat, growth rates,
and feed intake in a number of lines of swine.3 MC4R is an
intron-less gene with a transcript of 1800 nt containing a
coding region of roughly 1 kb. MC4R has been assigned to the
telomeric region of BTA24 by radiation hybrid mapping4 (RH)
and linkage analysis.5 Both papers also report SNPs in the
MC4R coding region – two single nucleotide substitutions
specific to the Red Holstein and Red Pied breeds,4 and a single
nucleotide substitution in cattle of unspecified origin.5
In this study we report: (i) the anchoring of the gene to a
specific contig in the bovine reference BAC genome scaffold;
(ii) the cytogenetic localization of the bovine MC4R gene using
FISH; and (iii) the results of an SNP discovery experiment using
a beef cattle reference panel.
Primer sequences:
Overgo hybridization
MC4RP1: 5¢-GCCTAAGATTTCCAAGTGATGCT
MC4RP2: 5¢-AAGTGTGGCTCTGGTCAGCATCAC
PCR verification
MC4RRev: 5¢-AAAGTTAGGCGGCGGAGA
SNP discovery
Forward: 5¢-GATTTCCAAGTGATGCTGACC
Reverse: 5¢-ACACACAGTATGGGTTCTGGG
Overgo hybridization to BAC filters: High density filters for the
bovine BAC library CHORI-240 were purchased from the BACPAC Resource Centre (http://bacpac.chori.org/home.htm).
Overgo probe oligomers (MC4RP1 and MC4RP2) and the PCR
verification primer (MC4RRev) were designed using the Overgo
1.02 program (http://www.mouse-genome.bcm.tmc.edu/web
overgo/OvergoInput.asp). Overgo probes were labelled and
hybridizations to high density filters carried out as previously
described.6 Hybridization-positive BAC clones were confirmed
via locus-specific PCR reactions using primers MC4RP1 and
MC4RRev revealing three clones for the MC4R gene – CHORI240 180D6, 213B5 and 265F11. All three clones map to
contig no. 926 in the bovine reference BAC genome scaffold
(http://www.bcgsc.ca/lab/mapping/bovine), thereby anchoring
this contig of 95 BACs to the telomeric end of BTA24.
Fluorescent in situ hybridization (FISH): BAC DNA for clone
180D6 was prepared using the R.E.A.L. Prep BAC kit (Qiagen,
Mississauga, ON, Canada). BAC DNA was labelled with digoxigenin-11-dUTP by standard nick translation and hybridized
with a 10· excess of bovine Cot1-DNA to normal male bovine
metaphase spreads. Probe hybridization was detected with
monoclonal mouse-anti digoxigenin (Roche, Mannheim,
Table 1 SNP discovery in the bovine MC4R gene.
Nucleotide position1,2
244
270
271
414
648
747
927
Codon
11
19
20
67
145
178
238
A
A
A
A
A
A
A
C
C
C
C
C
C
C
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
4G/2A (silent)4
G
G
G
C
C
C
5C/1T (silent)
C
C
C
A
G (T11A)
C
5C/1T (silent)
G
1G/5A (A20T)
G
5G/1A (silent)
G
1G/5A (silent)
G
G
C
C
Bos taurus
Angus3
Charolais
Hereford
Limousin
Simmental
Holstein
Wagyu
Bos indicus
Brahman
Bison bison
1
Positions are numbered according to GenBank accession no. AF265221.
SNPs detected previously at positions 647 and 7274 were not observed in this study, and the previously reported SNP at position 10695 lies
downstream of the fragment analysed.
3
Three unrelated bulls (six alleles) were sampled from each breed.
4
The impact of the SNP on the amino acid at the affected position is indicated in brackets.
2
2004 International Society for Animal Genetics, Animal Genetics, 35, 350–359
351
IX.
Cloning and characterization of the canine receptor for advanced
glycation end products.
Murua Escobar H, Soller JT, Sterenczak KA, Sperveslage JD,
Schlueter C, Burchardt B, Eberle N, Fork M, Nimzyk R, Winkler S,
Nolte I, Bullerdiek J
Gene. 2006 Mar 15;369:45-52.
Eigentanteil:
• Durchführung der FISH
• Erstellen der caninen Karyogramme
+ MODEL
ARTICLE IN PRESS
Gene xx (2005) xxx – xxx
www.elsevier.com/locate/gene
Cloning and characterization of the canine receptor for advanced glycation
end products
Hugo Murua Escobar a,⁎,1 , Jan T. Soller a,b,1 , Katharina A. Sterenczak b , Jan D. Sperveslage b ,
Claudia Schlueter b , Birgit Burchardt b , Nina Eberle a , Melanie Fork a , Rolf Nimzyk b ,
Susanne Winkler b , Ingo Nolte a , Jörn Bullerdiek b
a
Small Animal Clinic, University of Veterinary Medicine, Bischofsholer Damm 15, D-30173 Hannover, Germany
b
Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, D-28359 Bremen, Germany
Received 2 August 2005; received in revised form 26 September 2005; accepted 11 October 2005
Received by D.A. Tagle
Abstract
Metastasis is one of the major problems when dealing with malignant neoplasias. Accordingly, the finding of molecular targets, which can be
addressed to reduce tumour metastasising, will have significant impact on the development of new therapeutic approaches. Recently, the receptor
for advanced glycation end products (RAGE)–high mobility group B1 (HMGB1) protein complex has been shown to have significant influence
on invasiveness, growth and motility of tumour cells, which are essential characteristics required for metastatic behaviour. A set of in vitro and in
vivo approaches showed that blocking of this complex resulted in drastic suppression of tumour cell growth.
Due to the similarities of human and canine cancer the dog has joined the common rodent animal model for therapeutic and preclinical studies.
However, complete characterisation of the protein complex is a precondition to a therapeutic approach based on the blocking of the RAGE–
HMGB1 complex to spontaneously occurring tumours in dogs. We recently characterised the canine HMGB1 gene and protein completely. Here
we present the complete characterisation of the canine RAGE gene including its 1384 bp mRNA, the 1215 bp protein coding sequence, the 2835
bp genomic structure, chromosomal localisation, gene expression pattern, and its 404 amino acid protein. Furthermore we compared the CDS of
six different canine breeds and screened them for single nucleotide polymorphisms.
© 2005 Elsevier B.V. All rights reserved.
Keywords: Receptor for advanced glycation end products; RAGE; HMGB1; Metastasis; Canis familiaris; Comparative genomics
Abbreviations: A, adenosine; aa, amino acid(s); AGE, advanced glycation end product(s); BAC, bacterial artificial chromosome; bp, base pair(s); BSA, bovine
serum albumin; cDNA, DNA complementary to RNA; CDS, coding sequence(s); CFA, Canis familiaris; Ci, Curie; CD, carboxy-terminal domain; dCTP,
deoxycytidine 5′-triphosphate; DNA, deoxy-ribonucleic acid; DNase, deoxyribonuclease; EC, extracellular; FISH, fluorescence in situ hybridisation; G, guanosine;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTG, g-bands by trypsine using gimsa; HMG, high mobility group; HMGB1, high mobility group protein B1;
HSA, Homo sapiens; I, inosine; Ig, immunoglobulin; kDa, kilo Dalton; M-MLV, Moloney murine leukemia virus; mRNA, messenger ribonucleic acid; NCBI,
National Center for Biotechnology Information; ORF, open reading frame; 32P, phosphorus 32 radioisotope; PHA, phytohemagglutinin; PCR, polymerase chain
reaction; R, arginine; RACE, rapid amplification of cDNA ends; RAGE, receptor for advanced glycation end products; sRAGE, soluble RAGE variant(s); RNA,
ribonucleic acid; SDS, sodium dodecyl sulfate; SNP, single nucleotide polymorphism; SSC, standard saline citrate; SSPE, sodium saline phosphate EDTA; TM,
transmembrane domain; UTR, untranslated region; W, tryptophane.
⁎ Corresponding author. Tel.: +49 511 856 7251; fax: +49 511 856 7686.
E-mail address: [email protected] (H. Murua Escobar).
1
H. Murua Escobar and J. T. Soller have contributed equally to this article.
0378-1119/$ - see front matter © 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2005.10.015
GENE-35223; No of Pages 8
ARTICLE IN PRESS
2
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
1. Introduction
The canine genome offers a wide field for genetic studies on
various areas as e.g. phenotypic diversity, heredity and diseases
including cancer. In terms of cancer, the canine model shows
several advantages. First of all, the dog enjoys after the human
the second best medical care of all species allowing a detailed
surveillance of the cancer, progression, and therapy. The cancers
seen in dogs are spontaneously developing as opposed to rodents
with tumours being experimentally induced by carcinogen or
transplanted to immunocompromised animals. Also, the canine
cancers are more akin to human cancers than rodent tumours in
terms of patient size and cell kinetics allowing better comparison
of medical examinations as e.g. ultrasonography. It is generally
believed that dogs develop cancer twice as frequently as
humans, and it has been shown that the presentation, histology
and biology of several canine cancers are similar to those in
humans (Withrow and MacEwen, 1989, 2001; MacEwen,
1990). Most canine cancers progress more rapidly than their
human counterparts permitting a better surveillance of the
tumour state (Withrow and MacEwen, 2001). Additionally, dogs
show similar characteristics of physiology and metabolism for
most organ systems and drugs, which allows better comparability of modalities e.g. surgery, radiation, chemotherapy (Withrow
and MacEwen, 2001), and new therapeutic approaches aimed at
cancer treatment. At least a dozen distinct canine cancers are
hypothesized to be appropriate models for their human counterparts (Patterson et al., 1982; Withrow and MacEwen, 1989;
MacEwen, 1990; Knapp and Waters, 1997), among those
osteosarcoma, breast carcinoma, oral melanomas, lung carcinomas and malignant non-Hodgkin's lymphomas (MacEwen,
1990).
Lately, the RAGE–HMGB1 protein complex has attracted
significant interest in terms of metastasic behaviour of tumours.
The receptor itself is a multiligand member of the immunoglobulin superfamily, which was shown to bind nonenzymatically
glycated adducts, i.e. advanced glycation end products (AGE). It
has been described to be involved in a variety of pathophysiological processes, e.g. immune/inflammatory disorders (Hofmann et al., 1999, 2002), Alzheimer's disease (Yan et al., 1997;
Lue et al., 2001), abnormalities associated with diabetes, e.g.
arteriosclerosis (Park et al., 1998) or impaired wound healing
(Goova et al., 2001), and tumourigenesis (Taguchi et al., 2000;
Huttunen et al., 2002). In terms of tumours and metastasis, the
interaction with the extracellular ligand amphoterin, synonymously called HMGB1, was shown to have significant influence
(Taguchi et al., 2000; Huttunen et al., 2002) by activating key
cell signalling pathways such as MAP kinases and NF-κB
(Taguchi et al., 2000). Taguchi et al. (2000) were able to show
that blocking of this complex by using a soluble variant of the
receptor lacking the cytosolic and transmembrane domains
strongly inhibited the metastatic behaviour of glioma cells in
terms of invasive growth, motility and migration. To establish a
therapeutic approach based on blocking of the RAGE–HMGB1
protein complex in canine tumours as preclinical approach for
human neoplasias, the knowledge of the canine protein complex
is precondition. Previously we characterised the canine HMGB1
gene and its protein (Murua Escobar et al., 2003). Here we
present the complete characterisation of the canine RAGE gene
including its mRNA, the genomic structure, chromosomal
localisation, gene expression pattern, and its protein. Furthermore we compared the protein coding sequences (CDS) of six
different canine breeds and screened them for single nucleotide
polymorphisms (SNPs).
The complete characterisation of the canine RAGE–
HMGB1 protein complex will serve as base for future clinical
studies aimed at the development of blocking strategies to
inhibit metastatic behaviour of canine and human tumours.
2. Methods and materials
2.1. Tissues
The tissues used in this study were provided by the Small
Animal Clinic, University of Veterinary Medicine, Hannover,
Germany. The breeds represented were Bernese Mountain Dog,
Border Collie, Dachshund, Golden Retriever, Rottweiler, and
Siberian Husky. From each breed up to three samples of lung
tissue were taken and used for analyses.
2.2. Bacterial artificial chromosome (BAC) screening and
fluorescence in situ hybridisation FISH
A canine genomic RAGE DNA probe was used for
hybridisation of canine RPCI 81 BAC/PAC filter (BACPAC
RESOURCES/Children's Hospital Oakland Research Institute,
Oakland, USA). The 261 bp probe was generated by PCR with
the primer set 480up and canisRlo623 (5′ AGGGACTCTTAGCTGGCACT 3′/5′ GAAGGTGGGGTGGGGAGCTC 3′)
on genomic DNA prepared from a blood sample of a healthy
dog. The obtained PCR product was separated on a 1.5%
agarose gel, recovered with QIAEX II (QIAGEN, Hilden,
Germany), cloned in pGEM–T-Easy vector system (Promega,
Madison, USA) and sequenced for verification. The probe
labelling was performed by random primed labelling (Roche
Diagnostics, Mannheim, Germany) as described in the
manufacturer's protocol with 250 ng probe and 250 μCi
(α32P)dCTP (GE Healthcare, Freiburg, Germany). Purification
of the labelled probe was done using Sephadex G-50 Nick
Columns (Amersham Pharmacia Biotech, Freiburg, Germany)
and the probe was stored at − 20 °C before use.
The filters were placed in a minimum volume of Church
Buffer (0.15 mM bovine serum albumin (BSA), 1 mM EDTA,
0.5 M NaHPO4, 7% SDS) and transferred into hybridisation
bottles. The filters were prehybridised at 65 °C for 1 h in 25 ml
Church Buffer. Hybridisation was performed at 65 °C overnight
(16–18 h) in the same solution. All further steps were performed
according to manufacturer's protocol. Signals were visualised
using a STORM imager (Molecular Dynamics, Sunnyvale,
USA).
Metaphase preparations were obtained from blood samples
of different dogs. The samples were stimulated with phytohemagglutinin (PHA) and cultured for 96 h at 37 °C. After
incubation for 2 h with colcemide (0.1 μg/ml), the lymphocytes
ARTICLE IN PRESS
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
were harvested and slides were prepared according to routine
procedures. Prior to FISH, chromosomes were stained using an
adapted GTG-banding method. Chromosomal G-bands were
identified according to Reimann et al. (1996). After recording
the metaphases, the slides were destained in 70% ethanol for 15
min, air-dried and incubated at 60 °C overnight.
FISH was performed using the protocol of Fischer et al.
(1996) with some modifications. BAC DNA was digoxigenin
labelled (Dig-Nick-Translation-Kit, Roche Diagnostics, Mannheim, Germany). The hybridisation mixture contained 200 ng
probe, 43.2 μg salmon sperm DNA, 800 ng sonicated dog DNA,
1× SSC, 1× SSPE, 50% formamide and 10% dextransulfate. The
chromosomes were counterstained with propidiumiodide.
2.3. Genomic characterisation
For genomic characterization the canine RAGE gene was
amplified by PCR using the screened BAC RP81339J10
(BACPAC RESOURCES/Children's Hospital Oakland Research Institute, Oakland, USA). A 1298 bp fragment spanning
exon 1 to exon 6 was generated by the primer pair canisRup1/
canisRlo623 (5′ ATGGCAGCAGGGGCGGCAGC 3′/5′
GAAGGTGGGGTGGGGAGCTC 3′) and an additional 1403
bp fragment spanning exon 6 to exon 11 was generated with pair
cEx6up/3046lo (5′ CTCCCCACCCCACCTTCTCC 3′/5′
TCATGGCCCTGCTGCACCGCTCT 3′) including the respective introns. The obtained PCR products were separated on an
1.5% agarose gel, recovered with QIAEX II (QIAGEN,
Hilden, Germany), cloned in pGEM–T-Easy vector system
(Promega, Madison, USA) and sequenced for verification. The
final genomic canine RAGE contig and the identity alignments
were created with Lasergene software (DNAStar, Madison,
USA) using various sequences from the NCBI database
(GenBank accession nos.: D28769, AB036432, NM_001136,
BC020669, M91211) and the following described cDNA (see
Section 2.4).
2.4. cDNA characterisation
Total RNA was isolated from 50 mg canine lung tissue using
TRIZOL LS (Invitrogen, Karlsruhe, Germany) following the
manufacturer's protocol. To avoid genomic DNA contamination a DNase digest of each sample was performed using
RNase-Free DNase Set (Qiagen, Hilden, Germany). cDNA was
synthesised using 3′-RACE adaptor primer AP2 (AAGGATCCGTCGACATC(17)T), 5 μg total RNA, and SuperScript
II (Invitrogen, Karlsruhe, Germany) reverse transcriptase
according to the manufacturer's instructions. The PCRs for
the molecular cloning of the cDNA were done using the primer
pairs canisRup1/canisRlo623 (5′ ATGGCAGCAGGGGCGGCAGC 3′/5′ GAAGGTGGGGTGGGGAGCTC 3′), 480up/
RAGElo1236 (5′ AGGGACTCTTAGCTGGCACT 3′/5′
TGTCTGTGGGCCCCTCAAGG 3′) and gene-specific primers
cEx6up/cEx11up (5′ CTCCCCACCCCACCTTCTCC 3′/5′
GAATCAGTCAGAGGAGCCCGAGG 3′). 3′RACE PCR
was done using the adaptor primer AP2 specified above. The
primers were derived from human cDNA sequences (GenBank
3
accession no. M91211). 5′RACE was performed using the
primers 5′RACE Abridged Anchor Primer (5′ GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGII 3′), Universal
Amplification Primer (5′ CTACTACTACTAGGCCACGCGTCGACTAGTAC 3′), and the gene-specific primers
RAGElo1236 and canisRlo623 determined as above according
to the 5′RACE System for Rapid Amplifications of cDNA Ends
by Invitrogen. The PCR products were separated on a 1.5%
agarose gel, recovered with QIAEX II (QIAGEN, Hilden,
Germany), cloned in pGEM–T-Easy vector system (Promega,
Madison, USA) and sequenced. The cDNA contig and the
identity alignments were created with Lasergene software
(DNAStar, Madison, USA) and various sequences from the
NCBI database (GenBank accession nos.: D28769, AB036432,
NM_001136, BC020669, M91211).
2.5. CDS comparison between breeds
The CDSs were characterised for all breeds as described
previously in Section 2.2. The contigs and the identity
alignments were created using several sequences from the
NCBI database (GenBank accession nos.: D28769 AB036432,
NM_001136, BC020669, M91211). In case of single-nucleotide exchanges, the samples were sequenced again in both
forward and reverse direction. Exchanges causing no amino
acid (aa) substitution were not taken into account for further
analyses. For all samples with aa substitutions, the initial PCR
was repeated and the exchange verified by sequencing the
product in both forward and reverse direction.
2.6. Protein sequences
The canine RAGE protein sequence was derived from the
ORF (open reading frames) of the characterised cDNA
sequence described previously in Section 2.4. The protein
homology alignments were created with four sequences from
the NCBI database (GenBank accession nos.: BAA89369,
NP_776407, AAA42027, AAH61182).
2.7. Northern Blot and RT–PCR
Total RNA was isolated from canine liver, kidney, heart,
testis, lung, muscle, pancreas and spleen tissue using RNeasy
midi system (QIAGEN, Hilden, Germany). For Northern Blot
hybridisation 30 μg of total RNA from each tissue sample was
separated on a 1.2% denaturing agarose gel containing 0.65%
formaldehyde. RNA was transferred onto Hybond–N+ positive
nylon membrane (Amersham Pharmacia Biotech, Freiburg,
Germany) by capillary blot.
A 624 bp cDNA fragment derived from the canine RAGE
sequence (exon 1/exon 5) served as a molecular probe for
hybridisation. The probe was generated by PCR with the primer
set canisRup1 and canisRlo623 (5′ ATGGCAGCAGGGGCGGCAGC 3′/5′ GAAGGTGGGGTGGGGAGCTC 3′) using
the cloned cDNA described in Section 2.2. Probe labelling was
performed by random primed labelling (Amersham Pharmacia
Biotech, Freiburg, Germany) as described in the manufacturer's
ARTICLE IN PRESS
4
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
Fig. 1. An example of a metaphase spread after FISH with signals on both
chromosomes 12 (A) and the same metaphase after GTG-banding (B).
protocol with 50 μCi (α32P)dCTP (Amersham Pharmacia
Biotech, Freiburg, Germany). Purification of the labelled
probe was performed using Sephadex G-50 Nick Columns
(Amersham Pharmacia Biotech, Freiburg, Germany) and the
probe was stored at − 20 °C before use.
Prehybridisation was carried out for 30 min and hybridisation overnight at 68 °C using the PERFECTHYB PLUS hybridisation solution (Sigma-Aldrich, Saint Louis, MO, USA). The
membrane was washed for 5 min at room temperature in 2×
SSC/0.1% SDS, and twice for 20 min at 68 °C in 0.5× SSC/
0.1% SDS. Signals were visualised using a STORM phosphorimager (Molecular Dynamics, Sunnyvale, USA).
RT–PCR was performed using all isolated tissue cDNAs
with primer pair cEx6up/3046lo (5′ CTCCCCACCCCACCTTCTCC 3′/5′ TCATGGCCCTGCTGCACCGCTCT 3′).
3. Results and discussion
The RAGE–HMGB1 protein complex has lately attracted
significant interest of researchers working on cancer and other
diseases. Several publications demonstrate the involvement of
the RAGE receptor in a variety of pathophysiological processes,
e.g. immune/inflammatory disorders (Hofmann et al., 1999,
2002), Alzheimer disease (Yan et al., 1997; Lue et al., 2001),
abnormalities associated with diabetes, e.g. arteriosclerosis
(Park et al., 1998) and impaired wound healing (Goova et al.,
2001). It has been shown that the specific RAGE-related
diseases are caused by binding of different specific ligands to
the receptor (for reviews, see Schmidt et al., 2001; Huttunen and
Rauvala, 2004). In terms of tumourigenesis and metastasis, the
interaction with the extracellular ligand amphoterin, synonymously called HMGB1, was shown to have significant
influence by activating key cell signalling MAP kinase
pathways (Huttunen et al., 2002; Taguchi et al., 2000). A set
of in vivo and in vitro experiments showed that blocking of this
complex strongly inhibited the metastatic behaviour of cancer
cells in terms of invasive growth, motility and migration
(Taguchi et al., 2000). Furthermore, deregulation of the RAGE
gene expression level was associated with prostate cancer
(Simm et al., 2004), with malignant potential of colorectal
cancer (Sasahira et al., 2005) and non-small-cell lung cancer
(Bartling et al., 2005).
To establish a therapeutic approach based on blocking of the
RAGE–HMGB1 protein complex in canine tumours as a
preclinical approach for human neoplasias, the knowledge of
the canine protein complex is preconditioned.
3.1. Chromosomal localisation
A canine RAGE genomic DNA probe was generated and used
for screening of a canine BAC for localisation of the canine
RAGE gene locus by FISH. The verified BAC 339-J10 was used
for FISH experiments. Twelve well-spread metaphases were
Fig. 2. Structure of the canine RAGE gene on genomic, cDNA and protein level.
ARTICLE IN PRESS
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
examined for analyses, showing signals on both chromatides of
both chromosomes CFA 12 (Fig. 1). The chromosomal
localisation was done following the nomenclature established
by Reimann et al. (1996). Presented synteny studies (Yang et
al., 1999; Breen et al., 1999) showed that the canine CFA 12
shares homology to the human chromosome 6 where the
RAGE gene is located at HSA 6p21.32. As far as we know,
chromosomal aberrations affecting CFA 12 are not reported to
be significantly associated with canine neoplasias.
3.2. Genomic structure
The genomic structure of the canine RAGE gene consists of
eleven exons and ten introns. The complete canine gene spans
2835 bp. The exon/intron structure, size and the homologies to
their human counterparts were analysed and defined (Fig. 2 and
Table 1). The total identity to the corresponding human region
shows 63.4%. In detail, the identities of the exons vary between
73.9% and 86.7% to their human counterpart, while the introns
show identities between 43.4% and 71.0% (for details see Table
Table 1
Detailed analysis of the RAGE gene elements and the RAGE protein
Element
Size in bp
Identity to human counterpart
in % (D28769)
Total genomic gene
Total cDNA
5′UTR
CDS
3′UTR
Detail exons/introns
Exon 1
Intron 1
Exon 2
Intron 2
Exon 3
Intron 3
Exon 4
Intron 4
Exon 5
Intron 5
Exon 6
Intron 6
Exon 7
Intron 7
Exon 8
Intron 8
Exon 9
Intron 9
Exon 10
Intron 10
Exon 11
2835
1384
18
1215
151
63.4
80.9
100
82.9
70.8
58
170
107
131
193
159
65
119
88
98
183
94
125
199
139
268
27
106
127
125
254
78.0
67.5
86.7
71.0
85.8
53.8
85.5
57.0
86.6
71.1
86.7
47.3
80.2
57.6
85.0
51.8
79.2
62.3
84.3
62.3
73.9
Protein
Size in aa
Total protein
Total extracellular domain
Ig-type V domain
Transmebrane domain
Cytosolic tail
404
318
33
19
43
Identity to human counterpart
in % (BAA89369)
77.6
78.2
85.7
78.9
72.7
Identity comparison of the canine RAGE genomic elements, cDNA elements,
and protein to their human counterparts.
5
1). The genomic sequences were submitted to the NCBI
database (GenBank accession no. AY836509).
3.3. The canine RAGE cDNA transcript
The complete canine RAGE cDNA consist of eleven exons
spanning 1384 bp in total. The exon size varies between 27 bp
to 254 bp composing all together a 5′UTR of 18 bp, a CDS of
1215 bp, and a 3′UTR of 151 bp (Fig. 2 and Table 1). Identity
comparison to its human counterpart (GenBank accession no.
D28769) revealed a total identity of 80.9% on nucleotide level
varying in the exons from 73.9% (exon 11) to 86.7% (exon 2)
(for details see Table 1). In humans several naturally occurring
truncated RAGE transcripts have been described lacking the
cytosolic and transmembrane domains named soluble RAGE
variants (sRAGE) (Malherbe et al., 1999; Schlueter et al.,
2003). These aberrant transcripts act as naturally occurring
competitive inhibitors of the RAGE receptor taking effect on
receptor efficiency. Detailed analysis of the aberrant transcript
structure revealed the partial insertion of different genomic
RAGE intron DNA fragments leading to the observed aberrant
splicing products (Malherbe et al., 1999; Schlueter et al.,
2003). In dogs, we could not detect corresponding aberrant
splicing products using the experimental design developed
previously in our group by Schlueter et al. (2003). However,
the application of such soluble RAGE variants to block e.g. the
HMGB1 protein drastically suppressed the growth of tumour
cells in vitro and in vivo (for review see Huttunen et al., 2002).
Treatment of mice with sRAGE completely suppressed
diabetic atherosclerosis in a glycemia- and lipid-independent
manner (Park et al., 1998). The total canine RAGE cDNA
sequence was submitted to the NCBI database with GenBank
accession no. AY836152 completing our previous submission
of AY530943.
3.4. RAGE CDS comparison between different canine breeds
For six different canine breeds the protein coding
sequences were characterised by amplification of a fragment
spanning the CDS using the canine lung cDNA samples as
template. Nucleotide exchanges causing no amino acid
substitution were not taken into account in further analyses.
The comparison of these six protein-coding sequences
revealed one amino acid change. A Bernese Mountaindog
sample showed a nucleotide transition from C (CGG) to T
(TGG) at the first base of the CDS codon 364, leading to an
aa replacement from arginine (R) to tryptophane (W).
Possible PCR artefacts seem rather unlikely, since several
clones were sequenced for verification. Polymorphisms
causing mutations in the RAGE gene had been associated
with various inflammatory diseases and diabetic syndromes
such as rheumatoid arthritis, psoriasis, nephropathy, periodontitis, and microvascular diseases (Hudson et al., 1998,
2001; Kankova et al., 1999, 2001; Liu and Xiang, 1999;
Poirier et al., 2001; Hofmann et al., 2002; Schmidt, 2002;
Vasku et al., 2002). Considering the fact that canine breeds
show breed-specific predispositions for various cancers and
ARTICLE IN PRESS
6
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
other diseases, the detailed analyses of single breeds could be
of significant value to unravel the disease associated
mechanisms involved.
The CDS cDNA sequences of the six breeds were submitted
to the NCBI database with GenBank accession nos.
DQ125936, DQ125937, DQ125938, DQ125939, DQ125940,
and DQ125941.
3.5. The canine RAGE protein
The canine RAGE protein sequence was deduced from the
characterised cDNA sequence. The canine RAGE protein is a
404-amino-acid molecule with a calculated weight of 43 kDa
(Fig. 1 and Table 1). Identity comparison of the canine
molecule to its human counterpart (GenBank accession no.
BAA89369) showed a total of 77.6% identity to the human
protein including the described three extracellular (EC)
immunoglobulin (Ig) type domains V, C, C′, the hydrophobic
transmembrane domain (TM), and the highly charged
cytosolic tail including acidic carboxy-terminal domain
(CD) (Neeper et al., 1992). The total canine extracellular
domain shows 78.2%, the transmembrane domain 78.9%, and
the cytosolic tail 72.7% identity to their human counterparts,
respectively. The RAGE immunoglobulin type V domain was
identified as HMGB1 binding domain. The identity comparison of this domain between dog and human showed 85.7%
with 10 amino acid exchanges (Fig. 3). Recently, the motive
Fig. 4. Total RNA Northern blot showing 1.4 kb RAGE and 1.3 kb GAPDH
transcripts. Lanes: (1) canine testis, (2) canine heart, (3) canine lung, (4) canine
muscle, (5) canine kidney, (6) canine pancreas, (7) canine spleen, (8) canine
liver.
of the human HMGB1 protein for binding the V domain of
RAGE receptor was identified to consist of aa 150–183
including the HMG-Box-B and part of carboxy-terminal
domain (Huttunen et al., 2002). We previously characterised
the canine HMGB1 protein and comparison of the functional
domains revealed that the canine amino acid sequence is
identical to the human counterpart (Murua Escobar et al.,
2003). Due to the high similarity of the canine and human
RAGE–HMGB1 protein complexes in their interacting
domains, therapeutic approaches applied in dogs could be
more suitable in terms of transferability for the development
of human therapies than approaches tested in other
organisms.
Comparison of the canine RAGE protein with the described
mouse (GenBank accession no. AAH61182), rat (GenBank
accession no. AAA42027) and bovine (GenBank accession no.
Fig. 3. Comparison of the canine, human, mouse, rat, and bovine RAGE proteins. The amino acid differences are shown as bold letters.
ARTICLE IN PRESS
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
NP_776407) molecules showed identities of 73.5%, 72.8% and
77.7%, respectively (Fig. 3).
The canine RAGE protein sequence was submitted to the
NCBI database with GenBank accession no. AAX38183.
3.6. Canine RAGE expression analysis
To elucidate the expression patterns of the canine RAGE
gene, a canine Northern blot was performed using RNA from
canine liver, kidney, heart, testis, lung, muscle, pancreas and
spleen tissue samples as well as RNA from different canine
cell lines and hybridised with a 32P-labelled canine RAGE
cDNA probe. Except for the lung tissue showing a clear
approx. 1.4 kb signal, none of the samples revealed a distinct
signal. After stripping and rehybridisation with a canine
GAPDH probe, all samples revealed signals corresponding to
approx. 1.3 kb demonstrating intact RNA (Fig. 4). For
verification, performed RT–PCR using the same RNA
revealed, additionally to a clear lung signal, very weak
signals in spleen and heart tissue (data not shown). These
results are in accordance to the gene expression pattern seen
in humans. However, as mentioned before, aberrant transcripts like those found in humans could not be detected by
RT–PCR. Lately, deregulation of the RAGE gene had been
associated with various cancers and diseases e.g. upregulation of the gene has been shown to be associated
with prostate cancer development, human heart dysfunction,
and inhibition of liver regeneration (Simm et al., 2004;
Cataldegirmen et al., 2005; Ishiguro et al., 2005), while
down-regulation of the RAGE gene has been shown to
support non-small-cell lung carcinomas (Bartling et al.,
2005). Additionally, RAGE gene expression has been
associated with malignant potential of colorectal adenomas
(Sasahira et al., 2005). As far as we know, in canine
neoplasias, no RAGE expression analyses have been carried
out. Considering the mentioned characteristics of canine
neoplasias as model for human cancer, expression analyses
done in canine tumours could be of significant value to
further elucidate the role of RAGE in tumour and disease
development.
4. Conclusions
As reviewed lately by Khanna and Hunter (2005), the dog
is significantly helping to reveal characteristics of human
tumour biology especially of metastasis due to the described
similarities of the naturally occurring malignancies in both
species. Accordingly, the development of new therapeutic
approaches in animal model systems will be facilitated by
the ongoing characterisation of model species specific
molecular targets. Especially in points of transferability, the
newly gained knowledge will be of great value. Due to the
significant role of the RAGE–HMGB1 protein complex in
cancer metastasis and the described various other diseases,
the complete characterisation of the canine RAGE–HMGB1
protein complex will serve as basis for future clinical
studies.
7
References
Bartling, B., Hofmann, H.S., Weigle, B., Silber, R.E., Simm, A., 2005. Downregulation of the receptor for advanced glycation end-products (RAGE)
supports non-small cell lung carcinoma. Carcinogenesis 26 (2), 293–301.
Breen, M., Thomas, R., Binns, M.M., Carter, N.P., Langford, C.F., 1999.
Reciprocal chromosome painting reveals detailed regions of conserved
synteny between the karyotypes of the domestic dog (Canis familiaris) and
human. Genomics 61, 145–155.
Cataldegirmen, G., et al., 2005. RAGE limits regeneration after massive liver
injury by coordinated suppression of TNF-alpha and NF-kappaB. J. Exp.
Med. 201 (3), 473–484.
Fischer, P., Holmes, N., Dickens, H., Thomas, R., Binns, M., Nacheva, E., 1996.
The application of FISH techniques for physical mapping in the dog (Canis
familiaris). Mamm. Genome 7, 37–41.
Goova, M.T., et al., 2001. Blockade of receptor for advanced glycation endproducts restores effective wound healing in diabetic mice. Am. J. Pathol.
159, 513–525.
Hofmann, M.A., et al., 1999. RAGE mediates a novel proinflammatory axis: a
central cell surface receptor for S100/calgranulin polypeptides. Cell 97,
889–901.
Hofmann, M.A., et al., 2002. RAGE and arthritis: the G82S polymorphism
amplifies the inflammatory response. Genes Immun. 3, 123–135.
Hudson, B.I., Stickland, M.H., Grant, P.J., 1998. Identification of polymorphisms in the receptor for advanced glycation end products (RAGE)
gene: prevalence in type 2 diabetes and ethnic groups. Diabetes 47,
1155–1157.
Hudson, B.I., Stickland, M.H., Futers, T.S., Grant, P.J., 2001. Effects of novel
polymorphisms in the rage gene on transcriptional regulation and their
association with diabetic retinopathy. Diabetes 50, 1505–1511.
Huttunen, H.J., Rauvala, H., 2004. Amphoterin as an extracellular regulator of
cell motility: from discovery to disease. Intern. Med. 255 (3), 351–366.
Huttunen, H.J., Fages, C., Kuja-Panula, J., Ridley, A.J., Rauvala, H., 2002.
Receptor for advanced glycation end products-binding COOH-terminal
motif of amphoterin inhibits invasive migration and metastasis. Cancer Res.
62, 4805–4811.
Ishiguro, H., Nakaigawa, N., Miyoshi, Y., Fujinami, K., Kubota, Y., Uemura, H.,
2005. Receptor for advanced glycation end products (RAGE) and its ligand,
amphoterin are overexpressed and associated with prostate cancer
development. Prostate 64 (1), 92–100 (Jun 15).
Kankova, K., Vasku, A., Hajek, D., Zahejsky, J., Vasku, V., 1999. Association of
G82S polymorphism in the RAGE gene with skin complications in type 2
diabetes. Diabetes Care 22, 1745.
Kankova, K., et al., 2001. Polymorphisms 1704G/T and 2184A/G in the RAGE
gene are associated with antioxidant status. Metabolism 50, 1152–1160.
Khanna, C., Hunter, K., 2005. Modeling metastasis in vivo. Carcinogenesis 26
(3), 513–523.
Knapp, D.W., Waters, D.J., 1997. Naturally occurring cancer in pet dogs:
important models for developing improved cancer therapy for humans. Mol.
Med. Today 3 (1), 8–11.
Liu, L., Xiang, K., 1999. RAGE Gly82Ser polymorphism in diabetic
microangiopathy. Diabetes Care 22, 646.
Lue, L.F., et al., 2001. Involvement of microglial receptor for advanced
glycation endproducts (RAGE) in Alzheimer's disease: identification of a
cellular activation mechanism. Exp. Neurol. 171, 29–45.
MacEwen, E.G., 1990. Spontaneous tumours in dogs and cats: models for the
study of cancer biology and treatment. Cancer Metastasis Rev. 9,
125–136.
Malherbe, P., et al., 1999. cDNA cloning of a novel secreted isoform of the
human receptor for advanced glycation end products and characterization
of cells co-expressing cell surface scavenger receptors and Swedish mutant
amyloid precursor protein. Brain Res. Mol. Brain Res. 71, 159–170.
Murua Escobar, H., et al., 2003. Molecular characterization of the canine
HMGB1. Cytogenet. Genome Res. 101 (1), 33–38.
Neeper, M., et al., 1992. Cloning and expression of a cell surface receptor for
advanced glycosylation end products of proteins. J. Biol. Chem. 267,
14998–15004.
ARTICLE IN PRESS
8
H. Murua Escobar et al. / Gene xx (2005) xxx–xxx
Park, L., et al., 1998. Suppression of accelerated diabetic atherosclerosis by the
soluble receptor for advanced glycation endproducts. Nat. Med. 4,
1025–1031.
Patterson, D.F., Haskins, M.E., Jezyk, P.F., 1982. Models of human genetic
disease in domestic animals. Adv. Hum. Genet. 12, 263–339.
Poirier, O., et al., 2001. Polymorphism screening of four genes encoding
advanced glycation end-product putative receptors. Association study with
nephropathy in type 1 diabetic patients. Diabetes 50, 1214–1218.
Reimann, N., et al., 1996. An extended nomenclature of the canine. Cytogenet.
Cell Genet. 73, 140–144.
Sasahira, T., Akama, Y., Fujii, K., Kuniyasu, H., 2005. Expression of receptor
for advanced glycation end products and HMGB1/amphoterin in colorectal
adenomas. Virchows Arch. 446 (4), 411–415.
Schlueter, C., Hauke, S., Flohr, A.M., Rogalla, P., Bullerdiek, J., 2003. Tissuespecific expression patterns of the RAGE receptor and its soluble forms—a
result of regulated alternative splicing? Biochim. Biophys. Acta 1630 (1),
1–6.
Schmidt, A.M., 2002. RAGE and arthritis: the G82S polymorphism amplifies
the inflammatory response. Genes Immun. 3, 123–135.
Schmidt, A.M., Yan, S.D., Yan, S.F., Stern, D.M., 2001. The multiligand
receptor RAGE as a progression factor amplifying immune and inflammatory responses. J. Clin. Invest. 108, 949–955.
Simm, A., Casselmann, C., Schubert, A., Hofmann, S., Reimann, A., Silber, R.
E., 2004. Age associated changes of AGE-receptor expression: RAGE
upregulation is associated with human heart dysfunction. Exp. Gerontol. 39
(3), 407–413.
Taguchi, A., et al., 2000. Blockade of RAGE–amphoterin signalling suppresses
tumour growth and metastases. Nature 405, 354–360.
Vasku, V., et al., 2002. Gene polymorphisms (G82S, 1704G/T, 2184A/G and
2245G/A) of the receptor of advanced glycation end products (RAGE) in
plaque psoriasis. Arch. Dermatol. Res. 294, 127–130 (JID-8000462).
Withrow, S.J., MacEwen, E.G., 1989. Clinical Veterinary Oncology. J.B.
Lippincott, Co.
Withrow, S.J., MacEwen, E.G., 2001. Small Animal Clinical Oncology. W.B.
Saunders Company.
Yan, S.D., et al., 1997. Amyloid-beta peptide-receptor for advanced glycation
endproduct interaction elicits neuronal expression of macrophage-colony
stimulating factor: a proinflammatory pathway in Alzheimer disease. Proc.
Natl. Acad. Sci. U. S. A. 94, 5296–5301.
Yang, F., et al., 1999. A complete comparative chromosome map for the dog, red
fox, and human and its integration with canine genetic maps. Genomics 62,
189–202.
X.
Absence of ras-gene hot-spot mutations in canine fibrosarcomas
and melanomas
Murua Escobar H, Günther K, Richter A, Soller JT, Winkler S, Nolte I,
Bullerdiek J.
Anticancer Res. 2004 Sep-Oct;24(5A):3027-8.
Eigenanteil:
• Erstellen der caninen Gewebebank
ANTICANCER RESEARCH 24: xxx-xxx (2004)
No: 5085-E
Please mark the appropriate
section for this paper
■ Experimental
■ Clinical
■ Epidemiological
Absence of Ras-gene Hot-spot Mutations in
Canine Fibrosarcomas and Melanomas
HUGO MURUA ESCOBAR1,2, KATHRIN GÜNTHER1, ANDREAS RICHTER1,
JAN T. SOLLER1, SUSANNE WINKLER1, INGO NOLTE2 and JÖRN BULLERDIEK1
1Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen;
2Small Animal Clinic, School of Veterinary Medicine, Bischofsholer Damm 15, 30173 Hanover, Germany
Abstract. Point mutations within ras proto-oncogenes,
particularly within the mutational hot-spot codons 12, 13 and 61,
are frequently detected in human malignancies and in different
types of experimentally-induced tumours in animals. So far little
is known about ras mutations in naturally occurring canine
fibrosarcomas or K-ras mutations in canine melanomas. To
elucidate whether ras mutations exist in these naturally occurring
tumours in dogs, in the present study we screened 13 canine
fibrosarcomas, 2 feline fibrosarcomas and 11 canine melanomas
for point mutations, particularly within the mutational hot-spots,
making this the first study to investigate a large number of canine
fibrosarcomas. None of the samples showed a K- or N-ras hot
spot mutation. Thus, our data strongly suggest that ras mutations
at the hot-spot loci are very rare and do not play a major role in
the pathogenesis of the spontaneously occurring canine tumours
investigated.
Dogs and humans often share the same genetic pathways in
the development of cancer, as has been described in the
literature. Point mutations affecting genes of the ras- family
are assumed to be among the most important alterations in
human tumourigenesis (1). Ras proteins play an important role
as signal transmitters. The binding of growth factors activates
the ras protein and thus initiates cell division. Mutations in ras
genes are assumed to lead to enduring activation of pathways
that stimulate cell growth, which results in uncontrolled cell
division (2). Especially mutations in K-ras have been described
in human pancreatic cancers and tumours of the gastrointestinal tract, as well as in tumours of the skin (3-5). K-ras
screening for hot-spot point mutations in dogs has been
described in different types of lung cancer, pancreatic cancer
Correspondence to: Dr. J. Bullerdiek, Centre for Human Genetics,
University of Bremen, Leobener Strasse ZHG, 28359 Bremen,
Germany. Tel: +49-421-218 4239, Fax: +49-421-218 4239, e-mail:
[email protected]
Key Words: Canis familiaris, fibrosarcoma, hot-spot mutations,
melanoma, ras genes.
0250-7005/2004 $2.00+.40
and breast cancer (6-12), showing that the canine gene is also
affected by the typical ras mutations observed in humans but at
a much lower ratio.
Guerrero et al. (13) were able to induce fibrosarcomas in
nude mice by subcutaneously injecting transfected fibroblasts
with K-ras point mutations affecting codon 12. So far little is
known about ras mutations in canine fibrosarcomas. Just one
report of a ras mutation screening including three canine
fibrosarcoma samples has been described (11). There is also a
lack of studies about K-ras mutations in canine melanomas are
missing. In canine melanomas virtually no hot-spot N-ras
mutations were described with one exception: Mayr et al. (14)
found 2 out of 16 melanomas to be affected by mutations in
codon 61.
In the present study, we screened 13 canine fibrosarcomas,
2 feline fibrosarcomas and 11 canine melanomas for point
mutations, particularly within the mutational hot-spot codons
of the K-ras and N-ras genes, to analyze whether these changes
could be detected in these naturally occurring tumours.
Materials and Methods
The tissues used in this study were provided by the Small Animal
Clinic, School of Veterinary Medicine, Hanover, Germany. Thirteen
canine fibrosarcoma, 2 feline fibrosarcoma and 11 canine melanoma
samples were taken and used for analyses. The breeds represented
were German Shorthaired Pointer, Irish Terrier, Fox Terrier,
Schnauzer, Kuvasz, Berger de Brie, German Shepherd, Standard
Poodle, Irish Red Setter, Rottweiler, Cairn Terrier, Beagle and canine
and feline crossbreed.
The DNA of the twenty-six canine and feline fibrosarcoma and
melanoma samples (10 - 25 mg each) was isolated using QIAamp
DNA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s
tissue protocol. The two feline samples served as internal controls,
since they show specific point mutations compared to dogs (15). The
PCRs for the screening of the hot-spot exons were performed using
the following primer pairs. K-ras: primer pair KEx1up / KEx1lo (5’
cgatataaggcctgctgaaa 3’ / 5’ tgtaggatcatattcatcca 3’) and primer pair
KEx2up / KEx2lo (5’ caggattcctacaggaaaca 3’ / 5’ aacccacctataatggtgaa
3’). N-ras: primer pair NEx1up / NEx1lo (5’ gactgagtacaaactggtgg 3’ /
5’ gggcctcacctctatggtg 3’) and primer pair NEx2up / NEx2lo (5’
tcttaccgaaaacaggtggttatag 3’ / 5’ gtcctcatgtattggtctctcatggcac3’). The
PCR products were directly sequenced in the forward and reverse
3
ANTICANCER RESEARCH 24: xxx-xxx (2004)
Table I. Detected gene base substitutions in N-ras exon 1 und K-ras exons
1 and 2.
Gene /Exon Sample Codon Substitution
Amino Acid Exchange
K-ras Exon 1
K-ras Exon 2
No AA exchange (Leu)
Leu→Stop
Gln→Leu
Gly→Glu
Gly→Glu
Gln→Leu
N-ras Exon 1
3
3
13
14
3
24
23
53
70
48
10
22
CTA→TTA
TTG→TAG
CAG→CTG
GGA→GAA
GGA→GAA
CAG→CTG
direction and additionally cloned in pGEM-T Easy Vector System
(Promega, Madison, USA) and sequenced once more. The DNA
sequences and the homology alignments were created with various
sequences from the NCBI database (accession numbers CFU62093,
X02751, U62094, S42999, M54968, S64261). In case of single
nucleotide exchanges being present, the procedures were repeated for
verification.
Results
Four of the twenty-six analysed samples showed nucleotide
exchanges in the screened canine exons. None of the exchanges
found affected the ras hot-spot codons 12, 13 and 61. One
fibrosarcoma sample (Berger de Brie) showed three changes
affecting K-ras exon 1 codon 23 (CTA→TTA, no amino acid
exchange), exon 2 codon 53 (TTG→TAG, Leu→stop codon)
and N-ras exon 1 codon 10 (GGA→GAA, Gly→Glu). Two
other fibrosarcomas (Kuvasz and Poodle) each showed one
nucleotide exchange in K-ras exon 2 affecting codon 48
(GGA→GAA, Gly→Glu) and codon 70 (CAG→CTG,
Gln→Leu), respectively. N-ras exon 1 codon 22 (CAG→CTG,
Gln→Leu) was affected in a melanoma sample (crossbreed)
(Table I). The screening of N-ras exon 2 revealed no
nucleotide exchanges among the canine sequences. The
described nucleotide differences between the canine and feline
sequences (15) in N-ras exon 2 and K-ras exon 2 were detected.
Discussion
Our data strongly suggest that K- and N-ras mutations at the
hot-spot loci are very rare and do not play a major role in the
pathogenesis of the spontaneously occurring canine tumours
investigated. These results are in accordance with the sparse
data available for canine melanomas (twenty-four samples) and
fibrosarcomas (three samples) (11, 14). In both studies a total of
three mutations at the hot-spot codons could be detected.
Compared to the data obtained from different studies in
humans that show up to 30% of lung tumours, 90% of
pancreatic tumours and 50% of tumours of the gastrointestinal
tract to be affected by specific point mutations in the ras gene
hot-spot codons (16, 17), the data seen in dogs apparently
indicate that ras mutations do not play a major role in the
pathogenesis of these spontaneously occurring canine tumours.
4
References
1 Arber N: Janus faces of ras: anti or pro-apoptotic? Apoptosis 4(5):
383-388, 1999.
2 Park M: Genetic abnormalities of cell growth, In: Scriver et al: The
Metabolic and Molecular Basis of Inherited Disease, 7 edn. New
York: McGraw-Hill; 1995.
3 Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N and
Perucho M: Most human carcinomas of the exocrine pancreas
contain mutant c-K-ras genes. Cell 53(4): 549-554, 1988.
4 Belly RT, Rosenblatt JD, Steinmann M, Toner J, Sun J, Shehadi J,
Peacock JL, Raubertas RF, Jani N and Ryan CK: Detection of
mutated K12-ras in histologically negative lymph nodes as an
indicator of poor prognosis in stage II colorectal cancer. Clin
Colorectal Cancer 1(2): 110-116, 2001.
5 Shukla VK, Hughes DC, Hughes LE, McCormick F and Padua
RA: ras mutations in human melanotic lesions: K-ras activation is
a frequent and early event in melanoma development. Oncogene
Res 5(2): 121-127, 1989.
6 Kraegel SA, Gumerlock PH, Dungworth DL, Oreffo VI and
Madewell BR: K-ras activation in non-small cell lung cancer in the
dog. Cancer Res 52(17): 4724-4727, 1992.
7 Castagnaro M: [Ras gene analysis in mammary tumors of dogs by
means of PCR-SSCP and direct genomic analysis]. Ann Ist Super
Sanita 31(3): 337-341, 1995.
8 Tierney LA, Hahn FF and Lechner JF: p53, erbB-2 and K-ras gene
alterations are rare in spontaneous and plutonium-239-induced
canine lung neoplasia. Radiat Res 145(2): 181-187, 1996.
9 Griffey SM, Kraegel SA and Madewell BR: Rapid detection of Kras gene mutations in canine lung cancer using single-strand
conformational polymorphism analysis. Carcinogenesis 19(6): 959963, 1998.
10 Griffey SM, Kraegel SA, Weller RE, Watson CR and Madewell
BR: K-ras mutations in 239PuO2 canine lung neoplasms. Cancer
Lett 132(1-2): 1-5, 1998.
11 Watzinger F, Mayr B, Gamerith R, Vetter C and Lion T:
Comparative analysis of ras proto-oncogene mutations in selected
mammalian tumors. Mol Carcinog 2001, 30(4):190-198.
12 Mayr B, Schaffner G, Reifinger M: K-ras mutations in canine
pancreatic cancers. Vet Rec 153(3): 87-89, 2003.
13 Guerrero S, Figueras A, Casanova I, Farre L, Lloveras B, Capella
G, Trias M and Mangues R: Codon 12 and codon 13 mutations at
the K-ras gene induce different soft tissue sarcoma types in nude
mice. Faseb J 16(12): 1642-1644, 2002.
14 Mayr B, Schaffner G, Reifinger M, Zwetkoff S and Prodinger B:
N-ras mutations in canine malignant melanomas. Vet J 165(2):
169-171, 2003.
15 Watzinger F, Mayr B, Haring E and Lion T: High sequence
similarity within ras exons 1 and 2 in different mammalian species
and phylogenetic divergence of the ras gene family. Mamm
Genome 9(3): 214-219, 1998.
16 Knapp DW and Waters DJ: Naturally occurring cancer in pet
dogs: important models for developing improved cancer therapy
for humans. Mol Med Today 3(1): 8-11, 1997.
17 Bos JL: ras oncogenes in human cancer: a review. Cancer Res
49(17): 4682-4689, 1989.
Received March 22, 2004
Accepted June 14, 2004
XI.
Ras gene hot-spot mutations in canine neoplasias
Richter A, Murua Escobar H, Gunther K, Soller JT, Winkler S, Nolte
I,. Bullerdiek J.
J Hered. 2005 Nov-Dec;96(7):764-5.
Eigenanteil:
• Erstellen der caninen Gewebebank
Journal of Heredity 2005:96(7):764–765
doi:10.1093/jhered/esi121
Advance Access publication October 26, 2005
ª The American Genetic Association. 2005. All rights reserved.
For permissions, please email: [email protected].
RAS Gene Hot-Spot Mutations in
Canine Neoplasias
A. RICHTER, H. MURUA ESCOBAR, K. GÜNTHER, J. T. SOLLER, S. WINKLER, I. NOLTE,
J. BULLERDIEK
AND
From the Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen, Germany
(Richter, Murua Escobar, Günther, Soller, Winkler, and Bullerdiek); and Small Animal Clinic, School of Veterinary Medicine,
Bischofsholer Damm 15, 30173 Hanover, Germany (Murua Escobar and Nolte).
Address correspondence to Dr. Jörn Bullerdiek at the address above, or e-mail: [email protected].
Abstract
Point mutations in the cellular homologues HRAS, KRAS2, and NRAS of the viral Harvey and Kirsten rat sarcoma virus
oncogenes are commonly involved in the onset of malignancies in humans and other species such as dog, mouse, and rat. Most
often, three particular hot-spot codons are affected, with one amino acid exchange being sufficient for the induction of tumor
growth. While RAS genes have been shown to play an important role in canine tumors such as non-small lung cell carcinomas,
data about RAS mutations in canine fibrosarcomas as well as KRAS2 mutations in canine melanomas is sparse. To increase the
number of tumors examined, we recently screened 13 canine fibrosarcomas and 11 canine melanomas for point mutations,
particularly within the mutational hot spots. The results were compared to the already existing data from other studies about
these tumors in dogs.
A family of genes often involved in human tumors are the
well-characterized RAS genes, which comprise HRAS,
KRAS2, and NRAS, coding for closely related, small, 189
amino acid, 21 kDa, membrane-bound, intracellular proteins.
The human cellular HRAS and KRAS2 genes were identified
to be homologues of the Harvey and Kirsten rat sarcoma
virus oncogenes v-Ha-ras and v-Ki-ras2, respectively (Der
et al. 1982; Parada et al. 1982), with NRAS being only weakly
homologous to both v-Ha-ras and v-Ki-ras2 (a v-N-ras gene has
not been described) (Shimizu et al. 1983). Ras genes have
been found in a variety of mammals, showing high sequence
similarity across species, with sequence variation most often
not affecting the amino acid sequence of the encoded proteins (Watzinger et al. 1998).
The RAS proteins function in relaying mitogenic growth
signals into the cytoplasm and nucleus, influencing proliferation, differentiation, transformation, and apoptosis of cells
(Watzinger and Lion 1999). Regulation of RAS protein activity
occurs through intrinsic GTPase activity in the wild-type RAS,
which switches the protein from an active (guanosine triphosphate [GTP]-bound) to an inactive (guanosine diphosphate
[GDP]-bound) state. Point mutations in a number of particular hot-spot codons in exon 1 (mostly codons 12 and 13) and
exon 2 (mostly codon 61) lead to diminished GTPase activity,
bringing about constant signal transduction and facilitating
uncontrolled cell division and tumor growth (Park 1995).
764
Alterations in RAS genes are among the most important
incidents in the onset of malignancies in humans (Arber
1999; Hahn et al. 1994), and have been described in dog,
mouse, and rat, among others. Studies indicate that in man,
up to 13% of brain tumors, 30% of lung tumors, 30% of liver
tumors, 30% of acute myelogenous leukemia, 53% of follicular
and 60% of undifferentiated papillary thyroid tumors, 50% of
tumors of the gastrointestinal tract, and 90% of pancreatic
tumors are affected by a mutation in the hot-spot codons
of one of the three known RAS genes (Bos 1989; Knapp
and Waters 1997; Spandidos et al. 2002; Tang et al. 2002).
Studies about the involvement of RAS genes in canine
tumors have been performed by a number of groups investigating several types of tumors. Gumerlock et al. (1989) described the formation of activated NRAS through the
substitution of glycine by aspartartic acid at position 12 of
the protein in a case of a gamma radiation-induced canine
acute nonlymphocytic leukemia.
KRAS2 activation was observed in non-small cell lung
cancer of the dog (Kraegel et al. 1992). Out of 21 tumors,
which included adenocarcinomas, adenosquamous carcinomas, and one large cell carcinoma, 5 were shown to be affected by mutations mostly of codon 12 of the KRAS2
gene, being similar to the overall frequency of KRAS2 involvement in non-small cell lung cancer in man (25%). This
was confirmed by a later study investigating a wide range of
Richter et al. RAS Gene Hot-Spot Mutations in Canine Neoplasias
canine lung tumors where 19 out of 117 tumors (16%) showed
KRAS2 alterations in the hot-spot codons (Griffey et al. 1998).
On the other hand, NRAS was shown to be infrequently
activated in canine malignant lymphomas, with only 1 from
28 examined cases showing an amino acid substitution from
glycine to aspartate at position 13 (Edwards et al. 1993).
Similar to malignant lymphomas, RAS gene mutations at
the hot-spot loci were shown to be rarely or not involved in
canine mammary tumors (Castagnaro 1995; Mayr et al. 1998).
Furthermore, Watzinger et al. (1998) have shown in a variety of
canine tumors that RAS genes are, compared to humans, rather
infrequently involved in the onset of malignancies. In that
study, only three fibrosarcomas were included, none of which
showed RAS gene alterations. Since Guerrero et al. (2002)
showed that fibrosarcomas can be induced in nude mice by
subcutaneously injecting transfected fibroblasts with KRAS2
point mutations in codon 12, we recently screened a larger
number of 13 canine fibrosarcomas for KRAS2 and NRAS
mutations in the particular hot-spot codons. In addition, we
also recently screened 11 canine melanomas for KRAS2 and
NRAS mutations (Murua Escobar et al. 2004). However, none
of the screened tumors showed the characteristic RAS alterations in the hot-spot codons. A low rate of NRAS involvement in canine melanomas has been shown before, with 2 of
16 tumors showing NRAS mutations (Mayr et al. 2003).
In summary, the data from the available studies on canine
fibrosarcomas and melanomas (Mayr et al. 2003; Murua
Escobar et al. 2004; Watzinger et al. 2001) strongly indicate
that KRAS2 and NRAS mutations at the hot-spot loci are
essentially very rare in the investigated canine tumor entities.
To the best of our knowledge, from the total number of 32
screened canine fibrosarcomas and 17 screened canine melanomas, only 2 melanoma samples have been found to have
exon 61 of the NRAS gene affected. For KRAS2, no mutations in the hot-spot codons have been found. However, to
allow for a comparison of these canine tumors with research
results from, for example, man and mouse, with vast amounts
of data being available, a larger number of canine tumors will
have to be screened in the future, as it is still too early to draw
conclusions from the relatively small number of canine
tumors examined.
genes of Harvey and Kirsten sarcoma viruses. Proc Natl Acad Sci USA
79:3637–3640.
Edwards MD, Pazzi KA, Gumerlock PH, and Madewell BR, 1993. c-N-ras is
activated infrequently in canine malignant lymphoma. Toxicol Pathol
21:288–291.
Griffey SM, Kraegel SA, and Madewell BR, 1998. Rapid detection of K-ras
gene mutations in canine lung cancer using single-strand conformational
polymorphism analysis. Carcinogenesis 19:959–963.
Guerrero S, Figueras A, Casanova I, Farre L, Lloveras B, Capella G, Trias M,
and Mangues R, 2002. Codon 12 and codon 13 mutations at the K-ras gene
induce different soft tissue sarcoma types in nude mice. FASEB J 16:
1642–1644.
Gumerlock PH, Meyers FJ, Foster BA, Kawakami TG, and deVere White
RW, 1989. Activated c-N-ras in radiation-induced acute nonlymphocytic
leukemia: twelfth codon aspartic acid. Radiat Res 117:198–206.
Hahn KA, Bravo L, Adams WH, and Frazier DL, 1994. Naturally occurring
tumors in dogs as comparative models for cancer therapy research. In Vivo
8:133–143.
Knapp DW and Waters DJ, 1997. Naturally occurring cancer in pet dogs:
important models for developing improved cancer therapy for humans.
Mol Med Today 3:8–11.
Kraegel SA, Gumerlock PH, Dungworth DL, Oreffo VI, and Madewell BR,
1992. K-ras activation in non-small cell lung cancer in the dog. Cancer Res
52:4724–4727.
Mayr B, Dressler A, Reifinger M, and Feil C, 1998. Cytogenetic alterations in
eight mammary tumors and tumor-suppressor gene p53 mutation in one
mammary tumor from dogs. Am J Vet Res 59:69–78.
Mayr B, Schaffner G, Reifinger M, Zwetkoff S, and Prodinger B, 2003.
N-ras mutations in canine malignant melanomas. Vet J 165:169–171.
Murua Escobar H, Gunther K, Richter A, Soller JT, Winkler S, Nolte I,
and Bullerdiek J, 2004. Absence of ras-gene hot-spot mutations in canine
fibrosarcomas and melanomas. Anticancer Res 24:3027–3028.
Parada LF, Tabin CJ, Shih C, and Weinberg RA, 1982. Human EJ bladder
carcinoma oncogene is homologue of Harvey sarcoma virus ras gene. Nature
297:474–478.
Park M, 1995. Genetic abnormalities of cell growth. In: The metabolic and
molecular basis of inherited disease, 7th ed (Scriver CR, Beaudet AL, Sly WS,
and Valle D, eds). New York: McGraw-Hill.
Shimizu K, Goldfarb M, Suard Y, Perucho M, Li Y, Kamata T, Feramisco J,
Stavnezer E, Fogh J, and Wigler MH, 1983. Three human transforming
genes are related to the viral ras oncogenes. Proc Natl Acad Sci USA 80:
2112–2116.
Acknowledgments
Spandidos DA, Sourvinos G, Tsatsanis C, and Zafiropoulos A, 2002. Normal
ras genes: their onco-suppressor and pro-apoptotic functions (review). Int
J Oncol 21:237–241.
This article was presented at the 2nd International Conference on the
‘‘Advances in Canine and Feline Genomics: Comparative Genome Anatomy
and Genetic Disease,’’ Universiteit Utrecht, Utrecht, The Netherlands,
October 14–16, 2004.
Tang MS, Pfeifer GP, Denissenko MF, Feng Z, Hu W, Pao A, Zheng Y,
Zheng JB, Li H, and Chen JX, 2002. Mapping polycyclic aromatic hydrocarbon and aromatic amine-induced DNA damage in cancer-related genes at the
sequence level. Int J Hyg Environ Health 205:103–113.
References
Watzinger F and Lion T, 1999. RAS family. Atlas of Genetics and Cytogenetics in Oncology and Haematology (last modified March 1999) http://
www.infobiogen.fr/services/chromcancer/Deep/ras.html.
Arber N, 1999. Janus faces of ras: anti or pro-apoptotic? Apoptosis 4:383–388.
Bos JL, 1989. Ras oncogenes in human cancer: a review. Cancer Res
49:4682–4689.
Watzinger F, Mayr B, Gamerith R, Vetter C, and Lion T, 2001. Comparative
analysis of ras proto-oncogene mutations in selected mammalian tumors.
Mol Carcinog 30:190–198.
Castagnaro M, 1995. [Ras gene analysis in mammary tumors of dogs by
means of PCR-SSCP and direct genomic analysis]. Ann 1st Super Sanita
31:337–341.
Watzinger F, Mayr B, Haring E, and Lion T, 1998. High sequence similarity
within ras exons 1 and 2 in different mammalian species and phylogenetic
divergence of the ras gene family. Mamm Genome 9:214–219.
Der CJ, Krontiris TG, and Cooper GM, 1982. Transforming genes of
human bladder and lung carcinoma cell lines are homologous to the ras
Corresponding Editor: Elaine Ostrander
765
XII.
Expression pattern of the HMGB1 gene in sarcomas of the dog.
Meyer B, Murua Escobar H, Hauke S, Richter A, Winkler S, Rogalla
P, Flohr AM, Bullerdiek J, Nolte I.
Anticancer Res. 2004 Mar-Apr;24(2B):707-10.
Eigenanteil:
• Erstellen der caninen Gewebebank
ANTICANCER RESEARCH 24: 707-710 (2004)
Expression Pattern of the HMGB1 Gene
in Sarcomas of the Dog
BRITTA MEYER1, HUGO MURUA ESCOBAR2,3, SVEN HAUKE1, ANDREAS RICHTER1,
SUSANNE WINKLER3, PIERE ROGALLA1, ALJOSCHA M. FLOHR3, JÖRN BULLERDIEK3 and INGO NOLTE2
1alcedo
biotech GmbH, Leobener Strasse ZHG, D-28359 Bremen;
for Small Animals, School of Veterinary Medicine, Bischofsholer Damm 15, D-30173 Hannover;
3Center for Human Genetics, University of Bremen, Leobener Strasse ZHG, D-28359 Bremen, Germany
2Clinic
Abstract. Background: The human high mobility group protein
B1 (HMGB1) has attracted considerable interest among
oncologists because it sensitises cancer cells to the anticancer
drug cisplatin by shielding cisplatin-DNA adducts from
nucleotide excision repair. Materials and Methods: Since
cisplatin is the cornerstone of adjuvant systemic therapy for
osteosarcomas, in both humans and dogs, the expression pattern
of the HMGB1 gene in seven canine sarcomas was investigated
by Northern blot analysis and semi-quantitative RT-PCR.
Results: A strong intertumoural variation of HMGB1 expression
was detected by Northern blot analysis and confirmed by the
semi-quantitative RT-PCR established herein. Conclusion: The
observed variations of HMGB1 expression in canine sarcomas
emphasises the role of HMGB1 as a potential marker of clinical
interest as its expression level may predict the clinical outcome of
therapies based on cisplatin. The semi-quantitative RT-PCR
established allows a quick and convenient determination of the
HMGB1 expression level as necessary for clinical applications.
are chromatin-associated non-histone proteins characterised
by low molecular weight, acid-solubility and a high content
of charged amino acids. According to their molecular size,
sequence and DNA binding capacity, three families have
been distinguished: HMGB (formerly HMG1/2), HMGN
(formerly HMG14/17) and HMGA (formerly HMGI(Y))
(2,3). The HMGB family, comprising HMGB1, HMGB2
and HMGB3, is characterised by its two DNA-binding
domains called the "HMG-Box" (4,5).
One of the best analysed members of the group of HMGBox proteins is HMGB1 (synonymously known as HMG1 or
amphoterin). Both DNA-binding domains selectively bind
with a very high affinity to major cisplatin-DNA adducts (68) and interaction between HMGB1 and cisplatin-damaged
DNA contributes to its biological activity, as it sensitises
cancer cells to cisplatin by shielding its major DNA adducts
from nucleotide excision repair (9,10).
Interestingly, HMGB1 gene expression can be induced by
oestrogens in breast cancer cells probably due to an upregulation of the gene, so that HMGB1 itself can be
considered an oestrogen-responsive gene (11). Recently, we
were able to explain this observation by the identification of
two oestrogen responsive elements within the first intron of
HMGB1 (12). He et al. (10) have shown that, in oestrogen
receptor-positive human breast cancer cells, oestrogen can
significantly increase the effect of cisplatin by causing an
overexpression of HMGB1. This finding has led to the
conclusion that oestrogen treatment prior to cisplatin
therapy may sensitise the cancer cells against that drug.
Accordingly, a clinical trial for the treatment of
gynaecological tumours with cisplatin has already been
approved by the Food and Drug Administration (FDA)
(10). On the other hand, the former experiment clearly
shows that the quantitation of the intratumoural HMGB1
expression level may be of high impact for a
cisplatin/carboplatin therapy for two reasons. Firstly, it may
predict the clinical outcome of the therapy; secondly, it may
influence the therapy protocol as, for example, tumours
AR
The related platinum compounds cisplatin and carboplatin
are widely used antitumour drugs for the treatment of a
number of malignancies. The main cytotoxic effect of
cisplatin/carboplatin is the formation of cisplatin/carboplatinDNA adducts characterised by intrastrand cross-links and
significantly bended and distorted DNA.
Gel mobility shift assays revealed a selective affinity of
high mobility group (HMG) proteins for cisplatin-DNA
adducts (1). The recognition of cisplatin damage by HMG
is assumed to mediate cisplatin cytotoxicity. HMG proteins
Correspondence to: Prof. Dr. Ingo Nolte, Clinic for Small Animals,
School of Veterinary Medicine, Bischofsholer Damm 15, D-30173
Hannover, Germany. Tel: +49-511-8567251, Fax: +49-5118567686, e-mail: [email protected]
Key Words: Osteosarcoma, cisplatin, HMGB1 expression, semiquantitative RT-PCR.
0250-7005/2004 $2.00+.40
707
ANTICANCER RESEARCH 24: 707-710 (2004)
Table I. Sarcoma samples analysed in this study.
Sarcoma
sample
OS1
OS2
OS3
OS4
OS5
FS
LMS
1n.r.
Tumour
Osteosarcoma
Osteosarcoma
Osteosarcoma
Osteosarcoma
Osteosarcoma
Fibrosarcoma
Leiomyosarcoma
Breed
Sex
Rottweiler
Crossbreed
German Shepherd
Crossbreed
German Shepherd
Bobtail
Crossbreed
f
f
m
m
m
m
f
Age
1 yr
4 yrs
6 yrs
9 yrs
n.r.1
5 yrs
10 yrs
= not reported
TCTTCCTCCTCCTCCTCATCC 3’). A 445 bp cDNA probe
detecting the 1.3 kb transcript of the canine GAPDH gene was
amplified by PCR with the primer set GAPDH2up (5’
GTGAAGGTCGGAGTCAAC 3’) and GAPDHdog5do (5’
AGGAGGCATTGCTGACAAT 3’). Probes were labelled with 50
ÌCi(·-32P)dCTP (Amersham Biosciences) using the Megaprime
Labelling Kit (Amersham Biosciences) for random-primed
labelling (14). Hybridisation was performed for 3 h at 68ÆC in 10
ml of PerfectHyb Plus Hybridisation Buffer (Sigma-Aldrich, Saint
Louis, USA). The membranes were washed for 5 min with low
stringency at RT in 2x SSC, 0.1% SDS and twice for 20 min with
high stringency at 68ÆC in 0.5x SSC, 0.1% SDS. Signals were
visualised using a Storm PhosphorImager (Molecular Dynamics,
Sunnyvale, USA). Quantitation of the transcripts of HMGB1 and
GAPDH was performed using the software program ImageQuant
(Molecular Dynamics).
showing a high HMGB1 expression level may be treated
with a lower amount of this antitumour drug.
Due to the close similarities of numerous canine diseases
to their human counterparts, the role of the dog as a model
organism for therapeutic approaches is justified.
Furthermore, genes and proteins known to be of high
diagnostic and therapeutic impact in man can also be
considered to play an important role in the dog.
Osteosarcomas and several types of carcinomas belong to
the group of canine malignancies often treated with cisplatin
or carboplatin. So far no data are available analysing the
expression pattern of the HMGB1 gene in canine sarcomas.
Thus, in this study we analysed the HMGB1 expression level
in five canine osteosarcomas, one fibrosarcoma and one
leiomyosarcoma by Northern blot experiments. Based on
the observed strong intertumoural variation of HMGB1
expression, we further established a quick RT-PCR-based
diagnostic system for future studies.
Semi-quantitative RT-PCR. cDNA synthesis was performed using
primer AP2 (5’ AAGGATCCGTCGACATCT(17) 3’) with 500 ng of
mRNA with SuperScript Reverse Transcriptase (Invitrogen,
Karlsruhe, Germany) according to the manufacturer’s instructions. In
order to determine the expression of HMGB1 in relation to that of
the housekeeping gene GAPDH, a duplex PCR was established using
the primer sets ToastUP/Ex5lo and GAPDH2up/GAPDHdog5do
(see above). PCR reactions were set up according to the "basic PCR
protocol" of Taq DNA Polymerase (Invitrogen) using the following
PCR program: initial denaturation for 5 min at 94ÆC, 28 cycles of
denaturation for 30 sec at 94ÆC, primer annealing for 30 sec at 55ÆC
and extension for 45 sec at 72ÆC, followed by a final extension for 10
min at 72ÆC. The appropriate number of cycles was previously
determined so that for both PCR-products amplification was in the
exponential range (data not shown). PCR-products were separated
on a 1.2% agarose gel stained with VistraGreen (Amersham) and
visualised using a Storm PhosphorImager (Molecular Dynamics).
Quantitation of the PCR-fragments of HMGB1 and GAPDH was
performed using the software program ImageQuant (Molecular
Dynamics) measuring pixel intensities.
Materials and Methods
Results
AR
Tissue samples. All canine tumour samples used in this study (Table
I) were provided by the Clinic for Small Animals, Hanover,
Germany. Samples were taken during surgery, immediately frozen
in liquid nitrogen and stored at -80ÆC.
RNA isolation. Total RNA extraction of the canine sarcoma samples
was performed according to the RNeasy midi protocol for isolation
of total RNA from heart, muscle and skin tissue (Qiagen, Hilden,
Germany) including a Proteinase K digest. Enrichment of poly A+
mRNA was carried out using the Oligotex mRNA kit (Qiagen).
Northern blot hybridisation. For Northern blot analysis, 5 Ìg of
mRNA from each sample were separated on a 1.2% denaturing
agarose gel containing 0.65% formaldehyde. RNAs were
transferred onto a Hybond-XL charged nylon membrane
(Amersham Biosciences, Buckinghamshire, England) by capillary
blot overnight. As a probe for hybridisation, a 603 bp cDNA
fragment derived from the ORF (exon 2-5) of the canine HMGB1
gene was generated by PCR using the primer pair ToastUP (5’
GGGCAAAGGAGATCCTAAGAAG 3’) (13) and Ex5lo (5’
708
Northern blot hybridisation on a series of 5 osteosarcomas,
one fibrosarcoma and one leiomyosarcoma sample of the
dog (Table I), using a cDNA probe derived from the ORF
(Exon 2-5) of the canine HMGB1 gene, resulted in the
detection of two HMGB1 mRNA transcripts of
approximately 1.4 and 2.4 kb (Figure 1), which are similar
to that observed in human tissues (15-17) and various
canine tissues (18). In order to quantify the expression of
HMGB1, the blot was rehybridised with a canine GAPDHspecific cDNA probe (Figure 1). Summing up the intensities
of the 1.4 and 2.4 kb HMGB1 signals, the HMGB1-RNA /
GAPDH-RNA ratios were calculated. As shown in Figure 1,
the analysed canine sarcoma samples revealed a strong
intertumoural variation in the relative expression of
HMGB1. Values obtained by Northern blot analysis for the
osteosarcoma samples varied between 0.52 and 1.31, while
the fibrosarcoma and the leiomyosarcoma showed ratios of
0.73 and 0.24, respectively (Table II).
Meyer et al: HMGB1 and Canine Sarcomas
Figure 2. Semi-quantitative duplex RT-PCR products of HMGB1 (603
bp) and GAPDH (445 bp) using canine cDNAs of five osteosarcomas,
one fibrosarcoma and one leiomyosarcoma after electrophoresis and
VistraGreen staining (Amersham Biosciences). Lane 1: DNA molecular
weight standard 1 Kb Plus DNA Ladder (Invitrogen). Lanes 2-6:
osteosarcoma samples 1-5 (OS1-5). Lane 7: fibrosarcoma sample (FS).
Lane 8: leiomyosarcoma sample (LMS). Lane 9: H2O, negative control.
Figure 1. Northern blot analysis of five osteosarcomas (OS1-5), one
fibrosarcoma (FS) and one leiomyosarcoma (LMS) of the dog hybridised
with a HMGB1-specific cDNA probe detecting the two canine HMGB1
transcripts of approximately 1.4 and 2.4 kb (upper part). Co-hybridisation
of the same membrane with a GAPDH-specific cDNA probe detecting a
1.3 kb transcript (lower part).
obtained by the Northern blot hybridisation and RT-PCR
analyses, mean values for each test series were calculated,
set to one, and relative expression levels were determined
(Table II, Figure 3). Statistical analysis using the Pearson’s
Correlation Test revealed a significant correlation between
the relative HMGB1 expression level obtained by Northern
blot hybridisation and the level obtained by the established
RT-PCR (r=0.8919, p=0.0071).
Table II. Absolute and relative HMGB1-mRNA / GAPDH-mRNA ratios.
Discussion
Sarcoma
sample
Absolute HMGB1 /
GAPDH-RNA ratios
RT-PCR
Northern blot
Relative HMGB1 /
GAPDH-RNA ratios1
RT-PCR Northern blot
OS1
OS2
OS3
OS4
OS5
FS
LMS
0.95
0.99
1.02
1.28
0.72
0.73
0.42
0.52
0.79
1.05
1.31
0.60
0.73
0.24
1.09
1.13
1.17
1.47
0.83
0.84
0.48
0.7
1.06
1.41
1.75
0.79
0.97
0.32
Mean value
0.87
0.75
1.0
1.0
1 Calculated with the mean values of the absolute HMGB1 / GAPDHRNA ratios set to one.
In order to confirm the results and to develop a less timeand material-consuming technique, we established a semiquantitative duplex RT-PCR suitable for detecting
intertumoural variation of HMGB1 expression in relation to
expression of the house-keeping gene GAPDH (Figure 2).
After quantitation of the signals obtained by RT-PCR, the
HMGB1-RNA / GAPDH-RNA ratios were calculated. The
values for the osteosarcoma samples varied between 0.72
and 1.28, while the ratios for the fibrosarcoma and the
leiomyosarcoma were 0.73 and 0.42, respectively (Table II).
In order to determine the comparability of the results
Cisplatin and carboplatin are widely used anticancer drugs,
manifesting their cytotoxicity to tumour cells by damaging
DNA, generating a distorted DNA duplex. HMGB1 proteins
selectively bind with high affinity to cisplatin or carboplatinDNA adducts and several investigations revealed that this
interaction contributes to tumour death by blocking excision
repair of the major cisplatin-DNA adducts (9,10).
No features have been identified yet allowing clinicians to
predict the response to cisplatin or carboplatin therapies in
dogs with osteosarcomas at the time of diagnosis or during
treatment (19). Hence, it was the aim of this study to analyse
the expression level of HMGB1 in canine sarcomas.
Based on Northern blot and RT-PCR analyses, we were
able to show an intertumoural variation of HMGB1
expression levels among canine sarcomas. Very recently,
comparable results were obtained for human breast cancer
samples (17,20) and a clinical trial designed to increase
HMGB1 expression by oestrogen treatment has been
approved by the FDA (10). The observed intertumoural
variances of HMGB1 expression in seven sarcomas analysed
in this study may be of importance for therapeutic
approaches based on cisplatin/carboplatin treatment as, for
example, tumours showing a high HMGB1 expression level
may be treated with a lower amount of this antitumour
drug. However, future clinical studies including a greater
number of tumours have to be performed to correlate the
709
ANTICANCER RESEARCH 24: 707-710 (2004)
Figure 3. Variation of relative HMGB1 expression in five osteosarcomas
(OS1-5), one fibrosarcoma (FS) and one leiomyosarcoma (LMS) of the
dog as revealed by Northern blot analysis (dark grey bars) and semiquantitative RT-PCR (light grey bars). In order to compare the results
obtained by the two methods, mean values for each test series were
calculated, set to one and relative expression levels were determined.
HMGB1 expression level with clinical outcome of
cisplatin/carboplatin chemotherapy. The statistically
significant correlation of the relative HMGB1 expression
levels obtained by Northern blot analyses as well as duplex
RT-PCR makes the established PCR approach a quick and
convenient method to determine the intratumoural HMGB1
expression.
References
AR
1 Kartalou M and Essigmann JM: Recognition of cisplatin
adducts by cellular proteins. Mutat Res 478: 1-21, 2001.
2 Bustin M, Lehn DA and Landsman D: Structural features of
the HMG chromosomal proteins and their genes. Biochim
Biophys Acta 1049: 231-243, 1990.
3 Bustin M and Reeves R: High-mobility-group chromosomal
proteins: architectural components that facilitate chromatin
function. Prog Nucleic Acid Res Mol Biol 54: 35-100, 1996.
4 Jantzen HM, Admon A, Bell SP and Tjian R: Nucleolar
transcription factor hUBF contains a DNA-binding motif with
homology to HMG proteins. Nature 344: 830-836, 1990.
5 Landsman D and Bustin M: A signature for the HMG-1 box
DNA-binding proteins. Bioessays 15: 539-546, 1993.
6 Pil PM and Lippard SJ: Specific binding of chromosomal
protein HMG1 to DNA damaged by the anticancer drug
cisplatin. Science 256: 234-237, 1992.
7 Jung Y and Lippard SJ: Nature of full-length HMGB1 binding
to cisplatin-modified DNA. Biochemistry 42: 2664-2671, 2003.
710
8 Kasparkova J, Delalande O, Stros M, Elizondo-Riojas M-A,
Vojtiskova M, Kozelka J and Brabec V: Recognition of DNA
interstrand cross-link of antitumor cisplatin by HMGB1 protein.
Biochemistry 42: 1234-1244, 2003.
9 Zamble DB, Mu D, Reardon JT, Sancar A and Lippard SJ:
Repair of cisplatin-DNA adducts by the mammalian excision
nuclease. Biochemistry 35: 10004-10013, 1996.
10 He Q, Liang CH and Lippard SJ: Steroid hormones induce
HMG1 overexpression and sensitize breast cancer cells to
cisplatin and carboplatin. Proc Natl Acad Sci USA 97: 57685772, 2000.
11 Chau KY, Lam HY and Lee KL: Estrogen treatment induces
elevated expression of HMG1 in MCF-7 cells. Exp Cell Res
241: 269-272, 1998.
12 Borrmann L, Kim I, Schultheiss D, Rogalla P and Bullerdiek J:
Regulation of the expression of HMG1, a co-activator of the
oestrogen receptor. Anticancer Res 21: 301-305, 2001.
13 Jiang Z, Priat C and Galibert F: Traced orthologous amplified
sequence tags (TOASTs) and mammalian comparative maps.
Mamm Genome 9: 577-787, 1998.
14 Feinberg AP and Vogelstein B: A technique for radiolabeling
DNA restriction endonuclease fragments to high specific
activity. Anal Biochem 132: 6-13, 1983.
15 Wen L, Huang JK, Johnson BH and Reeck GR: A human
placental cDNA clone that encodes nonhistone chromosomal
protein HMG-1. Nucleic Acid Res 17: 1197-1214, 1989.
16 Rogalla P, Kazmierczak B, Flohr AM, Hauke S and Bullerdiek
J: Back to the roots of a new exon--the molecular archaeology
of a SP100 splice variant. Genomics 63: 117-122, 2000.
17 Flohr AM, Rogalla P, Meiboom M, Borrmann L, Krohn M,
Thode-Halle B and Bullerdiek J: Variation of HMGB1
expression in breast cancer. Anticancer Res 21: 3881-3885, 2001.
18 Murua Escobar H, Meyer B, Richter A, Becker K, Flohr AM,
Bullerdiek J and Nolte I: Molecular characterization of the
canine HMGB1. Cytogenet Genome Res 101: 33-38, 2003.
19 Hahn KA, Legendre AM and Talbott JR: The frequency of
micronuclei in lymphocytes of dogs with osteosarcomas: a
predictive variable for tumor response during cisplatin
chemotherapy. Cancer Epidemiol Biomakers Prev 5: 653-656,
1996.
20 Brezniceanu M-L, Völp K, Bösse S, Solbach C, Lichter P, Joos
S and Zörnig M: HMGB1 inhibits cell death in yeast and
mammalian cells and is abundantly expressed in human breast
cancer carcinoma. FASEB J 17: 1295-1297, 2003.
Received July 9, 2003
Revised November 4, 2003
Accepted December 12, 2003
XIII.
The canine HMGA1
Murua Escobar H, Soller JT, Richter A, Meyer B, Winkler S, Flohr
AM, Nolte I, Bullerdiek J.
Gene. 2004 Apr 14;330:93-9.
Eigenanteil:
• Erstellen der caninen Gewebebank
Gene 330 (2004) 93 – 99
www.elsevier.com/locate/gene
The canine HMGA1
Hugo Murua Escobar a,b, Jan T. Soller a, Andreas Richter a, Britta Meyer a, Susanne Winkler a,
Aljoscha M. Flohr a, Ingo Nolte b, Jörn Bullerdiek a,*
b
a
Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, D-28359 Bremen, Germany
Small Animal Clinic, School of Veterinary Medicine, Bischofsholer Damm 15, D-30173 Hanover, Germany
Received 28 October 2003; received in revised form 19 December 2003; accepted 15 January 2004
Received by D.A. Tagle
Abstract
Due to the emerging advantages of numerous canine diseases as a genetic model for their human orthologs, the dog could join the mouse
as the species of choice to unravel genetic mechanisms, e.g. of cancer predisposition, development and progression. However, precondition
for such studies is the characterisation of the corresponding canine genes.
Human and murine HMGA1 non-histone proteins participate in a wide variety of cellular processes including regulation of inducible gene
transcription, integration of retroviruses into chromosomes, and the induction of neoplastic transformation and promotion of metastatic
progression of cancer cells.
Chromosomal aberrations affecting the human HMGA1 gene at 6p21 were described in several tumours like pulmonary chondroid
hamartomas, uterine leiomyomas, follicular thyroid adenomas and others. Over-expression of the proteins of HMGA1 is characteristic for
various malignant tumours suggesting a relation between high titer of the protein and the neoplastic phenotype.
In this study, we characterised the molecular structure of the canine HMGA1 cDNA, its splice variants and predicted proteins HMGA1a
and HMGA1b. Furthermore, we compared the coding sequence(s) (CDS) of both splice variants for 12 different breeds, screened them for
single nucleotide polymorphisms (SNPs) and characterised a basic expression pattern.
D 2004 Elsevier B.V. All rights reserved.
Keywords: High mobility group proteins; HMGA1; HMGA1a; HMGA1b; Comparative genomics
1. Introduction
As witnessed by a number of recent articles (Kuska,
1996; Kingman, 2000; Ostrander et al., 2000; Vail and
Abbreviations: A, adenosine; aa, amino acid(s); BAC, bacterial
artificial chromosome; bp, base pair(s); cDNA, DNA complementary to
RNA; CDS, coding sequence(s); CFA, Canis familiaris; Ci, Curie; D,
Dalton; dCTP, deoxycytidine 5V-triphosphate; DNA, deoxy-ribonucleic
acid; DNase, deoxyribonuclease; G, guanosine; GAPDH, glyceraldehyde3-phosphate dehydrogenase; HMG, high mobility group; HMGA1, high
mobility group protein A1; HMGA2, high mobility group protein A2;
HSA, Homo sapiens; M-MLV, Moloney murine leukemia virus; mRNA,
messenger ribonucleic acid; NCBI, National Center for Biotechnology
Information; ORF, open reading frame; PCR, polymerase chain reaction;
RACE, rapid amplification of cDNA ends; RNA, ribonucleic acid; SDS,
sodium dodecyl sulfate; SNP, single nucleotide polymorphism; UTR,
untranslated region.
* Corresponding author. Tel.: +49-421-2184239; fax: +49-4212184239.
E-mail address: [email protected] (J. Bullerdiek).
0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2004.01.009
MacEwen, 2000), a growing number of scientists predict
that human genetics will focus on the dog in this century
(Kuska, 1996). Due to the emerging advantages of numerous canine diseases as a genetic model for their human
counterparts, the dog could join the mouse as the species of
choice to unravel genetic mechanisms, e.g. of cancer predisposition, development and progression.
The proteins of the human HMGA1 gene HMGA1a and
HMGA1b are associated with various human diseases
including cancer. Due to the similarities of various human
and canine cancer entities, the characterisation of the canine
HMGA1 gene could open new fields for experimental and
therapeutic approaches.
Four human members of the HMGA protein family
are presently known: the HMGA1a, HMGA1b, HMGA1c
and HMGA2 proteins, which can modify chromatin
structure by bending DNA, thus influencing the transcription of a number of target genes. The human
HMGA1 gene on 6p21 encodes the well characterised
94
H. Murua Escobar et al. / Gene 330 (2004) 93–99
HMGA1a and HMGA1b proteins (formerly known as
HMGI and HMGY) derived by alternative splicing and
the barely characterised HMGA1c variant, while the
HMGA2 protein is encoded by a separate gene on
chromosome 12 (12q14 – 15) (for review, Reeves and
Beckerbauer, 2001).
Expression of HMGA1 is detectable only at very low
levels or is even absent in adult tissues, whereas it is
abundantly expressed in embryonic cells (Chiappetta et
al., 1996). In humans, 6p21 is often affected by aberrations leading to an up-regulation of HMGA1 in benign
mesenchymal tumours, e.g. lipomas, uterine leiomyomas,
pulmonary chondroid hamartomas and endometrial polyps
(Williams et al., 1997; Kazmierczak et al., 1998; Tallini
et al., 2000). Transcriptional activation due to a chromosomal alteration of HMGA1 is probably an early and
often even primary event of cancer development. In
contrast, HMGA1 expression in malignant epithelial
tumours seems to be a rather late event associated with
an aggressive behaviour of the tumours. Thus, an overexpression of HMGA1 was reported for a number of
malignancies including thyroid, prostatic, pancreatic, cervical and colorectal cancer (Tamimi et al., 1993; Chiappetta et al., 1995, 1998; Fedele et al., 1996; Bandiera et
al., 1998; Abe et al., 1999, 2000). The correlation
between HMGA expression and tumour aggressiveness
in these malignancies has led to the conclusion that
HMGA expression may present a powerful prognostic
molecular marker. The causal role of HMGA1 expression
in the progression of carcinomas has been elucidated by a
set of in vitro experiments involving HMGA1 sense and
antisense transfection assays (Reeves et al., 2001). An
experimental approach aimed at the down-regulation of
HMGA protein in tumours has been presented by Scala et
al. (2000) who were able to show that an HMGA1
antisense strategy using an adenoviral vector treatment
of tumours induced in athymic mice caused a drastic
reduction in tumour size.
Recently, the canine HMGA1 gene has been mapped to
CFA 23. This cytogenetic assignment indicates that the
canine HMGA1 gene does not map to a hotspot of
chromosomal breakpoints seen in canine tumours (Becker
et al., 2003). However, despite the emerging role of
HMGA1 gene expression in malignancies, the molecular
characterisation of the canine HMGA1 gene had not been
carried out before. The characterisation of the molecular
structure could permit new therapeutic approaches using
the dog as model organism.
In this study, we characterised the molecular structure
of the canine HMGA1 gene on cDNA level, its splice
variants and proteins HMGA1a and HMGA1b, and a basic
expression pattern. Furthermore, for 12 different canine
breeds the coding sequence(s) (CDS) of both splice variants were characterised and screened for SNPs to find out
if changes at protein level exist between the different
breeds.
2. Materials and methods
2.1. Tissues
The tissues used in this study were provided by the Small
Animal Clinic, Veterinary School, Hanover, Germany. The
breeds represented were Alsatian, Bull Terrier, Collie,
Dachshund, Doberman Pinscher, German Shorthaired Pointer, Golden Retriever, Jack Russell Terrier, Kangal, Munsterland, West Highland Terrier and Yorkshire Terrier. From
each breed up to three samples of testis tissue were taken
and used for analyses.
2.2. cDNA characterisation
Total RNA was isolated from 150 mg canine testis tissue
using TRIZOL LS (Invitrogen, Karlsruhe, Germany) following the manufacturer’s protocol. To avoid genomic
DNA contamination a DNase digest of each sample was
performed using DNA-free (Ambion, Huntingdon, Cambridgeshire, UK). cDNA was synthesised using 3V-RACE
adaptor primer AP2 (AAGGATCCGTCGACATC(17)T), 5
Ag total RNA and M-MLV (Invitrogen) reverse transcriptase according to the manufacturer’s instructions. The
polymerase chain reactions (PCRs) for the molecular cloning of the cDNA were done using the primer pairs Ex1up
and Ex8lo (5V GCTCTTTTTAAGCTCCCCTGA 3V/5V
CTGTCCAGTCCCAGAAGGAA 3V) and primer pair
Ex8up and 3VUTRlo (5V AGGGCATCTCGCAGGAGTC
3V/5V ATTCAAGTAACTGCAAATAGGA 3V) which were
derived from human cDNA sequences (accession no.
X14957). The PCR products were separated on a 1.5%
agarose gel, recovered with QIAEX II (QIAGEN, Hilden,
Germany), cloned in pGEM-T Easy vector system (Promega, Madison, USA) and sequenced. The cDNA contig and
the homology alignments were created with Lasergene
software (DNAStar, Madison, USA) and various sequences
from the NCBI database (GenBank accession nos. X14957,
X14958, NM _ 002131, NM _ 145899, NM _ 145900,
NM_145901, NM_145902, NM_145903, NM_145904,
NM_145905).
2.3. Characterisation of splice variants
The splice variants HMGA1a and HMGA1b were
detected by amplifying a fragment spanning the CDS with
primer pair Up (5V CATCCCAGCCATCACTC 3V) and Lo
(5V GCGGCTGGTGTGCTGTGTAGTGTG 3V) using the
canine testis cDNA samples as template. The primer pair
was designed using the cDNA cloned as described in
Section 2.2. The obtained PCR products were separated
on a 4.0% agarose gel, recovered with QIAEX II (QIAGEN), cloned in pGEM-T Easy vector system (Promega)
and sequenced. The contigs and the homology alignments
were created with two sequences from the NCBI database
(GenBank accession nos. X14957, X14958).
H. Murua Escobar et al. / Gene 330 (2004) 93–99
2.4. CDS comparison between breeds
The CDS of both splice variants were characterised for
all breeds as described previously in Section 2.3. The
contigs and the homology alignments were created using
two sequences from the NCBI database (GenBank accession
nos. X14957, X14958). In case of single nucleotide
exchanges, the samples were sequenced again in both
forward and reverse direction. Exchanges causing no amino
acid (aa) substitution were not taken into account for further
analyses. For all samples with aa substitutions the initial
PCR was repeated and the exchange verified by sequencing
the product in both forward and reverse direction. If
possible, a restriction enzyme digestion was performed
additionally.
2.5. Protein sequences
The canine HMGA1a and HMGA1b protein sequences
were derived from the open reading frames (ORFs) of the
characterised cDNA sequences described previously in
Section 2.2. The protein homology alignments were created
with two sequences from the NCBI database (GenBank
accession nos. X14957, X14958).
2.6. Northern blot
Total RNAs were isolated from canine heart, lung,
muscle, kidney and spleen tissue using RNeasy system
(QIAGEN). An additional sample of total RNA was isolated
from canine heart tissue by TRIZOL LS acid guanidine
isothiocyanate – chloroform method (Invitrogen) in order to
figure out whether this isolation method would lead to any
difference in hybridisation. Further on poly A RNA was
purified from canine spleen total RNA with OLIGOTEX
(QIAGEN) and total RNA was prepared from human
cultured fibroblasts by RNeasy system (QIAGEN). Spleen
poly A RNA was placed on the blot in case that HMGA1
was not detectable in the total RNA samples.
For Northern Blot hybridisation, 20 Ag of total RNA
from each sample with the exception of 10 Ag of muscle and
3.6 Ag of spleen poly A RNA were separated on a 1.2%
denaturing agarose gel containing 0.65% formaldehyde.
RNAs were transferred onto Hybond-N+ positive nylon
membrane (Amersham Pharmacia Biotech, Freiburg, Germany) by capillary blot.
A 489-bp cDNA fragment derived from the canine
HMGA1a sequence (exon 5/exon 8) served as a molecular
probe for hybridisation. The probe was generated by PCR
with the primer set Up and Lo (5V CATCCCAGCCATCACTC 3V/5V GCGGCTGGTGTGCTGTGTAGTGTG 3V)
using the cloned cDNA described in Section 2.2. Probe
labelling was performed by random primed labelling (Amersham Pharmacia Biotech) as described in the manufacturer’s
protocol with 50 ACi(a32P)dCTP (Amersham Pharmacia
Biotech). Purification of the labelled probe was performed
95
using Sephadex G-50 Nick Columns (Amersham Pharmacia
Biotech) and the probe was stored at 20 jC before use.
Using the PERFECTHYB PLUS hybridisation solution
(Sigma-Aldrich, Saint Louis, MO, USA) prehybridisation
was carried out for 30 min and hybridisation for 2.5 h at 68
jC. The membrane was washed for 5 min at room temperature in 2SSC/0.1% SDS, and twice for 20 min at 68 jC in
0.5SSC/0.1% SDS. Signals were visualised using a
STORM phosphorimager (Molecular Dynamics, Sunnyvale,
USA).
3. Results and discussion
3.1. The canine HMGA1 cDNA transcripts
For the human HMGA1 gene various transcripts were
described for both splicing variants (HMGA1a and
HMGA1b) that differ in their 5V-UTR. The characterisation
of the canine HMGA1 cDNAs revealed that the complete
canine HMGA1 cDNA spans six exons and codes for two
splicing variants HMGA1a with 1836 bp and HMGA1b with
1803 bp which are similar to the human transcripts
(HMGA1a GenBank accession no. AY366390 and
HMGA1b GenBank accession no. AY366392). The exon
structure, the UTRs and the ORFs of both splice variants
were defined and their homologies to their human counterparts analysed (Fig. 1, Table 1). The splicing variants
showed the ‘‘typical’’ 33 bp gap which is conserved across
various species such as human, mouse, hamster and rat
(GenBank accession nos. BC013455, NM _ 016660,
A7193763, NM_139327, A7511040). The homology of
the canine cDNAs to their human counterparts is 80.6%
for both splice variants. The 5V-UTR, CDS and the 3V-UTR
showed homologies of 95.6%, 95.1% and 74,7%, respectively (Table 1). Homologies of the canine CDS with the
CDS from mouse, hamster and rat on nucleotide level vary
from 90.4% to 93.1%. The cDNA sequences were submitted
to the NCBI database: HMGA1a, GenBank accession no.
AY366390 and HMGA1b, GenBank accession no.
AY366392.
3.2. The canine HMGA1a and HMGA1b proteins
The canine HMGA1a and HMGA1b protein sequences
were deduced from the respective cDNA sequences. The
canine HMGA1a protein is a 107-amino acid molecule with
a calculated weight of 11,674.97 D and HMGA1b a 96amino acid molecule with a calculated weight of 10,677.85
D (Fig. 2). Homology comparison to the human counterparts (GenBank accession nos. P17096, X14957) showed
100% homology of the molecules including the three ‘‘AThooks’’ and the acidic carboxy-terminal domain.
Comparison of the canine and human HMGA1a and
HMGA1b proteins with the described mouse, rat and
hamster molecules showed aa changes in positions 5, 34,
96
H. Murua Escobar et al. / Gene 330 (2004) 93–99
Fig. 1. Structure of the canine HMGA1a and HMGA1b transcripts and partial genomic structure.
69, 75 and 78 of HMGA1a and positions 5, 34, 58, 64 and
67 of HMGA1b, respectively (Fig. 2) (Johnson et al., 1988,
1989; Friedmann et al., 1993; Aldrich et al., 1999; Sgarra et
al., 2000; Strausberg et al., 2002; Sgarra et al., 2003).
According to the definition of the AT-hooks (HMGA1a: I
aa 21 – 31, II aa 53 –63, III aa 78– 89; HMGA1b: I aa 21–
31, II aa 42– 52, III aa 67 – 78) by Reeves and Nissen (1990)
and Reeves (2000), none but the aa exchange at position 78
Table 1
Detailed analysis of the canine HMGA1a and HMGA1b cDNA
Element of canine
HMGA1 cDNAs
Size in bp
Homology to human
counterpart in %
Total cDNA HMGA1a
Total cDNA HMGA1b
5V-UTR
CDS HMGA1a
CDS HMGA1b
3V-UTR
Exon 1
Exon 2
Exon 5 HMGA1a
Exon 5 HMGA1b
Exon 6
Exon 7
Exon 8
1836
1803
231
324
291
1332
94
114
179
146
84
51
1386
80.6
80.6
95.6
95.1
95.1
74.7
97.8
96.5
93.9
93.9
96.4
94.1
75.4
Homology comparison of the cDNA elements of the canine HMGA1 to its
human counterpart (characterisation of the UTRs, the ORF and the exon
sizes).
(HMGA1a) or 67 (HMGA1b), respectively, do affect the
AT-hooks in either species. The exchange at position 78
leads to a difference in the third AT-hook of mouse and
hamster when compared to the other species. According to
the definition of the AT-hooks (HMGA1a: I aa 23– 31, II aa
55– 70, III aa 81– 89; HMGA1b: I aa 23 – 31, II aa 44– 59,
III aa 70 – 78) by Huth et al. (1997), this aa exchange does
not affect the third AT-hook. Following this definition, the
second AT-hook is affected by the aa exchange at position
69 (HMGA1a) or 58 (HMGA1b), respectively.
The canine protein sequences were submitted to the
NCBI database with GenBank accession nos. HMGA1a
AY366390 and HMGA1b AY366392.
Due to the identical structure of the canine HMGA
proteins to the respective human molecule, therapeutic
approaches applied in dogs could be more suitable in terms
of transferability for the development of human therapies
than to approaches tested in other organisms.
3.3. HMGA1a and HMGA1b CDS comparison between
canine breeds
For twelve different canine breeds the splicing variants
HMGA1a and HMGA1b were detected by amplification of a
fragment spanning the CDS using the canine testis cDNA
samples as template. The comparison of the characterised
protein coding sequences for these twelve canine breeds
H. Murua Escobar et al. / Gene 330 (2004) 93–99
97
Fig. 2. Comparison of the canine, human, mouse, rat and hamster HMGA1a and HMGA1b proteins.
revealed one amino acid change in a single breed. Nucleotide exchanges causing no amino acid substitution were not
taken into account in further analyses. Sample 2 (Teckel)
showed in its HMGA1b transcript a nucleotide transition
from A to G at the first base of codon 64 leading to an aa
replacement from threonine to alanine and a new restriction
recognition site for AluI causing four (58, 100, 158 and 176
bp) instead of three fragments (58, 100 and 334 bp) to
appear in an AluI digest. (data not shown). The substitution
was missing in the corresponding HMGA1a transcript of the
dog suggesting a heterozygous genotype. A possible PCR
artifact seems rather unlikely since the nucleotide transition
was verified as described in Section 2.4. The CDS cDNA
sequences of the twelve breeds were submitted to the NCBI
database with GenBank accession nos. AY363606,
AY 3 6 3 6 0 5 , AY 3 6 3 6 0 7 , AY 3 6 3 6 0 4 , AY 3 6 3 6 0 8 ,
AY 3 6 3 6 1 0 , AY 3 6 3 6 0 9 , AY 3 6 3 6 0 0 , AY 3 6 3 6 0 3 ,
AY 3 6 3 5 9 9 , AY 3 6 3 6 0 1 , AY 3 6 3 6 0 2 , AY 3 6 3 9 9 4 ,
AY 3 6 3 9 9 5 , AY 3 6 3 6 11 , AY 3 6 3 9 9 9 , AY 3 6 4 0 0 0 ,
AY 3 6 4 0 0 2 , AY 3 6 4 0 0 1 , AY 3 6 3 9 9 8 , AY 3 6 3 9 9 6 ,
AY363997, AY364003.
probe. Except for the kidney total RNA and one of two
heart samples (Trizol method) all total RNA samples
showed a weak signal of approximately 1.8 kb (Fig. 3,
Trizol sample not shown), while the poly A RNA spleen
sample revealed a distinct signal. After stripping, rehybridisation with a canine GAPDH probe showed signals
corresponding to approximately 1.3 kb in all but the Trizol
method (data not shown) samples, indicating a degradation
of the Trizol-prepared RNA.
In humans, HMGA1 expression in malignant epithelial
tumours seems to be associated with an aggressive behaviour of the tumours. Over-expression of HMGA1 was
reported for a number of malignancies including thyroid,
prostatic, pancreatic, uterus cervical and colorectal cancer
(Tamimi et al., 1993; Chiappetta et al., 1995, 1998; Fedele
et al., 1996; Bandiera et al., 1998; Abe et al., 1999, 2000).
The correlation between HMGA expression and tumour
3.4. Canine HMGA1 expression analysis
Expression of human HMGA1 is detectable at very low
levels or is even absent in adult tissues whereas it is
abundantly expressed in embryonic cells (Chiappetta et
al., 1996). To elucidate a basic HMGA1 gene expression
pattern in dogs, a canine Northern blot was generated
containing total RNA from canine spleen, heart, lung,
muscle and kidney tissue samples. In order to detect a
possible low level expression of HMGA1 as reported in
adult human tissues, a poly A RNA sample from canine
spleen was additionally added to the blot. Hybridisation was
performed with a a32P-labelled canine HMGA1a cDNA
Fig. 3. Northern blot showing 1.8-kb HMGA1 and 1.3-kb GAPDH
transcripts. Lanes: (1) canine kidney total RNA, (2) canine spleen total
RNA, (3) canine spleen poly A RNA, (4) canine heart total RNA, (5) canine
lung total RNA, (6) canine muscle total RNA and (7) human fibroblasts
total RNA.
98
H. Murua Escobar et al. / Gene 330 (2004) 93–99
aggressiveness in some of these malignancies has led to the
conclusion that HMGA expression may present a powerful
prognostic molecular marker.
So far no studies analysing the HMGA1 expression
pattern in canine tumours have been carried out. Since these
tumours occur spontaneously in dogs as well as in humans a
canine in vivo analysing system could have significant value
for research and drug development.
The causal role of HMGA1 expression in the progression
of carcinomas has been elucidated by a set of in vitro
experiments involving HMGA1 sense and antisense transfection assays (Wood et al., 2000a,b; Reeves et al., 2001). A
proof of concept for a therapy aimed at the down-regulation
of HMGA protein in tumours has been presented by Scala et
al. (2000) who were able to show that an HMGA1 antisense
strategy using an adenoviral vector treatment of tumours
induced in athymic mice caused a drastic reduction in
tumour size.
Due to the similarities of human and canine tumours, the
transfer of such experimental approaches could benefit
cancer research in either species.
The comprehension of the canine HMGA1 gene and its
gene products could be the precondition for future new
experimental approaches and for evaluating the canine gene
product as potential target for therapeutic strategies using
the dog as model system.
References
Abe, N., Watanabe, T., Sugiyama, M., Uchimura, H., Chiappetta, G.,
Fusco, A., Atomi, Y., 1999. Determination of high mobility group
I(Y) expression level in colorectal neoplasias: a potential diagnostic
marker. Cancer Res. 59, 1169 – 1174.
Abe, N., Watanabe, T., Masaki, T., Mori, T., Sugiyama, M., Uchimura, H.,
Fujioka, Y., Chiappetta, G., Fusco, A., Atomi, Y., 2000. Pancreatic duct
cell carcinomas express high levels of high mobility group I(Y) proteins. Cancer Res. 60, 3117 – 3122.
Aldrich, T.L., Reeves, R., Lee, C.C., Thomas, J.N., Morris, A.E., 1999.
HMG-I (Y) proteins implicated in amplification of CHO cell DNA.
Unpublished, GenBank Accession No. AF193763.
Bandiera, A., Bonifacio, D., Manfioletti, G., Mantovani, F., Rustighi, A.,
Zanconati, F., Fusco, A., Di Bonito, L., Giancotti, V., 1998. Expression
of HMGI (Y) proteins in squamous intraepithelial and invasive lesions
of the uterine cervix. Cancer Res. 58, 426 – 431.
Becker, K., Escobar, H.M., Richter, A., Meyer, B., Nolte, I., Bullerdiek,
J., 2003. The canine HMGA1 gene maps to CFA 23. Anim. Genet. 34,
68 – 69.
Chiappetta, G., Bandiera, A., Berlingieri, M.T., Visconti, R., Manfioletti,
G., Battista, S., Martinez-Tello, F.J., Santoro, M., Giancotti, V., Fusco,
A., 1995. The expression of the high mobility group HMGI (Y)
proteins correlates with the malignant phenotype of human thyroid
neoplasias. Oncogene 10, 1307 – 1314.
Chiappetta, G., Avantaggiato, V., Visconti, R., Fedele, M., Battista, S.,
Trapasso, F., Merciai, B.M., Fidanza, V., Giancotti, V., Santoro, M.,
Simeone, A., Fusco, A., 1996. High level expression of the HMGI
(Y) gene during embryonic development. Oncogene 13, 2439 – 2446.
Chiappetta, G., Tallini, G., De Biasio, M.C., Manfioletti, G., MartinezTello, F.J., Pentimalli, F., de Nigris, F., Mastro, A., Botti, G., Fedele,
M., Berger, N., Santoro, M., Giancotti, V., Fusco, A., 1998. Detection of
high mobility group I HMGI (Y) protein in the diagnosis of thyroid
tumors: HMGI (Y) expression represents a potential diagnostic indicator of carcinoma. Cancer Res. 58, 4193 – 4198.
Fedele, M., Bandiera, A., Chiappetta, G., Battista, S., Viglietto, G., Manfioletti, G., Casamassimi, A., Santoro, M., Giancotti, V., Fusco, A.,
1996. Human colorectal carcinomas express high levels of high mobility group HMGI (Y) proteins. Cancer Res. 56, 1896 – 1901.
Friedmann, M., Holth, L.T., Zoghbi, H.Y., Reeves, R., 1993. Organization,
inducible-expression and chromosome localization of the human HMGI (Y) nonhistone protein gene. Nucleic Acids Res. 21, 4259 – 4267.
Huth, J.R., Bewley, C.A., Nissen, M.S., Evans, J.N., Reeves, R., Gronenborn, A.M., Clore, G.M., 1997. The solution structure of an HMG-I
(Y)-DNA complex defines a new architectural minor groove binding
motif. Nat. Struct. Biol. 4, 657 – 665.
Johnson, K.R., Lehn, D.A., Elton, T.S., Barr, P.J., Reeves, R., 1988. Complete murine cDNA sequence, genomic structure, and tissue expression
of the high mobility group protein HMG-I (Y). J. Biol. Chem. 263,
18338 – 18342.
Johnson, K.R., Lehn, D.A., Reeves, R., 1989. Alternative processing of
mRNAs encoding mammalian chromosomal high-mobility-group proteins HMG-I and HMG-Y. Mol. Cell. Biol. 9, 2114 – 2123.
Kazmierczak, B., Dal Cin, P., Wanschura, S., Borrmann, L., Fusco, A., Van
den Berghe, H., Bullerdiek, J., 1998. HMGIY is the target of 6p21.3
rearrangements in various benign mesenchymal tumors. Genes Chromosomes Cancer 23, 279 – 285.
Kingman, S., 2000. Painting a brighter future for dogs and humans. Drug
Discov. Today 5, 127 – 128.
Kuska, B., 1996. Sit, DNA, sit: cancer genetics going to the dogs. J. Natl.
Cancer Inst. 91, 204 – 206.
Ostrander, E.A., Galibert, F., Patterson, D.F., 2000. Canine genetics comes
of age. Trends Genet. 16, 117 – 124.
Reeves, R., 2000. Structure and function of the HMGI (Y) family of
architectural transcription factors. Environ. Health Perspect. 108
(Suppl. 5), 803 – 809.
Reeves, R., Beckerbauer, L., 2001. HMGI (Y) proteins: flexible regulators
of transcription and chromatin structure. Biochim. Biophys. Acta 1519,
13 – 29.
Reeves, R., Nissen, M.S., 1990. The A.T-DNA-binding domain of mammalian high mobility group I chromosomal proteins. A novel peptide
motif for recognizing DNA structure. J. Biol. Chem. 265, 8573 – 8582.
Reeves, R., Edberg, D.D., Li, Y., 2001. Architectural transcription factor
HMGI (Y) promotes tumor progression and mesenchymal transition of
human epithelial cells. Mol. Cell. Biol. 21, 575 – 594.
Scala, S., Portella, G., Fedele, M., Chiappetta, G., Fusco, A., 2000. Adenovirus-mediated suppression of HMGI (Y) protein synthesis as potential therapy of human malignant neoplasias. Proc. Natl. Acad. Sci.
U. S. A. 97, 4256 – 4261.
Sgarra, R., Diana, F., Bellarosa, C., Rustighi, A., Toller, M., Manfioletti,
G., Giancotti, V., 2000: Increase of HMGA1a protein methylation is a
distinctive characteristic of tumor cells induced to apoptosis. Unpublished, GenBank Accession No. AF511040.
Sgarra, R., Diana, F., Bellarosa, C., Dekleva, V., Rustighi, A., Toller, M.,
Manfioletti, G., Giancotti, V., 2003. During apoptosis of tumor cells
HMGA1a protein undergoes methylation: identification of the modification site by mass spectrometry. Biochemistry 42, 3575 – 3585.
Strausberg, R.L., et al., 2002. Generation and initial analysis of more than
15,000 full-length human and mouse cDNA sequences. Proc. Natl.
Acad. Sci. U. S. A. 99, 16899 – 16903.
Tallini, G., Vanni, R., Manfioletti, G., Kazmierczak, B., Faa, G., Pauwels,
P., Bullerdiek, J., Giancotti, V., Van Den Berghe, H., Dal Cin, P.,
2000. HMGI-C and HMGI (Y) immunoreactivity correlates with cytogenetic abnormalities in lipomas, pulmonary chondroid hamartomas,
endometrial polyps, and uterine leiomyomas and is compatible with
rearrangement of the HMGI-C and HMGI (Y) genes. Lab. Invest. 80,
359 – 369.
Tamimi, Y., van der Poel, H.G., Denyn, M.M., Umbas, R., Karthaus, H.F.,
Debruyne, F.M., Schalken, J.A., 1993. Increased expression of high
H. Murua Escobar et al. / Gene 330 (2004) 93–99
mobility group protein I(Y) in high grade prostatic cancer determined
by in situ hybridization. Cancer Res. 53, 5512 – 5516.
Vail, D.M., MacEwen, E.G., 2000. Spontaneously occurring tumors of
companion animals as models for human cancer. Cancer Invest. 18,
781 – 792.
Williams, A.J., Powell, W.L., Collins, T., Morton, C.C., 1997. HMGI (Y)
expression in human uterine leiomyomata. Involvement of another
99
high-mobility group architectural factor in a benign neoplasm. Am. J.
Pathol. 150, 911 – 918.
Wood, L.J., Maher, J.F., Bunton, T.E., Resar, L.M., 2000a. The oncogenic
properties of the HMG-I gene family. Cancer Res. 60, 4256 – 4261.
Wood, L.J., Mukherjee, M., Dolde, C.E., Xu, Y., Maher, J.F., Bunton, T.E.,
Williams, J.B., Resar, L.M., 2000b. HMG-I/Y, a new c-Myc target gene
and potential oncogene. Mol. Cell. Biol. 20, 5490 – 5502.
XIV.
"Best Friends" sharing the HMGA1 gene: comparison of the human
and canine HMGA1 to orthologous other species.
Murua Escobar H, Soller JT, Richter A, Meyer B, Winkler S, Bullerdiek J, Nolte I.
J Hered. 2005 Nov-Dec;96(7):777-81.
Eigenanteil:
• Erstellen der caninen Gewebebank
Journal of Heredity 2005:96(7):777–781
doi:10.1093/jhered/esi083
Advance Access publication June 15, 2005
ª The American Genetic Association. 2005. All rights reserved.
For Permissions, please email: [email protected].
‘‘Best Friends’’ Sharing the HMGA1
Gene: Comparison of the Human and
Canine HMGA1 to Orthologous Other
Species
H. MURUA ESCOBAR, J. T. SOLLER, A. RICHTER, B. MEYER, S. WINKLER, J. BULLERDIEK,
AND
I. NOLTE
From the Small Animal Clinic, School of Veterinary Medicine, Bischofsholer Damm 15, 30137 Hanover, Germany
(Murua Escobar, Soller, and Nolte), and Center for Human Genetics, University of Bremen, Leobener Str ZHG,
28359 Bremen, Germany (Meyer, Winkler, Richter, and Bullerdiek).
Address correspondence to Ingo Nolte at the address above, or e-mail: [email protected].
Abstract
HMGA1 nonhistone proteins are reported to participate in various cellular processes including regulation of inducible gene
transcription, integration of retroviruses into chromosomes, and the induction of neoplastic transformation and promotion
of metastatic progression of cancer cells. Overexpression of HMGA1 was shown to be characteristic for various malignant
tumors, suggesting a relation between the neoplastic phenotype and a high titer of the protein. Also chromosomal
aberrations affecting the human HMGA1 gene at 6p21 were described in several tumors, e.g., uterine leiomyomas,
pulmonary chondroid hamartomas, and follicular thyroid adenomas. We characterize the molecular structure of the canine
HMGA1 cDNA, its splice variants, and predicted proteins HMGA1a and HMGA1b. Furthermore, we compared the CDS
of both splice variants for 12 different breeds, screened them for SNPs, characterised a basic expression pattern, and
mapped the gene via FISH. Additionally, we compared the known human, canine, murine, rat, hamster, bovine, pig, Xenopus,
and chicken HMGA1 transcripts.
High mobility group proteins named according to their
characteristic mobility in gel electrophoresis are small
chromatin-associated nonhistone proteins, which can be
subdivided into three families because of their functional
sequence motives: the HMGA (functional motive ‘‘AThook’’), HMGB (functional motive ‘‘HMG-box’’), and
HMGN (functional motive ‘‘nucleosomal binding domain’’)
protein families (for review see Bustin 2001). By binding
DNA with their functional motives, the HMG proteins
induce DNA conformation changes influencing the binding
of various transcription factors and thus taking indirect
influence on transcription regulation as so-called architectural transcription factors (for detail see Bustin and Reeves
1996).
The proteins HMGA1a, HMGA1b, and HMGA2 of the
human HMGA genes are associated with various human
diseases, including cancer. Members of the human HMGA1
protein family presently known are HMGA1a and
HMGA1b, which by modifying chromatin structure take
influence on transcription and up- and down-regulation of
a number of target genes, for example, ATF2, IFN-b, NFjB, Interleukin-2 receptor, E-Selektin, Interleukin-4, Interfeone-A,
ERCC1, and Cyclin A (Chuvpilo et al. 1993; Du and Maniatis
1994; Thanos and Maniatis 1992; Lewis et al. 1994; John
et al. 1995, 1996; Klein-Hessling et al. 1996; Yie et al. 1997;
Borrmann et al. 2003).
The expression pattern of the HMGA genes in human
adult tissues shows only very low levels or even absent
expression, whereas it is abundantly expressed in embryonic
cells (Rogalla et al. 1996; Chiappetta et al. 1996). In humans
the HMGA1 gene is located on HSA 6p21, a region often
affected by aberrations leading to an up-regulation of this
gene in various benign mesenchymal tumors, for example,
endometrial polyps, lipomas, pulmonary chondroid hamartomas, and uterine leiomyomas (Williams et al. 1997;
Kazmierczak et al. 1998; Tallini et al. 2000). This suggests
that transcriptional activation due to these chromosomal
alterations is probably an early and often even primary event
of cancer development. Recently, the canine HMGA1 gene
has been mapped to CFA 23. This cytogenetic assignment
777
Journal of Heredity 2005:96(7)
Figure 1. Species comparison of HMGA1a and HMGA1b transcripts. Exon 5 is enlarged by factor fife for better
visualization.
indicates that the canine HMGA1 gene does not map to
a hotspot of chromosomal breakpoints seen in canine
tumours (Becker et al. 2003).
778
HMGA1 expression in human malignant epithelial
tumors is reported to be associated with an aggressive
behavior of the tumors. Overexpression of HMGA1 was
Murua Escobar et al. Human and Canine HMGA1 Gene
detected in a number of malignancies, including thyroid,
prostatic, pancreatic, uterine cervical, and colorectal cancer
(Tamimi et al. 1993; Chiappetta et al. 1995; Fedele et al. 1996;
Bandiera et al. 1998; Abe et al. 1999, 2000; Czyz et al. 2004;
Takaha et al. 2004). The correlation between HMGA expression and tumor aggressiveness in some of these malignancies
has led to the conclusion that HMGA expression may present a powerful diagnostic and prognostic molecular marker.
Due to the similarities of various human and canine
cancer entities, the characterization of the canine HMGA
genes could open new fields for experimental and
therapeutic approaches. We recently characterized the canine
HMGA1a and HMGA1b transcripts, deduced their proteins,
evaluated them as targets for therapeutic approaches, and
characterized a basic expression pattern in healthy tissues
(Murua Escobar et al. 2004). Sequence comparison showed
a 100% identity between the human and canine protein
molecules. Although both species showed the identical two
proteins, the number of found cDNA transcripts varies. For
the human HMGA1 seven different cDNA transcripts
(Figure 1: SPV1–SPV7) were described (Johnson et al. 1988)
of which SPV1 and SPV2 are the commonly found variants.
The characterized dog variants showed the same composition structure as the mentioned human variants SPV1 and
SPV2. Canine counterparts of the human transcript variants
SPV3–SPV7 could not be detected using polymerase chain
reaction (PCR) amplification approaches. Comparison of the
human cDNAs to the known transcripts of other species
shows that the dog is the only species showing similar
transcripts to those commonly found in humans referring to
exon structure and distribution. In detail, human and dog are
the only known species showing the presence of exon one
and two in both HMGA1a or HMGA1b transcripts,
respectively (Figure 1). Both isoforms (HMGA1a and
HMGA1b) were found in mouse (BC013455, NM_016660),
hamster (AF1893762, AF193763), and rat (NM_139327,
AF511040), of which for the last two species the described
transcripts are limited to the protein coding sequences and
the mouse transcripts show either exon one (HMGA1a) or
exon two (HMGA1b) in the respective transcripts (Figure 1).
For the HMGA1 transcripts of horse (CD535395), pig
(AU296646), chicken (AY303673), bovine (CK951567), and
Xenopus (BC084025), either the HMGA1a or the HMGA1b
isoform are currently (2004) present at the NCBI database.
For CDS (coding sequence) and protein identity analysis, we
used the described sequences and deduced, if necessary, the
corresponding parts for analyses. The in silico analyses were
done using Lasergene software programs (DNASTAR,
Madison). The coding sequence identities of the canine
HMGA1 transcripts to the sequences from other species
vary between 72.0% (chicken AY303673) and 95.7% (pig
AU296646, horse CD535395) (Table 1). Identity comparison
of the deduced proteins revealed similarities between 69.7%
(chicken AY303673) and 100.0% (human: P17096, X14957,
horse CD535395) (Table 1). The proteins of all species
showed strong conservation in the functional AT-Hook
DNA binding domains. Common for all species analysed is
that the protein coding sequences are composed of four
Table 1. HMGA1 identity comparison (CDS and protein) of
various species to the canine transcripts and proteins
Identity (%) to C. familiaris
Species
Isoform
CDS
Protein
Human (H. sapiens)
Human (H. sapiens)
Mouse (M. musculus)
Mouse (M. musculus)
Rat (R. norvegicus)
Rat (R. norvegicus)
Hamster (C. griseus)
Hamster (C. griseus)
Pig (S. scrofa)
Horse (E. caballus)
Cattle (B. taurus)
Chicken (G. gallus)
African clawed frog
(X. laevis)
HMGA1a
HMGA1b
HMGA1a
HMGA1b
HMGA1a
HMGA1b
HMGA1a
HMGA1b
HMGA1a
HMGA1b
HMGA1b
HMGA1b
95.1
95.1
90.1
90.1
90.4
90.4
92.6
92.6
95.7
95.7
94.4
72.0
100.0
100.0
96.3
96.9
96.3
95.8
98.1
97.9
99.1
100.0
99.0
69.7
HMGA1a
90.4
97.2
exons (Figure 1). The described proteins of the different
species are composed of 107 amino acids and 96 amino
acids, respectively, for HMGA1a and HMGA1b. Also
common for those species where both protein isoforms
were described is that the difference between the splicing
variants is the ‘‘typical’’ 33-bp deletion in the HMGA1b
transcripts resulting in the lack of 11 amino acids.
Previous results describing the comparison of the protein
coding sequences in 12 canine breeds revealed that the
mentioned deletion is also conserved in the analyzed breeds.
SNP screening in these breeds resulted in detection of oneamino-acid change in a single breed. A Teckel showed
a nucleotide transition from A to G at the first base of codon
64 in its HMGA1b transcript leading to an amino acid
replacement from threonine to alanine (Murua Escobar et al.
2004). As far as we know, no other canine HMGA1
polymorphisms have been described. Summarizing the
HMGA1 transcript and protein comparison data emphasizes
the relevance of the canine species as a model organism for
the research and development of therapeutic approaches for
human disorders.
Due to the mentioned properties of the HMGA1 gene,
its proteins HMGA1a/HMGA1b, and its reported role in
development of cancer, future studies targeting HMGA1
proteins could be of significant value.
Acknowledgments
This paper was delivered at the 2nd International Conference on the
‘‘Advances in Canine and Feline Genomics: Comparative Genome Anatomy
and Genetic Disease,’’ Universiteit Utrecht, Utrecht, The Netherlands,
October 14–16, 2004.
References
Abe N, Watanabe T, Masaki T, Mori T, Sugiyama M, Uchimura H, Fujioka Y,
Chiappetta G, Fusco A, and Atomi Y, 2000. Pancreatic duct cell carcinomas
express high levels of high mobility group I(Y) proteins. Cancer Res 60:
3117–3122.
779
Journal of Heredity 2005:96(7)
Abe N, Watanabe T, Sugiyama M, Uchimura H, Chiappetta G, Fusco A,
and Atomi Y, 1999. Determination of high mobility group I(Y) expression
level in colorectal neoplasias: a potential diagnostic marker. Cancer Res
59:1169–1174.
John S, Robbins CM, and Leonard WJ, 1996. An IL-2 response element in
the human IL-2 receptor alpha chain promoter is a composite element that
binds Stat5, Elf-1, HMG-I(Y) and a GATA family protein. EMBO J
15:5627–5635.
Aldrich TL, Reeves R, Lee CC, Thomas JN, and Morris AE, 1999. HMG-I(Y)
proteins implicated in amplification of CHO cell DNA. Sequence at NCBI
AF193763. Unpublished manuscript.
Johnson KR, Lehn DA, Elton TS, Barr PJ, and Reeves R, 1988. Complete
murine cDNA sequence, genomic structure, and tissue expression of
the high mobility group protein HMG-I(Y). J Biol Chem 263(34):
18338–18342.
Bandiera A, Bonifacio D, Manfioletti G, Mantovani F, Rustighi A,
Zanconati F, Fusco A, Di Bonito L, and Giancotti V, 1998. Expression of
HMGI(Y) proteins in squamous intraepithelial and invasive lesions of the
uterine cervix. Cancer Res 58:426–431.
Becker K, Murua Escobar H, Richter A, Meyer B, Nolte I, and Bullerdiek J,
2003. The canine HMGA1 gene maps to CFA 23. Anim Genet 34(1):
68–69.
Beitzel B and Bushman F, 2003. Construction and analysis of cells lacking
the HMGA gene family. Nucleic Acids Res 31(17):5025–5032.
Borrmann L, Schwanbeck R, Heyduk T, Seebeck B, Rogalla P, Bullerdiek J,
and Wisniewski JR, 2003. High mobility group A2 protein and its
derivatives bind a specific region of the promoter of DNA repair gene
ERCC1 and modulate its activity. Nucleic Acids Res 31:6841–6851.
Bustin M, 2001. Revised nomenclature for high mobility group (HMG)
chromosomal proteins. Trends Biochem Sci 26(3):152–153.
Bustin M and Reeves R, 1996. High-mobility-group chromosomal proteins:
architectural components that facilitate chromatin function. Prog Nucleic
Acid Res Mol Biol 54:35–100.
Chiappetta G, Bandiera A, Berlingieri MT, Visconti R, Manfioletti G,
Battista S, Martinez-Tello FJ, Santoro M, Giancotti V, and Fusco A, 1995.
The expression of the high mobility group HMGI (Y) proteins correlates
with the malignant phenotype of human thyroid neoplasias. Oncogene
10:1307–1314.
Chiappetta G, Avantaggiato V, Visconti R, Fedele M, Battista S, Trapasso F,
Merciai BM, Fidanza V, Giancotti V, Santoro M, Simeone A, and Fusco A,
1996. High level expression of the HMGI (Y) gene during embryonic
development. Oncogene 13:2439–2446.
Chuvpilo S, Schomberg C, Gerwig R, Heinfling A, Reeves R, Grummt F,
and Serfling E, 1993. Multiple closely-linked NFAT/octamer and HMG I(Y)
binding sites are part of the interleukin-4 promoter. Nucleic Acids Res
21(24):5694–5704.
Czyz W, Balcerczak E, Jakubiak M, Pasieka Z, Kuzdak K, and Mirowski M,
2004. HMGI(Y) gene expression as a potential marker of thyroid follicular
carcinoma. Langenbecks Arch Surg 389(3):193–197.
Du W and Maniatis T, 1994. The high mobility group protein HMG I(Y)
can stimulate or inhibit DNA binding of distinct transcription factor ATF-2
isoforms. Proc Natl Acad Sci USA 91:11318–11322.
Fedele M, Bandiera A, Chiappetta G, Battista S, Viglietto G, Manfioletti G,
Casamassimi A, Santoro M, Giancotti V, and Fusco A, 1996. Human
colorectal carcinomas express high levels of high mobility group HMGI(Y)
proteins. Cancer Res 56:1896–1901.
Johnson KR, Lehn DA, and Reeves R, 1989. Alternative processing of
mRNAs encoding mammalian chromosomal high-mobility-group proteins
HMG-I and HMG-Y. Mol Cell Biol 9(5):2114–2123.
Kazmierczak B, Dal Cin P, Wanschura S, Borrmann L, Fusco A, Van den
Berghe H, and Bullerdiek J, 1998. HMGIY is the target of 6p21.3
rearrangements in various benign mesenchymal tumors. Genes Chromosomes Cancer 23:279–285.
Klein SL, Strausberg RL, Wagner L, Pontius J, Clifton SW, and Richardson P,
2002. Genetic and genomic tools for Xenopus research: the NIH Xenopus
initiative. Dev Dyn 225(4):384–391.
Klein-Hessling S, Schneider G, Heinfling A, Chuvpilo S, and Serfling E,
1996. HMG I(Y) interferes with the DNA binding of NF-AT factors and
the induction of the interleukin 4 promoter in T cells. Proc Natl Acad Sci
USA 93:15311–15316.
Lewis H, Kaszubska W, DeLamarter JF, and Whelan J, 1994. Cooperativity
between two NF-kappa B complexes, mediated by high-mobility-group
protein I(Y), is essential for cytokine-induced expression of the E-selectin
promoter. Mol Cell Biol 14:5701–5709.
Murua Escobar H, Soller JT, Richter A, Meyer B, Winkler S, Flohr AM,
Nolte I, and Bullerdiek J, 2004. The canine HMGA1. Gene 14(330):
93–99.
Reeves R, Edberg DD, and Li Y, 2001. Architectural transcription factor
HMGI(Y) promotes tumor progression and mesenchymal transition of
human epithelial cells. Mol Cell Biol 21:575–594.
Rogalla P, Drechsler K, Frey G, Hennig Y, Helmke B, Bonk U, and
Bullerdiek J, 1996. HMGI-C expression patterns in human tissues.
Implications for the genesis of frequent mesenchymal tumors. Am J Pathol
149(3):775–779.
Sgarra R, Diana F, Bellarosa C, Rustighi A, Toller M, Manfioletti G, and
Giancotti V, 2002. Increase of HMGA1a protein methylation is a distinctive
characteristic of tumor cells induced to apoptosis. Sequence at NCBI
AF511040. Unpublished manuscript.
Sgarra R, Diana F, Bellarosa C, Dekleva V, Rustighi A, Toller M,
Manfioletti G, and Giancotti V, 2003. During apoptosis of tumor cells
HMGA1a protein undergoes methylation: identification of the modification
site by mass spectrometry. Biochemistry 42(12):3575–3585.
Sonstegard TS, Van Tassell CP, Matukumalli LK, Harhay GP, Bosak S,
Rubenfield M, and Gasbarre LC, 2004. Production of EST from cDNA
libraries derived from immunologically activated bovine gut. Sequence at
NCBI CK951567. Unpublished manuscript.
Friedmann M, Holth LT, Zoghbi HY, and Reeves R, 1993. Organization,
inducible-expression and chromosome localization of the human HMG-I(Y)
nonhistone protein gene. Nucleic Acids Res 21(18):4259–4267.
Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
Collins FS, Wagner L, Shenmen CM, Schuler GD, and others, 2002.
Generation and initial analysis of more than 15,000 full-length human
and mouse cDNA sequences. Proc Natl Acad Sci USA 99(26):
16899–16903.
Fujisaki S, Hiraiwa H, Eguchi T, Watanabe Y, Honma D, Saitou T, and
Yasue H, 2003. Construction of a full-length library of swine olfactory bulb
and its preliminary characterization. Sequence at NCBI AU296646.
Unpublished manuscript.
Takaha N, Resar LM, Vindivich D, and Coffey DS, 2004. High mobility
group protein HMGI(Y) enhances tumor cell growth, invasion, and matrix
metalloproteinase-2 expression in prostate cancer cells. Prostate 60(2):
160–167.
John S, Reeves RB, Lin JX, Child R, Leiden JM, Thompson CB, and
Leonard WJ, 1995. Regulation of cell-type-specific interleukin-2 receptor
alpha-chain gene expression: potential role of physical interactions between
Elf-1, HMG-I(Y), and NF-kappa B family proteins. Mol Cell Biol 15:
1786–1796.
Tallini G, Vanni R, Manfioletti G, Kazmierczak B, Faa G, Pauwels P,
Bullerdiek J, Giancotti V, Van Den Berghe H, and Dal Cin P, 2000.
HMGI-C and HMGI(Y) immunoreactivity correlates with cytogenetic abnormalities in lipomas, pulmonary chondroid hamartomas,
endometrial polyps, and uterine leiomyomas and is compatible with
780
Murua Escobar et al. Human and Canine HMGA1 Gene
rearrangement of the HMGI-C and HMGI(Y) genes. Lab Invest 80:
359–369.
from equine (Equus caballus) unstimulated peripheral blood leukocytes.
Sequence at NCBI CD535395. Unpublished manuscript.
Tamimi Y, van der Poel HG, Denyn MM, Umbas R, Karthaus HF,
Debruyne FM, and Schalken JA, 1993. Increased expression of high
mobility group protein I(Y) in high grade prostatic cancer determined by in
situ hybridization. Cancer Res 53:5512–5516.
Williams AJ, Powell WL, Collins T, and Morton CC, 1997. HMGI(Y)
expression in human uterine leiomyomata. Involvement of another highmobility group architectural factor in a benign neoplasm. Am J Pathol
150:911–918.
Thanos D and Maniatis T, 1992. The high mobility group protein HMG
I(Y) is required for NF-kappa B-dependent virus induction of the human
IFN-beta gene. Cell 71:777–789.
Yie J, Liang S, Merika M, and Thanos D, 1997. Intra- and intermolecular
cooperative binding of high-mobility-group protein I(Y) to the betainterferon promoter. Mol Cell Biol 17:3649–3662.
Vandenplas M, Cordonnier-Pratt MM, Suzuki Y, Sugano S, Moore JN,
Liang C, Sun F, Sullivan R, Shah M, and Pratt LH, 2003. An EST database
Corresponding Editor: Francis Galibert
781
XV.
HMGA2 expression in a canine model of prostate cancer
Winkler S, Murua Escobar H, Meyer B, Simon D, Eberle N, Baumgartner W, Loeschke S, Nolte I, Bullerdiek J.
Zur Veröffentlichung angenommen
Eigentanteil:
• Erstellen der caninen Gewebebank
• RNA-Isolierung, cDNA-Synthese, DNAse Verdau
• Real Time PCR
• Verfassen des Artikels
HMGA2 Expression in a Canine Model of Prostate Cancer
Susanne Winkler1,2, Hugo Murua Escobar2, Britta Meyer1, Daniela Simon2, Nina Eberle2,
Wolfgang Baumgartner3, Siegfried Loeschke1, Ingo Nolte2 and Jörn Bullerdiek1
1
Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen,
Germany
2
Small Animal Clinic, University of Veterinary Medicine, Bischofsholer Damm 15, 30173
Hannover, Germany
3
Department of Pathology, University of Veterinary Medicine, Bünteweg 17, 30559 Hannover, Germany
Correspondence to:
Prof. Dr. Jörn Bullerdiek: Center for Human Genetics, University of Bremen,
Leobener Strasse ZHG, D-28359 Bremen, Germany,
Phone:+49-(0)421-218-4239,
Fax: +49-(0)421-218-4239,
Email: [email protected]
1
Abstract:
Prostate cancer is the most prevalent cancer in western countries, being the third leading cause
of male cancer death. To check its possible significance as a prognostic marker, allowing a
better prognosis of the tumor, we analyzed the High-Mobility-Group-Protein-A2 gene
(HMGA2) expression level because HMGA2 overexpression has been shown to correlate with
malignant potential of various neoplasias. As the dog is beside men the only mammalian species showing spontaneously occurring prostate carcinomas with striking similarities to prostate cancer growth and progression in man it is an adequate animal model for this neoplasia.
We used real-time quantitative RT-PCR for HMGA2 expression analyses in a subset of canine
prostate tissue samples. Our investigations revealed that HMGA2 expression levels in all carcinomas were higher than those of any of the non-malignant tissues. Thus, canine prostate
cancer represents a spontaneously occurring model to test therapeutic effects due to a reduced
expression of HMGA2.
Introduction:
According to a recent study of the World Health Organisation (WHO), prostate cancer is the
most prevalent cancer in western countries and is the third leading cause of male cancer death
[1]. Prostate cancer most commonly affects men over the age of 50 years. Thus, considering
the worldwide trend towards an ageing population, the number of prostate cancer deaths even
can be expected to increase. There have been 220,900 new prostate cancer cases in the US in
2003, increasing to 234,460 new prostate cancer cases in the US in 2006. By the year 2020
393,000 prostate cancer-related deaths are expected worldwide [1-3]. Therefore, research into
that tumor is a major challenge for future management of the disease. Of particular relevance
are parameters allowing a better prediction of the course of the disease, because based on the
histology of the lesions alone it is often not possible to recognize sufficiently the malignant
potential of the tumor in terms of e.g. local invasiveness and metastatic spread. Nevertheless
2
the latter is a prerequisite for appropriate therapy management. Even more challenging is the
field of “theragnostics”. To address these questions, animals models are of valuable help. Of
these, the dog will be increasingly important in the future.
Beside humans the dog is the only mammalian species that spontaneously develops prostate
cancer with a considerably high frequency [4]. In addition, both species show striking similarities in the development and clinical course of the disease. The average age in which prostate carcinomas appear in dogs is ten years, closely resembling the situation in men, where
prostate carcinoma most commonly appears in older patients [1, 2, 5]. In both species, adenocarcinomas of the prostate represent a locally invasive disease. Also in both species, the tumors tend to metastasize to the same distant regions [6] and akin to their human counterparts
canine prostatic cancers vary over a broad range with respect to their clinical behavior. Currently, there is no widely accepted grading for canine prostate cancer.
In human prostate carcinomas overexpression of HMGA1 has been described to correlate with
more aggressive disease [7]. The similar protein HMGA2 is encoded by a separate gene,
mapping to 12q14-15 [8]. All HMGA proteins show a high amino acid sequence homology in
particular among their three highly conserved AT-hooks, representing the DNA-binding domains [9]. HMGA proteins are abundantly expressed during embryogenesis and expressed at
very low levels in most normal adult tissues [10, 11]. However, HMGA2 is frequently involved in chromosomal translocations occurring in benign human tumors, such as lipomas,
uterine leiomyomas, lung hamartomas, and fibroadenomas and adenolipomas of the breast
[12-18]. It has been demonstrated, that truncated transcripts are able to induce cell transformation [19]. Because the dog is the only animal model for spontaneously occurring prostate cancers. We have addressed the present study to the potential role of HMGA2 Expression in canine prostate tumors and non-malignant tissues. If it turns out that overexpression of HMGA2
plays a role in these tumors they constitute a suitable model to study therapeutic effects aimed
at a reduced expression of HMGA2.
3
Materials and Methods:
Canine tissue samples: All canine tissues samples used in this study were taken from dogs of
different breeds admitted to the Small Animal Clinic, University of Veterinary Medicine,
Hannover due to different medical conditions. All samples were taken during surgery or autopsy and immediately frozen in liquid nitrogen and stored at –80°C for RNA isolation. Additionally, pathohistological examination was carried out by hematoxylin an eosin staining of
paraffin embedded specimens, showing four non-neoplastic tissues, three hyperplasias, three
cysts, one anaplastic carcinoma and five adenocarcinomas (Table 1). Examples of two adenocarcinomas are given in Figure 2.
RNA isolation: Total RNA extraction of all tumor specimens was performed according to the
RNeasy midi protocol for isolation of total RNA from animal tissues (Qiagen, Hilden, Germany), following the manufacturer’s instructions.
cDNA-synthesis: 250 ng of total RNA of each sample were reverse transcribed using MMLV-Reverse Transcriptase and RNase Out (Invitrogen, Karlsruhe, Germany) with
HMGA2dog Reverse Primer (5’GCCATTTCCTAGGTCTGCCTC3’) and 10 mM dNTPs.
Each sample was prepared in triplicate for real-time quantitative RT-PCR. Negative controls
were prepared by adding distilled water instead of RNA.
Standard curves: mRNA levels were measured using an “absolute” quantification method,
which is relative to amplicon specific standard curves. The standard curve resulted from seven
dilution steps from 102 to 108 copies, each dilution step was measured in triplicate. The sequence for this standard was (5’ to 3’): AGAGTCCCTCCAAAGCAGCTCAAAAGAAAGC
AGAAGCCAATGGAGAAAAACGGCCAAGAGGCAGACCTAGGAAATGGCCA. Copy
numbers were normalized relative to total RNA concentration and expressed as copy numbers/250ng RNA.
4
Real-time quantitative RT-PCR: For quantitative analysis of canine HMGA2 expression levels
2µl of each of the cDNA triplicates were subjected to real time RT-PCR, using the ABI Prism
7000 Sequence Detection System (Applied Bioystems, Warrington, UK). To minimize the
risk of false positives, the dilutions for the standard curve were dispensed after the samples of
interest had been dispensed and sealed. An additional negative control was prepared using
water with the PCR-reaction mix. Nucleotide sequences for the canine primers and probe
were designed according to Gross et al. [20] with slight modifications of the lower primer:
HMGA2dog up (5’ to 3’): AGTCCCTCCAAAGCAGCTCAAAAG, HMGA2dog lo (5’ to
3’): GCCATTTCCTAGGTCTGCCTC, HMGA2 probe (5’ to 3’): 6FAM-GAAGCCACTGG
AGAAAAACGGCCA-TAMRA. PCR-conditions were as follows: 50°C for 2 minutes, initial
denaturation at 95°C for ten minutes, followed by 45 cycles at 95 °C for 15 seconds and 60°C
for 1 minute.
Statistical Analysis: An exact chi-square (χ2) test was used to assess diagnostic efficiency.
Results:
Real-time quantitative RT-PCR: The mean quantities of all samples investigated are listed in
Table 1. The expression levels of all carcinomas were significantly higher than those of any of
the non malignant tissues. All ten non malignant prostatic tissues showed quantities lower
than 50,000 transcripts per 250 ng total RNA. One prostatic tissue (sample No. 16) designated
as a carcinoma showed a mean quantity below this amount, too, but pathohistological examination of this tissue shows that the tumor consisted of large areas of non-tumorigenic connective tissue. Thus, it seems possible, that the sample used for preparation of total RNA consisted mostly of this non-malignant tissue, explaining the low expression of HMGA2. Additionally, the integrity of the cDNA was tested by PCR for the house-keeping gene FUT6 (data
not shown). Different from all other tissue samples investigated in this study, there was no
visible band for the gene product in tissue sample 16. Thus, the actual HMGA2 transcript level
5
of this tumor may be higher than revealed by our investigations. The mean quantities among
the investigated tissue samples, as indicated in Figure 1, showed a broad range from 127 transcripts per 250 ng RNA for the lowest level in non-neoplastic tissues and 4,239,000 transcripts per 250 ng RNA as the highest level observed in an adenocarcinoma. There was also
some variation observed between tissues with the same pathohistological findings: nonneoplastic tissues showed transcript levels from 127 per 250 ng RNA to 1,433 per 250 ng
RNA whereas benign lesions presented transcript levels from 963 per 250 ng RNA to 20,755
per 250 ng RNA. Adenocarcinomas exhibited a much broader span than the non-neoplastic
tissues and benign lesions from 27,215 transcripts per 250 ng RNA to 4,239,000 transcripts
per 250 ng RNA. Nevertheless, even when comparing the highest transcript level of nonneoplastic tissues to the lowest transcript level of adenocarcinomas, there is a nearly 19-fold
increase of expression of HMGA2.
Statistical Analysis: The HMGA2 level may be used to separate malign from benign cases.
Assuming a logarithmic normal distribution of the HMGA2 values, the optimal limit to separate these categories is 23086 transcripts/250 ng RNA (smaller values indicate a benign situation). Using this limit, all cases can be classified as malign or benign, respectively, without
error, i.e. with sensitivity = specificity = diagnostic efficiency = 100%. An exact chi-square
test shows that this is not a random result (p < 0.001).
Discussion:
Compared to the situation in man, overexpression of genes in canine cancer compared to nonmalignant tissues has been studied rarely. As to a comparison between humans and dogs,
Walker-Daniels et al. have described a specific tyrosine kinase, EphA2 showing overexpression in humans as well as in canine prostate cancer [21].
Herein we report that another gene, namely HMGA2 is overexpressed in canine prostatic cancer compared to non-neoplastic tissues. It has been demonstrated previously that overexpres6
sion of proteins of the HMGA family is associated with tumor progression in a variety of human tumors as e.g. colon cancer, squamous cell carcinoma of the oral cavity, breast, and lung
cancer [22-26]. The expression of an embryonic protein in tumors of adults, as demonstrated
in this study, suggests that HMGA2 is associated with the malignant potential in the oncogenic
process [27]. Presumably, the neoplastic transformation of cells expressing high levels of
HMGA proteins takes part in a multi-step process; resulting in the aberrant expression of factors able to induce the continuous expression of HMGA proteins. These elevated levels of
HMGA proteins then contribute to neoplastic transformation of the cells [28]. Because of the
correlation between elevated levels of HMGA and the malignant and metastatic potential of
tumors the overexpression of HMGA proteins can be used as a diagnostic and prognostic
marker [23, 29]. Thus, some efforts have been made to establish HMGA2 expression as a tool
to classify subsets of malignant tumors with poor prognosis [30]. Herein we report on
HMGA2 expression in canine prostate cancer, a disease in a companion animal which closely
resembles the situation in men. Our data clearly show that expression of HMGA2 is low in
non-neoplastic tissues, rises in benign lesions with intermediate values for cysts and hyperplasia and increases at least 19 fold in carcinomas (Figure 1). In our study, all malignant neoplasias showed expression levels beyond a quantity of 50,000 transcripts per 250ng total RNA,
whereas none of the non-malignant tissues showed expression levels exceeding that value.
Most likely, the broad intertumoral range of transcript levels reflects differences of the aggressive behavior of the tumors. In summary, our investigations show that in canine prostate
cancer HMGA2 Expression seems to play an important role. Therefore, canine prostate cancer
not only represents a valuable animal model for that frequent type of human cancer, but is
also an interesting model with respect to therapeutic intervention aimed at reducing HMGA2
Expression.
7
Table 1: Pathohistological findings of the canine tissue samples examined. Additionally, information about breed and age of the related dogs is given as well as the Mean Quantity of
transcription levels obtained by Real-Time Quantitative RT- PCR.
Sample Breed
No.
Age
Microscopic
(years) Findings
1
4
Non-neoplastic
2
Golden
Retriever
Engl. Setter
9
3
Mixed breed
11
4
Mixed breed
14
5
6
Golden
Re- 11
triever
Hovavart
10
7
8
Munsterlander 10
Briard
10
9
10
11
12
13
14
Rottweiler
Mixed breed
Mixed breed
Mixed breed
Pinsher
Mixed breed
8
10
11
13
7
9
15
16
Mixed breed
Mixed breed
16
10
Anisokaryosis of cells,
cytoplasm poorly definable, Adenocarcinoma
Anisokaryosis of cells,
invasive growth, Adenocarcinoma
Moderately cystic hyperplasia
Multifocal,
low-grade
hyperplasia
Anisokaryosis of cells,
large nucleus with multiple nucleoli, Anapl.
Carcinoma
Non-neoplastic
Highly malignant adenocarcinoma
Moderately hyperplasia
Non-neoplastic
Cyst
Cyst
Cyst
Pleomorphic cells, several
anaplastic cells, Adenocarcinoma
Non-neoplastic
large areas of connective
tissue, invasive growth,
Adenocarcinoma
Metastatic
behavior
Mean Quantity
(Copy Number/
250ng/RNA
127
Bone meta- 85,587
stases
Infiltration of 1,233,000
blood vessels
-
963
-
20,755
Lymph node
metastases
1,116,000
Mesentery
metastases
Not tested
213
4,239,000
Not tested
466
27,215
7,603
1,433
4,188
10,923
9,710
56,984
8
Figures
Figure 1: HMGA2 Expression in canine prostatic tissues: white bars: non-neoplastic tissues;
spotted bars: hyperplasias; grey bars: cysts; black bars: carcinomas.
Figure 2: a) Sample No 8: poorly differentiated adenocarcinoma of the canine prostate with
mucus filled atypical glands on the left and several mitoses.
b) Sample No 14: moderately to poorly differentiated adenocarcinoma of the canine prostate.
9
References:
[1]
Brundtland GH, World Health Organization, Geneva 2001.
[2]
Mettlin CJ, Murphy GP, Rosenthal DS, Menck HR. The National Cancer Data Base
report on prostate carcinoma after the peak in incidence rates in the U.S. The American College of Surgeons Commission on Cancer and the American Cancer Society. Cancer 1998; 83:
1679-1684.
[3]
American Cancer Society 2007, http://www.cancer.org/docroot/stt/stt_0.asp.
[4]
Boutemmine D, Bouchard N, Boerboom D, Jones HE, Goff AK, Dore M, Sirois J.
Molecular characterization of canine prostaglandin G/H synthase-2 and regulation in prostatic
adenocarcinoma cells in vitro. Endocrinology 2002; 143: 1134-1143.
[5]
Nolte I, Nolte M. Praxis der Onkologie bei Hund und Katze. Enke, Stuttgart, 2000.
[6]
MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of cancer
biology and treatment. Cancer Metastasis Rev 1990; 9: 125-136.
[7]
Tamimi Y, van der Poel HG, Denyn MM, Umbas R, Karthaus HF, Debruyne FM,
Schalken JA. Increased expression of high mobility group protein I(Y) in high grade prostatic
cancer determined by in situ hybridization. Cancer Res 1993; 53: 5512-5516.
[8]
Wanschura S, Kazmierczak B, Schoenmakers E, Meyen E, Bartnitzke S, Van de Ven
W, Bullerdiek J, Schloot W. Regional fine mapping of the multiple-aberration region involved
in uterine leiomyoma, lipoma, and pleomorphic adenoma of the salivary gland to 12q15.
Genes Chromosomes Cancer 1995; 14: 68-70.
[9]
Wisniewski JR, Schwanbeck R. High mobility group I/Y: multifunctional chromoso-
mal proteins causally involved in tumor progression and malignant transformation (review).
Int J Mol Med 2000; 6: 409-419.
[10]
Pentimalli F, Dentice M, Fedele M, Pierantoni GM, Cito L, Pallante P, Santoro M,
Viglietto G, Dal Cin P, Fusco A. Suppression of HMGA2 protein synthesis could be a tool for
the therapy of well differentiated liposarcomas overexpressing HMGA2. Cancer Res 2003;
63: 7423-7427.
[11]
Rogalla P, Drechsler K, Frey G, Hennig Y, Helmke B, Bonk U, Bullerdiek J. HMGI-C
expression patterns in human tissues. Implications for the genesis of frequent mesenchymal
tumors. Am J Pathol 1996; 149: 775-779.
[12]
Ashar HR, Fejzo MS, Tkachenko A, Zhou X, Fletcher JA, Weremowicz S, Morton
CC, Chada K. Disruption of the architectural factor HMGI-C: DNA-binding AT hook motifs
fused in lipomas to distinct transcriptional regulatory domains. Cell 1995; 82: 57-65.
10
[13]
Bullerdiek J, Wobst G, Meyer-Bolte K, Chilla R, Haubrich J, Thode B, Bartnitzke S.
Cytogenetic subtyping of 220 salivary gland pleomorphic adenomas: correlation to occurrence, histological subtype, and in vitro cellular behavior. Cancer Genet Cytogenet 1993; 65:
27-31.
[14]
Hennig Y, Deichert U, Bonk U, Thode B, Bartnitzke S, Bullerdiek J. Chromosomal
translocations affecting 12q14-15 but not deletions of the long arm of chromosome 7 associated with a growth advantage of uterine smooth muscle cells. Mol Hum Reprod 1999; 5:
1150-1154.
[15]
Hennig Y, Wanschura S, Deichert U, Bartnitzke S, Bullerdiek J. Rearrangements of
the high mobility group protein family genes and the molecular genetic origin of uterine leiomyomas and endometrial polyps. Mol Hum Reprod 1996; 2: 277-283.
[16]
Kazmierczak B, Hennig Y, Wanschura S, Rogalla P, Bartnitzke S, Van de Ven W,
Bullerdiek J. Description of a novel fusion transcript between HMGI-C, a gene encoding for a
member of the high mobility group proteins, and the mitochondrial aldehyde dehydrogenase
gene. Cancer Res 1995; 55: 6038-6039.
[17]
Kazmierczak B, Wanschura S, Rosigkeit J, Meyer-Bolte K, Uschinsky K, Haupt R,
Schoenmakers EF, Bartnitzke S, Van de Ven WJ, Bullerdiek J. Molecular characterization of
12q14-15 rearrangements in three pulmonary chondroid hamartomas. Cancer Res 1995; 55:
2497-2499.
[18]
Schoenmakers EF, Wanschura S, Mols R, Bullerdiek J, Van den Berghe H, Van de
Ven WJ. Recurrent rearrangements in the high mobility group protein gene, HMGI-C, in benign mesenchymal tumours. Nat Genet 1995; 10: 436-444.
[19]
Battista S, Fidanza V, Fedele M, Klein-Szanto AJ, Outwater E, Brunner H, Santoro M,
Croce CM, Fusco A. The expression of a truncated HMGI-C gene induces gigantism associated with lipomatosis. Cancer Res 1999; 59: 4793-4797.
[20]
Gross KL, Neskey DM, Manchanda N, Weremowicz S, Kleinman MS, Nowak RA,
Ligon AH, Rogalla P, Drechsler K, Bullerdiek J, Morton CC. HMGA2 expression in uterine
leiomyomata and myometrium: quantitative analysis and tissue culture studies. Genes Chromosomes Cancer 2003; 38: 68-79.
[21]
Walker-Daniels J, Coffman K, Azimi M, Rhim JS, Bostwick DG, Snyder P, Kerns BJ,
Waters DJ, Kinch MS. Overexpression of the EphA2 tyrosine kinase in prostate cancer. Prostate 1999; 41: 275-280.
11
[22]
Miyazawa J, Mitoro A, Kawashiri S, Chada KK, Imai K. Expression of mesenchyme-
specific gene HMGA2 in squamous cell carcinomas of the oral cavity. Cancer Res 2004; 64:
2024-2029.
[23]
Rogalla P, Drechsler K, Kazmierczak B, Rippe V, Bonk U, Bullerdiek J. Expression
of HMGI-C, a member of the high mobility group protein family, in a subset of breast cancers: relationship to histologic grade. Mol Carcinog 1997; 19: 153-156.
[24]
Meyer B, Loeschke S, Schultze A, Weigel T, Sandkamp M, Goldmann T, Vollmer E,
Bullerdiek J. HMGA2 Overexpression in Non-Small Cell Lung Cancer. Molecular Carcinogenesis in press.
[25]
Abe N, Watanabe T, Sugiyama M, Uchimura H, Chiappetta G, Fusco A, Atomi Y.
Determination of high mobility group I(Y) expression level in colorectal neoplasias: a potential diagnostic marker. Cancer Res 1999; 59: 1169-1174.
[26]
Sarhadi V, Wikman H, Salmenkivi K, Kuosma E, Sioris T, Salo J, Karjalainen A,
Knuutila S, Anttila S. Increased expression of high mobility group A proteins in lung cancer.
J Pathol 2006.
[27]
Goodwin G. The high mobility group protein, HMGI-C. Int J Biochem Cell Biol 1998;
30: 761-766.
[28]
Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function. Gene
2001; 277: 63-81.
[29]
Reeves R. Structure and function of the HMGI(Y) family of architectural transcription
factors. Environ Health Perspect 2000; 108 Suppl 5: 803-809.
[30]
Rogalla P, Drechsler K, Schroder-Babo W, Eberhardt K, Bullerdiek J. HMGIC ex-
pression patterns in non-small lung cancer and surrounding tissue. Anticancer Res 1998; 18:
3327-3330.
12
XVI.
Inhibitory effect of antisense HMGA AAV-mediated delivery suppresses cell proliferation in canine carcinoma cell line
Soller JT, Murua Escobar H, Winkler S, Fork M, Pöhler C, Bünger S,
Sterenczak KA, Willenbrock S, Nolte I, Bullerdiek J.
In Vorbereitung
Eigenanteil:
• Bereitstellung der Zell-Linie
• Zellkultur für die Produktion der Viren
• Hilfestellung bei der Transfektion zur Virusproduktion
• Hilfestellung bei der Durchführung des Proliferationsassays
Inhibitory effect of antisense HMGA AAV-mediated delivery suppresses cell
proliferation in canine carcinoma cell line
J T Soller1,2, H Murua Escobar1,2, S Winkler1, M Fork2, C Pöhler1, S Bünger1,
K A Sterenczak1,2, S Willenbrock1,2, I Nolte2 and J Bullerdiek1
1
Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen,
Germany
2
Small Animal Clinic, University of Veterinary Medicine, Bischofsholer Damm 15, 30173
Hannover, Germany
Correspondence to:
Jörn Bullerdiek
Center for Human Genetics
University of Bremen,
Leobener Strasse ZHG
D-28359 Bremen, Germany,
Phone:+49-(0)421-218-4239,
Fax: +49-(0)421-218-4239,
Email: [email protected]
1
Abstract
Carcinomas of the prostate are the most common malignancy with a high cause for
tumor related deaths in men. The dog is the only mammalian species which shows a
predisposition for spontaneously developing cancer of the prostate and suitable as a
genetic model organism for human prostate cancer considering the similarities
between both species in metastatic behavior, histopathology, age, as well as the
clinical course of carcinomas of the prostate gland. In humans overexpression of high
mobility group A (HMGA1 and HMGA2) proteins has been observed in a variety of
cancers. Aberrant HMGA protein expression has been reported to correlate with an
appearance of a malignant phenotype of tumors and the metastasis of tumor cells,
often associated with an unfavorable prognosis.
Herein we report that adeno-associated virus (AAV)-2 particles carrying the mRNA of
HMGA1 or HMGA2 in antisense orientation induce an inhibition of proliferation of
canine prostate carcinoma cells in vitro, whereas a control AAV-2 carrying the lacZ
mRNA did not inhibit the growth of the tumor-cells. Contribute to our results a
suppression of HMGA expression mediated by recombinant AAV-2 carrying HMGA
genes in antisense orientation presents a method in a potential treatment of prostate
carcinomas.
Introduction
In Europe prostate cancer is a leading cause of death among men with over 56,000
deaths in the European Union 19981. Worldwide the incidence of registered prostate
cancer accounts for 193,000 in 1993, which is strongly related to Western lifestyle
and an increasing risk of developing the disease at middle age (> 50 years). For men
the risk o get prostate cancer is about 10 % in lifetime with a mortality rate of 3 %2.
Additionally the risk of developing prostate cancer shows an ethnical predisposition
within the human population. People of African origin appear to be at greater risk for
prostate cancer than Caucasian people, whereas Asian people develop prostate
cancer less than the latter3.
In terms of animal models dogs are most suitable to elucidate the mechanisms of
pathogenesis of human prostate carcinomas. First of all dogs are the only known
mammalian species which frequently develop carcinomas of the prostate comparable
to humans4. As abundantly described in the literature over the last ten years, in many
cases dogs and humans share the genetic pathways for developing neoplastic
2
diseases, including cancer predisposition, progression and histological findings5, 6.
Additionally canine tumor entities allow a better comparability to human tumor
diseases than rodent tumors in terms of patient size and cell kinetics. Also, canine
cancer diseases are characterized by a spontaneous development of neoplasias
without experimental induction by carcinogen, transplantation and artificially acquired
immunodeficiency, respectively7. It is known that dogs develop cancer twice as often
as humans together with a higher progression of tumors allowing a better monitoring
of the tumor process8.
Canine prostate carcinomas akin to human prostate adenocarcinomas constitute as a
local invasiveness of growth and metastasize to the same organs e.g. lung and
bones by bloodstream or lymph4. In case of age distribution older individuals are
prevalently affected by developing prostate cancer with an average age of 65 years
in men9 which means a comparable age of 10 years in dogs10.
In numerous human malignant tumors high mobility group A proteins are highly
expressed while the expression of HMGA is relatively low in non-dividing well
differentiated adult tissues11-13. An overexpression of HMGA is highly associated with
neoplastic transformation and correlated with bad prognosis for the patient. It is
proposed to recognize high levels of HMGA as suitable prognostic markers for
malignancies14-17. The HMGA protein group consists of three members HMGA1a,
HMGA1b and HMGA2. HMGA proteins are characterized by three highly conserved
DNA binding domains called the “AT-hooks”18. The proteins HMGA1a and HMGA1b
are isoforms coded by the same gene for alternative splicing variants. HMGA1 is
located on human chromosome region 6p2119, 20. The closely related HMGA2 protein
is encoded by a different gene, which is located on chromosome region 12q14-152123
. These non-histone proteins are small secondary structured polypeptides which
preferably bind to the minor groove of AT-rich B-form DNA and are defined as
architectural nuclear factors, which are involved in chromatin dynamics24, 25. HMGA1
proteins influence the expression by modifying chromatin structure of a large number
of genes, for example ATF2, IFN-β, NFκB, Interleukin-2 receptor, Interleukin-4
26-31
HMGA2 as a transcription factor regulates the genes of cyclin A, pRB and ERCC1
.
32-
35
.
Overexpression of HMGA1 is reported in a diversity of human cancers, as for
example breast cancer, cervical cancer, colorectal cancer, thyroid cancer and
prostate cancer15, 16, 36, 37, whereas high levels of HMGA2 expression are observed in
3
breast cancer, leukemia, non-small cell lung cancer and pancreatic cancer38-42. In
case of prostate malignancies HMGA2 expression is suggested to be a powerful
prognostic marker tool in clinical practice in diagnosis and progression of prostate
carcinomas. It is also proposed that not even an overexpression of HMGA proteins is
sufficient for tumor progression but also their posttranslational modifications can be
used as a potent tool in tumor grading 43.
Due to the similarities of human and canine prostate cancer the characterization of
the nucleotide and amino acid sequences of HMGA is of significant value. For
HMGA1 we recently characterized the canine HMGA1a and HMGA1b transcripts and
deduced their protein sequence, which showed a 100 % identity to its human
counterpart whereas the coding sequence shows a 95 % identity in both splice
variants44. To the best of our knowledge the canine HMGA2 transcript was not
characterized so far. In order to construct antisense HMGA2 AAV Vectors for the
experimental studies presented herein we characterized the coding sequence which
contains the full sequence of the AT-hooks.
Recently a new cell line was established from a canine prostate carcinoma45, which
joins the existing well-known human prostate carcinoma cell lines available for cancer
research. Due to the similarities between human and canine prostate cancer entities,
this new canine cell line provides a valuable tool in experimental cancer gene
therapy. An important aspect of the canine carcinoma cell line as well as the original
tumor from which the cell line is derived from is the observation of high level
expression of HMGA genes. The overexpression of HMGA genes in the canine cell
line strongly correlates to the described malignancy of the carcinoma46.
The aim of this study was to construct recombinant adeno-associated viruses
encoding HMGA1 and HMGA2 antisense RNA and to analyze the proliferative effects
of canine carcinoma cells infected with the virus. AAV mediated gene therapy
experiments show many advantages to deliver antitumor drugs compared to the most
prominent gene therapy tool of adenoviral vectors, which induce host immune
response to the target cells. Recombinant AAVs demonstrate long-term transgene
expression and a minimal immune response.47 Previous studies have shown that
AAV vectors can successfully be used for the delivery of gene expression in sense
and antisense orientation for up- and down regulation of target genes 48-51. In terms of
suppression of HMGA expression other studies used adenoviral virus systems to
deliver anti sense HMGA cDNA in order to induce inhibitory effects of tumor cell
4
proliferation, malignant transformation and engrafted tumor sizes52,
53
. In our study,
we demonstrate the inhibition of cell proliferation in a canine prostate carcinoma cell
line mediated by antisense HMGA mRNA recombinant AAVs (rAAV-asHMGA1,
rAAV-asHMGA2).
Material and methods
Cell lines: The canine carcinoma cell line (CT1258)45 (Centre for Human Genetics,
University of Bremen, Bremen, Germany) was cultured in sterile flasks containing 5
ml of medium 199 with Earle’s salts (Gibco, Invitrogen, Karlsruhe, Germany) with
20% heat inactivated and filtrated fetal bovine serum (FBS). 12 hours prior to
infection with recombinant AAVs, 2500 CT1258 cells per well were seeded into 96
multiwell dishes and cultivated in 10 % FBS 199 medium.
For AAV production HEK-293 cells (AAV-293) were obtained from Stratagene’s AAVHelper-Free System. According to the manufacture’s protocol the cells were cultured
in 10 % FBS D-MEM Medium (Biochrom AG, Berlin, Germany). All cell lines were
cultivated in a 37°C incubator with 5 % CO2 saturation.
AAV plasmids: The vector plasmid for generating the recombinant AAVs was
obtained from Stratagene’s AAV-Helper-Free System (Stratagene, La Jolla, USA).
The kit includes the pAAV-MCS (AF396260) plasmid containing the ITR sequences,
multiple cloning site (MCS), the CMV promoter and hGH poly A tail. The system also
includes the pAAV-RC (AF369963) for AAV replication and the capsid genes, the
pHelper (AF396965) which provides adenoviral helper function by coding for E2A,
E4, and VA RNA genes; the pAAV-LacZ (AF369964) contains the CMV promoter, the
ORF for the reporter gene lacZ and ITR sequences (Figure 1). For all transfection
and clonal production of the plasmids ultra competent the XL-10-Gold E. coli were
used (Stratagene, La Jolla, USA). The AAV plasmids were harvested and purified
with the EndoFree Plasmid Purification Kit (Qiagen, Hilden Germany).
Cloning of canine HMGA cDNA and construction of antisense RNA plasmid vectors:
Total RNA was isolated from CT1258 canine carcinoma cell line using RNeasy Mini
Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. In order to
prevent genomic DNA contamination DNAse I digestion was performed using RNaseFree DNase Set (Qiagen, Hilden, Germany). cDNA was synthesized using 3’RACE
adapter primer AP2 (seq), 5µg of total RNA, and SuperScript II reverse transcriptase
(Invitogen, Karlsruhe, Germany) according to the manufacturer’s instructions. The
5
RT-PCRs for the molecular cloning the canine cDNA fragments of HMGA1a (515 bp)
and HMGA2 (326 bp) were done using BamHI and EcoRI adapter primer pairs. For
HMGA1,
BamHI-IYup
(enzyme
sites
in
minuscule)
(5’-CGggatccCTCGCGGCATCCCAGCCATCACTC-3’),
(5’-CGgaattcGCGGCTGGTGTGCTGTGTAGTGTG-3’)
EcoRI-IYlo
and
for
HMGA2,
BamHI-ICup (5’-CGggatccGTGAGGGCGCGGGGCAGCCGTCCACTTC-3’), EcoRIIClo (5’-CGgaattcCTCTTCGGCAGACTCTTGTGAGGATGTCT-3’) were used. A 1.5
% agarose gel electrophoresis was performed to separate the PCR products, the
fragments were recovered with QIAquick Gel Extraction Kit (Qiagen, Hilden,
Germany) The PCR products were cloned in the pGEM-T Easy Vector and
sequenced in forward and reverse direction (MWG-Biotech AG, Ebersberg,
Germany). The vector plasmid containing the HMGA (HMGA1a or HMGA2) cDNA
was afterwards double-digested with BamHI and EcoRI (Fermentas GmbH, St.LeonRot, Germany), and separated in a 1.5 % agarose gel, and the HMGA fragment was
purified with QIAquick Gel Extraction Kit. In a separate preparation the pAAV-MCS
plasmid was correspondently digested with BamHI and EcoRI endonuclease enzyme
and the assay was purified with QIAquick Nucleotide Removal Kit (Qiagen, Hilden,
Germany). The HMGA fragment was ligated with T4-DNA Ligase (Fermentas GmbH,
St Leon-Rot, Germany) at 25 °C for 12 h into the EcoRI/BamHI sites of the linearized
pAAV-MCS plasmid to generate pAAV-HMGA plasmids in anti sense orientation
relative to the CMV promoter (pAAV-asHMGA1a, pAAV-asHMGA2) (Figure 1). For
validation the constructed pAAV-asHMGA vectors were confirmed by sequencing
and restriction enzyme digestion.
6
pAAV-LacZ
CMV-P
β-Globin
intron
lacZ CDS
hGH pA
L-ITR
R-ITR
pAAV-MCS
CMV-P
β-Globin
intron MCS
hGH pA
L-ITR
R-ITR
pAAV-asHMGA1
CMV-P
β-Globin
intron
canine asHMGA1 cDNA
hGH pA
L-ITR
R-ITR
pAAV-asHMGA2
CMV-P
β-Globin
intron
canine asHMGA2 cDNA
L-ITR
Figure 1
hGH pA
R-ITR
Overview of the rAAV vector plasmids
rAAV vector construction, purification and titer measurement
Recombinant AAVs serotype 2 (AAV-2) were generated by transient transfection with
CaCl2/HBS buffer of AAV-293 cells with 10 µg of each of the three plasmids (pAAVRC, pAAV-Helper, pAAV-asHMGA or pAAV-LacZ, respectively) according to the
manufacturer’s protocol (Stratagene, AAV-Helper-Free System). The AAV-2 primary
stocks were purified using ViraKit AAV Purification Kit (Virapur LLC, San Diego, USA)
and stored in aliquot at -20°C. The virus genome titer (vg/ml) was determined by
CMV promoter specific quantitative RT-PCR (qRT-PCR) as mentioned by previously
described methods54,
55
For absolute quantification of vg/ml the qRT-PCR
amplification was carried out using the Applied Biosystem 7300 Real-Time PCR
System (Applied Biosystem, Darmstadt, Germany). The following primers were used
in
the
qRT-PCR
reactions:
GAGGTCTATATAAGCAGAGCTCGTTTAGT
7
forward
3’),
reverse
pAAV
pAAV
(5’
(5’
GGTGTCTTCTATGGAGGTCAAAACA 3’) and the fluorogenic probe pAAV (5’ 6FAM-CAGATCGCCTGGAGACGCCATCC-TAMRA).
Cell proliferation assay: 2500 CT1258 cells per well were vertically seeded into a 96
multi well plate in eight different wells in medium 199 (20 % FBS) at incubated for 24
h, 37°C and 5 % CO2. The following day the medium was removed and replaced by 2
% FBS 199 medium. Subsequently, the CT1258 cells were divided into two different
groups: group A, infected cells with a combination of 50 rAAV-asHMGA virus
genomes per cell (vg/cell) (25/25 vg/cell of rAAV-asHMGA1a/rAAV-asHMGA2) and
an untreated control, group B with 50 vg/cell of rAAV-LacZ infected cells and
untreated control. In order to prevent cross-contamination each assay was performed
on a separate multi well plate. After 90 min 18 % FBS 199 medium was added to the
treated and untreated cells. BrdU was added after 60 h for an incubation time of 12 h.
After 72 h of rAAV infection the incubation was stopped and prepared for cell
proliferation assay as noted in the manufacture’s instruction. The quantification of the
cell proliferation was performed by ELISA, BrdU colorimetric assay (Roche
Diagnostics, Penzberg, Germany). The measurement of absorbance of the samples
was done with the Synergy HT multititer plate reader (Biotek Inc., Winooski, USA) at
370 nm (reference wavelength 492 nm).
Statistical analysis: Statistical significance was tested using an unpaired Student’s ttest. A P-value less than 0.01 was considered to be statistically significant.
Results
The incorporation of BrdU as a synthetic analog of thymidine into newly synthesized
DNA of replicating cells of the S-phase is used for the measurement of proliferation.
The cells were either served as a control or treated with 50 vg/cell of rAAV-LacZ. For
antisense HMGA AAV treatment the cells were infected with 50 vg/cell of rAAVasHMGA in a combination (50:50 ratios) of both asHMGA1a and asHMGA2.
For comparability the absorbance values were presented as percentage of
proliferation. The proliferation rate of untreated cells was presumed to be 100 %
meaningthat the quotient of the mean values from treated and untreated cells are
expressed as the percentage of proliferation rates of cells exposed to rAAV vectors.
Both rAAV-LacZ and rAAV-asHMGA vectors showed a decrease in proliferation of
the CT1285 cells (Figure 2). Whereas the effect of 50 rAAV-LacZ vg/cells is a
decrease of 21.5 % compared to the untreated control, the P-value is 0.02, which
8
means the decline of proliferation seems to be out of significance. A decrease in
proliferation is shown for the CT1258 cells treated with the rAAV-asHMGA vector
combination. The inhibitory effect of proliferation is about 95.5 % compared to the
control. Statistical analyses using an unpaired Student’s t-test showed a high
significance of decreasing cell proliferation with P<0.0001. (Figure 2).
Inhibition of CT1258 cell proliferation induced by rAAV
140
120
Absorbance (norm alized to %)
*
100
80
60
40
20
**
0
LacZ control LacZ (50 vg/cell)
asHMGA control asHMGA (50 vg/cell)
Figure 2
Effect of cell proliferation inhibition by the addition of rAVV at 50 vg/cell
(white: control, gray: rAAV) *P = 0.02 rAAV-LacZ, **P < 0.001 rAAV-asHMGA (A1a/A2)
Discussion
In many tumors mostly in benign mesemchymal tumors there seems to be a
transcriptional
reactivation
of
HMGA
genes
because
of
chromosomal
rearrangements, as for example in uterine leiomyomas, lipomas and pulmonary
chrondroid harmatomas22,
56, 57
. In case of HMGA2 transcriptional reactivation are
often been detected in these benign tumor entities. Translocations generate a fusion
transcript, which contains the three AT-hooks and ectopic sequences from other
9
genes58, whereas in malign tumors a reactivation of HMGA transcription is caused by
disordered
promoter
and
enhancer
regions
affecting
the
gene
regulation
mechanism59. Furthermore it is proposed that a translocation event within the
HMGA2 gene locus can remove its recognition sites for its corresponding miRNA let760. A high level of HMGA protein expression is an important aspect in neoplasias
concerning their malignant transformation as well as the progress for the
development of metastasis. An overexpression of HMGA1 and HMGA2 genes seems
to be characteristic for many different malign tumors in particular of thyroid, breast,
lung and prostate cancer. Previous in-vitro and in-vivo studies have shown that
antisense HMGA vector transcripts induced by adenoviral vectors were able to
prevent a significant protein synthesis of HMGA, which led to decreasing tumor
growth and proliferation in transfected cancer cells and tissues of the thyroid52. In the
present study the in-vitro infection of canine prostate carcinoma cells by combination
of recombinant antisense HMGA1 and HMGA2 AAV-vectors also show an inhibition
of cell proliferation. The incorporation of BrdU into newly synthesized DNA indicates
the cell division and can be used as tool for indicating cell proliferation. The infection
of canine prostate carcinoma cells with rAAVasHMGA viruses led to a decreased
assembly of BrdU by the means of only 4.5% of the cells showed a proliferation
compared to the untreated control. An inhibitory effect of 21.5 % of rAAV-LacZ can
be estimated but the P-value shows 0.02 and is slightly out of significance. A possible
inhibitory effect of rAAV-LacZ infection accounts to the genetic expression of the
external lacZ gene.
References
1.
2.
3.
4.
5.
6.
10
Davidson P, Gabbay J. Should mass screening for prostate cancer be
introduced at the national level? WHO Regional Office for Europe’s Health
Evidence Network (HEN). 2004:1-12.
Brundtland G. Men, ageing and health - achieving health across the life span.
Geneva: World Health Organisation; 2001.
WHO. Global cancer rates could increase by 50% to 15 million by 2020. World
Health Organization. Available at:
http://www.who.int/mediacentre/news/releases/2003/pr27/en/. 2007.
Boutemmine D, Bouchard N, Boerboom D, et al. Molecular characterization of
canine prostaglandin G/H synthase-2 and regulation in prostatic
adenocarcinoma cells in vitro. Endocrinology. Mar 2002;143(3):1134-1143.
Khanna C, Hunter K. Modeling metastasis in vivo. Carcinogenesis. Mar
2005;26(3):513-523.
Ostrander EA, Wayne RK. The canine genome. Genome Res. Dec
2005;15(12):1706-1716.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
11
Vail DM, MacEwen EG. Spontaneously occurring tumors of companion
animals as models for human cancer. Cancer Invest. 2000;18(8):781-792.
MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of
cancer biology and treatment. Cancer Metastasis Rev. Sep 1990;9(2):125136.
ACS. Detailed Guide: Prostate Cancer. American Cancer Society. 07/26/2006.
Available at:
http://www.cancer.org/docroot/CRI/content/CRI_2_4_2X_What_are_the_risk_f
actors_for_prostate_cancer_36.asp?sitearea=. 2007.
Withrow SJ, MacEwen EG, eds. Small Animal Clinical Oncology. 3 ed.; 2001.
Chiappetta G, Avantaggiato V, Visconti R, et al. High level expression of the
HMGI (Y) gene during embryonic development. Oncogene. Dec 5
1996;13(11):2439-2446.
Rogalla P, Drechsler K, Frey G, et al. HMGI-C expression patterns in human
tissues. Implications for the genesis of frequent mesenchymal tumors. Am J
Pathol. Sep 1996;149(3):775-779.
Hirning-Folz U, Wilda M, Rippe V, Bullerdiek J, Hameister H. The expression
pattern of the Hmgic gene during development. Genes Chromosomes Cancer.
Dec 1998;23(4):350-357.
Chiappetta G, Bandiera A, Berlingieri MT, et al. The expression of the high
mobility group HMGI (Y) proteins correlates with the malignant phenotype of
human thyroid neoplasias. Oncogene. Apr 6 1995;10(7):1307-1314.
Chiappetta G, Tallini G, De Biasio MC, et al. Detection of high mobility group I
HMGI(Y) protein in the diagnosis of thyroid tumors: HMGI(Y) expression
represents a potential diagnostic indicator of carcinoma. Cancer Res. Sep 15
1998;58(18):4193-4198.
Flohr AM, Rogalla P, Bonk U, et al. High mobility group protein HMGA1
expression in breast cancer reveals a positive correlation with tumour grade.
Histol Histopathol. Oct 2003;18(4):999-1004.
Miyazawa J, Mitoro A, Kawashiri S, Chada KK, Imai K. Expression of
mesenchyme-specific gene HMGA2 in squamous cell carcinomas of the oral
cavity. Cancer Res. Mar 15 2004;64(6):2024-2029.
Reeves R, Nissen MS. The A.T-DNA-binding domain of mammalian high
mobility group I chromosomal proteins. A novel peptide motif for recognizing
DNA structure. J Biol Chem. May 25 1990;265(15):8573-8582.
Friedmann M, Holth LT, Zoghbi HY, Reeves R. Organization, inducibleexpression and chromosome localization of the human HMG-I(Y) nonhistone
protein gene. Nucleic Acids Res. Sep 11 1993;21(18):4259-4267.
Johnson KR, Lehn DA, Reeves R. Alternative processing of mRNAs encoding
mammalian chromosomal high-mobility-group proteins HMG-I and HMG-Y.
Mol Cell Biol. May 1989;9(5):2114-2123.
Manfioletti G, Giancotti V, Bandiera A, et al. cDNA cloning of the HMGI-C
phosphoprotein, a nuclear protein associated with neoplastic and
undifferentiated phenotypes. Nucleic Acids Res. Dec 25 1991;19(24):67936797.
Schoenmakers EF, Wanschura S, Mols R, Bullerdiek J, Van den Berghe H,
Van de Ven WJ. Recurrent rearrangements in the high mobility group protein
gene, HMGI-C, in benign mesenchymal tumours. Nat Genet. Aug
1995;10(4):436-444.
Chau KY, Patel UA, Lee KL, Lam HY, Crane-Robinson C. The gene for the
human architectural transcription factor HMGI-C consists of five exons each
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
12
coding for a distinct functional element. Nucleic Acids Res. Nov 11
1995;23(21):4262-4266.
Bustin M. Regulation of DNA-dependent activities by the functional motifs of
the high-mobility-group chromosomal proteins. Mol Cell Biol. Aug
1999;19(8):5237-5246.
Bustin M, Reeves R. High-mobility-group chromosomal proteins: architectural
components that facilitate chromatin function. Prog Nucleic Acid Res Mol Biol.
1996;54:35-100.
Chuvpilo S, Schomberg C, Gerwig R, et al. Multiple closely-linked
NFAT/octamer and HMG I(Y) binding sites are part of the interleukin-4
promoter. Nucleic Acids Res. Dec 11 1993;21(24):5694-5704.
Du W, Maniatis T. The high mobility group protein HMG I(Y) can stimulate or
inhibit DNA binding of distinct transcription factor ATF-2 isoforms. Proc Natl
Acad Sci U S A. Nov 22 1994;91(24):11318-11322.
Thanos D, Maniatis T. The high mobility group protein HMG I(Y) is required for
NF-kappa B-dependent virus induction of the human IFN-beta gene. Cell. Nov
27 1992;71(5):777-789.
Lewis H, Kaszubska W, DeLamarter JF, Whelan J. Cooperativity between two
NF-kappa B complexes, mediated by high-mobility-group protein I(Y), is
essential for cytokine-induced expression of the E-selectin promoter. Mol Cell
Biol. Sep 1994;14(9):5701-5709.
John S, Reeves RB, Lin JX, et al. Regulation of cell-type-specific interleukin-2
receptor alpha-chain gene expression: potential role of physical interactions
between Elf-1, HMG-I(Y), and NF-kappa B family proteins. Mol Cell Biol. Mar
1995;15(3):1786-1796.
Yie J, Merika M, Munshi N, Chen G, Thanos D. The role of HMG I(Y) in the
assembly and function of the IFN-beta enhanceosome. Embo J. Jun 1
1999;18(11):3074-3089.
Cattaruzzi G, Altamura S, Tessari MA, et al. The second AT-hook of the
architectural transcription factor HMGA2 is determinant for nuclear localization
and function. Nucleic Acids Res. 2007;35(6):1751-1760.
Fedele M, Visone R, De Martino I, et al. HMGA2 induces pituitary
tumorigenesis by enhancing E2F1 activity. Cancer Cell. Jun 2006;9(6):459471.
Tessari MA, Gostissa M, Altamura S, et al. Transcriptional activation of the
cyclin A gene by the architectural transcription factor HMGA2. Mol Cell Biol.
Dec 2003;23(24):9104-9116.
Borrmann L, Schwanbeck R, Heyduk T, et al. High mobility group A2 protein
and its derivatives bind a specific region of the promoter of DNA repair gene
ERCC1 and modulate its activity. Nucleic Acids Res. Dec 1 2003;31(23):68416851.
Bandiera A, Bonifacio D, Manfioletti G, et al. Expression of HMGI(Y) proteins
in squamous intraepithelial and invasive lesions of the uterine cervix. Cancer
Res. Feb 1 1998;58(3):426-431.
Bussemakers MJ, van de Ven WJ, Debruyne FM, Schalken JA. Identification
of high mobility group protein I(Y) as potential progression marker for prostate
cancer by differential hybridization analysis. Cancer Res. Jan 15
1991;51(2):606-611.
Rogalla P, Drechsler K, Kazmierczak B, Rippe V, Bonk U, Bullerdiek J.
Expression of HMGI-C, a member of the high mobility group protein family, in
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
13
a subset of breast cancers: relationship to histologic grade. Mol Carcinog. Jul
1997;19(3):153-156.
Rommel B, Rogalla P, Jox A, et al. HMGI-C, a member of the high mobility
group family of proteins, is expressed in hematopoietic stem cells and in
leukemic cells. Leuk Lymphoma. Aug 1997;26(5-6):603-607.
Rogalla P, Drechsler K, Schroder-Babo W, Eberhardt K, Bullerdiek J. HMGIC
expression patterns in non-small lung cancer and surrounding tissue.
Anticancer Res. Sep-Oct 1998;18(5A):3327-3330.
Abe N, Watanabe T, Masaki T, et al. Pancreatic duct cell carcinomas express
high levels of high mobility group I(Y) proteins. Cancer Res. Jun 15
2000;60(12):3117-3122.
Meyer B, Loeschke S, Schultze A, et al. HMGA2 overexpression in non-small
cell lung cancer. Mol Carcinog. May 3 2007.
Diana F, Di Bernardo J, Sgarra R, et al. Differential HMGA expression and
post-translational modifications in prostatic tumor cells. Int J Oncol. Feb
2005;26(2):515-520.
Murua Escobar H, Soller JT, Richter A, et al. The canine HMGA1. Gene. Apr
14 2004;330:93-99.
Winkler S, Murua Escobar H, Eberle N, Reimann-Berg N, Nolte I, Bullerdiek J.
Establishment of a cell line derived from a canine prostate carcinoma with a
highly rearranged karyotype. J Hered. 2005;96(7):782-785.
Winkler S, Murua Escobar H, Meyer B, et al. HMGA2 expression in canine
Model of Prostate Cancer. 2007 (submitted).
Kaplitt MG, Leone P, Samulski RJ, et al. Long-term gene expression and
phenotypic correction using adeno-associated virus vectors in the mammalian
brain. Nat Genet. Oct 1994;8(2):148-154.
Scallan CD, Lillicrap D, Jiang H, et al. Sustained phenotypic correction of
canine hemophilia A using an adeno-associated viral vector. Blood. Sep 15
2003;102(6):2031-2037.
Streck CJ, Dickson PV, Ng CY, et al. Antitumor efficacy of AAV-mediated
systemic delivery of interferon-beta. Cancer Gene Ther. Jan 1 2006;13(1):99106.
Ponnazhagan S, Nallari ML, Srivastava A. Suppression of human alpha-globin
gene expression mediated by the recombinant adeno-associated virus 2based antisense vectors. J Exp Med. Feb 1 1994;179(2):733-738.
Li J, Hu SJ, Sun J, et al. Construction of phospholamban antisense RNA
recombinant adeno-associated virus vector and its effects in rat
cardiomyocytes. Acta Pharmacol Sin. Jan 2005;26(1):51-55.
Berlingieri MT, Manfioletti G, Santoro M, et al. Inhibition of HMGI-C protein
synthesis suppresses retrovirally induced neoplastic transformation of rat
thyroid cells. Mol Cell Biol. Mar 1995;15(3):1545-1553.
Scala S, Portella G, Fedele M, Chiappetta G, Fusco A. Adenovirus-mediated
suppression of HMGI(Y) protein synthesis as potential therapy of human
malignant neoplasias. Proc Natl Acad Sci U S A. Apr 11 2000;97(8):42564261.
Rohr UP, Wulf MA, Stahn S, Steidl U, Haas R, Kronenwett R. Fast and reliable
titration of recombinant adeno-associated virus type-2 using quantitative realtime PCR. J Virol Methods. Oct 2002;106(1):81-88.
Veldwijk MR, Topaly J, Laufs S, et al. Development and optimization of a realtime quantitative PCR-based method for the titration of AAV-2 vector stocks.
Mol Ther. Aug 2002;6(2):272-278.
56.
57.
58.
59.
60.
14
Gattas GJ, Quade BJ, Nowak RA, Morton CC. HMGIC expression in human
adult and fetal tissues and in uterine leiomyomata. Genes Chromosomes
Cancer. Aug 1999;25(4):316-322.
Kazmierczak B, Meyer-Bolte K, Tran KH, et al. A high frequency of tumors with
rearrangements of genes of the HMGI(Y) family in a series of 191 pulmonary
chondroid hamartomas. Genes Chromosomes Cancer. Oct 1999;26(2):125133.
Arlotta P, Tai AK, Manfioletti G, Clifford C, Jay G, Ono SJ. Transgenic mice
expressing a truncated form of the high mobility group I-C protein develop
adiposity and an abnormally high prevalence of lipomas. J Biol Chem. May 12
2000;275(19):14394-14400.
Wood LJ, Mukherjee M, Dolde CE, et al. HMG-I/Y, a new c-Myc target gene
and potential oncogene. Mol Cell Biol. Aug 2000;20(15):5490-5502.
Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses the HMGA2
oncogene. Genes Dev. May 1 2007;21(9):1025-1030.
XVII.
DNA sequence, polymorphism, and mapping of luteinizing hormone
receptor fragment (LHCGR) gene in Great Dane dogs
Santos SE, Murua Escobar H, Sider LH, Winkler S, Aoki SM, Milazzotto MP, Campagnari F, Vannucchi CI, Bullerdiek J, Nolte I, Garcia
JF.
Anim Genet. 2004 Feb;35(1):74-5.
Eigenanteil:
• Durchführung der FISH
• Erstellen der caninen Karyogramme