Positionsklonierung des Gens für Bartter

Werbung
Aus dem Zentrum für Kinderheilkunde und Jugendmedizin
der Albert-Ludwigs-Universität Freiburg im Breisgau
Positionsklonierung des Gens für
Bartter-Syndrom mit Taubheit (BSND)
INAUGURAL-DISSERTATION
zur
Erlangung des Medizinischen Doktorgrades
der Medizinischen Fakultät
der Albert-Ludwigs-Universität
Freiburg im Breisgau
Vorgelegt
2004
von
Eva Maria Frederike Ruf
geboren in
Stuttgart
Dekan
Prof. Dr. M. Werner
1. Gutachter
Prof. Dr. F. Hildebrandt
2. Gutachter
Prof. Dr. F. v. Weizsäcker
Jahr der Promotion
2004
1
INHALTSVERZEICHNIS
ABKÜRZUNGEN ................................................................................................................................................. 3
1.
EINLEITUNG.............................................................................................................................................. 5
1.1. DAS BARTTER-SYNDROM (BS) ................................................................................................................. 5
1.2. KLINIK ....................................................................................................................................................... 6
1.2.1.
Anteatales Bartter Syndrom (aBS) .................................................................................................. 6
1.2.2.
Antenatales Bartter Syndrom mit sensoneuraler Taubheit (SND)................................................... 6
1.2.3.
Klassisches Bartter Syndrom (cBS)................................................................................................. 7
1.2.3.
Gitelman Syndrom (GS) .................................................................................................................. 8
1.3. GENETIK .................................................................................................................................................... 9
1.3.1.
BS Typ 1 .......................................................................................................................................... 9
1.3.2.
BS Typ 2 .......................................................................................................................................... 9
1.3.3.
BS Typ 3 ........................................................................................................................................ 10
1.3.4.
BS Typ 4 ........................................................................................................................................ 10
1.3.5.
Gitelman Syndrom......................................................................................................................... 10
1.4. PATHOLOGIE UND PATHOPHYSIOLOGIE ................................................................................................... 11
1.4.1.
Pathophysiologie der Niere........................................................................................................... 11
1.4.2.
Physiologie und Pathophysiologie des Ohres .............................................................................. 13
1.4.2.1.
Aufbau und Funktion des Ohres ............................................................................................... 13
1.4.2.2.
Genetische Ursachen für Taubheit ........................................................................................... 14
1.5. STRATEGIEN ZUR GENFINDUNG ............................................................................................................... 16
1.5.1.
Physikalische Kartierung .............................................................................................................. 16
1.5.2.
Kopplungsanalyse ......................................................................................................................... 17
1.5.3.
Haplotypenanalyse ........................................................................................................................ 18
1.5.4.
Kandidatengenanalyse .................................................................................................................. 18
2.
ZIELE DIESER ARBEIT......................................................................................................................... 19
3.
FAMILIEN, MATERIALIEN UND METHODEN................................................................................ 20
3.1. FAMILIEN................................................................................................................................................. 20
3.2. MEHRFACH VERWENDETE MATERIALIEN ................................................................................................ 21
3.2.1.
Geräte............................................................................................................................................ 21
3.2.2.
Lösungen ....................................................................................................................................... 21
3.2.3.
Sonstige Materialien ..................................................................................................................... 21
3.3. METHODEN.............................................................................................................................................. 22
3.3.1.
Polymerase-Ketten-Reaktion (PCR).............................................................................................. 22
3.3.2.
Agarose-Gelelektrophorese........................................................................................................... 23
3.3.3.
Haplotypenanalyse ........................................................................................................................ 23
3.3.3.1.
32
3.3.3.2.
Polyacrylamid-Gelelektrophorese............................................................................................ 25
3.3.3.3.
Autoradiographie ..................................................................................................................... 25
P-markierte PCR.................................................................................................................... 23
2
4.
INHALTSVERZEICHNIS
3.3.4.
Haplotype-Sharing-Analyse .......................................................................................................... 26
3.3.4.
Single Strand Conformation Polymorphism (SSCP) ..................................................................... 26
3.3.4.1.
SSCP-Polyacrylamid-Gelektrophorese .................................................................................... 27
3.3.4.2.
Silberfärbung............................................................................................................................ 27
3.3.5.
automatische DNA-Sequenzierung................................................................................................ 28
3.3.6.
Restriktionsverdau......................................................................................................................... 28
3.3.7.
allelspezifische PCR...................................................................................................................... 29
ERGEBNISSE............................................................................................................................................ 30
4.1. HAPLOTYPENANALYSE ZUR WEITEREN EINGRENZUNG DES GENORTS ..................................................... 30
4.1.1.
Eingrenzung mittels Homozygosity mapping ................................................................................ 30
4.1.2.
Haplotype-Sharing-Analyse .......................................................................................................... 38
4.2. MUTATIONSANALYSE .............................................................................................................................. 39
5.
4.2.1.
Ergebnisse der SSCP-Analyse....................................................................................................... 39
4.2.2.
Ergebnisse der Sequenzierung ...................................................................................................... 46
DISKUSSION ............................................................................................................................................ 53
5.1. HAPLOTYPENANALYSE ............................................................................................................................ 53
5.1.1.
Auswahl der Familien ................................................................................................................... 53
5.1.2.
Haplotypenanalyse ........................................................................................................................ 53
5.1.3.
Haplotype-Sharing-Analyse .......................................................................................................... 54
5.2. DAS HUMAN GENOME PROJEKT .............................................................................................................. 55
5.3. KANDIDATENGENE .................................................................................................................................. 56
5.3.1.
funktionelle Kandidatengene......................................................................................................... 56
5.3.2.
Positionelle Kandidatengene für BSND ........................................................................................ 58
5.3.3.
Screening-Methoden...................................................................................................................... 59
5.3.3.1.
SSCP als Screening-Methode ................................................................................................... 59
5.3.3.2.
WAVE Nucleic Acid Fragment Analysis System..................................................................... 60
5.3.3.3.
RT-PCR .................................................................................................................................... 61
5.3.3.4.
direkte Sequenzierung .............................................................................................................. 61
5.4. CHARAKTERISIERUNG DES BSND-GENS .................................................................................................. 61
5.4.1.
Position der Mutationen................................................................................................................ 62
5.5. AUSBLICK AUF WEITERFÜHRENDE ERGEBNISSE ...................................................................................... 63
6.
ZUSAMMENFASSUNG........................................................................................................................... 66
7.
LITERATURVERZEICHNIS ................................................................................................................. 67
3
ABKÜRZUNGEN
θ
Theta
%(v/v)
Volumenprozent
%(w/v)
Gewichtsprozent
aBS
antenatales Bartter Syndrom
APS
Ammonium Persulfat
BAC
bacterial artificial chromosome
BS
Bartter Syndrom
BSND
Bartter Syndrom mit sensoneuraler Taubheit
bp
Basenpaare
cBS
klassisches Bartter Syndrom
cDNA
“complementary DNA”
cM
centi Morgan
ddNTP
Didesoxynucleosidtriphosphat
DAF
“decay acceleration factor”
DNA
Desoxyribonucleinsäure
dNTP
Desoxynucleosidtriphosphat
dRTA
distal renale tubuläre Azidose
EBV
Epstein Barr Virus
EDTA
Ethylendiamintetraacetat
EST
“expressed sequence tag”
Fa.
Firma
FISH
Fluorescenz in-situ Hybridisierung
GS
Gitelman Syndrom
JGA
Juxtaglomerulärer Apparat
kb
Kilobase
LOD-Score
“logarithmic odds ratio”
mRNA
“messenger RNA”
mTAL
dicker aufsteigender Teil der Henle-Schleife
NPH
Nephronophtise
PAC
“P1-related artificial chromosomes”
PGE2
Prostaglandin E2
PCR
“polymerase chain reaction”
ABKÜRZUNGEN
4
RNA
Ribonucleinsäure
SCR
„short consensus repeat“
SND
sensorineural deafness
STS
”sequence tagged side”
tAL
dünner aufsteigender Teil der Henle-Schleife
Taq
Thermus aquaticus
TBE
Tris-Borat-EDTA-Puffer
TEMED
Tetramethylethylendiamin
Tris
Trishydroxymethylaminomethan
U
Unit
YAC
”yeast artificial chromosoms”
ABKÜRZUNGEN
5
1.
EINLEITUNG
EINLEITUNG
1.1. DAS BARTTER-SYNDROM (BS)
Das Bartter-Syndrom ist eine autosomal-rezessiv vererbte Krankheit, die in vier Typen
unterteilt werden kann, die sich im Manifestationsalter und der Schwere des klinischen Bildes
voneinander unterscheiden.
Bartter
et
al.
beschrieben
1962
erstmals
zwei
Patienten
mit
hypokaliämischer
hypochlorämischer metabolischer Alkalose sowie normotensivem Hyperaldosteronismus mit
Hyperplasie des Juxtaglomerulären Apparates (JGA). Hervorgerufen durch einen renal
tubulären Transportdefekt kommt es zu Polyurie mit erhöhter Ausscheidung von Na, K und
Cl. Zusätzlich findet man histologisch eine Hyperplasie der interstitiellen Zellen der Medulla,
die auf eine Erhöhung der renalen Prostaglandinproduktion zurückzuführen ist (Gill et al.,
1976). 1966 berichteten Gitelman et al. über 3 erwachsene Patienten mit intermittierenden
Episoden von Muskelschwäche und Tetanie, Hypokaliämie und Hypomagnesiämie, jedoch
ohne Polyurie. Patienten mit neonataler Manifestation und schwererer klinischer
Symptomatik als weitere Variante des klassischen Bartter-Syndroms wurden beschrieben
(Marlow et al., 1982; Rodriguez et al., Ohlsson et al., 1984; Proesmans et al., 1985; Seyberth
et al.).
6
EINLEITUNG
1.2. KLINIK
1.2.1. Antenatales Bartter Syndrom (aBS)
Das antenatale BS (aBS) ist charakterisiert durch massive isoosmolare bis hypoosmolare
Polyurie,
die
sich
bereits
intrauterin
manifestiert
und
zu
Polyhydramnion
und
Frühgeburtlichkeit in der 24.-30. SSW führt. In den ersten 4-6 Lebenswochen kommt es durch
exzessiven renalen Salzverlust mit Ausscheidung von 12-50ml/kg/h hypoosmolaren Urins zu
einem Gewichtsverlust von bis zu 25% und zu hypokaliämischer hypochlorämischer
metabolischer Alkalose. Der Volumenmangel bedingt einen hyperreninämischen jedoch
normotensiven Hyperaldosteronismus. Im weiteren Verlauf sind Hyperkalziurie, frühzeitige
medulläre Nephrokalzinose und Hyperprostaglandinämie mit rezidivierenden Phasen
lebensbedrohlicher Exsikkose und Fieber kennzeichnend. Bei zu spätem Therapiebeginn
kommt es zu einer Wachstumsretardierung und einer Gedeihstörungen. Einige Patienten
fallen durch eine dreieckige Gesichtsform mit hervorsthender Stirn, großen Augen,
abstehenden Ohren und herunter hängenden Mund auf.
Therapeutisch steht die Volumen- und Elektrolytsubstitution, insbesondere die Behandlung
der Hypokaliämie mit KCl, im Vordergrund. Zum anderen werden kaliumsparende Diuretika
wie Spironolacton eingesetzt. Durch Gabe von Indomethacin als Cyclooxygenasehemmer
wird die Polyurie vermindert und die körperliche Entwicklung insgesamt begünstigt. (Ohlson
et al. 1984, Proesmans et al. 1985; Seyberth et al. 1985, 1998).
1.2.2. Antenatales Bartter Syndrom mit sensoneuraler Taubheit (SND)
Das antenatale BS mit sensoneuraler Taubheit ähnelt in seinem klinischen Erscheinungsbild
sehr der antenatalen Form, ist jedoch zusätzlich durch Innenohrschwerhörigkeit
gekennzeichnet. Ein weiteres differentialdiagnostisches Kriterium ist das Entwickeln eines
chronischen Nierenversagens, das beim aBS normalerweise nicht auftritt (Jeck et al., 2001).
Auf Behandlung mit Indomethacin sprechen die Patienten nur schlecht an, was für einen
schwereren Verlauf der Krankheit spricht. Zum Teil müssen die Kinder über längere Zeit
künstlich ernährt werden.
7
EINLEITUNG
1.2.3. Klassisches Bartter Syndrom (cBS)
Patienten mit cBS entwickeln innerhalb der ersten Lebensjahre eine Polyurie, Polydipsie,
rezidivierendes Erbrechen und tendieren zur Exsikkose. Der Krankheitsverlauf ist im
Vergleich zur neonatalen Form insgesamt deutlich milder, eine Nephrokalzinose fehlt.
Teilweise können ab der späten Kindheit Müdigkeit, Muskelschwäche, Krämpfe und
rezidivierende Carpopedale Spasmen beobachtet werden. Wie bei der antenatalen Form
besteht eine Hypokaliämie mit Blutkonzentrationen zwischen 1,5 und 2,5 mEq/l, meist
begleitet von Hypochlorämie und metabolischer Alkalose. Die renale Ausscheidung von K,
Na, und Cl ist erhöht. im Unterschied zum Gitelman Syndrom ist die renale Ausscheidung
von Ca normal oder erhöht.
Neonatales BS
"Klassisches" BS
Neonatales BS mit Gitelman- Syndrom
Innenohrschwerhörigkeit
Manifestations- neonatal
alter
SchwangerPolyhydramnion/
schaft
Frühgeburtlichkeit
frühe Kindheit
neonatal
Klinik
Wachstumsretardierung
z.Teil Exsikkose
insgesamt milder
Verlauf
Wachstumsretardierung
Exsikkose
Nephrokalzinose
Innenohrschwerhörigkeit
terminales
Nierenversagen
intermittierende
Muskelschwäche
Tetanie
metabolische
Alklalose
Hypokaliämie
erhöhte renale
NaCl- und CaAusscheidung
hyperreninämischer
Hyperaldosteronismus
metabolische
Alklalose
Hypokaliämie
stark erhöhte renale
NaCl- und CaAusscheidung
hyperreninämischer
Hyperaldosteronismus
metabolische
Alkalose
Hypokaliämie
Hypomagnesiämie
renale NaClAusscheidung
normal bis leicht
erhöht, CaAusscheigung
vermindert
hyperreninämischer
Hyperaldosteronismus
Wachstumsretardierung
Exsikkose
Nephrokalzinose
Salz-/ Wasser- metabolische
haushalt
Alklalose
Hypokaliämie
stark erhöhte renale
NaCl- und CaAusscheidung
hyperreninämischer
Hyperaldosteronismus
oft Polyhydramnion/ Polyhydramnion/
Frühgeburtlichkeit
Frühgeburtlichkeit
Tab. 1.1 klinische Charakterisierung des Bartter Syndroms
Kindheit oder
Adoleszenz
_
8
EINLEITUNG
1.2.3. Gitelman Syndrom (GS)
Die Symptomatik bei Patienten mit GS ist oft schwach ausgeprägt. Erste Symptome zeigen
sich erst in der Adoleszenz bzw. im frühen Erwachsenenalter (Simon et al. 1996a). Es treten
übergangsweise Episoden von Müdigkeit und Tetanie auf, die von Bauchschmerzen,
Erbrechen und Fieber begleitet werden (Gitelman et al. 1966). Das Fehlen von
Polyhydramnion und Frühgeburtlichkeit sowie Polyurie und Wachstumsretardierung sind
wichtige Kriterien in der Differentialdiagnose zum cBS. Charakteristisch sind außerdem
Hypomagnesiämie, Hypokaliämie, leichte metabolische Alkalose und hyperreninämischer
Hyperaldosteronismus. Eine Hyposthenurie ist meist nicht vorhanden, jedoch können
Hypermagnesiurie, Hyperkaliurie und eine verminderte Ca-Ausscheidung unter 0,5
mg/kg/Tag beobachtet werden (Rodriguez-Soriano et al., 1998).
9
EINLEITUNG
1.3. GENETIK
Das BS ist eine heterogene Erkrankung, für die in den letzten Jahren für 3 Varianten des BS
und das GS die verantwortlichen Gene identifiziert werden konnten (Tab. 1.2). Bei allen kann
von einem autosomal-rezessiven Vererbungsmodus ausgegangen werden, da die Inzidenz bei
beiden Geschlechtern gleich ist und die Eltern keine Krankheitszeichen zeigen.
Erkrankung Locus
Symbol
BS Typ 1
15q15-21
Gen
Genprodukt
Klinisches Bild
SLC12A1
aBS
BS Typ 2
11q24-25
KCNJ1
BS Typ 3
1p36
CLCNKB
BS Typ 4
Gitelman
Syndrom
1p31
16q13
?
SLC12A3
Furosemid-sensitiver
Na+-K+-2Cl-Kotransporter
(NKCC2)
luminaler ATPregulierter K+-Kanal
basolateraler Cl-Kanal (CLC-Kb)
?
Thiazid-sensitiver
Na+/Cl--Kotransporter
aBS
CBS/ aBS
aBS mit SND
Gitelman
Syndrom (GS)
Tab. 1.2 genetische Charakterisierung des Bartter-Syndroms
1.3.1. BS Typ 1
Für das antenatale Bartter-Syndrom hat sich gezeigt, dass es sich um eine heterogene
Erkrankung handelt. Im BS Typ 1 sind Mutationen in SLC12A1 beschrieben (Simon et al.,
1996a). Das Gen, lokaliesiert auf Chromosom 15q15-21, enthält 24 Exone und kodiert für den
Furosemid-sensitiven Na+-K+-2Cl--Kanal (NKCC2) im dicken aufsteigenden Teil der Henle
Schleife (mTAL) (Abb. 1.1).
1.3.2. BS Typ 2
Defekte in KCNJ1, das für ROMK, kodiert führen ebenfalls zum klinischen Bild des aBS.
(Simon et al., 1996b, International Collaborative Study Group for Bartter-like Syndromes,
1997, Vollmer et al., 1997) Bei ROMK handelt es sich um einen ATP-regulierten K+-Kanal
im mTAL, der reabsorbiertes K+ zurück ins tubuläre Lumen zurück transportiert und so den
10
EINLEITUNG
für die Funktion von NKCC2 notwendigen K+-Gradienten aufrecht erhält (Greger et al.,
1981).
1.3.3. BS Typ 3
Für das cBS sind Deletionen, frame-shift, nonsense, missense oder splice Mutationen in
CLCNKB, lokalisiert auf Chromosom 1p36, verantwortlich. Das Genprodukt von CLCNKB
ist der spannungsgesteuerte basolaterale Cl--Kanal ClC-Kb (Abb. 1.1).
1.3.4. BS Typ 4
Brennan et al. identifizierten 1998 einen Genort auf Chromosom 1p31 mit einem Intervall von
3,4 cM zwischen den Markern D1S1661 und D1S2690 für das Bartter Syndrom assoziiert mit
SND. Der Bereich konnte 1999 von Vollmer et al. mit den flankierenden Markern D1S2661
und D1S475 auf 2 cM weiter eingegrenzt werden.
1.3.5. Gitelman Syndrom
Obwohl beim GS einzelne Fälle bekannt sind, in denen ein Elternteil eines Betroffenen auch
erkrankt ist, kann auch hier von einer autosomal-rezessiv vererbten Krankheit ausgegangen
werden (Betinelli et al., 1995). Bei nahezu allen Betroffenen können Mutationen in SLC12A3
gefunden werden. SLC12A3 kodiert für NCCT, einen Thiazid-sensitiven Na+-Cl-Kotransporter, der hauptsächlich im distalen Konvolut exprimiert wird (Abb. 1.1).
proximales
Konvolut
Vas afferens
Juxtaglomerulärer
Filtration
Apparat distales
Konvolut
Gitelman
Syndrom
Reab
sorptio
Sekretion
Sammelrohr
pars
recta
distaler
Tubulus
Bartter
Syndrom
1-3
Überleitungsstück
HENLE-Schleife
Ausscheidung
Abb.1.1.
Expression
der
Genprodukte
bei
Bartter
Syndrom Typ 1 – 3 und beim
Gitelman Syndrom
Die verantwortlichen Gene für BS
Typ 1 – 3, NKCC2, ROMK und
CLCNK-b werden im dicken
aufsteigenden Teil der HenleSchleife exprimiert. Der dicke
aufsteigende Teil der HenleSchleife ist für die Wasser- und
Elektrolytreabsorption
von
Bedeutung.
NCCT, das Gen, das Gitelman
Syndrom verursacht, wird im
distalen
Konvolut
(DCT)
exprimiert. (Bartter et al., 1962,
Clive 1995, Fanconi et al., 1971,
Hildebrandt F, 1997, RodriguezSoriano, 1998, Stein, 1985)
11
EINLEITUNG
1.4. PATHOLOGIE UND PATHOPHYSIOLOGIE
1.4.1. Pathophysiologie der Niere
Histologisch findet man beim aBS und beim cBS in der Niere eine Hyperplasie des
juxtaglomerulären Apparates (JGA). In einigen Fällen ist zusätzlich noch eine Hyperplasie
interstitieller medullärer Zellen zu erkennen. Beim aBS kann kein Tamm-Horsfall-Protein
nachgewiesen werden. Als Langzeitfolge kann es zu glomerulärer Sklerose, tubulärer
Atrophie, interstitieller Fibrose und Zystenbildung, die vor allem für BSND typisch ist,
kommen. Das histologische Bild erinnert alles in allem stark an das Bild einer
Nephronophtise, für die chronische renale Fibrose und Zystenbildung an der Grenze zwischen
Rind und Mark charakteristisch sind.
Bei Patienten mit GS ist der Biopsiebefund meist unauffällig. In Ausnahmefällen ist eine
Hyperplasie des JGA zu sehen. (Rodriguez-Soriano et al., 1994)
a
b
c
Abb. 1.2. Morphologischer Befund der Niere von Patient II-1 der Familie F708
a, Der sonographischer Befund der rechten Niere im Alter von 20 Monaten zeigt ein echogenitätserhöhtes
Parenchym mit Verlust der corticomedullären Differenzierung. b, Renale Histologie: der mikroskopische
Überblick zeigt eine dichte mononucleäre Infiltration mit fokalen follikelartigen Clustern (Vergrößerung
160x). c, Bei höherer Vergrößerung (400x) erkennt man eine tubulointerstitielle Fibrose und tubuläre
Atrophie, die >40% des tubulointerstitiellen Raums betrifft. Ferner finden sich fokale Kalzifikationen und
dichte mononukleäre Infiltrationen im Interstitium. Die Glomeruli sind zum Teil sklerosiert, wobei die
anderen ein kollabiertes kapilläres Konvolut und eine Verdickung der Basalmembran am vaskulären Pol
der Bowman-Kapsel aufweisen.
(Jeck et al., 2001)
Pathophysiologisch ist für das BS der gestörte Elektrolyttransport im mTAL verantwortlich.
Der Flüssigkeits- und NaCl-Verlust führt durch die daraus folgende Hypovolämie zu einem
normotensiven hyperreninämischen Hyperaldosteronismus. Die gesteigerte Reninsynthese
bedingt eine Hyperplasie des JGA. Das verminderte Extrazellulärvolumen löst eine
gesteigerte Prostaglandinproduktion aus, die zu Fieber führt und über den EP3-Rezeptor die
12
EINLEITUNG
Adenylatcyclase inhibiert. Die gesteigerte intrazelluläre cAMP-Konzentration wiederum
hemmt CLC-Kb und verschlechtert so zusätzlich den Elektrolyttransport.
Der parazelluläre Ca++- und Mg++-Transport ist wegen des reduzierten elektrochemischen
Gradienten gestört, es kommt zu einer Hypokalziämie.
Abb. 1.3. Bisher sind Defekte in drei
Transportern,
die
im
dicken
TUBULUS
BLUT
aufsteigenden Teil der Henle-Schleife
(mTAL) exprimiert werden, bekannt,
Furosemid
die
für
das
Bartter
Syndrom
3Na+
verantwortlich sein können. Defekte in
NKCC2, der für einen luminalen
Na+
2K+
NKCC2
K+
Na+K+2Cl--Cotransporter kodiert, der
BS-Typ1
Cl
2ClCLCKB
durch Furosemid gehemmt wird, führen
K+
BS-Typ3
zu BS Typ 1. BS Typ 2 findet man
ClROMK
Mutationen in ROMK, dem luminalen
K+
BS-Typ2
ATP-regulierten Kaliumkanal, der den
cAMP
K+-Gradienten, der für die Funktion von
NKCC2 notwendig ist, aufrecht erhält.
ATP
Für BS Typ3 sind Defekte in CLC-Kb,
Mg++, Ca++
Indomethacin
einem
basolateralen
Chloridkanal,
verantwortlich. In allen drei Fällen
resultiert verminderte NaCl- Reabsorption und darauf folgend eine reduzierte Wasserretention, die den Verlust von Ca++ und Mg++, sowie den
hyperreninämischen Hyperaldosteronismus bedingt. Durch das verminderte Extrazellulärvolumen wird die
PGE2-Synthese gesteigert. PGE2 inhibiert über den renalen EP3-Rezeptor die Adenylatcyclase. Die
dadurch verminderte intrazelluläre cAMP- Konzentration hemmt zusätzlich die Funktion von CLC-Kb.
Indomethacin als Cyclooxigenasehemmer reduziert den PGE2-Spiegel im Blut und verbessert so indirekt
die Funktion von CLC-Kb und damit auch die Elektrolyt- und Wasserreabsorption.
(Hildebrandt, 2000)
Beim GS ist der Elektrolyttransport im Gegensatz zum BS nicht im mTAL sondern im
distalen Konvolut (DCT) gestört. Durch reduzierte NaCl-Rückresorption kommt es auch hier
durch Wasser- und Na-Verlust zu hyperreninämischem Hyperaldosteronismus, der jedoch
weniger stark ausgeprägt ist als beim BS. Die verminderte intrazelluläre Na-Konzentration
führt zu einer vermehrten Ca++-Ausscheidung. Wie die für das GS charakteristische
Hypomagnesiämie pathophysiologisch zustande kommt, ist bisher nicht bekannt.
TUBULUS
Thiazide
NCCT
Na+
Cl-
Ca++
BLUT
3Na+
-
Cl
Ca++
Ca++
A 2K+
A
3Na+
Abb. 1.4. Die Na+-Cl--Rückresorption über den
luminale Na+-Cl--Kotransporter NCCT wird
sekundär durch die Na+-K+-ATPase angetrieben.
NCCT wird pharmakologisch durch Thiazide
gehemmt.
Der
Na+-Verlust
führt
zu
hyperreninämischem Hyperaldosteronismus mit
hypokaliämischer metabolischer Alkalose. Durch
die verminderte Na+-Aufnahme in die Zelle wird
die Aktivität des basolateralen Na+-Ca++Austauschers und gleichzeitig die luminale Ca++Rückresorption gesteigert. Dies führt zu
Hypocalciurie. Der Entstehungsmechanismus der
Hypomagnesiämie ist bisher nicht geklärt.
(Hildebrandt, 2000)
13
1.4.2.
EINLEITUNG
Physiologie und Pathophysiologie des Ohres
Da das Verständnis über die Entstehung von Taubheit mit gleichzeitiger Nierenbeteiligung für
die spätere Bewertung von Kandidatengenen von Bedeutung ist, soll hier kurz auf Aufbau und
Funktion der Ohren eingegangen werden.
1.4.2.1.
Aufbau und Funktion des Ohres
Die Cochlea besteht aus drei übereinander liegenden Gängen (Scala vestibuli, Scala tympani,
Ductus cochlearis=Scala media), die alle flüssigkeitsgefüllt sind. Von der Scala vestibuli, die
mit der Scala tympani am Helicotrema verbunden ist und die beide mit Perilymphe gefüllt
sind, ist der Ductus chochlearis zu differenzieren, der mit Endolymphe gefüllt ist und blind
endet. Die Perilymphe ähnelt eher einer extrazellulären Flüssigkeit, die Endolymphe, von der
Stria vascularis gebildet, ist mit einem K+-Konzentration von 145mmol/l und einer Na+Konzentration von 1mmol/l besser mit einer intrazellulären Flüssigkeit zu vergleichen. Die
Scala vestibuli wird gegen den Ductus chochlearis durch die Reissner’sche Membran
abgegrenzt, zwischen Scala tympani und Ductus cochlearis liegt die Basilarmembran. Auf der
Basilarmembran liegt das Corti-Organ, in welchem in Form von Haarzellen die
Sinnesrezeptoren liegen. Es gibt drei Reihen äußere Haarzellen
und eine Reihe innere
Haarzellen. Als Hörsinneszellen fungieren nur die inneren Haarzellen von denen jede mit
einer eigenen afferenten Faser verbunden ist. Über dem Corti-Organ liegt die
Tektorialmembran, an der die Haarzellen durch “tip links” befestigt sind (Abb. 1.5.a).
Scala media
Tektorialmembran
Reissner Membran
Scala vestibuli
Innere Haarzelle
Stria
Tektorial- vascularis
membran
Haarzellen
Stereovilli
äußere
innere
Haarzellen
Basilarmembran
Limulus
Knochen
Tunnel Stützzellen
Pfeilerzellen
Scala tympani
Basilarmembran
Nervenfasern
Abb. 1.5.a Schemazeichnung eines histologischen Querschnitts
durch das Coritorgan
(ROCHE-Lexikon)
Nervenfasern
Abscherung
der Stereovilli
Auslenkung
Abb. 1.5.b Abscherung der Stereovilli bei Schallreiz
14
EINLEITUNG
Die in den äußeren Gehörgang eingetretenen Schallwellen treffen auf das Trommelfell,
welches das Schallphänomen über die Gehörknöchelchenkette an die Perilymphe der Scala
vestibuli weitergibt. Durch die Schwingungen des Stapes wird die inkompressible
Perilymphflüssigkeit in der Scala vestibuli angestoßen. Zum Druckausgleich schwingt die
Membran des ovalen Fensters gegenphasig mit. Diese winzigen Flüssigkeitsverschiebungen
führen zu einer schallsynchronen Auf- und Abbewegung der Basilarmembran, den sog.
Wanderwellen. Jede Welle hat ihr Amplkitudenmaximum und damit das Maximum der
Schneckengangsauslenkung an einem für diese Frequenz ganz charakteristischen Punkt. Am
Maximum der Amplitude kommt es durch die relativen Bewegungen zwischen Basilar- und
Tektorialmembran zur Abscherung der Villi (Abb. 1.5.b), die durch resultierende Spannung
der “tip links” zur Öffnung bestimmter Ionenkanäle führt. Dies löst durch Motormoleküle wie
Aktin- und Myosinfilamente die aktive Kontraktion der Haarzelle aus. Diese Kontraktion
erfüllt ein Verstärkerfunktion, die die Entstehung des Aktionspotentials je nach Tonfrequenz
an der entsprechenden Stelle der Cochlea bewirkt.
1.4.2.2.
Genetische Ursachen für Taubheit
Taubheit ist eine relativ häufiger vererbter Defekt. Ungefähr eines von 800 Kindern wird mit
deutlichem Hörverlust geboren. Bei den über 70-jährigen leiden sogar über 60% an einem
nicht syndromische Taubheit
Molekül
Gen
Protein
connexin 26
GJB2
Kanalkomponente
KCNQ 4
KCNQ4
Kanalkomponente
Myosin 7A
MYO7A
Motormolekül
diaphanous
DIAPH1
Protein des Cytoskeletts
POU3F4
POU3F4
Transkriptionsfaktor
Kollagen11α2
COLL11A2
Extrazelluläre Matrix
Otoferlin
OTOF
Synaptische Komponente
Claudin 14
CLDN14
Junction Protein
Otocadherin
CDH23
Cadherin
Tab. 5.1 nicht syndromische Taubheitsgene
15
EINLEITUNG
Hörverlust von 25dB oder mehr (Steel et al., 2001). Über die Hälfte der Fälle von Taubheit im
Kindesalter sind monogen vererbt. Hingegen ist Taubheit im Alter eher multifaktoriell
bedingt. Daher sind neue Erkenntnisse über die Entstehung von Taubheit von großer
Bedeutung. Bis 1996 waren noch keine nicht-syndromischen Taubheitsgene identifiziert.
Inzwischen sind 19 neue Gene bekannt, die Taubheit ohne weitere organische
Manifestationen auslösen. Einige Beispiele hierfür sind in Tab. 5.1 dargestellt.
Mit Taubheit assoziierte Syndrome sind in großer Zahl bekannt. Bisher sind über 400
verschiedene Syndrome, die mit Hörverlust einhergehen, beschrieben. Der genetische Defekt
kann sich hierbei neben dem Ohr in unterschiedlichen Organen oder Geweben manifestieren.
syndromische Taubheit
Molekül
Gen
Connexin 32 GJB1
zusätzlich betroffene Protein
Strukturen
periphere Nerven
Kanalkomponente
ATP6B1
ATP6B1
renale Azidose
Ionen Pumpe
KvLQT1
KCNQ1
Herz
Kanalkomponente
IsK
KCNE1
Herz
Kanalkomponente
Myosin 7A MYO 7A
Retina
Motormolekül
EYA1
EYA1
Niere, Kiefer
Transkriptionsfaktor
Kollagen 4
COL4A3/4/5 Niere
Kollagen 2
COL2A1
Harmonin
USH1C
Otocadherin CDH23
Augen, Gelenke,
Gaumen
Retina
Retina
Tab. 5.2 syndromische Taubheitsgene
Extrazelluläre Matrix
Extrazelluläre Matrix
Syndrom
Charcot-MarieSyndrom
dRTA mit
Taubheit
Jervell und
Lange-Nielsen
Jervell und
Lange-Nielsen
Usher-Syndrom
1B
branchio-otorenales Syndrom
Alport-Syndrom
SticklerSyndrom
PDZ Clustering Protein Usher-Syndrom
1C
Cadherin
Usher-Syndrom
1D
16
EINLEITUNG
1.5. STRATEGIEN ZUR GENFINDUNG
1.5.1. Physikalische Kartierung
Die Lokalisierung von Markern auf Klonen und die Position verschiedener Klone zueinander,
die z.B. durch STS content mapping bestimmt werden kann (Theorie siehe Sambrook et al.,
1989), gibt eine räumliche (physikalische) Lokalisierung der Marker. Eine Serie
überlappender Klone wird Contig genannt (engl. contiguous). Von der Größe der verwendeten
Klone, YACs („yeast artificial chromosomes“, genomische Fragmente mit einer Größe bis
2000kb), BACs („bacterial artificial chromosome“) und PACs („P1-related artificial
chromosome“, Größe bis 150 kb), wird die Auflösung der physikalischen Karte bestimmt. Die
höchstmögliche physikalische Auflösung wird durch die DNA-Sequenz erreicht. Inzwischen
stehen im Internet im Rahmen des Human Genome Project über 90% der Sequenz des
menschlichen Genoms zur Verfügung. (http://www.ncbi.nlm.nih.gov/ genome/guide/human/)
Der Region können ESTs („expressed sequence tags“) oder cDNAs zugeordnet werden. Zur
Identifikation vorhandener Gene stehen verschiedene Verfahren zur Verfügung (Parrish und
Nelson, 1993):
•
Zoo-Blotting: Hybridisierung humaner DNA-Klone mit Säugetier-DNA (kodierende
Sequenzen sind stärker konserviert als nicht kodierende) (Monaco et al., 1986)
•
CpG-Inseln: am 5‘-Ende von Genen gehäuftes Auftreten von unmethylierten CG-reichen
Sequenzabschnitten (Cross und Bird 1995)
•
Hybridisierung mit mRNA/cDNA: Hybridisierung von Klonen mit mRNA aus
verschiedenen Zelllinien („Northern Blotting“) oder Screening mit cDNA-Banken
(Rommens et al., 1989)
•
Exonidentifikation: Subklonierung genomischer DNA-Klone in einen Expressionsvektor
und künstliches Splicen („exon trapping“) (Duyk et al., 1990)
•
cDNA-Selektion (Lovett et al., 1991)
•
Computeranalyse von DNA-Sequenzen: Suche nach Sequenzhomlogien von PACSequenzen in Datenbanken und Vorhersage von Exonen mittels Computerprogrammen
(http://www.genome.dkfz-heidelberg.de/cgi-bin/GENSCAN/genscan.cgi/)
17
•
EINLEITUNG
Inzwischen stehen Genkarten exprimierter Gene des menschlichen Genoms zur
Verfügung (http://www.sciencemap.org/genome2001,
http://www.sanger.ac.uk/HGP/Genes/, http://www.nature.com/genomics/human/)
den Vorteil, dass die DNA-Abschnitte, die genetische Information enthalten, meist den
interessanteren und medizinisch/biologisch bedeutsameren Teil darstellen.
1.5.2. Kopplungsanalyse
Unter Kopplung versteht man die gemeinsame Vererbung von zwei oder mehreren Allelen
auf die Nachkommen (cosegregation) wegen der engen physischen Nachbarschaft ihrer Loci
auf dem Genom. Genetische Karten geben Auskunft über die Rekombinationshäufigkeit
zwischen Markern. Die Rekombinationsrate wird mit dem griechischen Buchstaben θ (theta)
bezeichnet. Zwei Loci, die voneinander unabhängig segregieren, sind nicht gekoppelt und
weisen zwischen sich eine Rekombinationsrate von θ = ½ auf. Die Rekombinationsrate θ
zwischen gekoppelten Loci ist < ½. Bei immer enger werdender Kopplung strebt θ gegen 0,
d.h. ein Rekombinationsereignis zwischen den beiden Loci wird immer unwahrscheinlicher.
Das Ziel einer Kopplungsanalyse ist es, θ zu schätzen und die Hypothese „keine Kopplung“
( = ½) gegen die Hypothese „Kopplung“ ( < ½) zu testen.
Zur Durchführung einer Kopplungsanalyse werden polymorphe Mikrosatelliten-Marker,
verteilt über das ganze Genom mit einem Abstand von durchschnittlich 10cM, an mehreren
Familien bzw. einer großen Familie untersucht. Ein cM entspricht dabei dem Auftreten einer
Rekombination in 100 Meiosen. Anhand aufgetretener Rekombinationen zwischen
Mikrosatelliten-Markern in verschiedenen Generationen kann im Vergleich zwischen
Betroffenen und Gesunden der Genort eingegrenzt werden.
Durch Berechnung des LOD-Scores für einen Marker kann die Kopplungswahrscheinlichkeit
des Krankheitsgenes an den Genort bestimmt werden. Ein positives Kopplungsverhältnis
zwischen Marker und Erkrankung wird angenommen, wenn der LOD-Score >3 ist. Ein LODScore <-2 schließt diesen Genort nahezu aus.
18
EINLEITUNG
1.5.3. Haplotypenanalyse
Unter einem Haplotypen versteht man ein Allel-Muster für verschiedene, benachbarte Loci
auf dem gleichen Chromosom. Zur Haplotypenanalyse werden hoch polymorphe SatellitenMarker, die repetitive di-, tri-, oder tetranukleoid-Sequenzen enthalten, verwendet (Weber
und May, 1989). Die Basis dieser genetischen Untersuchung ist die Tatsache, dass sämtliche
Gene bzw. Allele eines Chromosoms eine Kopplungsgruppe darstellen und so während der
Meiose als Einheit weitergegeben werden. Dieses theoretisch absolute Kopplungsverhältnis
wird durch Rekombination zwischen mütterlichen und väterlichen Allelen (Crossover)
gebrochen. Die Stärke einer Kopplung wird durch die Rekombinationsfraktion θ beurteilt. θ
nimmt für den Fall einer absoluten Kopplung den Wert 0 an, während θ = 0,5 die
unabhängige Segregation zeigt.
Befindet sich ein polymorpher Marker in der Nähe des Krankheitsgens, so ist die
Wahrscheinlichkeit, dass er mit dem Gen gemeinsam vererbt wird, sehr hoch. So kann das
Intervall, das als Genort in Frage kommt weiter eingegrenzt werden.
1.5.4. Kandidatengenanalyse
Es gibt die Möglichkeit der funktionellen und der positionellen Kandidatengenanalyse.
Funktionelle
Kandidaten
stehen
pathogenetisch
mit
der
Krankheit
in
direktem
Zusammenhang.
Positionelle Kandidaten dagegen sind all die Gene, die in der durch Eingrenzung definierten
kritischen Region liegen.
Zur Untersuchung der Kandidaten können verschiedene Methoden eingesetzt werden:
•
SSCP („single strand conformation polymorphism“) (Orita et al., 1989)
•
WAVE® Nucleic Acid Fragment Analysis (Taylor et al., 2000)
•
RT-PCR
•
direkte Sequenzierung
19
2.
ZIELE DIESER ARBEIT
ZIELE DIESER ARBEIT
Zu Beginn der Arbeit war bekannt, dass der Genort für BSND auf Chromosom 1p31 liegt
(Landau et al., 1995). Das kritische Intervall war von Vollmer et al. (2000) bereits auf ca. 2
Mb eingegrenzt worden und wurde durch ein PAC-Kontig überspannt: 654h19, 167a19,
845c20, 705f19, 277a12, RP5-1099n07, RP11-12c17, 109i2 und 633h17: zwischen den
Klonen RP11-12c17 und 109i2 lag eine Lücke, von der im Rahmen des Human Genom
Projekts noch keine Sequenz bekannt war, die jedoch durch Screening der human genomic
BAC library BAC-5331 (GenomSystemsInc, St. Louis, Missouri) durch einen Klon (GS1118i2) überbrückt wurde.
Ziel dieser Arbeit war zunächst, das als Genort in Frage kommende Intervall auf Chromosom
1p31 weiter einzugrenzen. Hierzu sollte zunächst eine Haplotypenanalyse an einer nicht
konsanguinen und 9 konsanguinen Familien durch homozygosity-mapping durchgeführt
werden. Im Anschluss daran unter der Hypothese, dass die Familien untereinander entfernt
verwandt sind eine Sharing-Analyse durchgeführt werden, um den Bereich eventuell noch
weiter verkleinern zu können.
Der zweite Teil der Arbeit befasst sich mit der Untersuchung der Gene, die in dem
eingegrenzten Intervall als Kandidaten in Frage kommen. Dabei sollten die Gene mittels
SSCP und direkter Sequenzierung untersucht werden. Nach Identifizierung des Gens sollte
bei allen anderen Betroffenen eine Mutationsanalyse durchgeführt werden.
20
3.
FAMILIEN, MATERIAL UND METHODEN
FAMILIEN, MATERIALIEN UND METHODEN
3.1. FAMILIEN
Untersucht wurden 10 Familien, bei 9 war Konsanguinität bekannt. Fünf der Familien waren
türkischer Abstammung, zwei tunesischer, eine libanesischer und je eine französischer bzw.
britischer Abstammung.
Die Klinik 6 dieser Familien mit insgesamt 8 Betroffenen wurde von Jeck et al. 2001
veröffentlicht. Alle Patienten zeigten eine schwere Form des aBS kombiniert mit
Innenohrschwerhörigkeit. Die Kinder kamen in der 27-33 SSW auf die Welt und hatten ein
Geburtsgewicht zwischen 1100g und 1700g. Die Patienten hatten eine eingeschränkte
glomeruläre Funktion und mit Ausnahme eines Patienten erhöhte Serum-Kreatininwerte
zwischen 1 und 6 mg/dl. Die Fähigkeit zur Harnkonzentrierung war fast komplett aufgehoben.
Ab einem Alter von 6 Monaten konnte durchweg sonographisch eine gesteigerte Echogenität
sowohl im Cortex als auch in der Medulla der Nieren gezeigt werden. Bei 2 Kindern konnte
eine Nephrokalcinose festgestellt werden. Bemerkenswert ist, dass alle 8 Patienten ein
chronisches Nierenversagen entwickelten. Zwei der Patienten wurden im Alter von 4 bzw. 14
Jahren wegen terminalen Nierenversagens transplantiert und zeigten im 2 und 4 Jahre Followup eine normale Funktion des Spenderorgans.
Durch frühen Beginn einer Indomethacin-Therapie konnte bei 4 von 5 therapierten Kindern
ein Rückgang des Flüssigkeits- und Salzverlustes beobachtet. Die günstige Auswirkung der
Indomethacin-Therapie auf die Verbesserung der Symptome und den Rückgang der
hypokaliämischen Alkalose war jedoch sehr viel geringer als bei Indomethacin-behandelten
Bartter-Patienten, bei denen Mutationen in NKCC2 oder ROMK beschrieben sind. (Seyberth
et al., 1987)
21
FAMILIEN, MATERIAL UND METHODEN
3.2. MEHRFACH VERWENDETE MATERIALIEN
3.2.1. Geräte
Thermal cycler:
cyclogene PHC-3, Techne, Thermo-Dux GmbH, Wertheim
Eppendorf-Zentrifuge:
Biofuge 15, Heraeus Instruments
Brutschrank:
Typ b 6200, Heraeus Instruments
3.2.2. Lösungen
10×TBE:
108 g Tris Base, 55 g Borsäure, 40 ml 0,5 M EDTA (pH 8,0)
Nukleotid-Stammlösungen: Ultrapure dNTP Set, 100 mM Solutions, Pharmacia Biotech
Taq-Polymerase:
Thermus aquaticus DNA Polymerase, 5000 U/ml, (Gibco)
HotStarTaq:
DNA-Polymerase, 50 U/ml, (Quiagen)
10×PCR Puffer:
500 mM KCL, 15 nM MgCl2, 100 mM Tris-HCl, pH 9,0
TE -Puffer:
10 mM Tris-HCl, 1 mM EDTA, pH 8,0
EDTA (0,5 M):
186,1 g EDTA auf 800 ml Aqua dest.(steril) gefüllt
mit NaOH auf pH 8,0 titriert, Aqua dest. (steril) ad 1000 ml,
vor Gebrauch autoklaviert
100 Base Pair Ladder:
Konzentration 1µg/µl (Pharmacia Biotech, Freiburg)
APS (10 %):
300 mg Ammoniumpersulfat (Kodak, New Haven,USA)
Aqua dest. (steril) ad 3000 µl
TEMED:
N,N,N’,N’-Tetramethylethylendiamin
(Sigma Aldrich, Steinheim)
3.2.3. Sonstige Materialien
Mikrotiterplatten:
96 well, Techne, Ltd.
Whatman Papier:
GB002, Schleicher & Schuel
22
FAMILIEN, MATERIAL UND METHODEN
3.3. METHODEN
3.3.1. Polymerase-Ketten-Reaktion (PCR)
Mit Hilfe der PCR können bestimmte DNA-Fragmente zu verschiedenen Versuchszwecken
exponentiell vermehrt werden. (Saiki et al. 1985; Mullis et al. 1986; Mullis and Faloona 1987)
PCR-Protokoll für ein Reaktionsvolumen von 15µl:
•
3 µl genomische DNA (10 ng/µl)
•
1,5 µl je Primer (forward und reverse) (10 pmol/µl)
•
1,5 µl 10×PCR-Puffer
•
1,5 µl einer 2mM dATP-dCTP-dGTP-dTTP-Stammlösung (von Gibco)
•
0,1 µl Taq-Polymerase (5U/µl) (von Gibco)
•
0,5 µl 50mM MgCl2-Lösung
•
Aqua bidest ad 15 µl
Dieser Ansatz wurde in eine Mikrotiterplatte mit 96 wells pipettiert und mit einem Tropfen
Mineralöl (Firma Sigma) vor dem Verdunsten geschützt. Der Thermal Cycler wurde
folgendermaßen programmiert:
Zyklen
1
Dauer [sec] Temperatur [°C]
Initiale Denaturierung
240
94
30
94
Annealing
30
54-72
Extension
60
72
final Extension
600
72
25-32 Denaturierung
1
Die Annealing-Temperatur variiert bei den verschiedenen Primern je nach Länge (18-30
Nukleotide) und GC-Gehalt. Je länger die Primer sind, desto spezifischer ist ihre Bindung und
desto höher kann die Annealing-Temperatur gewählte werden. Die Annealingtemperatur kann
annäherungsweise nach der folgenden Formel berechnet werden: T = 4(C+G) + 2(A+T)
23
FAMILIEN, MATERIAL UND METHODEN
Zum Design der Primer wurde das Computer-Programm des Zeno HTTP server verwendet.
(http://zeno.well.ox.ac.uk:8080/git-bin/primer3.www.cgi)
3.3.2. Agarose-Gelelektrophorese
Die PCR-Produkte werden mit Probenpuffer (30% Glycerin, 0,25% Bromphenolblau, 0,25%
Xylenxyanol, 5-fach konzentriert) vermischt und je nach Größe auf einem 0,8 - 2%iges
Agarose-Gel mit Ethidiumbromidzusatz bei ca. 120V für eine Stunde elektrophoretisch
aufgetrennt. (ultraPURE Agarose von Gibco, in TBE-Puffer: 90 mM Trisborat, 2 mM EDTA
pH 8,0). Als Längenmarker wurde 1µl „ReadyLoad“ 100 bp DNA Ladder bzw. 1 kb DNA
Ladder (beides von Gibco) aufgetragen.
Die ethidiumbromidgefärbten Banden wurden unter UV-Licht abfotografiert (Bio Print DS
System, CCD Kameramodul (mit Objektiv und UV-Filter), CN-TFX Dunkelkammer,
Aufnahmesoftware: BioCapt 97, Videoprinter: Mitsubishi Electronic LTF Labortechnik
GmbH, Deutschland).
3.3.3. Haplotypenanalyse
Die Haplotypenanalyse beruht auf Genotypisierung mit Mikrosatelliten-Markern betroffener
Familien. Bei konsanguinen Familien findet man durch gemeinsame Abstammung bei
autosomal rezessiver Vererbung homozygote Bereiche. Nach diesen homozygoten Bereichen
sucht man, da das Krankheitsgen nur dort lokalisiert sein kann, setzt man voraus, dass das
zweite krankmachende Allel nicht aus dem allgemeinen Genpool stammt.
3.3.3.1.
32
P-markierte PCR
Zur Haplotypenbestimmung mit Mikrosatelliten-Markern wurden die PCR-Produkte durch
32
radioaktives dCTP ( P-dCTP) markiert. Zum Teil wurden Mikrosatelliten-Marker aus der
Gènèthon-Mikrosatelliten-Karte (Dib et al. 1996) eingesetzt (http://www.ncbi.nlm.nih.gov/
genome/guide/human/). Zusätzlich wurden in der Umgebung von di-, tri-, oder tetranukleotidRepeats neue Primer generiert.
24
FAMILIEN, MATERIAL UND METHODEN
Die PCR wurde pro Reaktionsansatz (10µl) durchgeführt mit:
•
3 µl genomisch DNA (10 ng/µl)
•
1 µl je Primer (forward, reverse) (10pmol/µl)
•
1 µl 4×dNTP (2 mM dATP, dGTP, dTTP; 0,027 mM dCTP)
•
0,1µl 32P-dCTP (10 Ci/µl; Amershman Life Science)
•
1 µl 10×PCR-Puffer
•
0,3 µl 50mM MgCl2
•
0,06 µl Taq-Polymerase (5 U/µl)
•
Aqua bidest ad 10 µl
Reaktionszyklen siehe 3.2.1.
I
= normales Allel
= krankes Allel
II
III
IV
Abb.3.1 Prinzip der Homozygotie durch Abstammung. Ein normales Allel ist mit einem Strich markiert, ein
krank machendes Allel mit einem Kreuz. Die Großmutter vererbt an ihre beiden Söhne gemeinsam mit den
umgebenden Allelen ein krank machendes Allel. Die Söhne geben das defekte Allel wiederum an ihre
Nachkommen weiter. Nachkommken einer konsaguinen Ehe in der III. Generation können nun von Vater und
Mutter das krank machende Allel vererbt bekommen und mit diesem die Allele in der direkten Umgebung.
Durch Rekombinationen im Verlauf der Meiose verändern sich die dem Lokus entfernt liegenden DNAAbschnitte, die dem Lokus naheliegenden bleiben gleich, d.h. sie sind homozygot durch Abstammung. Das
Krankheitsgen muss also in einem homozygoten Bereich liegen.
(Hildebrandt, 2000)
25
3.3.3.2.
FAMILIEN, MATERIAL UND METHODEN
Polyacrylamid-Gelelektrophorese
Zur Auftrennung der radioaktiv markierten PCR-Produkte wurde ein 8 %iges denaturierendes
Polyacrylamidgel hergestellt:
8 %iges Instagel:
100 ml Accugel 19:1 [40 % (19:1) Acrylamid: Bisacrylamid Solution
(gas stabilized), National Diagnostics]
250 g Harnstoff
50 ml 10×TBE
ad 500 ml mit Aqua dest.
60 ml des Instagels wurden zur Initiation der Polymerisation 300 µl 10 %iges APS (Sigma
Chemie GmbH, Deisenhofen) und 30 µl TEMED (Sigma Chemie GmbH, Deisenhofen)
zugesetzt und vermischt.
Die Proben wurden im Verhältnis 1:1 mit Ladepuffer [980 µl Formamid, 20 µl 0,5 M EDTA,
5 l Bromphenolblau 10 % (w/v), 2 µl Xylencyanol 10 % (w/v)] vermischt und 5 min bei 94°C
denaturiert. Je 5 µl wurden auf das Gel aufgetragen und bei 55 W elektrophoretisch je nach
Produktlänge 3 – 6 h aufgetrennt (Spannungsquelle: Pharmacia LKB ECPS 3000/150;
GIBCO BRL PS 9009).
3.3.3.3.
Autoradiographie
Das Gel wurde auf Whatman-Papier (GB002, Schleicher & Schall) unter Vakuum bei 80 °C
für ca. 30 min getrocknet. Zwischen Geltrockner (Modell 583, BIO-RAD) und
Vakuumpumpe war eine Kühlfalle zwischengeschaltet. Auf das Gel wurde ein Röntgenfilm
(100 NIF, 35×43 cm, Kodak) aufgelegt und in einer lichtdichten Pappkassette für 6 – 24 h bei
Raumtemperatur exponiert.
Die Übertragung der Haplotypen mit Hilfe des Computerprogramms Cyrillic (Version 2.1) in
Stammbäume erleichtert die Auswertung, da homozygote Bereiche deutlich werden.
26
FAMILIEN, MATERIAL UND METHODEN
3.3.4. Haplotype-Sharing-Analyse
Diese Methode beruht auf dem Prinzip des "Identity by descent". In einer geeigneten
Isolatpopulation erwartet man, dass ein Teil der Patienten von einem oder wenigen
mutationstragenden Vorfahren ( foundern ) abstammen. Die Patienten haben die Mutation von
einem founder und teilen sich ein Chromosomensegment um die Mutation. An dieser Stelle
sind sie also "identical by descent". Während übliche kopplungsanalytische Verfahren die
Beziehungen zwischen einzelnen Markern und einem Mutationslocus betrachten, macht sich
die Haplotype-Sharing-Analyse die Informationen ganzer Chromosomensegmente zu Nutze.
Vorteil von der Haplotype-Sharing-Analyse ist, dass die Verwandtschaft weiter entfernt ist als
beim Homozygosity-mapping und der identische Bereich deshalb kleiner.
3.3.4. Single Strand Conformation Polymorphism (SSCP)
Die SSCP ist eine Methode, die zur schnellen Detektion von Mutationen verwendet werden
kann. Sie wurde erstmals 1989 von Orita beschrieben (Orita et al., 1989; Sheffield et al.,
1993). Das Prinzip beruht auf der Tatsache, dass die Konformation eines DNA-Moleküles
schon durch einen einzelnen Basenaustausch verändert sein kann.
Hierzu amplifiziert man mittels PCR aus genomischer DNA-Fragmente mit einer Größe bis
zu 250 bp. Diese Fragmente werden auf einem nicht-denaturierenden Polyacrylamidgel
elektrophoretisch aufgetrennt. Liegt bei einem Individuum eine Mutation vor, so kann man
dies aufgrund des veränderten Laufverhaltens des Fragments im Vergleich zu einem
Kontrollindividuum erkennen.
Die Proben, bei denen ein „Shift“ gefunden wurde, werden mittels direkter Sequenzierung
weiter untersucht. So lassen sich Punktmutationen, Deletionen oder Insertionen innerhalb des
amplifizierten Produktes sichtbar machen.
27
3.3.4.1.
FAMILIEN, MATERIAL UND METHODEN
SSCP-Polyacrylamid-Gelektrophorese
Da mit Hilfe der SSCP als Screening-Verfahren nur ca. 70% der vorhandenen Mutationen
gefunden werden (Grompe et al.,1993), wird die Elektrophorese bei zwei unterschiedlichen
Bedingungen durchgeführt, um eine höhere Sensitivität zu erreichen:
für zwei 5 %ige (10 %ige) SSCP-Gele (0,5xTBE, 8% Acrylamid):
12,5 ml (10 ml) H2O
2,5 ml (5 ml) Glycerin wasserfrei
25 ml 1xTBE
10 ml Accugel (29:1) [40% (29:1) Acrylamid:Bisacrylamid Solution]
250 µl APS 10% (w/v)
25 µl TEMED
Die PCR-Produkte wurden 1:1 mit SSCP-Ladepuffer [9,8 ml Formamid, 500 µl EDTA 0,5
molar; 50 µl Bromphenolblau(w/v); 20 µl Xylencyanol 10% (w/v)] versetzt, 5 min bei 94°C
denaturiert und anschließend zur Minimierung der Renaturierung sofort auf Eis gestellt.
Die Elektrophorese wurde in einer Elektrophoresekammer (Multigel Long, Biometra,
Göttingen) durchgeführt, die an eine Kühlanlage (Pharmacia LKB MultiTemp II, Freiburg)
und eine Spannungsquelle (Biometra Power Pack P25) angeschlossen war. Zu diesem Zweck
wurden die Gele mit 6 – 8 µl der vorbereiteten Proben beschickt und bei 150 V und einer
Lauftemperatur von 14°C für 6 h elektrophoretisch aufgetrennt.
3.3.4.2.
Silberfärbung
Die Banden wurden mittels einer Silberfärbung der Gele sichtbar gemacht. (Hiort et al.1994)
Zur Fixierung wurden die Gele für 10 min in eine 10 %ige Ethanollösung (v/v) gelegt. Um die
Silberbindung an die DNA vorzubereiten, folgte eine 3 minütige Behandlung mit 1 %iger
Salpetersäure (w/v). Nach zweimaligem Spülen mit Aqua bidest. wurden die Gele für 20 – 30
min in 0,2 %iger Silbernitratlösung inkubiert. Nach zwei weiteren Waschgängen in Aqua
bidest. wurde die Entwicklerlösung [23 g Natriumcarbonat (Na2Co3), 540 µl 37%
Formaldehyd (v/v), 1 l Aqua bidest.] zugegeben und abgewartet, bis die Banden zu sehen
28
FAMILIEN, MATERIAL UND METHODEN
waren. Die Entwicklungsreaktion wurde mit 10 %iger Essigsäure (v/v) gestoppt, die
abschließend mit Wasser abgespült wurde.
Die gefärbten Gele wurden auf Whatman-Papier geblottet und für ca. 1 h auf einem
Vakuumtrockner (Fa. Biorad, Darmstadt) getrocknet.
3.3.5. automatische DNA-Sequenzierung
Die DNA-Sequenzierung erfolgte nach der Methode des „Flourescence-based didesoxy DNA
cycle sequencing“ (Sanger et al., 1977; Ansorge et al., 1987). Hierfür wurden der BigDyeTM
Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems) und der ABI
PRISMTM Taq Dye DeoxyTM CycleSequencing Kit (PE Applied Biosystems) verwendet.
Eingesetzt wurden 0,2 bis 1 µg template DNA und 10 pmol Primer in einem 20 µl
Reaktionsansatz, vermischt mit 4 µl BigDyeTM. Die Sequenzierreaktion wurde im Thermal
cycler nach folgendem Zyklus durchgeführt:
Zyklen
25
Dauer [sec] Temperatur [°C]
Initiale Denaturierung
240
94
Denaturierung
30
94
Annealing
30
50-60
Extension
240
60
Das Reaktionsprodukt wurde mit 75 % Isopropanol gefällt. Die elektrophoretische
Auftrennung wurde von der „core facility“ am Zentrum für Klinische Forschung der
Universitätsklinik Freiburg übernommen.
3.3.6. Restriktionsverdau
Restriktionsendonukleasen sind in der Lage, spezifische DNA-Sequenzen zu erkennen und zu
schneiden. Durch Mutationen können neue Schnittstellen entstehen oder vorhandene verloren
gehen. Der Restriktionsverdau ist eine Methode, mit der schnell viele Individuen auf
Vorhandensein eines Basenaustauschs, der durch Sequenzanalyse bei Betroffenen gefunden
wurde, untersucht werden können.
29
FAMILIEN, MATERIAL UND METHODEN
Das Enzym wurde unter Verwendung des vom Hersteller angegebenen Puffers dem
aufgereinigten PCR-Produkt in einer Konzentration von 1 U pro µg der zu verdauenden DNA
zugesetzt. Der Ansatz wurde bei dem jeweiligen Temperaturoptimum des Enzyms ca. 2 h
inkubiert. Die Proben wurden anschließend durch Agarose-Gelektrophorese aufgetrennt.
3.3.7. allelspezifische PCR
Die allel- bzw. sequenzspezifischen PCR ist eine molekulargenetische Methode, die die
direkte Feststellung einer Punktmutation durch ein einfaches PCR-Experiment erlaubt. Ein
Basen-Mismatch zwischen 3‘-Terminus eines PCR-Primers und DNA-Matrize verhindert
unter geeigneten Versuchsbedingungen die die Amplifikation des PCR-Produkts. Zunächst
amplifiziert man ein Produkt, das die zu untersuchende Mutation enthält. Dieses verwendet
man in einer zweiten PCR mit einem geschachtelten (nested) sequenzspezifischen Primerpaar
als Template. Ein Produkt erhält man nur, wenn die Matrizen-Sequenz auch am 5‘-Ende
komplementär zur Primersequenz ist. Als interne Kontrolle amplifiziert man zusätzlich im
gleichen PCR-Ansatz ein Fragment, dessen Länge sich deutlich von den allelspezifischen
Fragmenten unterscheidet (Sommer et al., 1992).
Die PCR-Reaktion wird mit HotStarTaqTM (Quiagen) unter folgenden Bedingungen
durchgeführt:
Zyklen
Dauer [sec] Temperatur [°C]
1
Initiale Denaturierung
240
94
25
Denaturierung
30
94
Annealing
30
62
Extension
60
72
final Extension
600
72
1
30
4.
ERGEBNISSE
ERGEBNISSE
4.1. HAPLOTYPENANALYSE ZUR WEITEREN EINGRENZUNG DES GENORTS
4.1.1. Eingrenzung mittels Homozygosity mapping
Der auf Chromosom 1p31 lokalisiert Genort (Landau et al., 1995) war 2000 von Vollmer et
al. zwischen die Marker D1S2661 und D1S475 auf ca. 4kb eingegrenzt worden. Ziel war nun
auf dem nahezu lückenlosen Kontig durch Design neuer polymorpher Mikrosatelliten-Marker
diese Eingrenzung weiter einzugrenzen.
Untersucht wurden 9 Familien, die Eltern waren mit einer Ausnahme konsanguin. Von 21 neu
entworfenen Mikrosatelliten-Marker waren 8 polymorph: 277A12-a, 277A12-b, 109I2-b,
101C11-e, 319F11-a, 845C20-a, 845C20-b und DJ1099N07-c (Tab. 4.1). Außerdem wurden
die kommerziellen Marker der Region aus der Gènèthon Map bei allen Familien untersucht,
für die bisher noch keine Ergebnisse vorlagen. Mit den Markern wurde ein Bereich von ca.
3,5 Mb abgedeckt.
Im folgenden sollen die durch Genotypisierung erhaltenen Daten in Form von Haplotypen für
die untersuchten Familien dargestellt werden (Abb. 4.1-4.5).
Tab.4.1 Polymorphe Mikrosatellitenmarker
Marker
Forward - Primer
Repeat
Größe
Temp.
Allelanzahl
taa
183
58°
nicht polymorph
gaat
142
58°
polymorph
at
136
58°
polymorph
gcc
217
58°
nicht polymorph
aac
151
58°
nicht polymorph
Reverse - Primer
997D24A2
5'-cag tgg cat acg cct gta gtt cc-3'
5'-tcc ctg aat ggt gga cat tg-3'
277a12-a
5'-ctg gcc aca gca gat act caa aa-3'
5'-cta gtg gct att gta ttg ggc a-3'
277a12-b
5'-gtt ctg ggt ttt aat ata gtc aac-3'
5'-aca gag caa gcc ttg tct cta-3'
277a12-c
5'-cct ttg cct ttg gca aac atg g-3'
5'-ctt tga cag ctg gaa tga gc-3'
277a12-d
5'-gca aca aga gcg aaa ctc cg-3'
5'-cag gtg ttc tgc ctg cct t-3'
31
Marker
F-Strang-Primer
ERGEBNISSE
Repeat
Größe
Temp.
Allelanzahl
gaat
170
58°
nicht polymorph
gt
212
58°
nicht polymorph
tg
179
58°
nicht polymorph
ac
123
58°
polymorph
gatt
164
58°
nicht polymorph
aac
164
58°
nicht polymorph
ca
174
58°
nicht polymorph
tg
175
58°
nicht polymorph
caat
145
58°
nicht polymorph
ca
112
52°
nicht polymorph
gt
150
58°
polymorph
tc
132
58°
nicht polymorph
gt
146
58°
polymorph
ac
212
58°
polymorph
ggaa
203
58°
polymorph
ct
173
58°
polymorph
R-Strang-Primer
240d10-a
5'-cca gca cat agc aca tgg ca-3'
5‘-tgt gcc tgg cca gaa tta ac-3'
240d10-b
5'-agg agg cag aga ttg cag tg-3'
5'-cac tga cat cct act gta tgc-3'
109i2-a
5'-tgc tga gct gct cca gtt tc-3'
5'-tgg agt ctg gag gat ggt-3'
109i2-b
5'-gct tta gct tct ctc tct gtc-3'
5'-gga gtc aga tgt ctt gac at-3'
109i2-c
5'-cca agt gct ggg att aca gg-3'
5'-tga gct gag att gct cca ct-3'
109i2-d
5'-gga act tgt cat agc cac gg-3'
5'-caa agt gct gag ata aca ggc-3'
101c11-a
5'-aca cag aga cct ctg ata cc-3'
5'-tct ctg gtt tga ctt gtg cc-3'
101c11-b
5'-gtc aga tgt ctt gac att tgc-3'
5'-cga tga aca ctt gta tac cc-3'
101c11-c
5'-aga ttg ctc cac tgt act cc-3'
5'-gga tta cag gca tga gcc act-3'
101c11-d
5'-ccc att caa aga gta cta cc-3'
5'-gtg ggt cat aat cat cag tg-3'
101c11-e
5'-ggt aga aat cta gac tcc cg-3'
5'-ctg tac tct act cta gcc aaa cac c
1043g4-a
5'-tat tgt gct tgc cga cct cc-3'
5'-tt ctc cag aga aac aga acc-3'
319f11-a
5'-gtt gct aca atc cac aga gc-3'
5'-gct act gga agc tac aga ta-3'
845c20-a
5'-caa aca gcc ctg agc aaa tac g-3'
5'-atg cct atc ctc agc tca gcg-3'
845c20-b
5'-ctt ctc ccg ctt cct aat gct c-3'
5'-gcc ttg aaa gga acgt tga tgg-3'
DJ1099n07-c 5'-gag ttg gag ataa cca atg ag-3'
5'-ctt ctc agt gcc aca gct tg-3'
32
ERGEBNISSE
F791
I:1
II:3
II:1
III:4
IV:2
I:2
II:2
III:1
III:5
II:4
III:2
III:3
III:6
IV:1
IV:4
IV:2
IV:3
D1S2661
845C20a
845C20
845C20b
845C20
277A12a
277A12
277A12b
277A12
DJ1099N0
DJ1099N07c
D1S41
D1S417
D1S2652
109I2
109I2b
101C11e
101C11
319F11a
319F11
633H17g
633H17
D1S47
D1S475
D1S20
D1S200
D1S2690
1
2
?
2
1
2
1
3
1
?
?
1
1
1
1
1
?
?
?
?
?
2
1
?
?
?
?
1
2
1
1
1
?
2
2
2
2
1
?
?
?
2
2
3
2
1
1
?
2
2
3
2
1
3
?
?
1
1
2
1
1
?
?
?
?
?
2
1
?
?
?
?
1
2
1
?
2
?
2
1
2
?
?
?
?
?
1
?
?
?
1
1
?
1
3
1
1
2
?
?
?
2
2
2
2
V:4
V:
V:3
V:2
D1S2661
845C20a
845C20b
277A12a
277A12b
DJ1099N07c
D1S417
D1S2652
109I2b
101C11e
319F11a
633H17g
D1S475
D1S200
D1S2690
IV:3
?
1
?
1
3
2
?
?
?
?
?
2
?
?
?
1
1
4
2
2
2
2
1
3
5
2
2
2
3
2
1
1
4
2
2
2
2
1
3
5
4
1
1
2
1
Abb. 4.1. Haplotypen der Familie F791. Marker, die bei den Eltern homozygot waren und somit nicht informativ
sind, sind als farblose Balken dargestellt. Der homozygote Bereich bei dem betroffenen Kind V-4 ist eingerahmt.
Flankierender Marker war 319F11a. Die Haplotypen des verstorbenen Cousin wurde nicht weiter untersucht.
4
1
3
3
3
3
?
1
1
?
?
1
?
2
?
D1S2661
845C20a
845C20b
277A12a
277A12b
DJ1099N07c
D1S417
D1S2652
109I2b
101C11e
319F11a
633H17g
D1S475
D1S200
D1S2690
1
3
4
4
1
4
?
2
2
?
?
2
?
1
?
4
1
3
3
3
3
1
1
3
1
4
1
2
2
4
II:1
3
2
1
1
2
3
1
1
3
1
4
1
2
2
4
3
2
1
1
2
3
?
1
1
?
?
1
?
2
?
I:2
1
1
2
2
4
3
?
2
2
?
?
2
?
3
?
4
2
1
1
5
2
1
1
2
?
?
1
1
1
2
1
2
1
1
5
2
2
1
2
?
?
1
1
2
3
1
3
3
1
5
1
2
2
2
?
?
3
1
2
3
II:1
II:1
I:1
I:1
1
2
1
1
5
2
2
1
2
?
?
1
1
2
3
F730
?
3
3
1
5
1
2
2
2
?
?
3
1
?
?
2
2
1
1
5
2
1
1
2
?
?
1
1
2
3
II:2
II:2
I:2
I:2
?
2
2
2
5
3
2
3
1
?
?
2
2
?
?
1
2
2
2
5
3
2
3
1
?
?
2
3
3
1
. 4.2. Haplotypen der Familien F591 und F730. Flankierender Marker war bei F591 277A12-b, bei Familie F730 war der gesamte
ich homozygot . Der Marker 277A12-b war telomerisch neuer flankierender Marker und konnte den Bereich weiter eingrenzen.
D1S2661
845C20a
845C20b
277A12a
277A12b
J1099N07c
D1S417
D1S2652
109I2b
101C11e
319F11a
633H17g
D1S475
D1S200
D1S2690
I:1
F591
33
ERGEBNISSE
34
ERGEBNISSE
35
ERGEBNISSE
36
ERGEBNISSE
37
ERGEBNISSE
Die 5 Marker DJ1099n07-c, D1S417, D1S2652, 109i2-b und 101c11-e waren bei allen
Betroffenen konsanguiner Familien homozygot. Neue flankierende Marker waren telomerisch
277a12-b, der bei F591 und F813 heterozygot war, und centromerisch 319f11-a, heterozygot
bei F791. Der Bereich, der noch mit Kopplung vereinbar war und so als Genort für BSND in
Frage kam, verkleinerte sich durch diese neue Eingrenzung auf ca. 0,8 Mb (Abb. 4.6).
tel
D1S1661
67664 Kbp
D1S2661
61155 Kbp
277a12b
61913 Kbp
D1S417
62218 Kbp
D1S2652
62371 Kbp
101c11e
62850 Kbp
D1S475
D1S200
62974 Kbp
63100 Kbp
D1S2690
64867 Kbp
cen
0,9Mb
Landau
Vollmer
F197
F591
F813
Abb. 4.6 Kopplungsintervall auf 1p31
links sind die Mikrosatellitenmarker aufgetragen, rechts die Position auf Chromosom 1. Die Balken
symbolisieren die Ergebnisse des Homozygosity mappings. Heterozygote Bereiche sind hellblau
markiert, homozygote orange. Das Intervall, das 1999 von Vollmer et al. auf 4cM eingegrenzt
worden konnte auf weniger als 900 kb verkleinert werden. Neue flankierende Marker (fett gedruckt)
sind 277A12b und 101c11e.
38
ERGEBNISSE
4.1.2. Haplotype-Sharing-Analyse
Die fünf Familien türkischer Abstammung zeigten ein ausgedehntes Haplotype-Sharing. Der
Sharing-Haplotype erstreckte sich über 14 Marker zwischen D1S2661 und D1S200. Für die
Marker DJ1099n07-c, D1S417 und D1S2652 teilten alle fünf Familien den gleichen
Haplotypen. Nach telomerisch bzw. centromerisch setzte sich der gemeinsame Haplotyp bei
einzelnen Familien weiter fort.
Das fehlende Sharing bei F314 für den Marker 109i2-b grenzte das bestehende Intervall auf
weniger als 900 kb weiter ein.
Bei F197 und F813 waren die Haplotypen der beiden Marker D1S417 und D1S2652
identisch, jedoch distal davon keine Gemeinsamkeiten zu finden. Die beiden betroffenen
Kinder von F708 und F662 und F206 teilten die Haplotypen für 3 Marker: DJ1099n07-c,
D1S417 und D1S2652. F708 und F662 hatten zusätzlich noch den Marker 109i2-b und
heterozygot 277A12-b gemeinsam (Abb 4.7).
F791
D1S2661
845C20a
845C20b
277A12a
277A12b
DJ1099N07c
D1S417
D1S2652
109I2b
101C11e
319F11a
633H17g
D1S475
D1S200
D1S2690
2
4
4
2
4
4
1
1
3
5
4
2
2
1
3
2
4
4
2
4
4
1
1
3
5
2
1
1
2
4
F314
2
4
4
2
3
4
1
1
2
5
2
1
1
2
4
2
4
4
2
3
4
1
1
2
5
2
1
1
2
4
F591
2
4
4
2
3
4
1
1
3
1
4
1
2
2
4
3
5
5
5
4
4
1
1
3
1
4
1
2
2
4
F730
3
2
1
3
5
4
1
1
3
1
4
1
2
2
2
3
2
1
3
5
4
1
1
3
1
4
1
2
2
2
F786
2
4
4
1
3
4
1
1
3
1
4
3
2
3
4
2
4
4
1
3
4
1
1
3
1
4
3
2
3
4
F197
1
3
4
2
4
3
3
3
4
3
4
2
2
2
1
2
3
4
2
4
3
3
3
4
4
4
2
2
2
4
F813
1
5
7
2
1
6
3
3
1
4
4
1
2
1
4
3
6
2
5
4
6
3
3
1
4
4
1
2
1
4
F708 II-1 F708 II-2 F662
1
3
4
2
4
?
2
2
3
5
5
1
2
5
4
2
3
2
6
2
1
2
2
3
5
5
1
2
5
4
2
3
2
6
2
1
2
2
3
5
5
1
2
5
4
2
3
2
6
2
1
2
2
3
5
5
1
2
5
4
3
1
2
3
4
1
2
2
3
5
4
1
1
3
4
3
2
6
3
5
5
2
2
3
5
4
1
1
3
4
F206
1
1
4
6
2
5
2
2
3
1
5
3
1
5
4
2
2
4
6
2
5
2
2
3
1
5
3
1
5
4
Abb. 4.7 Haplotype Sharing Analyse bei den 10 untersuchten Familien. Die flankierenden neuen Marker
sind kursiv gedruckt. Die Marker DJ1099N07-c, D1S417 und D1S2652 waren bei allen Familien homozygot.
Haplotypen die distal dieser Marker kontinuierlich Homozygotie zeigen, sind unterlegt. Farblich markiert sind
Allele, die mindestens zwei Patienten in Kontinuität mit den 3 homozygoten Markern teilen. Auffällig ist das
ausgedehnte Hyplotype-Sharing bei den fünf türkischen Familien F791, F314, F591, F730 und F786 (orange
markiert), das sich über 14 Marker erstreckt.
39
ERGEBNISSE
4.2. MUTATIONSANALYSE
In dem Intervall von 900 kb zwischen den Markern DJ1099n07-c und 109i2-b, das durch
Haplotypenanalyse eingegrenzt worden war, konnten mit Hilfe des Computerprogramms
GENSCAN
(http://genome.dkfz-heidelberg.de/cgi-bin/GENSCAN/genscan.cgi)
9
Gene
identifiziert werden, 6 davon waren unbekannt: die Ubiquitin spezifische Protease 24
Hs.7243; DKFZp564M2423, ein hypothetisches Gen, zu dem ein homologes Gen bei der
Maus bekannt ist (Hyaluron-bindendes Protein); ein unbekanntes Gen, zu dem Homologe bei
Maus und Rind bekannt und ESTs aus der Niere vorhanden waren; Hs.112554, für das es 13
ESTs gab, von denen 9 aus der Niere kamen; eine endogene Retrovirus W Sequenz; Hs.75616
KIAA0018, ein diminuto-like Protein; FJL20619 (Hs. 127723, Hs.16230, DKFZp586J211);
FJL21931 (Hs.13036, DKFZp727A071) und ein weiteres hypothetisches Proteine.
Da keines dieser Proteine ein guter funktioneller Kandidat für BSND war, sollten sie bei den
11 Patienten mittels SSCP und direkter Sequenzierung von Exon-PCR-Produkten und RTPCR-Produkten von cDNA EBV-transformierter Lymphozyten nacheinander untersucht
werden.
4.2.1. Ergebnisse der SSCP-Analyse
Proteine, für die keine ESTs bekannt waren und die deshalb nicht durch RT-PCR untersucht
werden konnten, sollten mittels SSCP gescreent werden. Die Exone mussten zum Teil wegen
ihrer Größe in mehrere Fragmente geteilt werden. Dabei wurden die Primer so gewählt, dass
die einzelnen Fragmente überlappten, um die komplette Exon-Sequenz abzudecken. Es
wurden 5 Proteine bei den 9 Patienten und jeweils 3 gesunden Kontrollindividuen gescreent.
Bei Auftreten eines Band-Shifts, wurde der Versuch anschließend erst mit 20 weiteren
Kontrollen wiederholt. Wurde der Shift auch bei gesunden Individuen gefunden, konnte von
einem Polymorphismus ausgegangen werden.
Es wurden drei Proteine, die auf dem PAC DJ1099N07 lagen, zwei Proteine auf dem PAC
RP11-12c17 und ein Protein auf dem PAC 109I2 mit Hilfe der SSCP untersucht. Tab. 4.1
zeigt die Primer, die zur Amplifizierung der untersuchten Proteine verwendet wurden.
40
ERGEBNISSE
Tab. 4.1 SSCP-Primer
Primer
Sequenz
109I2P1E1.1(F)
5‘-ggc agg aca gca acc tct c-3‘
109I2P1E1.1(R)
5‘-gcc tcc cac ccc tac acc-3‘
109I2P1E2.1(F)
5‘-ttg ctg ggt ttc ttc cat gt-3‘
109I2P1E2.1(R)
5‘-ccc agc cct atc agg aag t-3‘
109I2P1E3.1(F)
5‘-atc agg taa ggc cag gct gt-3‘
109I2P1E3.1(R)
5‘-ggc aga gca aat gga ttc ag-3‘
109I2P1E4.1(F)
5‘-gcc tgg gat gtg ctc tgt ag-3‘
109I2P1E4.1(R)
5‘-acc tcc agg atg ggg ata tg-3‘
109I2P1E5.1(F)
5‘-cag cca cct gct gat ttg t-3‘
109I2P1E5.1(R)
5‘-cca ggt cca gat gga gag ag-3‘
109I2P1E6.1(F)
5‘-aac cat cac tct gtg cct gt-3‘
109I2P1E6.1(R)
5‘-gag tag agg cag gca tcg tc-3‘
109I2P1E6.2(F)
5‘-gcc tgg agt tta ttc gga aa-3‘
109I2P1E6.2(R)
5‘-ccc acg tgc cac aag aag-3‘
109I2P1E7.1(F)
5‘-cct ctc ttg ggc tcc ttt ct-3‘
109I2P1E7.1(R)
5‘-aca gac cct gac tgc caa ag-3‘
109I2P1E8.1(F)
5‘-ggg cca tca cca tct ttc-3‘
109I2P1E8.1(R)
5‘-ggt cac aca gac ctc cca ag-3‘
109I2P1E9.1(F)
5‘-gcc ctc ctc tct cct acc at-3‘
109I2P1E9.1(R)
5‘-cga agg agg ggt aca gtc ac-3‘
109I2P1E10.1(F)
5‘-gtc cct ttc tgt gtt ttc aaa g-3‘
109I2P1E10.1(R)
5‘-tgg gtg cat aag gag aaa gag-3‘
109I2P1E11.1(F)
5‘-cca gca ttt cac atc tga gc-3‘
109I2P1E11.1(R)
5‘-cac aga aaa gct gtg cag ga-3‘
109I2P1E12.1(F)
5‘-gat gtc gga ggg aga aat ga-3‘
109I2P1E12.1(R)
5‘-gat ggc aac ggc tgt cac-3‘
109I2P1E12.2(F)
5‘-gag ggc tgg acc ctg act-3‘
109I2P1E12.2(R)
5‘-agg gac aag tcg gaa cca tt-3‘
T
Größe
61°
260
60°
284
60°
266
60°
282
59°
258
59°
263
60°
296
60°
297
59°
270
59°
258
59°
299
60°
286
60°
250
60°
275
41
Primer
Sequenz
DJ1099P1E1.1 (F) 5‘-caa aca tgg gga acc acc ag-3‘
ERGEBNISSE
T
Größe
59°
254
59°
273
58°
280
58°
272
60°
251
60°
289
59°
268
58°
295
58°
257
60°
260
58°
287
59°
291
60°
264
60°
278
58°
255
60°
271
DJ1099P1E1.1 (R) 5‘-cag gct tgc taa tgt cct g-3‘
DJ1099P1E1.2 (F) 5‘-gtt ctg caa cag gga gag gat g-3‘
DJ1099P1E1.2 (R) 5‘-cca cct tac tgc agt atg ac-3‘
DJ1099P1E2.1 (F) 5‘-gac gac tac aag cca agg aac-3‘
DJ1099P1E2.1 (R) 5‘-gtt ggt gcc tct agg atc tg-3‘
DJ1099P1E3.1 (F) 5‘-gga caa aga ggc ttt ggt gtt g-3‘
DJ1099P1E3.1 (R) 5‘-cct ctc cag att tca-3‘
DJ1099P1E4.1 (F) 5‘-ccc aag act gag ata ttc cc-3‘
DJ1099P1E4.1 (R) 5‘-ctc aca tca caa taa gaa gca-3‘
DJ1099P1E4.2 (F) 5‘-ggg ttt cgg gga agt tta g-3‘
DJ1099P1E4.2 (R) 5‘-gat gcc cca ttg ctt ttc tc-3‘
DJ1099P1E5.1 (F) 5‘-gtc ctt ggg ttc aaa tcc cag-3‘
DJ1099P1E5.1 (R) 5‘-ctt atg ggc act act cca tg-3‘
DJ1099P1E5.2 (F) 5‘-gac taa cac cct tca acc c-3‘
DJ1099P1E5.2 (R) 5‘-cat cac ctc tgc tgt gct gta g-3‘
DJ1099P1E5.3 (F) 5‘-ctt ttg aag aag tag gtg ccg g-3‘
DJ1099P1E5.3 (R) 5‘-gta acc cat aca cca agc tg-3‘
DJ1099P1E5.4 (F) 5‘-gaa tga gac cgg tcc cag gca ttc-3‘
DJ1099P1E5.4 (R) 5‘-caa gcg gac acc ctg aaa atc-3‘
DJ1099P1E6.1 (F) 5‘-gaa tga att tgt tgg gca ccc-3‘
DJ1099P1E6.1 (R) 5‘-ctt ctt cct gcg tgg att ttc c-3‘
DJ1099P1E6.2 (F) 5‘-ctt ttg ctc ctg tgc caa gag-3‘
DJ1099P1E6.2 (R) 5‘-cag tac cag gcc atc atg aaa g-3‘
DJ1099P1E6.3 (F) 5‘-cag caa tgg aca gga aga c-3‘
DJ1099P1E6.3 (R) 5‘-ctc caa aga gac ctg ctt c-3‘
DJ1099P1E6.4 (F) 5‘-cac ctc ctt cat cag ctt ctt c-3‘
DJ1099P1E6.4 (R) 5‘-gtc acg att gca ctt tga gtg-3‘
DJ1099P1E7.1 (F) 5‘-ctc cac agt cct tac caa tac c-3‘
DJ1099P1E7.1 (R) 5‘-cac tac tat tcc act ctg tct c-3‘
DJ1099P1E7.2 (F) 5‘-ctg gaa cac agt agg tga gag-3‘
DJ1099P1E7.2 (R) 5‘-ccc agg gtt ctt tta cca tc-3‘
42
Primer
Sequenz
DJ1099P1E8.1 (F) 5‘-ggc tca gcc ctg tgt gta gct-3‘
ERGEBNISSE
T
Größe
60°
280
58°
275
60°
291
60°
267
60°
267
58°
290
60°
255
60°
289
59°
279
60°
276
62°
294
61°
276
60°
261
59°
271
60°
245
60°
253
DJ1099P1E8.1 (R) 5‘-cat gag gga aag cca gga tg-3‘
DJ1099P1E8.2 (F) 5‘-gtt cca gcc atg agc tc-3‘
DJ1099P1E8.2 (R) 5‘-caa gaa ggg cca tta cat ctg-3‘
DJ1099P1E8.3 (F) 5‘-ctt gtc cgt gca cat ttt cag-3‘
DJ1099P1E8.3 (R) 5‘-ctc agt ttc cca tca gca caa g-3‘
DJ1099P4E1.1(F)
5‘-cac cca acc aca tct cct tct c-3‘
DJ1099P4E1.1(R)
5‘-cct tga ggt gca cag atg agt g-3‘
DJ1099P4E2.1(F)
5‘-gtg aca ctt agg atg ggg atg-3‘
DJ1099P4E2.1(R)
5‘-agt gct cct tct cag ttt ag-3‘
DJ1099P4E3.1(F)
5‘-ac cca gga agt aca ctt ac-3‘
DJ1099P4E3.1(R)
5‘-ctt tct act atg cca ctg gg-3‘
DJ1099P4E3.2(F)
5‘-cat tca cag tat tcc ctc tgc c-3‘
DJ1099P4E3.2(R)
5‘-cat ccc cca acc tta caa ag-3‘
DJ1099P4E4.1(F)
5‘-caa gaa cca acc tcc cat c-3‘
DJ1099P4E4.1(R)
5‘-ctg gcc ctt gtt ctc tga tcc-3‘
DJ1099P4E5.1(F)
5‘-gag cag aga gga agg cag ag-3‘
DJ1099P4E5.1(R)
5‘-gcc tgg caa gga gta aac ag-3‘
DJ1099P4E6.1(F)
5‘-gag agg gtg gga atg agt ga-3‘
DJ1099P4E6.1(R)
5‘-ctt gat gcg cag gca ctt-3‘
DJ1099P4E6.2(F)
5‘-aac cag gcg ctg gtg ttc-3‘
DJ1099P4E6.2(R)
5‘-cgc ggg gta ctt gtc ctg-3‘
DJ1099P4E6.3(F)
5‘-cag tgg agc cag gca cag-3‘
DJ1099P4E6.3(R)
5‘-gca cct gag ccc tag aat ga-3‘
DJ1099P4E7.1(F)
5‘-tgg atg cca aat gaa gtg aa-3‘
DJ1099P4E7.1(R)
5‘-gtg tgg cag gag gag ctg-3‘
DJ1099P4E9.1(F)
5‘-atg agg cca gga gtt caa ga-3‘
DJ1099P4E9.1(R)
5‘-aca agt tcc cag gtg aca ca -3‘
DJ1099P4E10.1(F) 5‘-gct tca tgg tgt tgg aac ac-3‘
DJ1099P4E10.1(R) 5‘-gtc ttc ccg aag gtt ctg tg-3‘
DJ1099P4E10.2(F) 5‘-ctt gca ggt ttc acc act gtg-3‘
DJ1099P4E10.2(R) 5‘-ctg cat ctc ctg vgtc tat c-3‘
43
Primer
Sequenz
DJ1099P4E10.3(F) 5‘-cat ata ccg tcc gtg cca tg-3‘
ERGEBNISSE
T
Größe
60°
272
58°
260
58°
273
59°
265
58°
284
60°
277
60°
265
59°
288
59°
298
60°
271
60°
245
60°
289
58°
276
58°
288
58°
257
59°
294
DJ1099P4E10.3(R) 5‘-gaa gct gct tgt agg aca gt-3‘
DJ1099P4E10.4(F) 5‘-gcc tta att gcc tcc cag aag-3‘
DJ1099P4E10.4(R) 5‘-cat cac aca cca ggc tgt ag-3‘
DJ1099P4E10.5(F) 5‘-gta cac ctt tga ctc ctc c-3‘
DJ1099P4E10.5(R) 5‘-caa gca ggg cag ttc att tg-3‘
DJ1099P4E10.6(F) 5‘-cat gga gac act aga ctt gtc-3‘
DJ1099P4E10.6(R) 5‘-gga caa agt ctt cag tag aga g-3‘
DJ1099P4E10.7(F) 5‘-gat ctt ggc tgc tgc cat tg-3‘
DJ1099P4E10.7(R) 5‘-ctc aaa atg tgc agg gtc ctc-3‘
DJ1099P5E1.1 (F) 5‘-gat ggg agt gtg tgc atg tc-3‘
DJ1099P5E1.1 (R) 5‘-cct gat tac agt gcc tgc aac-3‘
DJ1099P5E1.2 (F) 5‘-gaa ctg gag caa agg cat g-3‘
DJ1099P5E1.2 (R) 5‘-cct aga gct gaa tcc tca g-3‘
DJ1099P5E2.1 (F) 5‘-ctg gcc cat ctc ttc ttt g-3‘
DJ1099P5E2.1 (R) 5‘-cag at agg caa gga cat g-3‘
DJ1099P5E3.1 (F) 5‘-gtc gta aac agg acc ctc tg -3‘
DJ1099P5E3.1 (R) 5‘-gaa atg ctc ctg tct gtc ctc-3‘
DJ1099P5E4.1 (F) 5‘-cct aca ctc gtt acc aag tc-3‘
DJ1099P5E4.1 (R) 5‘-ctt gaa tga gga ttt ggg ac-3‘
DJ1099P5E5.1 (F) 5‘-cag cag tgt gaa aat gga c-3‘
DJ1099P5E5.1 (R) 5‘-caa cta cta acc gtt gcc atc-3‘
DJ1099P5E6.1 (F) 5‘-gtt ccc aac aag ctt cac ag-3‘
DJ1099P5E6.1 (R) 5‘-gtt gga tag agg cca gag at-3‘
DJ1099P5E7.1 (F) 5‘-gag aga cac aat ctt ggg-3‘
DJ1099P5E7.1 (R) 5‘-gta ctg gct ggt agt tgg tg-3‘
DJ1099P5E8.1 (F) 5‘-cct tag tct ggg ttt ctg g-3‘
DJ1099P5E8.1 (R) 5‘-gca gat cct gat ttg aat gc-3‘
DJ1099P5E8.2 (F) 5‘-cag ata gta ctg tgc tgc tg-3‘
DJ1099P5E8.2 (R) 5‘-cgc ttt ggt gtg tca tat ag-3‘
DJ1099P5E9.1 (F) 5‘-caa tca gaa cgc ttc taa ccc-3‘
DJ1099P5E9.1 (R) 5‘-cat gga att gga tct gct cag-3‘
44
Primer
Sequenz
DJ1099P5E10.1 (F) 5‘-cag gga tct ggg att gaa gga g-3‘
ERGEBNISSE
T
Größe
58°
266
60°
270
59°
265
60°
301
60°
275
59°
261
59°
287
59°
260
58°
251
60°
270
60°
272
58°
256
60°
255
58°
278
59°
281
59°
291
DJ1099P5E10.1 (R) 5‘-ggc atc agc tat gga aca ac-3‘
DJ1099P5E10.2 (F) 5‘-atg acg tcg tct gag ctg gga tc-3‘
DJ1099P5E10.2 (R) 5‘-cac ccc aaa agc att cga ag-3‘
DJ1099P5E11.1 (F) 5‘-ctg aag gac tgc agt tgt tc-3‘
DJ1099P5E11.1 (R) 5‘-caa aag tgg cag ggt tga g-3‘
DJ1099P5E11.2 (F) 5‘-ctg tgc tgt tgg tgt ctg ta-3‘
DJ1099P5E11.2 (R) 5‘-caa tgt ctg gag atg ctt ctg-3‘
DJ1099P5E12.1 (F) 5‘-cac tgt gat tct act cac tg-3‘
DJ1099P5E12.1 (R) 5‘-cat ctc tga gga act ctg gtc-3‘
DJ1099P5E13.1 (F) 5‘-agg tgc tga aag ggc tag ag-3‘
DJ1099P5E13.1 (R) 5‘-gat ggg caa ttg gtt cct ctg-3‘
DJ1099P5E14.1 (F) 5‘-ctg tat cct gca gag ttg tgc ttg-3‘
DJ1099P5E14.1 (R) 5‘-cag gat act aaa ggc tct gag -3‘
DJ1099P5E15.1 (F) 5‘-cat tgc aaa tct cca aga gg-3‘
DJ1099P5E15.1 (R) 5‘-ctc agt tag gct att ggc c-3‘
DJ1099P5E16.1 (F) 5‘-gtt aac gta aaa aga ggt gcg ccc-3‘
DJ1099P5E16.1 (R) 5‘-ctc tga atc agc cgc agt gag tg-3‘
DJ1099P5E17.1 (F) 5‘-ccc caa ggt agt aaa aga cc-3‘
DJ1099P5E17.1 (R) 5‘-gaa gaa cat ggt tgg gat gc-3‘
DJ1099P5E17.2 (F) 5‘-ctt gaa gac agc ctt gag gtt g-3‘
DJ1099P5E17.2 (R) 5‘-ggc cac caa gtt cat ttc ag-3‘
DJ1099P5E18.1 (F) 5‘-gtg aag ctc tgt cct tcc tc-3‘
DJ1099P5E18.1 (R) 5‘-ctc agc ctg gca agt aat gac-3‘
DJ1099P5E19.1 (F) 5‘-atc gtc caa gct gca cac ca-3‘
DJ1099P5E19.1 (R) 5‘-ctc ctt ttc tgc ctc ctc-3‘
DJ1099P5E20.1 (F) 5‘-gta ttg tgg gag gaa aga gc-3‘
DJ1099P5E20.1 (R) 5‘-gaa gtg ctc tct gtg agt cag-3‘
DJ1099P5E21.1 (F) 5‘-ctc aag tca ctt gtt tcc cc-3‘
DJ1099P5E21.1 (R) 5‘-gaa cca cca acc ttt gct g-3‘
DJ1099P5E22.1 (F) 5‘-cat agg aga aat gac cag tg-3‘
DJ1099P5E22.1 (R) 5‘-cag tgt cac aag caa atc cc-3‘
45
Primer
Sequenz
DJ1099P5E23.1 (F) 5‘-gtc tga aga tcc tga ggt c-3‘
ERGEBNISSE
T
Größe
60°
263
58
253
60
282
58
263
58
236
59
257
60
233
58
271
58
238
58
275
59
266
58
292
60
270
60
294
DJ1099P5E23.1 (R) 5‘-gag gtc tta att gcc ttg tc-3‘
12C17P1E1.1 (F)
5‘-gat gcc tga cca ctc aca cgt gt-3‘
12C17P1E1.1 (R)
5‘-gag aag tgg gtg agg acg cca-3‘
12C17P1E2.1 (F)
5‘-tca ttc ccc tgg agc agt acc c-3‘
12C17P1E2.1 (R)
5‘-ggt aga cct ggg tag acc agg g-3‘
12C17P1E3.1 (F)
5‘-tgg atg tcg ttt tgg aag gtg tg-3‘
12C17P1E3.1 (R)
5‘-gaa aaa acc aac aag ggt tg-3‘
12C17P1E4.1 (F)
5‘-gga gcc agg gct aca gaa ag-3‘
12C17P1E4.1 (R)
5‘-tca gcc tgc aga caa gcg cc-3‘
12C17P1E5.1 (F)
5‘-cac tca tgc ctc ccc agt ctt-3‘
12C17P1E5.1 (R)
5‘-ggg tga act tgg cac aga tag cc-3‘
12C17P1E5.2 (F)
5‘-gta gag cag ccc ttc cac gaa gt-3‘
12C17P1E5.2 (R)
5‘-aga att gat gtg ttg tga gaa acc t-3‘
12C17P1E6.1 (F)
5‘-gag gag cca cct ccc tga c-3‘
12C17P1E6.1 (R)
5‘-gga gag ctg tgg gta cag ggt-3‘
12C17P1E7.1 (F)
5‘-ttg gct aaa atc atc tcc cta tga gtc-3‘
12C17P1E7.1 (R)
5‘-ctt gct acc ctg ctc ctt cca tt-3‘
12C17P1E7.2 (F)
5‘-tac ttc ccg aca cgt agt gag ac-3‘
12C17P1E7.2 (R)
5‘-agc aag gct gac aga aaa gcc-3‘
12C17P1E8.1 (F)
5‘-gcg cac gcc gcc tcc ggc cct g-3‘
12C17P1E8.1 (R)
5‘-cgg taa gcg ctg cgg gtt cgc-3‘
12C17P1E9.1 (F)
5‘-cag cct ggg aaa cag ggt ag-3‘
12C17P1E9.1 (R)
5‘-ggt cga agt gag ttt ttc ttg ctg-3‘
12C17P2E1.1 (F)
5‘-ggt gga ctc cta gct cta ctg-3‘
12C17P2E1.1 (R)
5‘-tgc tgc acc cga aca ttt c-3‘
12C17P2E2.1 (F)
5‘-gtg ttt agg ctg aac tac-3‘
12C17P2E2.1 (R)
5‘-ccc tat cct tta gtt gtc atc-3‘
46
ERGEBNISSE
Abb. 4.9 zeigt das Beispiel
eines SSCP-Gels, bei dem
man bei den Familien F206
und F708 einen bandshift in
Exon 6.1 von 109I2P1 sieht,
der bei den gezeigten
Kontrollen nicht zu erkennen
ist. Die Untersuchung von 20
weiteren
gesunden
Individuen zeigte jedoch,
dass es sich um einen
Polymorphismus handelt.
4.2.2. Ergebnisse der Sequenzierung
Neu bekannte Sequenz vom Sanger Center des BACs GS1-118i5 schloss die noch
bestehenden Lücke zwischen den Klonen RP11-12c17 und 109i2 und ermöglichte mit Hilfe
des Programms GENESCAN die Vorhersage von zwei weiteren mutmaßlichen Genen. Bei
der direkten Sequenzierung der 4 Exone eines dieser beiden Gene fanden sich 7
unterschiedliche Mutationen bei den Betroffenen der 10 BSND-Familien.
Zum amplifizieren der Exone wurden folgende Primer verwendet:
Tab. 4.2 Primer zur Amplifikation der Exone
Primer
Sequenz
S P5 Ex1 F 5‘-gag cag aga gaa gac cga gtc-3‘
T Länge
58°
359
58°
290
58°
426
58°
612
S P5 Ex1 R 5‘-tgt ctt ctc tcc ctg tgt aag c-3‘
S P5 Ex2 F 5‘-tgc cta act cac aga att gag ag-3‘
S P5 Ex2 R 5‘-aca gag gct gtc tct cct ttg-3‘
S P5 Ex3 F 5‘-ctc tcc ttt tta acc ctt gaa ctg-3‘
S P5 Ex3 R 5‘-gac cac ata ccc aaa gca aac-3‘
S P5 Ex4 F 5‘-cca ttt tgc aga tag gga aac-3‘
S P5 Ex4 R 5‘-cgg gaa ggt gga tta tcc tac-3‘
Zu diesem Gen waren 3 menschliche ESTs von renalen Tumoren, ein menschliches EST aus
der Niere, zwei Maus – ESTs aus der Niere und ein EST aus fetaler Niere des Rindes bekannt.
Die Sequenz der menschlichen cDNA hatte eine Länge von 1596 bp.
47
ERGEBNISSE
GAGAGGGCAAGGAGTAAAGGTGGCTGGGTGTGGGTCCGTTGAAGCGAGCCGCCTCCAGCCCTG
1
21
41
61
81
101
121
141
161
181
201
221
241
261
281
301
321
TTGAACTGGTGGGCCCAGGGACTGGAGCGGGATTGAAAGGGATCTTGCTCTCCCTTGAAG
CCTCGAGTTGCAGCGATTTCAGTGTCTTCTCTCCCTGTGTAAGCCTGTCTGGGTGTTTAG
GCTGAACTACAGCCACCCCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC
ATGGCTGACGAGAAGACCTTCCGGATCGGCTTCATTGTGCTGGGGCTTTTCCTGCTGGCC
60
M A D E K T F R I G F I V L G L F L L A
* * * * * * * * * * * * * * * * * * * S
CTCGGTACGTTCCTCATGAGCCATGATCGGCCCCAGGTCTACGGCACCTTCTATGCCATG 120
L G T F L M S H D R P Q V Y G T F Y A M
* * * * * * * * * * * * * * * * * * * *
GGCAGCGTCATGGTGATCGGGGGCATCATCTGGAGCATGTGCCAGTGCTACCCCAAGATC 180
G S V M V I G G I I W S M C Q C Y P K I
* * * * * * * * V * * * * * * * * * * *
ACCTTCGTCCCTGCTGACTCTGACTTTCAAGGCATCCTCTCCCCAAAGGCCATGGGCCTG 240
T F V P A D S D F Q G I L S P K A M G L
* * * * * * * * * * * * * * * * * L S *
CTGGAGAATGGGCTTGCTGCCGAGATGAAGAGCCCCAGTCCCCAGCCGCCCTATGTAAGG 300
L E N G L A A E M K S P S P Q P P Y V R
* * A * * - S * V * - - * * * * * * * *
CTGTGGGAGGAAGCCGCCTATGACCAGAGCCTGCCTGACTTCAGCCACATCCAGATGAAA 360
L W E E A A Y D Q S L P D F S H I Q M K
* * * * * * * * * * * * * * T * * * * *
GTCATGAGCTACAGTGAGGACCACCGCTCCTTGCTGGCCCCTGAGATGGGGCAGCCGAAG 420
V M S Y S E D H R S L L A P E M G Q P K
* * G * * * * P * P * * * * * L - - - *
CTGGGAACCAGTGATGGAGGAGAAGGTGGCCCTGGCGACGTTCAGGCCTGGATGGAGGCT 480
L G T S D G G E G G P G D V Q A W M E A
T * A * S V R * * E * R T A * * * * * *
GCCGTGGTCATCCACAAGGGCTCAGACGAGAGTGAAGGGGAAAGACGCCTAACTCAGAGC 540
A V V I H K G S D E S E G E R R L T Q S
P * * V * R * * * * N * * * K S H S * *
TGGCCCGGCCCCCTGGCCTGTCCCCAGGGCCCTGCCCCCTTGGCTTCCTTCCAAGATGAC 600
W P G P L A C P Q G P A P L A S F Q D D
- - S * S V G * * * S * * * * * * H * *
CTGGACATGGACTCCAGTGAAGGCAGCAGCCCCAATGCATCTCCACATGACAGGGAGGAA 660
L D M D S S E G S S P N A S P H D R E E
* * V G * * * * * * L Q P * * N R D * GCTTGTTCCCCACAACAGGAACCTCAGGGCTGCAGGTGCCCGCTGGACCGCTTCCAAGAC 720
A C S P Q Q E P Q G C R C P L D R F Q D
- - P H R * V * W A S * G * * * * * S *
TTTGCCCTGATTGATGCCCCAACGTTGGAGGATGAGCCCCAAGAGGGGCAGCAGTGGGAA 780
F A L I D A P T L E D E P Q E G Q Q W E
* * * * D* T * * S * * T V L D * * A R *
ATAGCCCTGCCCAACAACTGGCAGCGGTACCCAAGGACAAAGGTGGAGGAGAAGGAGGCT 840
I A L P N N W Q R Y P R T K V E E K E A
A * * * P K Q * W S L * M * G * T V Q *
TCGGACACAGGTGGGGAGGAACCTGAGAAGGAAGAGGAAGACCTGTACTATGGGCTGCCA 900
S D T G G E E P E K E E E D L Y Y G L P
R - - - A * * * * Q * * * * * * * * * *
GATGGAGCCGGGGACCTCCTCCCGGACAAGGAGCTGGGTTTTGAGCCTGACACCCAAGGC 960
D G A G D L L P D K E L G F E P D T Q G
* S P * N P * * * * * * * * * * * I * *
TGAGATGTTTGTGCTCCGTAGCTTTTAGTCTGGAACTGCTGCTGACCCCTGTGTGACATC 1220
*
*
ACAGGGCCTCAGTTTCCCTATTTGCAAAATGGGATGATATGGAGGTTCAATGAGATGGTG 1280
GCATTTTGAGAATGGTAAAGAAATACCCAGGGAGGGGATGATGCCTAAAAAAAAAAAAAA 1340
AAAAAAAAAAAAA
1353
Abb. 4.10 Menschliche cDNA-Sequenz und abgeleitete Aminosäuresequenz von Mensch und Maus. Start
und Stopkodon sind fett gedruckt, die identifizierten Mutationen eingerahmt. Exon 2 und 4 sind gestrichelt
unterstrichen. Die vorhergesagten mutmaßlichen Transmembrandomänen sind unterstrichen.
48
ERGEBNISSE
Bei den den Betroffenen der fünf türkischen Familien F314, F591, F730, F786 und F791 fand
sich im Startkodon homozygot ein 1A→T Basenaustausch, der zu einer Substitution von
Methionin durch Leucin führt (Abb. 4.11). Diese Mutation im Startkodon wird die Initiation
der Translation stören oder gar ganz verhindern.
Leu
Ala
Met
Ala
*
Abb. 4.11 Mutation 1A→T, die bei den Familien F314, F591, F730, F786 und F791 identifiziert wurde.
Rechts Wildtypsequenz mit intaktem Startkodon ATG.
NcoI schneidet:
CCATGG
GGTACC
Durch den Basenaustausch von A nach T an Position 1 wird eine NcoI-Schnittstelle
abgeschafft. Bei 100 gesunden Kontrollindividuen konnte die Mutation durch Verdau des
PCR-Produkts von Exon 1 mit NcoI ausgeschlossen werden.
49
ERGEBNISSE
Die Sequenzierung von Exon 1 bei F813 zeigte homozygot einen 22C→T Basenaustausch,
der zu einer Substitution von Tryptophan durch Arginin an Position 8 führt (Abb. 4.12). Bei
den Eltern war dieser Basenaustausch heterozygot zu finden.
Trp
Phe
Ile
Arg
Phe
Gly
Ile
Gly
*
Abb. 4.12 Links die Sequenz des betroffenen Kindes von F813 mit der homozygoten Mutation 22C→T, die
zu einer Substitution von Tryptophan durch Arginin an Position 8 führt. Rechts die Sequenz eines gesunden
Individuums.
Das betroffene Kind der Familie F206 zeigte einen homozygoten 23G→T Basenaustausch,
der ebenfalls an Position 8 einen Austausch von Arginin durch Leucin verursacht (Abb. 4.13).
Phe
Leu
Ile
Gly
Phe
Arg
Ile
Gly
*
Abb. 4.13 Sequenz des betroffenen Kindes von F206 mit homozygotem 23G→T Basenaustausch und
normale Sequenz bei einem gesunden Individuum.
Durch die beiden Mutationen an Position 22 und 23 bei F813 und F206 wird eine BspISchnittstelle
abgeschafft.
Kontrollindividuen
Zum
untersucht.
Ausschluss
Die
eines
Schnittstelle
Polymorphismus
war
bei
allen
wurden
100
vorhanden.
50
ERGEBNISSE
Bei Familie F197 gingen durch eine 41 bp große Deletion (157-IVS1+20del41) die letzten 21
Basenpaare von Exon 1 und die ersten 20 Basenpaare von Intron 1 verloren (Abb. 4.14a).
Dadurch verändert sich das splice-Verhalten.
Das um 41 Basenpaare kleinere PCR-Produkt von Exon 1 des betroffenen Kindes konnte
gelelektrophoretisch von dem Produkt mit normaler Größe getrennt werden (Abb. 4.14b). Bei
100 gesunden Kontollindividuen wurde keine Deletion gefunden.
g t a g g t g g t a g t g g g g c t g g g t g g g gc c a g g t ca g c
AT
t g g g gc c ag
g
bp
g t g g g gc c
S
F
M
II-1 II-2 N
500
400
300
Abb. 4.14 a
Abb. 4.14 b
Abb.4.14a zeigt die 41 bp-Deletion bei F197. Oben dargestellt ist die WT-Sequenz, unten die Sequenz des
betroffenen Kindes, bei dem 21 bp von Exon 1 und 20 bp von Intron 1 fehlen.
In Abb.4.14b ist die gelelekrophoretische Auftrennung dargestellt. Bei den Eltern und dem gesunden
Geschwisterkind (II-2) ist das deletierte Produkt heterozygot vorhanden, bei dem betroffene Kind II-2
homozygot, bei der dargestellten Normalperson und 100 weiteren Kontrollen war die kurze Bande nicht
vorhanden.
51
ERGEBNISSE
Bei Familie F708 ließen sich initial die Exone 3 und 4 nicht amplifizieren. Mit folgenden
Primern, die diese beiden Exone flankierten, konnte ein ca. 400 bp großes PCR-Produkt
amplifiziert werden (Tab. 4.3).
Tab. 4.3 Primer zur Amplifizierung des Deletionsfragments bei Familie F708
Primer
Sequenz
T
del 708 (F)
atg gca cag cca aga atg ctc cag
del 708 (R)
atc tgg gca cag gcg atc tca agg t
Länge
70°C 3483 bp
Durch Sequenzierung des Produkts erhielt man den proximalen Bruchpunkt 885 bp vor Exon
3 und den distalen Bruchpunkt 579 bp distal von Exon (Abb. 4.15a und b).
bp
S
F M II-1II-2 N
4000
3000
500
400
300
Abb. 4.15a Darstellung der Sequenz des Bruchpunkts
der Deletion bei F708. Oben und unten ist die Sequenz
im Bereich des Bruchpunkts eines nicht betroffenen
Individuums dargestellt, in der Mitte die Sequenz von
F708, II-1.
Abb.4.15b Auftrennung der durch PCR
amplifizierten Fragmente, die die
Deletion von Exon 3 und 4 bei F708 mit
einschließen. Man sieht das deletierte
Fragment mit einer Länge von ca. 400 bp
bei den Eltern F und M heterozygot und
bei den beiden betroffenen Kinder II-1
und II-2 homozygot. Das nicht
betroffene Normalindividuum zeigt
homozygot das nicht deletierte Fragment
mit einer Länge von ca. 3500bp.
52
ERGEBNISSE
4.2.3. Übersicht über die identifizierten Mutationen
Die Mutationsanalyse bei den
ergab 7 verschiedene Mutationen bei den 11 Patienten
(Tab. 4.4). Davon handelte es sich bei Hierbei handelte es sich zum einen um 5 verschiedene
Punktmutationen, die zu einem Basenaustausch führten. In 2 Fällen lag diese Punktmutation
im Startkodon. Die anderen 3 identifizierten Punktmutationen fanden sich alle in Exon 1.
Außerdem konnte eine kleinere Deletion von 41bp, die ebenfalls Exon 1 betraf, sowie eine
Deletion von Exon 3 und 4 festgestellt werden.
Bei den 5 Patienten türkischer Abstammung, bei denen aufgrund des Haplotype-Sharings eine
entfernte Verwandtschaft angenommen worden war, handelte es sich in allen Fällen um die
Mutation 1A→T, die zur Abschaffung des Startkodons führt.
Tab. 4.4. Übersicht über alle identifizierten Mutationen
Familie Konsanguinität Herkunft
homozygote
heterozygote
Mutation
Mutationen
Exon
F197
ja
Frankreich 157_IVS1+20del41
1
F314
ja
Türkei
1A→T
1
F591
ja
Türkei
1A→T
1
F730
ja
Türkei
1A→T
1
F786
ja
Türkei
1A→T
1
F791
ja
Türkei
1A→T
1
F206
ja
Frankreich
23G→T
1
F813
ja
Tunesien
22C→T
1
F708
ja
Libanon
Ex3_Ex4del
3 und 4
F662
nein
GB
3G→A und 28G→A
1
53
5.
DISKUSSION
DISKUSSION
5.1. HAPLOTYPENANALYSE
5.1.1. Auswahl der Familien
Zur Identifikation und Eingrenzung eines Genorts für eine autosomal-rezessiv vererbte
Erkrankung durch Haplotypenanalyse ist es wichtig, Familien zu untersuchen, bei denen
durch klinische und gegebenenfalls histologische Daten die Diagnose gesichert ist. Besteht
Konsanguinität, kommen als Genort in der Regel nur die homozygoten Regionen in Frage. Es
ist also günstig, möglichst viele konsanguine Familien zu untersuchen. Auch gesunde Kinder
werden in die Untersuchung mit eingeschlossen, da Regionen, in denen sie die gleichen
Haplotypen haben wie die betroffenen Geschwister, als Genort ausgeschlossen werden
können. Dabei muss beachtet werden, bis zu welchem Alter sich die untersuchte Krankheit
manifestiert. Da BSND bereits intrauterin auftritt, die Kinder postnatal früh durch ihre
massive Polyurie auffallen und innerhalb des ersten Lebensjahres sensoneurale Taubheit
diagnostiziert werden kann, die sonst bei keinem der Typen 1 - 3 des BS auftritt, können
falsch negativ diagnostizierte Kinder hier nahezu ausgeschlossen werden.
5.1.2. Haplotypenanalyse
Liegen in dem gekoppelten Bereich des Genorts mehrere Kandidatengene, ohne dass ein
geeignetes Kandidatengen ausgemacht werden kann, ist es sinnvoll, die Region weiter
einzugrenzen. So können möglichst viele Gene ausgeschlossen und deren nähere
Untersuchung unterlassen werden. Ferner bestand die Möglichkeit durch weitere Eingrenzung
durch Haplotypisierung das Teilstück, für das lange keine Sequenz vorlag, als Genort
auszuschließen. Da jedoch das identifizierte Gen genau in dieser Lücke liegt, konnte dieses
Ziel nicht erreicht werden. Der Bereich konnte aber durch Familie F591 und F813 telomerisch
und Familie F197 zentromerisch zwischen die Marker 277a12-b und 319f11-a eingegrenzt
werden.
54
DISKUSSION
5.1.3. Haplotype-Sharing-Analyse
Um bei den fünf Familien türkischer Abstammung eine eventuelle Verwandtschaft
abzuklären, wurde an die Haplotypen-Analyse ein Sharing-Analyse angeschlossen. Es zeigte
sich, dass bei diesen fünf Familien in unterschiedlicher Ausprägung der gleiche Haplotyp
vorlag. Bei Familie F591 findet man zwischen den Markern D1S2661 und D1S200 für fast
den gesamten untersuchten Bereich den Sharing-Haplotypen, der bei Familie F730 p-terminal
für den Marker 277a12-b und bei Familie F314 zentromerisch für den Marker 109i2-b
abbricht. Bei den Familien F786 und F791 zeigen für die hochpolymorphen Marker 277a12-a
bzw. 277a12-b vom Sharing-Haplotypen abweichende Allele, die folgenden Allele sind
jedoch wieder mit dem Sharing-Haplotypen vereinbar. Hier kann davon ausgegangen werden,
dass es sich nicht um den Abbruch des Sharing-Haplotypen sondern um ansestrale
Mutationen handelt.
Die Familien F708 und F662 teilten die Haplotypen für die folgenden 5 Marker:
DJ1099n07-c, D1S417, D1S2652, 109i2-b und 319f11-a. Hier fehlt jedoch die Fortsetzung
des Sharing-Haplotypen proximal bzw. distal dieser Marker. Da der Bereich der 5 Marker mit
dem Sharing-Haplotypen weniger als 0,9Mb groß ist und sich weder nach telomerisch noch
nach centromerisch fortsetzt, kann man davon ausgehen, dass das „Sharing“ dieser fünf
Marker zufällig ist und nicht auf gemeinsame Abstammung zurückzuführen ist.
Das Vorkommen von ansestralen Mutationen und „zufälligem“ Sharing, macht die
Interpretation schwierig. Zum Beispiel besteht die Gefahr, durch eine ansestrale Mutation die
Region falsch einzugrenzen und dadurch das Krankheitsgen fälschlicherweise auszuschließen.
Da es sich bei BSND jedoch um eine autosomal-rezessiv vererbte Erkrankung handelt, man
also bei vorhandener Konsanguinität homozygote Haplotypen erwartet, und die HaplotypeSharing-Analyse nur eine ergänzende Methode darstellt, konnte die weitere Eingrenzung mit
dem neuen flankierenden Marker 109i2-b als richtig angenommen werden. Ferner konnte bei
den beschriebenen Familien aufgrund der gemeinsamen ethnischen Herkunft und des
ausgeprägten Sharings über 14 Marker von einer entfernten Verwandtschaft ausgegangen
werden. Bei der Mutationsanalyse wurde später tatsächlich bei den genannten türkischen
Familien die gleiche Mutation identifiziert. Dies bestätigt die Annahme, dass die Familien
miteinander verwandt sind und der genetische Defekt von einem gemeinsamen Vorfahren an
die Familien weitergegeben wurde.
55
DISKUSSION
5.2. DAS HUMAN GENOME PROJEKT
Durch die nahezu vollständig vorhandene Sequenz des menschlichen Genoms in öffentlichen
Datenbanken seit Februar 2001 (International Human Genome Sequencing Consortium,
Venter et al., 2001) können Gene immer leichter identifiziert werden. Da jedoch die meisten
PACs noch aus mehreren Fragmenten bestehen, die durch kleine Lücken voneinander
getrennt sind, ist die Orientierung und Reihenfolge der Fragmente oft unklar. Dies wird bei
der Anwendung Von Programmen wie GENESCAN zum Problem. Wenn sich die Exone auf
unterschiedlichen Fragmenten und sich dadurch nicht in der richtigen Reihenfolge befinden,
kann das Programm das Gen nicht identifizieren. Zudem werden Exone, die einer Lücke
zwischen zwei PACs liegen, übersehen. Obwohl also statistisch gesehen, die Sequenz des
menschlichen Genoms nahezu vollständig vorliegt, werden mit Programmen wie
GENESCAN immer noch nicht alle Gene identifiziert. Nachdem in dem durch
Haplotypenanalyse eingegrenzten Bereich durch die Sequenz des Klons GS1-118i2, der beim
Sanger Center zum Sequenzieren eingereicht worden war, die Lücke zwischen den PACs
RP11-12c17 und 109i2 geschlossen war, identifizierte das Programm Genescan in diesem
Bereich zusätzlich zu einem einzelnen Exon auf dem PAC 109i2 die Exone zwei, drei und
vier von BSND. Da zu diesem Gen 3 menschliche ESTs von renalen Tumoren, ein
menschliches EST aus der Niere, zwei Maus – ESTs aus der Niere und ein EST aus fetaler
Niere des Rindes bekannt waren, war es als Kandidat besonders interessant.
56
DISKUSSION
5.3. KANDIDATENGENE
Funktionelle Kandidaten für BSND sind vor allem Gene, deren Genprodukt den
Elektrolyttransport in Niere und Ohr beeinflusst. Dabei könnte es sich um Kanäle oder
Transporter oder auch Trankriptionsfaktoren, die deren Produktion regeln, handeln. Alternativ
wäre es auch möglich, dass zwei nahe zusammen liegende Gene zum Beispiel durch eine
größere Deletion betroffen sind, wovon das eine für den Phänotyp in der Niere, das andere für
die Taubheit verantwortlich ist. Betrachtet man verschiedene bisher bekannte Taubheitsgene
und die Gene, die die ersten drei Typen des BS und das GS verursachen, erscheint diese
Möglichkeit jedoch unwahrscheinlich. Man kann eher von einem pleiotropen Effekt eines
einzelnen Gendefekts ausgehen, der sich in Ohr und Niere manifestiert.
5.3.1. funktionelle Kandidatengene
Bei den ersten drei identifizierten Genen, deren Defekt zu BS führt und beim GS handelt es
sich um Transporter bzw. Ionenkanäle, die für den Elektrolyttransport der Niere von
Bedeutung sind. Vor diesem Hintergrund liegt die Vermutung nahe, dass es sich bei BSND
auch um einen Kanal oder Transporter handeln könnte. Diskutiert wurde zum Beispiel ein
basolateraler K+-Cl--Transporter im mTAL, für den bisher keine Mutationen beschrieben
waren. Eine weitere Möglichkeit wäre zum Beispiel ein Protein, dass direkt mit einem der
Kanäle interagiert und dessen Funktion beeinflusst. Bedenkt man, dass Furosemid, Inhibitor
von NKCC2 in der Niere, als Nebenwirkung Innenohrschäden und teilweise auch
Gleichgewichtsstörungen verursacht, wäre z.B. ein gemeinsames Regulator-Protein von
NKCC2 und NKCC1, das im Ohr exprimiert wird, ein geeigneter Kandidat für BSND
(Vargish et al., 1970). Bei dem renale NKCC2 handelt es sich um die absorptive Form des
Transporters, bei NKCC1 im Innenohr um die sekretorische Form. Mit einer gestörten
Funktion der beiden Transporter könnte ein verschobenes Elektrolytgleichgewicht in Ohr und
Niere sowohl die Innenohrschwerhörigkeit als auch der Wasser- und Elektrolytverlust erklärt
werden.
Taubheitsgene, die die Entwicklung bzw. die Funktion des Innenohres beeinträchtigen, sind
hauptsächlich Ionenkanäle, Kollagene, Motormoleküle wie z.B. Actin- oder Myosinmoleküle,
um Proteine, die für den Zell-Zell-Kontakt von Bedeutung sind sowie Proteine, die durch
Interaktion mit anderen Proteinen die Hörfunktion beeinflussen.
57
DISKUSSION
Kollagene bzw. Actin- oder Myosinmoleküle kamen als Kandidaten für BSND weniger in
Frage, da der nephrologische Phänotyp mit dem massiven Flüssigkeits- und Salzverlustes
nicht erklärbar wäre. Korrelation verschiedener Merkmalen haben oft Pleiotropie als
genetische Ursache. Durch den pleiotropen Effekt eines einzelnen Gendefekts können
mehrere phänotypische Merkmale in verschiedenen Organen, z.B. in Ohr und Niere wie bei
BSND, gleichzeitig ausgelöst werden. Eine Erklärung hierfür ist die Expression eines Genes
in verschiedenen Organen mit spezifischen Aufgaben. Der Defekt löst dann je nach
Organfunktion unterschiedliche phänotypische Merkmale aus. Eine weitere Möglichkeit
besteht darin, dass ein Genprodukt z.B. im Blut zirkuliert und in den verschiedenen Organen
zur Wirkung kommt.
Die gleichzeitige Manifestation in Ohr und Niere kommt außer bei BSND auch bei anderen
Syndromen vor:
•
distal renal tubulärere Azidose (dRTA) (Konigsmark et al., 1966) ist charakterisiert durch
beeinträchtigte renale Säuresekretion, die zu metabolischer Azidose führt. Klinische
Symptome sind Nephrocalcinose, Nephrolithiasis und Osteomalazie. Es existiert eine
Variante, bei der parallel eine Innenohrschwerhörigkeit vorliegt. Hierbei liegt eine
Mutation in ATP6B1 zugrunde (Karet et al., 1999). ATP6B1 kodiert für die
β−Untereinheit
einer
apikalen
Protonenpumpe,
die
im
distalen
Nephron
die
Säuresekretion reguliert und auch in der Cochlea und im Endolymphraum exprimiert
wird, wo es den pH der Endolymphe beeinflusst.
•
Alport Syndrom (ATS), phänotypisch charakterisiert durch Nephritis, die oft zu
progressivem Nierenversagen führt, Hämaturie und sensoneurale Taubheit (Alport et al.,
1927). Beim ATS kann man Heterogenität beobachten. Es existiert eine autosomal
dominante Form (Jefferson et al., 1997), eine autosomal rezessive Form (Gubler et al.,
1995) sowie eine X-chromosomal vererbte Form (O’Neill et al., 1978). Als
verantwortliche Gene sind bisher COL4A3, COL4A4 und COL4A5 identifiziert, die für
Typ IV-Kollagene codieren.
•
Fechtner Syndrom (FTNS), eine Variante des Alport Syndroms, das mit Nephritis,
Taubheit,
congenitalem
Katarakt
und
hämatologischen
Veränderungen
wie
Makrothrombozytopathie und Leukozyten-Einschlüssen einhergeht (Peterson et al., 1985).
Aufgrund der phänotypischen Gemeinsamkeiten zwischen dem Fechtner-Syndrom und
der May-Hegglin-Anomalie und des Ergebnisses, dass die Loci beider Erkrankungen auf
einer überlappender Region auf Chromosom 22 kartieren, ergab sich die Hypothese, dass
58
DISKUSSION
es sich um verschiedene Mutationen in einem Gen handeln könnte. Diese Vermutung
wurde durch die Ergebnisse des May-Hegglin/Fechtner Syndrome Consortiums (2000)
bestätigt. Es wurden 6 Mutationen in MYH9, das in Thrombocyten exprimiert wird, bei 7
nicht verwandten Probanden, die jeweils an einem dieser Syndrome litten, identifiziert.
•
branchio-oto-renales Syndrom (BOR), bezeichnet eine autosomal-dominat vererbte
Störung, die durch Hörverlust, bilaterale branchiale Fisteln und bilaterale Nierendysplasie
charakterisiert ist (Melnick et al., 1976). Abdelhak et al. haben 1997 Mutationen in EYA1
beschrieben (Abdelhak et al., 1997), das wahrscheinlich ein Rolle in der Entwicklung aller
Komponenten des Innenohrs spielt und auch in der embryonalen Niere exprimiert wird.
Diese Syndrome haben mit BS Typ 4 gemeinsam, dass sie alle sowohl zu einem
nephrologischen Phänotyp als auch zu Taubheit führen. Dennoch ist der Pathomechanismus
und somit auch das klinische Bild sehr unterschiedlich.
Ferner sind Syndrome beschrieben, bei denen Taubheit mit anderen Störungen assoziiert ist.
Beim Jervell und Lange-Nielsen Syndrom z.B. findet man Mutationen in KCNQ1 oder
KCNE1, die zu Taubheit und kardialen Funktionsstörungen (verlängerte QT-Zeit) führen. Das
Usher-Syndrom ist eine autosomal-rezessiv vererbte Erkrankung, die durch sensoneurale
Taubheit und Retinitis pigmentosa charakterisiert ist. Es sind vier klinische Subtypen bekannt,
die durch unterschiedliche Gendefekte ausgelöst werden (Smith et al., 1994).
5.3.2. Positionelle Kandidatengene für BSND
Keines der Gene, die in dem eingegrenzten Intervall lagen, war aufgrund seiner Funktion ein
interessanter Kandidat für BSND. Von den 11 vorhergesagten Genen waren nur drei bekannt.
Keines dieser Gene schien funktionell mit BSND in Verbindung zu stehen. Zu den anderen
Genen waren zum Teil ESTs bekannt
Daher war es erforderlich, die unbekannten Gene bei allen Betroffenen mittels SSCP und RTPCR zu screenen, um eine Mutation zu finden.
59
DISKUSSION
5.3.3. Screening-Methoden
Zum Auffinden von Mutationen stehen verschiedene Methoden zur Verfügung, die
unterschiedliche Vorteile haben. Wenn kein guter funktioneller Kandidat vorhanden ist, ist
primär wichtig, dass möglichst schnell alle Gene, die positionell in Frage kommen, gescreent
werden. Ferner ist die Wahl der Methode abhängig von der Anzahl der untersuchten Familien.
Je mehr Familien untersucht werden, desto mehr verschieden Mutationen werden erwartet
und desto größer ist die Wahrscheinlichkeit, auch mit weniger sensitiven Methoden
Auffälligkeiten zu entdecken. Ist das verantwortliche Gen identifiziert, können alle Exone bei
den Betroffenen direkt sequenziert werden.
5.3.3.1.
SSCP als Screening-Methode
Die SSCP ist eine Methode, mit der relativ schnell und einfach viele Patienten untersuchen
werden können. Jedoch ist die Sensitivität der Methode eher gering. Bei einer Produktlänge
von ca.180 bp werden 90% der Mutationen erkannt, bei einer Länge von >300bp sind es nur
noch ca. 60% (Sarkar et al., 1992). Um die Sensitivität zu erhöhen wird unter verschiedenen
Versuchsbedingungen gearbeitet, jedoch kann auch damit nicht erreicht werden, dass alle
Mutationen detektiert werden können.
Über die Art und die Position der Mutationen, die sich hinter einem bandshift verbergen,
können keine Aussagen gemacht werden. Ein Großteil der Shifts ist auf Polymorphismen
zurückzuführen, die keine Krankheitsrelevanz haben. Daher wurden parallel drei gesunde
Kontrollindividuen untersucht. Wurde ein Shift bei einem Patienten gefunden, der bei keinem
der Kontrollindividuen zu erkennen war, wurden 20 weitere Kontrollen mittels SSCP und
gegebenenfalls Sequenzierung untersucht, um zu entscheiden, ob es sich um einen
Polymorphismus oder eine Mutation handelt. Polymorphismen finden sich häufig im Bereich
des Introns, da dort Single Nucleotide Polymorphisms (SNP) durch den fehlenden
Selektionsdruck öfter vorkommen.
Die SSCP ist alles in allem eine Methode, die zum aufsuchen neuer Mutationen nur noch
eingeschränkt zu empfehlen ist, da Mutationen leicht übersehen werden. Da aufgrund der
Sharing-Analyse nur 4 – 6 unterschiedliche Mutationen zu erwarten waren, wäre es durchaus
möglich gewesen, dass die entscheidenden Mutationen unerkannt geblieben wären. Daher war
60
DISKUSSION
es erforderlich, zusätzlich aufwendigere und teurere Methoden wie RT-PCR und direkte
Sequenzierung anzuwenden.
5.3.3.2.
WAVE Nucleic Acid Fragment Analysis System
Da die Suche nach krankheitsverursachende Mutationen immer weiter zunimmt und andere
einfache Methoden wie beispielsweise die SSCP den Anforderungen nur noch bedingt
genügen, war es notwendig, nach anderen schnellen, empfindlichen und preisgünstigen
Möglichkeiten zum Auffinden von DNA-Polymorphismen zu suchen (Schwarzer et al.,
2000). Bei dem WAVE-DNA-System handelt es sich um einen temperaturmodulierten
Hochleistungsflüssigkeits-chromatographen, durch das ca. 93% der Mutationen aufgefunden
werden können (Klein et al., 2000). Das Prinzip beruht auf Heteroduplexbildung bei der
gemeinsamen Abkühlung von auf 95°C erhitzten Wildtyp- und Mutanten-DNA-Fragmenten,
die nur zustande kommt, wenn ein DNA-Polymorphismus in dem amplifizierten Fragment
vorhanden ist. Die DNA-Fragmente werden auf eine Säule aufgetragen und bei nicht
denaturierender Temperatur (d.h. 50 – 51°C) aufgetrennt. Da Homo- und Heteroduplices
unter nicht denaturierenden Bedingungen dieselbe Retentionszeit haben, erhält man nur einen
Peak. Bei erhöhter Temperatur nahe der Schmelztemperatur kommt es zur Trennung der
Homoduplices von den Heteroduplices, weil letztere teilweise denaturieren. Dies führt zur
früheren Elution der Heteroduplices und zum Entstehen von zwei Peaks.
Wildtyp und Mutanten können anhand der unterschiedlichen Chromatogramme unterschieden
werden. Sind keine Mutationen oder Polymorphismen in dem amplifizierten Fragment
vorhanden, erhält man unabhängig von der Temperatur stets nur einen Peak. Bei Anwesenheit
von Heteroduplices sieht man nahe der Schmelztemperatur einen zweiten Peak. Auffällige
Fragmente müssen durch Sequenzierung weiter untersucht werden.
Da die WAVE-DNA-Analyse automatisiert abläuft, stellt sie ein schnelles und einfaches
System dar, es müssen lediglich die PCR-Produkte amplifiziert werden und die Ergebnisse
anschließend mit geeigneten Computer-Programmen ausgewertet werden. Aufgrund der
höheren Sensitivität ist diese Methode der SSCP wohl sicher überlegen und daher
vorzuziehen.
61
5.3.3.3.
DISKUSSION
RT-PCR
EBV-transformierte Lymphocyten, die aus Patienten-Blut gewonnen werden, exprimieren
unter geeigneten Bedingungen mRNA von bestimmten Genen. Mit Hilfe von Reverser
Transkriptase (RT) wird diese zunächst in komplementäre cDNA umgeschrieben und
anschließend mit der PCR amplifiziert.
Die RT-PCR hat den Vorteil, dass die cDNA direkt sequenziert werden kann und somit nicht
jedes einzelne Exon amplifiziert werden muss, sondern je nach Größe die komplette cDNA
sequenziert werden kann. Nachteile sind, dass in Lymphocyten nicht alle Gene exprimiert
werden und die RNA außerdem sehr instabil ist, da sie schnell durch RNasen abgebaut wird.
5.3.3.4.
direkte Sequenzierung
Die direkte Sequenzierung ist die genauste Methode, da die Sequenz der einzelnen Patienten
direkt und auf einzelne Basen genau untersucht wird. Da die Methode jedoch auch relativ
aufwendig und teuer ist, ist der Einsatz zum Screening nur eingeschränkt sinnvoll.
5.4. CHARAKTERISIERUNG DES BSND-GENS
Über das BSND–Gen waren bisher keine weiteren Informationen bekannt. Es war keine
nähere Verwandtschaft zu bekannten Genfamilien beschrieben. Es besteht aus vier Exonen,
und ist mit einer kompletten cDNA-Länge von 1596 bp ein relativ kleines Gen. Das
Programm TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) sagte am Nterminalen Ende zwei mutmaßliche membrandurchgängige Helices, wobei es sich bei der
ersten alternativ, vorhergesagt von dem Programm SMART, (http://smart.embl-heidelberg.de)
auch um ein Signal Peptid handeln könnte. Weitere funktionelle Domänen konnten mit Hilfe
von den verwendeten Programmen nicht vorhergesagt werden.
62
DISKUSSION
5.4.1. Position der Mutationen
Bei den fünf türkischen Familien fand sich eine Mutation im Startcodon. Dies hat zur Folge,
dass das Gen gar nicht exprimiert werden kann oder ein alternatives ATG-Triplet in der Nähe
als Startcodon eintritt und ein verändertes Protein entsteht. Ähnliches kann sich auch im Fall
der 41 bp Deletion bei Familie F197 einstellen, da durch das Fehlen der letzten 21 bp des
ersten Exons die richtige splice site verloren geht.
Bei den Mutationen, die bei Familie F813 und Familie F206 gefunden wurden, fällt auf, dass
sie sich im Bereich der vorhergesagten Signal-Peptid-Sequenz befinden. Dies spricht für die
Wichtigkeit dieses Sequenzabschnitts, da Punktmutationen das Protein so verändern, dass es
seine Funktion nicht mehr richtig erfüllen kann. Auch eine der beiden Mutationen, die bei
dem betroffenen Kind der Familie F662 identifiziert wurde, liegt in diesem Bereich. Die
zweite Mutation bei diesem Patienten betrifft ebenfalls das Startcodon.
Dass die Deletion von Exon 3 und 4 bei Familie F708 die Funktion des Proteins beeinträchtigt
ist ebenfalls einleuchtend, da dadurch die beiden größten Exone und das Stopcodon verloren
gehen (Abb. 5.2).
28G->A
1A->T
3G->A
157_IVS1+20del41
Exon 1
Exon 2
EX3_EX4del
Exon 3
Exon 4
22C->T
23G->T
Abb. 5.2. Position der Mutationen: Auffällig ist, dass die Punktmutation die
Aminosäuren 8 und 10 am Beginn von Exon 1 und das Startkodon betreffen.
63
DISKUSSION
5.5. AUSBLICK AUF WEITERFÜHRENDE ERGEBNISSE
Nach der Identifikation eines Genes für eine bestimmte Krankheit schließt sich die Frage nach
der Funktion des Proteins an. Ist wie im Falle des BSND-Gens über die Funktion nichts oder
nur wenig bekannt, gibt es verschiedene Ansätze für weitere Untersuchungen. Bei BSND war
zunächst interessant zu klären wo es exprimiert wird. Eine Northern blot Analyse bestätigte
die hauptsächliche Expression in der Niere. In situ Hybridisierung mit Nieren adulter Mäuse,
die von einem kooperierenden Labor in Hannover durchgeführt wurden, zeigte starke Signale
im inneren und äußeren Streifen der äußeren Medulla. Dieses Signal zeigt auffallende
Homologien zur Expression von murinem NKCC2 (Igarashi et al., 1995). Daher ist
anzunehmen, dass es wahrscheinlich eine Expression im mTAL darstellt. Ferner konnte eine
Hybridisierung in einem Teil der kortikalen Tubuli gezeigt werden, die ähnlich auch für die
Isoform B des murinen NKCC2 beschrieben wurde und das distale Konvolut darstellt.Diese
Ergebnisse sind gut mit dem klinischen Bild von BSND vereinbar, da die Gene, deren
Defekte die anderen Formen des aBS auslösen, NKCC2, ROMK und CLCNKB alle im
mTAL von Säugetiernieren exprimiert werden (Yoshikawa et al., 1999; Kobayashi et al.,
2001; Kohda et al., 1998). Die Expression im mTAL war aufgrund der physiologischen
Funktion dieses Abschnitts des Nephrons und dem beobachteten renalen Phänotyp, der den
Phänotypen der anderen Formen des BS stark ähnelt, bereits hypothetisch angenommen
worden. Zusätzlich zeigte sich noch ein starkes Hybridisierungssignal in der inneren Medulla
der Niere. Dieses Signal war nicht kontinuierlich bis in die Spitze der Papille vorhanden. Dies
spricht nicht für eine Expression im Sammelrohr, sondern eher für Expression im dünnen
aufsteigenden Teil der Henle-Schleife (tAL). Für diesen Nephronabschnitt ist nur die
Expression von CLC-K1, das murine Äquivalent zum humanen CLCNKA, beschrieben
(Yoshikawa et al., 1999). Der dünne aufsteigende Teil der Henle-Schleife ist vor allem für
den Konzentrationsmechanismus des Gegenstromprinzips von Bedeutung. Dies könnte eine
Erklärung dafür sein, dass die Erkrankung schwerer verläuft als bei den anderen Formen des
aBS (Abb. 5.3).
Eine weitere offene Frage ist die Pathogenese des chronischen Nierenversagens, das bei
BSND regelmäßig eintritt. Es wird spekuliert, ob es infolge der hohen renalen
Prostaglandinproduktion entsteht. Die histologischen Ähnlichkeiten zur Nephronophtise, die
auch zu chronischem Nierenversagen führt, legen die Hypothese nahe, dass ein paralleler
Entstehungsweg vorhanden sein könnte. Neue Erkenntnisse über die Pathogenese bei BSND
könnten in analog auch für die Nephronophtise zutreffen.
64
DISKUSSION
Abb. 5.3 In situ-Hybridisierungsanalyse von murinem Bsnd. a Expression in der Niere einer adulten
Maus mit einer stärkeren Vergrößerung in b, c und d. Besonders im inneren (is) und äußeren Streifen
(os) der äußeren Medulla (OM) kann man starke Signale erkennen, wobei es sich um Expression im
dicken aufsteigenen Teil der Henle-Schleife handeln könnte. e, f Expression von Bsnd im Innenohr 18,5Tage alter Mausembryonen, bei der ein starkes Signal in den Marginalzellen der Stria vascularis sowie in
der Crista ampullaris des Vestibulärorgans zu erkennen ist. Ca, crista ampullaris, cd, cochlear duct, Co,
organ of Corti, Rm, Reissner membrane, sct, scala tympani, scv, scala vestibuli, sv, stria vascularis.
(Birkenhäger et al., 2002)
65
DISKUSSION
Da bei BSND neben dem renalen Phänotyp auch das Auftreten sensoneuraler Taubheit
typisch ist, war außer der renalen Expression die Expression im Innenohr von Interesse. In
situ Hybridisierung mit muriner fetaler Cochlea von Tag 18,5 p.c. bestätigte die Expression in
den chromophilen Zellen der Stria vascularis. Da die Stria vascularis in das K+-Recycling mit
einbezogen ist und so am Erhalt der hohen K+-Konzentration der Endolymphe beteiligt sind,
ist die Taubheit als phänotypische Ausprägung des Gendefekts begründbar. Die primär aktive
Na-K-ATPase in der apikalen Membran der Marginalzellen der Stria vascularis ist direkt für
den K+-Rücktransport verantwortlich. Unterstützt wird dieser Transport von NKCC1, dem
sekundär aktiven sekretorischen Na-K-2Cl-Kotransporterin der basolateralen Membran der
chromophilen Zellen (Delpire et al., 1999). Ein Maus-Modell, bei dem Nkcc1 (Slc12A2)
ausgeschaltet ist, zeigt phänotypisch Taubheit, da durch das Fehlen von Endolymphe im
Ductus cochlearis die Reissner Membran zusammenfällt. Zusätzlich zeigt sich ein vestibulärer
Defekt.
Auch eine Regulator-Funktion von CLC-Kb und CLC-Ka oder ROMK käme als
Mechanismus des Proteins in Betracht, da der Transport über NKCC2 von der Funktion dieser
Kanäle abhängig ist.
Das weitere Vorgehen bei der näheren Charakterisierung des Proteins erfordert die
Identifikation von Interaktionspartnern beispielsweise mit Hilfe von Yeast two hybrid,
Western Plot Analysen und Immunpräzipitation oder Koexpression in Xenopus Oozyten.
Ein weiteres Ziel ist es, z.B. durch Kristallisation Informationen über die Struktur des Proteins
herauszufinden.
66
6.
ZUSAMMENFASSUNG
ZUSAMMENFASSUNG
Das Bartter Syndrom BS ist eine autosomal-rezessiv vererbte Nierenerkrankung, die in
verschiedenen Formen auftritt. Es handelt sich um eine renale Salzverlusttubulopathie, die
durch Defekte in verschiedenen Kanälen bzw. Transportern, die im dicken aufsteigenden Teil
der Henle-Schleife exprimiert werden, ausgelöst werden. Klinisch bildet sich eine
hypokaliämische
metabolische
Azidose
mit
normotensivem
hyperreninämischem
Hyperaldosteronismus aus, die auf die gestörte Na+Cl--Resorption zurückzuführen ist. Hinzu
kommen bei der antenatalen Form massive Polyurie, die zu Polyhydramnion und
Frühgeburtlichkeit führt, Hyperkalziurie, erhöhte renale Prostaglandin E2 Produktion und die
Entwicklung einer Nephrokalzinose. Für drei Typen sind bereits Gendefekte beschrieben, für
eine vierte Variante des aBS, die mit Taubheit assoziiert ist, wurde ein Genlokus auf 1p31
lokalisiert.
In der vorliegenden Arbeit wurde die bestehende Eingrenzung dieses 2 MB großen Intervalls
mit Hilfe von 15 polymorphen Mikrosatellitenmarkern durch Homozygosity mapping und
Haplotype Sharing Analyse auf weniger als 900 kb eingegrenzt werden. Dabei konnte gezeigt
werden, dass 5 der Familien ein ausgeprägtes Haplotype Sharing über bis zu 14 der 15
untersuchten Marker aufwiesen.
In diesem Bereich wurden 9 Gene und mehre hypothetische Gene identifiziert. Für 6 von den
Proteinen war keine Funktion bekannt. 6 Proteine wurden mittels SSCP an 10 Betroffenen
untersucht. In mehreren Exonen wurden bandshifts entdeckt, die sich jedoch alle als auch bei
Gesunden Kontrollindividuen vorkommende Polymorphismen erwiesen.
In einem neuartigen Gen, bestehend aus vier Exonen, wurden bei den Betroffenen 7
verschiedene Mutationen identifiziert, die mit einem Funktionsverlust einhergehen. Die
Identifikation dieses Gens bildet die Grundlage zu weiteren funktionellen Untersuchungen des
in Niere und Innenohr exprimierten Proteins, die neue Erkenntnisse über die Physiologie
dieser beiden Organe und insbesondere über die Entstehung von sensoneuraler Taubheit
liefern können.
67
7.
LITERATURVERZEICHNIS
LITERATURVERZEICHNIS
Abdelhak, S.; Kalatzis, V.; Heilig, R.; Compain, S.; Samson, D.; Vincent, C.; Weil, D.;
Cruaud, C.; Sahly, I.; Leibovici, M.; Bitner-Glindzicz, M.; Francis, M.; Lacombe, D.;
Vigneron, J.; Charachon, R.; Boven, K.; Bedbeder, P.; Van Regemorter, N.;
Weissenbach, J.; Petit, C. (1997) A human homologue of the Drosophila eyes absent gene
underlies branchio-oto-renal (BOR) syndrome and identifies a novel gene family. Nature
Genet. 15: 157-164.
Ansorge W, Sproat B, Stegemann J, Schwager C, Zenke M. (1987) Automated DNA
sequencing: ultrasensitive detection of fluorescent bands during electrophoresis. Nucleic
Acids Res 11;15(11):4593-602
Bartter FC, Pronove P, Gill, J.R Jr, MacCardle, RC. (1962) Hyperplasia of the
juxtaglomerular complex with hyperaldosteronism and hypokalemic alkalosis: a new
syndrome. Am J Med; 33: 811-828.
Bettinelli A, Bianchetti M, Girardin E, Caringella A, Cecconi M, Appiani AC, Pavanello
L, Gastaldi R, Isimbaldi C, Lama G. (1992) Use of calcium excretion values to distinguish
two forms of primary renal tubular Hypokalemic Alkalosis: Bartter and Gitelman syndromes.
J. Pediatric. 120: 38-43.
Brennan TMH, Landau D, Shalev H, Lamb F, Schutte BC, Walder RY, Mark AL,
Carmi R, Sheffield VC. (1998) Linkage of Infnatile Bartter Syndrome with Sensoneural
Deafness to Chromosome 1p. Am. J. Hum. Genet. 62:355-61
Clive DM. (1995) Bartter's syndrome: the unsolved puzzle. Am J Kidney Dis. 813-23.
Delpire E, Lu J, England, R, Dull C, & Thorne T. (1999) Deafness and imbalance
associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet 22, 192-195.
Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, et al. (1996). A
comprehensive genetic map of the human genome based on 5,264. microsatellites. Nature;
380:152-154.
68
LITERATURVERZEICHNIS
Duyk GM, Kim SW, Myers RM, Cox DR (1990) Exon trapping: a genetic screen to identify
candidate transcribed sequences in cloned mammilian genomic DNA. Proc Natl Acad Sci
USA 87:8995-8999
Fanconi A, Schachenmann G, Nussli R, Prader A. (1971) Chronic hypokalaemia with
growth retardation, normotensive hyperrenin-hyperaldosteronism ("Bartter's syndrome"), and
hypercalciuria. Report of two cases with emphasis on natural history and on catch-up growth
during treatment. Helv Paediatr Acta. 144-63
Greger R, Dillingham MA, Schrier RW. (1996) Mechanisms of diuretic action. In: Schrier
RW and Gottschalk CW (eds) Diseases of the Kidney. Little, Brown and Company, Boston
p.2321
Grompe M. (1993) The rapid detection of unknown mutations in nucleic acids. Nat Genet;
5(2):111-7
Hildebrandt F and Igarashi P. (eds) (1999) Techniques in Molecular Medicine. Springer,
Berlin-Heidelberg-New York, 381 S.
Hiort O, Wodtke A, Struve D, Zöllner A, Sinnecker GHG and the German
‘Collaborative Intersex Study Group’. (1994) Detection of point mutations in the androgen
receptor gene using non-isotopic single strand conformation polymorphism analysis. Hum.
Mol. Gen. Vol. 3, No. 7.
Igarashi, P., Vanden Heuvel, G. B., Payne, J. A., & Forbush, B., (1995) III. Cloning,
embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl
cotransporter. Am J Physiol 269, F405-F418.
International Collaborative Study Group for Bartter-like-Syndromes. (1997) Mutations
in the gene encoding the inwardly-rectifying renal potassium channel, ROMK, cause the
antenatal variant of Bartter syndrome: evidence for genetic heterogeneity. Hum. Mol. Gen. 6:
17-26.
69
LITERATURVERZEICHNIS
Jeck N, Reinalter SC, Henne T, Marg W, Mallmann R, Pasel K, Vollmer M, Klaus G,
Leonhardt A, Seyberth HW, Konrad M. (2001) Hypokalemic salt-losing tubulopathy with
chronic renal failure and sensorineural deafness. Pediatrics; 108(1):E5
Karolyi L, Koch MC, Grzeschik KH, Seyberth HW. (1998) The molecular genetic
approach to "Bartter's syndrome". J Mol Med Apr;76(5):317-25
Klein B, Weirich G, Brauch H. (2001) DHPLC-based germline mutation screening in the
analysis of the VHL tumor suppressor gene: usefulness and limitations. Hum Genet,
108(5):376-84
Kobayashi, K., Uchida, S., Mizutani, S., Sasaki, S., & Marumo, F. (2001) Intrarenal and
cellular localization of clc-k2 protein in the mouse kidney. J Am Soc Nephrol 12, 1327-1334.
Kohda Y, Ding W, Phan E, Housini I, Wang J, Star RA, Huang CL. (1998) Localization
of the ROMK potassium channel to the apical membrane of distal nephron in rat kidney.
Kidney Int 54, 1214-1223.
Konigsmark, B. W. (1966) Personal Communication. Baltimore, Md.
Landau D, Shalev H, Ohaly M, Carmi R. (1995) Infantile variant of Bartter-Syndrome and
sensorineural deafness: a new autosomal recessive dissorder. Am J Med Genet; 62: 355-361.
Liddle GW, Bledsoe T, Coppage WS Jr. (1963) A familial renal disorderr simulating
primary aldosteronism but with negligible aldosterone secretion. Trans assoc Am Phys; 76;
199-213
Lovett M, Kere J, Hinton LM (1991) Direct selection: a method for the isolation of cDNAs
encoded by large genomic regions. Proc Natl Acad Sci USA 88:9628-9632
Monaco AP, Neve RL, Colletti-Feener C, Bertelson CJ, Kurnit DM, Kunkel LM (1986)
Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature
323:646-650
70
LITERATURVERZEICHNIS
Mullis KB, Faloona FA (1987) Specific Synthesis of DNA in Vitro via a PolymeraseCatalyzed Chain Reaction. Methods Enzymol 155:335-350
Mullis KB, Faloona FA, Scharf S, Saiki R, Horn G, Erlich H (1986) Specific enzymatic
amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant
Biol 51:263-73
Ohlsson A, Sieck U, Xumming W, Akhtar M, Serenius F. (1984) Bartter syndrome
associated with hydramnios, prematurity, hypercalciuria and nephrocalcinosis. Acta Pediatr.
Scand. 73: 868-874.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. (1989) Detection of
polymorphisms of human DNA by gel electrophoresis as single-strand conformation
polymorphisms. Proc Natl Acad Sci U S A; 86(8):2766-70
Petit C, (1996) Genes responsible for human hereditary deafness: symphony of a thousand.
Nat Genet 14, 385-391.
Proesmans W, Devlieger H, Assche AV, Eggermont E, Vandenberghe K, Lemmens F,
Sieprath P, Lijnen P. (1985) Bartter syndrome in two siblings - antenatal and neonatal
observations. Int. J. Pediatr. Nephrol. 6: 63-70.
Rodriguez-Soriano J, Vallo A. (1994) Pathophysiology of the renal acidification defect
present
in
the
syndrome
of
familial
hypomagnesaemia-hypercalciuria.
Pediatr
Nephrol;8(4):431-5
Rodriguez-Soriano J. (1998) Bartter and related syndromes: the puzzle is almost solved.
Pediatr Nephrol; 12: 315-327.
Rommens JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G, Dean M, Rozmahel R,
Cole JL, Kennedy D, Hidaka N, Zsiga M, Buchwald M, Riordan JR, Tsui LC, Collins FS
(1989) Identification of the cystic fibrosis gene: chromosome walking and jumping. Science
245:1059-1065
71
LITERATURVERZEICHNIS
Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (1985)
Enzymatic amplification of beta genomic sequences and restriction site analysis for diagnosis
of sickle cell anemia. Science 230:1350-1354
Sambrook J, Fritsch EF, Maniatis T. (1989) Molecular cloning. Cold Spring Harbor
Laboratory Press, New York, 2. Auflage: 9.16-9.19.
Sanger F, Nicklen S, Coulson AR. (1977) DNA sequencing with chain-terminating
inhibitors, Proc Natl Acad Sci, p.5463-7.
Sarkar G, Yoon HS, and Sommer SS (1992) Screening for mutations by RNA single
stranded conformation polymorphism (rSSCP); comparison with DNA-SSCP. Nucl Acids Res
20:871-878
Schwarzer S, (2000) DHPLC spürt Mutationen auf, LaborPraxis
Seyberth HW, Rascher W, Schweer H, Kuehl PC, Mehls O, Schaerer K. (1985)
Congenital hypokaliemia with with hypercalciurie in preterm infants: a hyperprostagnsinuric
tubular syndrome different from Bartter`s Syndrome. J. Pediatr. 107: 694-701.
Sheffield VC, Beck JS, Kwitek AE, Sandstrom DW, Stone EM. (1993) The sensitivity of
single-strand conformation polymorphism analysis for the detection of single base
substitutions. Genomics; 16(2):325-32
Simon DB, Karet FE, Hamdan JM; Di Pietro A, Sanjad SA, Lifton RP. (1996) Bartter’s
syndrome, hypokalemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl
cotransporter NKCC2. Nature Genet; 13: 183-188.
Simon DB, Karet, FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H,
Sanjad SA, and Lifton RP. (1996b) Genetic heterogeneity of Bartter´s syndrome revealed by
mutations in the K+ channel, ROMK. Nature Genet;14 :152-156.
72
LITERATURVERZEICHNIS
Smith, R. J. H.; Berlin, C. I.; Hejtmancik, J. F.; Keats, B. J. B.; Kimberling, W. J.;
Lewis, R. A.; Moller, C. G.; Pelias, M. Z.; Tranebjaerg, L. (1994) Clinical diagnosis of the
Usher syndromes. Am. J. Med. Genet. 50: 32-38.
Snyder PM, Price MP, McDonald FJ, Adams CM, Volk KA, Zeiher BG, Stokes JB,
Welsh MJ. (1995) Mechanism by wich Liddle’s Syndrome mutations increase activity of a
human epithelial Na(+) channel. Cell 83, 969-987
Sommer SS. (1992 ) PCR amplification of specific alleles. Science 31;255(5044):514
Sommer SS, Groszbach AR, Bottema CDK. (1992) PCR amplification of specific alleles
(PASA) is a general method for rapidly detecting known single-base changes.
BioTechniques 12, 82-87
Steel, K. P. & Kros, C. J. (2001) A genetic approach to understanding auditory function. Nat
Genet 27, 143-149.
Stein JH. (1985) The pathogenetic spectrum of Bartter's syndrome. Kidney Int. 85-93.
Taylor P, Munson K, Gjerde, D. (2000), Detection of Mutations and Polymorphisms on the
WAVE® Nucleic Acid Fragment Analysis System, Transgenomic, inc.
Vollmer M, Koehrer M, Topaloglu R, Strahm B, Omran H, Hildebrandt F. (1998) Two
Novel Mutations of the gene for Kir 1.1 (ROMK) in the neonatal Bartter syndrome. Ped
Nephrol 12: 69-71
Vargish T, Benjamin R, Shenkman L. (1970) Deafness from furosemide. Ann Intern Med;
72:761.
Venter C, Adams M, Myers EW, Li P, Mural R et al. (2001), The Sequence of the Human
Genome, Science, p.291
73
LITERATURVERZEICHNIS
Vollmer M, Jeck N, Lemmink H, Vargas R, Feldmann D, Konrad M, Beekmann F, van
den Heuvel B, Deschenes G, Guay-Woodford L, Antignac C, Seyberth HJ, Hildebrandt
F and Knoers N van. (1999) Antenatal Bartter-Syndrome with sensorineural deafness:
Refinement of the locus on chromosome 1p31. Nephrol Dial Transplant, 15:970
Yoshikawa M, Uchida S, Yamauchi A, Miyai A, Tanaka Y, Sasaki S, Marumo F. (1999)
Localization of rat CLC-K2 chloride channel mRNA in the kidney. Am J Physiol 276, F552F558.
74
DANKSAGUNG
8. DANKSAGUNG
An erster Stelle möchte ich Herrn Prof. Dr. Friedhelm Hildebrandt für die Überlassung des
Themas und die hervorragende Betreuung danken! Seine unermüdliche Hilfsbereitschaft und
Bereitwilligkeit, alle meine Fragen zu beantworten, haben sehr zur Durchführung meiner
Arbeit beigetragen.
Herrn Dr. Ralf Birkenhäger danke ich für die praktische Anleitung und dafür, dass er mir zu
allen möglichen und unmöglichen Zeiten geduldig zur Lösung kleinerer und größerer
Probleme zur Seite stand und bei scheinbar unlösbaren Problemen meine Motivation mit einer
Tüte Haribo neu wecken konnte.
Mein Dank gilt auch Frau Anita Imm für ihre vielfältige Hilfe, ihre guten Tipps in allen
Lebenslagen und ihr immer offenes Ohr, nicht nur für molekulargenetische Probleme.
Herrn PD Dr. von Weizsäcker danke ich für die Übernahme des Zweitgutachtens und dafür,
dass er sich sogar in den Pfingstferien Zeit für das Promotionskolloquium nimmt.
Außerdem möchte ich mich ganz herzlich bei allen Labormitarbeitern und meinen
Mitdoktoranden Frauke Weidanz, Achim Becker und Kathleen Schorn bedanken.
Insbesondere für die immer gute Stimmung. In diesem guten Team hat die Arbeit sehr viel
Freude gemacht! Danken möchte ich auch Tina Tomann für die gründliche Korrektur meiner
Arbeit und Edda Fischer, die mich immer wieder daran erinnert hat, dass es auch noch ein
Leben außerhalb des Labors gibt.
Mein ganz besonderer Dank gilt meinem Bruder Rainer, der mein Interesse für die Forschung
geweckt hat, sowie meinen Eltern. Sie haben mich stets sehr unterstützt und ohne ihre Hilfe
wäre mein ganzes Studium in dieser Form wohl nicht möglich gewesen.
75
LEBENSLAUF
9. LEBENSLAUF
Persönliche Daten
Name
Ruf
Vorname
Eva Maria Frederike
gerboren
09.07.1977 in Stuttgart
Schulbildung
1984-1989
Pestalozzi-Grundschule, Stuttgart
1989-1997
Hegel-Gymnasium, Stuttgart
1997
Abitur
Hochschulbildung
1997-1999
Medizinstudium an der Eberhard-Karls-Universität, Tübingen
August 1999
Physikum
Seit 1999
Medizinstudium an der Albert-Ludwigs-Universität, Freiburg
August 2000
1. Staatsexamen
April 2003
2. Staatsexamen
Famulaturen
02-03/00
Famulatur im Klinikum Prenzlauer Berg, Berlin (Chirurgie)
09/01
Famulatur am Peter Lougheed Center, Calgary, Canada
(Innere Medizin)
10-11/01
Famulatur am Rarotonga Hospital, Rarotonga, Cook Islands (Pädiatrie)
01/02
Famulatur am Royal Brisbane Hospital, Brisbane, Ausralien, (klinische
Genetik)
05/02
Famulatur im Josefs-Krankenhaus, Freiburg (Anästhesie)
07-08/02
Famulatur an der Universtiäts-Frauenklinik Tübingen
(Gynäkologie und Geburtshilfe)
Dissertation
09/00 – 08/01
„Positionsklonierung des Gens (BSND) für Bartter-Syndrom mit
Taubheit“ im molekulargenetischen Labor der Albert-LudwigsUniversität Freiburg bei Herrn Prof. Dr. med. Hildebrandt. Methoden:
PCR, Haplotypenanalyse, SSCP, direkte Sequenzierung
76
LEBENSLAUF
Herunterladen
Random flashcards
lernen

2 Karten oauth2_google_6c83f364-3e0e-4aa6-949b-029a07d782fb

Erstellen Lernkarten