Proteindesign zur Veränderung der - Ti

Werbung
Aus dem Institut für Reproduktionsmedizin
der Tierärztlichen Hochschule Hannover
Proteindesign zur Veränderung
der Sequenzspezifität
der Restriktionsendonuklease EcoRI
INAUGURAL-DISSERTATION
zur Erlangung des Grades eines
DOCTOR MEDICINAE VETERINARIAE
durch die Tierärztliche Hochschule Hannover
Vorgelegt von
Daniela Gerschon
aus Hannover
Hannover 2000
Wissenschaftliche Betreuung: Prof. Dr. E. Töpfer-Petersen
Prof. Dr. J. Alves
1. Gutacher:
Prof. Dr. E. Töpfer-Petersen
2. Gutachter:
Prof. Dr. B. Otto
Tag der mündlichen Prüfung: 28.11.2000
Inhaltsverzeichnis
I
INHALTSVERZEICHNIS
1
Einleitung
1
1.1
1.2
1.3
1.4
1.5
1
2
5
6
1.6
1.7
RESTRIKTIONSENZYME
DIE RESTRIKTIONSENDONUKLEASE ECORI
UNSPEZIFISCHE DNA-BINDUNG UND LINEARE DIFFUSION
ERKENNUNG DER SPEZIFISCHEN DNA-SEQUENZ UND KOPPLUNG ZUR KATALYSE
STRUKTUR DER RESTRIKTIONSENDONUKLEASE ECORI IM VERGLEICH MIT ANDEREN
RESTRIKTIONSENDONUKLEASEN
KATALYSE
ZIEL DER ARBEIT
9
16
18
2
Material und Methoden
20
2.1
MIKROBIOLOGISCHE METHODEN
2.1.1
Bakterienstämme
2.1.2
Verwendete Vektoren
2.1.3
Herstellung kompetenter Zellen
2.1.4
Transformation von Bakterienzellen
2.2
MOLEKULARBIOLOGISCHE METHODEN
2.2.1
Isolierung von Plasmid-DNA
2.2.2
Restriktionsspaltung von Plasmid-DNA
2.2.3
Ligation
2.2.4
Elektrophoretische Trennung von DNA
2.2.4.1
Agarosegel-Elektrophorese
2.2.4.2
Polyacrylamidgel-Elektrophorese
2.2.5
Polymerasekettenreaktion (PCR)
2.2.6
Mutagenesestrategien
Gapped duplex-Mutagenese
2.2.6.1
2.2.6.2
PCR-Mutagenese
2.2.6.3
Mutageneseprimer
2.2.6.4
Klonierung der Mutanten mit StrepTag II
2.2.7
DNA-Sequenzierung
2.2.7.1
DNA-Vorbereitung und Annealingreaktion
2.2.7.2
Markierungsreaktion
2.2.7.3
Terminationsreaktion
2.2.7.4
Sequenziergel
2.3
PROTEINCHEMISCHES ARBEITEN
2.3.1
Elektrophorese unter denaturierenden Bedingungen nach Laemmli
2.3.2
Expressionstest
2.3.3
Fermentation
2.3.4
Ultraschallzellaufschluß
2.3.5
Chromatographische Verfahren
2.3.5.1
Affinitätschromatographie mit Hexahistidintag
2.3.5.2
Affinitätschromatographie mit StrepTag II
2.3.5.3
Ionenaustauschchromatographie
2.3.6
Dialyse
2.4
BIOCHEMISCHE CHARAKTERISIERUNG DER ECORI-MUTANTEN
2.4.1
UV-Spektroskopie
λ-DNA-Kinetiken
2.4.2
2.4.3
Gelretardationsexperimente (Mobility-Shift-Assays)
2.4.3.1
Bindung an ein 174Bp-Fragment
Mobility-Shift-Assay mit modifizierten Oligonukleotiden
2.4.3.2
2+
Mobility-Shift-Assay unter Ca -Zusatz
2.4.3.3
20
20
21
22
23
24
24
24
25
25
25
26
27
28
28
31
34
34
35
36
36
37
37
38
38
40
41
42
42
42
43
44
45
46
46
46
47
47
49
50
II
2.4.4
2.4.5
2.4.6
Inhaltsverzeichnis
Spaltung von Oligonukleotiden
Gelfiltration (HPLC)
Circulardichroismus (CD)
51
52
52
3
Ergebnisse
53
3.1
3.1.1
53
3.1.3
3.2
3.2.1
3.2.2
3.3
3.3.1
3.3.2
3.3.2.1
3.3.2.2
3.4
3.4.1
3.4.2
3.4.3
3.4.3.1
3.4.3.2
3.4.4
3.4.4.1
3.4.4.2
DARSTELLUNG DER MUTANTEN
PCR-Mutagenese zur Generierung der Mutanten G140A/N141AHis6 und
G140A/N141SHis6
Gapped duplex-Mutagenese zur Generierung der Mutanten G140S/R145KHis6 und
G140S/N141S/R145KHis6
Klonierung des StrepTag II
AUFREINIGUNG DER MUTANTEN
Aufreinigung der Mutanten mit Hexahistidintag
Aufreinigung der Mutanten mit StrepTag II
CHARAKTERISIERUNG DER MUTANTEN MIT HEXAHISTIDINTAG
DNA-Bindung der Mutanten mit Hexahistidintag
Kinetische Charakterisierung der Mutanten mit Hexahistidintag
Spaltverhalten auf λ-DNA
Spaltkinetiken mit λ(dam , dcm )-DNA
CHARAKTERISIERUNG DER MUTANTEN MIT STREPTAG II
Gelfiltration
Circulardichroismus
Bestimmung der DNA-Bindung der Mutanten mit StrepTag II
DNA-Bindung an das 174Bp-Fragment
DNA-Bindung an modifizierte Oligonukleotide
Charakterisierung der Spaltaktivität der Mutanten mit StrepTag II
Spaltaktivität auf λ(dam , dcm )-DNA
Spaltaktivität auf modifizierten Oligonukleotiden
4
5
6
7
Diskussion
Zusammenfassung
Summary
Literaturverzeichnis
3.1.2
53
55
57
57
57
63
65
65
66
66
69
71
71
73
74
74
75
79
79
82
91
106
107
108
Abkürzungsverzeichnis
ABKÜRZUNGSVERZEICHNIS
A
AA
AAP
ad
Amp
APS
ATP
Bis
Bp
BSA
c
CCD
Chl
dd
ddH2O
DMS
DNA
dNTP
DTB
DTT
E.coli
EDTA
εxxxnm
EtBr
g
GTP
Gua/HCl
h
HPLC
k
kDa
Konz.
l
LB
M
m
min
µ
MOPS
n
NNTA
NTP
ODxxxnm
Oligonukleotid
p
Ampère
Acrylamid
Agarose-Auftragspuffer
auffüllen auf
Ampicillin
Ammoniumperoxodisulfat
Adenin-5‘-triphosphat
N,N-Methylen-bisacrylamid
Basenpaar(e)
Bovines Serumalbumin
Konzentration
CarboxylCirculardichroismus
Chloramphenicol
didesoxy
bidestilliertes Wasser
Dimethylsuberimidat
Desoxyribonukleinsäure
Desoxyribonukleosid-5´-triphosphat
Desthiobiotin
1,4-Dithiothreitol
Escherichia coli
Ethylendiamintetraacetat, Dinatriumsalz
Extinktionskoeffizient bei xxx nm
Ethidiumbromid
Gramm oder Erdbeschleunigung
Guanosin-5´-triphosphat
Guanidiniumhydrochlorid
Stunde(n)
High pressure liquid chromatography
kilo
Kilo-Dalton
Konzentration
Liter
Luria Bertani
molar
milli oder Meter
Minute(n)
mikro
3-Morpholinopropansulfonsäure
nano
AminoNitrilotriessigsäure
Ribonukleosid-5´-triphosphat
optische Dichte bei xxxnm
oligomeres Desoxyribonukleotid
pico oder Plasmid
III
IV
PCR
Pi
T4-PNK
r
RNA
rpm
RT
SDS
s
ST
Taq
TBS
TCA
TE
TEMED
TPE
Tris
TTE
TTP
U
ÜN
UV
V
% (v/v)
% (w/v)
wt
Abkürzungsverzeichnis
Polymerase chain reaction
anorganisches Phosphat
T4-Polynukleotidkinase
ribo
Ribonukleinsäure
Umdrehungen pro Minute
Raumtemperatur
Natriumdodecylphosphat
Sekunde(n)
Saline tris buffer
Thermus aquaticus
Tris buffered saline
Trichloressigsäure
Tris-EDTA-Puffer
N,N,N´,N´-Tetramethylethylendiamin
Tris-Posphat-EDTA-Puffer
Tris(hydroxymethyl)aminoethan
Tris-Taurin-EDTA-Puffer
Thymidin-5´-triphosphat
Unit (Einheit)
über Nacht
Ultraviolett
Volt
Volumenprozent pro Volumen
Gewichtsprozent pro Volumen
Wildtyp
Aminosäuren werden nach dem internationalen Ein- oder Drei-Buchstabencode abgekürzt.
Eine Zahl hinter der Bezeichnung kennzeichnet die Position der Aminosäure innerhalb des
Proteins.
Mutanten werden benannt, indem an die auszutauschende Aminosäure mit
anschließender Positionsnummer das Kürzel der eingeführten Aminosäure angehängt
wird.
Einleitung
1
EINLEITUNG
1.1
Restriktionsenzyme
1
Restriktionsenzyme sind ubiquitär in Prokaryonten vorkommende Endonukleasen,
welche spezifisch kurze DNA Sequenzen erkennen und in beiden Strängen spalten
[Luria & Human, 1952]. Als Bestandteil von sogenannten Restriktions/Modifikationssystemen (R/M-System) stellen sie einen Abwehrmechanismus gegen das
Etablieren von Fremd-DNA in der Bakterienzelle dar, indem sie dieser durch
Spaltung in Teilstücke die Infektiosität nehmen. Die zelleigene DNA muß durch
Methylierung in der Erkennungssequenz geschützt werden, die durch ein korrespondierendes Modifikationsenzym erfolgt. Dabei ist sowohl die Methylierung einer hemimethylierten Erkennungssequenz als auch eine de novo-Methylierung möglich. Das
Enzym führt eine Methylgruppe in die DNA ein, wobei die Methylasen danach unterschieden werden, ob eine Methylierung des Ringkohlenstoffatoms zum C5-Methylcytosin oder eines exocyclischen Stickstoffatoms zum N4-Methylcytosin beziehungsweise N6-Methyladenin stattfindet [Cheng, 1995]. Für Restriktionsenzym und
Methylase ist eine hohe Spezifität unabdingbar, da ein Schutz des Bakteriengenoms
sonst nicht möglich ist.
R/M-Systeme lassen sich in vier Klassen einteilen, die sich aufgrund der Zusammensetzung ihrer Untereinheiten sowie der verwendeten Kofaktoren unterscheiden
[Heitmann, 1993; Pingoud & Jeltsch, 1997]. Weiterhin bestehen Unterschiede in der
Erkennung der spezifischen Sequenz und nachfolgender Spaltung der DNA. Allen
gemeinsam ist die notwendige Anwesenheit divalenter Kationen (Mg2+), die eine
katalytische Aktivität ermöglichen.
Bei den R/M-Systemen vom Typ I handelt es sich um einen aus drei Untereinheiten
(R, M, S) bestehenden Komplex [Murray, 2000]. Dabei steht R für Restriktion, M für
Modifikation und S für Spezifität des Enzymkomplexes. Als Kofaktoren werden ATP,
S-Adenosylmethionin (AdoMet) und Magnesiumionen benötigt. Die Spaltung der
DNA erfolgt in großer Entfernung zur sieben Basenpaare (Bp) umfassenden, unterbrochenen Erkennungssequenz.
R/M-Systeme des Typs II beinhalten zwei voneinander unabhängige Enzyme: Einerseits die Restriktionsendonuklease, welche als Homodimer auftritt und DNA in Anwe-
2
Einleitung
senheit von Mg2+ spaltet, andererseits die monomere Methyltransferase, die AdoMet
als Kofaktor braucht. Die Spaltung erfolgt innerhalb oder in unmittelbarer Nähe der
vier bis acht Basenpaare langen palindromen Erkennungssequenz, wobei entweder
glatte (blunt ends) oder überhängende (sticky ends) DNA-Enden entstehen.
Innerhalb des Typ II R/M-Systems wurden aufgrund ungewöhnlicher Eigenschaften
einiger dort klassifizierter Enzyme Untergruppen eingeführt. Bei den Restriktionsenzymen der Klasse IIe erfolgt eine allosterische Aktivierung durch Bindung einer
zweiten als Effektor wirkenden Erkennungssequenz [Krüger et al., 1995]. Enzyme
des Typs IIs erkennen vier bis sieben Basenpaare lange Erkennungssequenzen, die
Spaltung erfolgt in definiertem Abstand außerhalb derselben.
Typ III-Systeme bestehen aus zwei Untereinheiten (R und M). Während die Methyltransferase allein in Anwesenheit von AdoMet katalytisch aktiv ist, erfordert die
Restriktion ein Zusammenwirken beider Untereinheiten sowie ATP [Meisel et al.,
1995].
Erkennungssequenzen der Typ III-Systeme bestehen aus einem Enzymkomplex mit
jeweils einer Untereinheit für Restriktion und Modifikation. Die Erkennungssequenz
ist asymmetrisch und die Spaltung erfolgt in definiertem Abstand von etwa 25
Basenpaaren [Bickle, 1993].
Bei den Typ IV-R/M-Systemen treten Restriktionsendonukleasen auf, deren Spaltung
einerseits durch AdoMet stimuliert wird, andererseits jedoch ATP unabhängig ist. Die
Spaltung erfolgt in definiertem Abstand außerhalb der asymmetrischen sechs
Basenpaare langen Erkennungssequenz [Janulaitis et al., 1992].
Restriktionsenzyme, die unterbrochene Sequenzen erkennen und DNA in definiertem
Abstand auf beiden Seiten außerhalb dieser Sequenz spalten, werden dem Typ BcgI
zugeordnet [Kong et al., 1993].
1.2
Die Restriktionsendonuklease EcoRI
Die zuerst aus dem Bakterium Escherischia coli isolierte Restriktionsendonuklease
EcoRI gehört neben EcoRV zu den am besten untersuchten Typ II-Endonukleasen.
Sie besteht aus 276 Aminosäuren bekannter Sequenz [Greene et al., 1981; Newman
et al., 1981]. Das Enzym zeigt seine katalytische Aktivität im Homodimer [Alves et al.,
Einleitung
3
1982]. Weiterhin können in höheren Konzentrationen spaltaktive Tetramere gebildet
werden [Modrich & Zabel, 1976], darüber hinaus entstehen unlösliche Komplexe
[Luke & Halford, 1985].
Die EcoRI-Methylase zeigt keine Homologie zur Endonuklease. Beide Enzyme erkennen jedoch spezifisch die palindrome Sequenz GAATTC, welche von der Endonuklease zwischen G und A gespalten und von der Methylase an der N6-Aminogruppe der zentralen Adenine methyliert wird (Me; siehe Abbildung 1.1).
Me
G A AT T C
C T T AAG
Me
Abb. 1.1: Spaltung und Methylierung
an der EcoRI-Erkennungssequenz
Durch die Methylierung der Erkennungssequenz wird eine vollständige Spaltung des
DNA-Doppelstrangs verhindert [Jost & Saluz, 1993; McClelland et al., 1994].
Eine sehr langsame Spaltung unspezifischer oder methylierter Sequenzen ist möglich, wobei es vorwiegend zu Einzelstrangbrüchen in der DNA kommt [Jen-Jacobson
et al., 1996]. Diese können durch die zelleigene Ligase repariert werden und stellen
so keine Gefahr für die Zelle dar [Taylor et al., 1990].
In Gegenwart von Magnesiumionen werden kognate Sequenzen erkannt und gespalten. Sequenzen, die in einem Basenpaar davon abweichen, werden Starsequenzen genannt. Ihre Spaltung erfolgt um den Faktor 103 bis 106 langsamer [Lesser et
al., 1990; Thielking et al., 1990]. Unter bestimmten Pufferbedingungen relaxiert die
hohe Genauigkeit des Enzyms. Dazu zählen erhöhter pH-Wert (pH8,8) bei erniedrigter Salzkonzentration [Polisky et al., 1975], Verwendung von Manganionen
anstelle des Magnesiums [Hsu & Berg, 1978] oder der Zusatz organischer Lösungsmittel [Goodman et al., 1978]. Unter diesen Bedingungen steigt die Spaltaktivität für
Starsequenzen um den Faktor 103, während die Spaltgeschwindigkeit für die kanonischen Sequenzen bis auf den Level der Staraktivität absinkt.
4
Einleitung
Vier Jahre nach Veröffentlichung der ersten Röntgenstruktur der Restriktionsendonuklease EcoRI im Komplex mit dem Oligonukleotid d(TCGCGAATTCGCG)
[McClarin et al., 1986] folgte 1990 nach Analyse weiterer EcoRI-Schwermetall-Derivate eine Korrektur dieses Strukturmodells [Kim et al., 1990]. Die beiden EcoRI-Untereinheiten bilden im Dimer eine nahezu globuläre Struktur aus, welche die DNA
umschließt. Dabei umgreift jede Untereinheit die DNA mit armähnlichen Gebilden,
den so genannten Inner arms und Outer arms (siehe Abbildung 1.2).
Inner
arm
Outer
arm
Extended
chain
ß3
(Katalyse)
α4
α5
Abb. 1.2: Schleifenmodell der dimeren EcoRI im Komplex mit DNA
Bei Bindung des Enzyms an die spezifische DNA-Sequenz kommt es zu ausgeprägten Konformationsänderungen, wobei die große Furche der DNA um 28° entwunden
[Rosenberg, 1991] und ein Knick von etwa 30° induziert wird [McClarin, 1986].
Einleitung
5
Daraus ergibt sich eine Aufweitung der großen Furche um etwa 0,35nm, was die
Einlagerung von je zwei α-Helices (α4 und α5) und einem ausgestreckten Abschnitt
der Polypeptidkette (Extended chain) pro Untereinheit der Restriktionsendonuklease
in die große Furche für die Erkennung der Basensequenz ermöglicht. Die kleine
Furche der DNA bleibt dem Lösungsmittel zugewandt.
Das zentrale Strukturmotiv jeder Untereinheit wird gebildet durch ein fünfsträngiges
β-Faltblatt sowie vier α-Helices, wobei die Faltblätter β1 und β3 eine antiparallele
Ausrichtung erfahren und die katalytisch bedeutungsvollen Aminosäurereste Asp91,
Glu111 und Lys113 enthalten. Durch die Faltblätter β3 und β5 sowie den Helices α4
und 5 entsteht ein α/β-Bindungsmotiv. Dieses weist Ähnlichkeiten zu der in zahlreichen Dehydrogenasen vorkommenden nukleotidbindenden Rossman-Falte auf
[Rossman et al., 1975]. Durch die innere (α4) und die äußere (α5) Erkennungshelix
wird im Homodimer ein Vier-Helix-Bündel gebildet, welches zur DNA hin ausgerichtet
ist.
1.3
Unspezifische DNA-Bindung und lineare Diffusion
Um ihrer Funktion als Abwehrenzym gegen Fremd-DNA gerecht werden zu können,
muß EcoRI ihr Substrat zunächst erkennen und binden, bevor es zur Spaltung kommen kann. Die Bindung kann sowohl an spezifischen als auch an unspezifischen Sequenzen erfolgen [Langowski et al., 1980; Woodhead & Malcolm, 1980]. Bedingt dadurch, daß die spezifischen Bindungsstellen deutlich unterrepräsentiert sind, bindet
das Enzym in der überwiegenden Zahl der Fälle sein Substrat zunächst an unspezifischen Bindungsstellen. Anschließend erfolgt eine eindimensionale Diffusion auf die
Erkennungssequenz mit einer Geschwindigkeit von etwa 7 × 106 Basenpaaren pro
Sekunde [Ehbrecht et al., 1985]. Bei Bindung der DNA durch EcoRI wird diese dann
von den Strukturen des Inner arm (Aminosäuren 124-136) und Outer arm (Aminosäuren 176-193) umschlossen.
Unspezifische Bindung in Anwesenheit von Magnesium ist möglich (Kass≅105
[Langowski et al., 1980; Terry et al., 1985]), wobei jedoch die Bindung spezifischer
Sequenzen deutlich stärker erfolgt (Kass>108, [Grabowski et al., 1995]). Dabei liegen
6
Einleitung
der unspezifischen Bindung elektrostatische Wechselwirkungen zugrunde. Diese
sind sowohl anziehender als auch abstoßender Natur und müssen in einem Gleichgewicht miteinander stehen, um eine optimale lineare Diffusion zu ermöglichen.
Diese stellt keine gleichmäßige Bewegung dar, vielmehr ist sie abhängig von Sequenz und Struktur der DNA. Sie folgt den Windungen der großen Furche in der DNA
[Jeltsch et al., 1994]. Starsequenzen können vom Enzym wesentlich besser gebunden werden als unspezifische DNA [Lesser et al.,1990; Thielking et al., 1990]. Dieses
führt zu längeren Pausen (bis zu 20 Sekunden) während der linearen Diffusion, ohne
daß es zur Spaltung kommt [Jeltsch et al., 1994].
Die Bedeutung einer optimalen linearen Diffusion liegt in der schnellen Spaltung der
Fremd-DNA durch die Restriktionsendonuklease, was für die Zelle von entscheidender Bedeutung ist, da eine schnellere Methylierung der kognaten Sequenzen zu einem Schutz der Fremd-DNA führt.
1.4
Erkennung
der
spezifischen
DNA-Sequenz
und
Kopplung zur Katalyse
Zu den herausragendsten Eigenschaften der Restriktionsendonukleasen gehört ihre
hohe Präzision in der Substraterkennung und Katalyse, welche sich aus einer Vielzahl von Wechselwirkungen des Enzyms mit der zu spaltenden DNA-Sequenz ergibt.
Es handelt sich dabei um van der Waals-Kontakte, ionische Kontakte und Wasserstoffbrückenbindungen zwischen Protein und DNA. Als Erkennung bezeichnet man
die Summe dieser bevorzugten Wechselwirkungen; sie beginnt mit dem Übergang
vom unspezifischen in den spezifischen Komplex und schließt mit der Aktivierung
des katalytischen Zentrums ab.
Die spezifische Bindung durch die Restriktionsendonuklease EcoRI führt zu einer
Entwindung der DNA um 28° in der großen Furche. So entsteht Platz, um die Einlagerung der Erkennungshelices α4 und α5 und der Extended chain (Aminosäuren
137-142) zu ermöglichen. Das Extended chain-Motiv bildet eine Vielzahl spezifischer
Kontakte zu den Basen aus. Es wird durch das Vier-Helix-Bündel α4/α5 und das antiparallele Faltblatt (β1/β3) ausgerichtet. Ein Peptid der Sequenz des Extended chain-
Einleitung
7
Motivs ist in der Lage, an die spezifische Erkennungssequenz zu binden [Jeltsch et
al., 1995; Vennekohl 1999]. Für diese Arbeit von besonderer Wichtigkeit sind die
Kontakte zum äußeren AT-Basenpaar, in dem sich die Erkennungssequenz von
EcoRI von der von BamHI (GGATCC) unterscheidet.
Dabei wird das äußere Thymin durch einen van der Waals-Kontakt durch Gly140
kontaktiert. Diese Aminosäure bildet einen vergleichbaren Kontakt zum inneren Thymin [Küster, 1998]. Das äußere Adenin wird durch eine Wasserstoffbrückenbindung
vom Arg145 kontaktiert. Diese Aminosäure bildet gleichzeitig einen Kontakt zum inneren Adenin aus und einen ionischen Kontakt zu Glu144 der anderen Untereinheit.
Gleichzeitig besteht eine doppelseitige Wasserstoffbrückenbindung zwischen Asn141
und dem äußeren Adenin [Fritz et al., 1998].
Die katalytischen Aminosäuren Glu111 und Lys113 sind im Faltblatt β3 lokalisiert. Es
enthält ebenso die zur Kopplung wichtigen Aminosäuren Gln115 und Lys117. Als
Kopplung wird die Kommunikation zwischen einzelnen Proteinteilen bezeichnet, die
dafür sorgt, daß nach Bindung der spezifischen DNA-Sequenz die Spaltung erfolgt.
Gln115 bildet neben einem Kontakt zur DNA ebenfalls Kontakte zum Extended chain
aus (vergleiche auch Abbildung 1.3) [Jeltsch et al., 1993a]. Durch die Lage im β3Faltblatt ist eine Kommunikation mit dem katalytischen Zentrum wahrscheinlich.
Weiterhin wichtig für die Kopplung von Erkennungssequenz und Spaltung ist die
Aminosäure Glu144, die durch Kontakte zur eigenen Untereinheit (Asn141 und
Arg203) und zur anderen Untereinheit (Arg145 und Lys148) für eine effektive Vernetzung sorgt. So führt auch ein Austausch von Aminosäuren, die nicht direkt an der
Katalyse beteiligt sind, durch Störung dieses Netzwerkes zu einer unter Umständen
gravierenden Einbuße in der Spaltaktivität [Jeltsch et al., 1993a].
Insgesamt bildet die Restriktionsendonuklease EcoRI sowohl mit Purin- als auch mit
Pyrimidinbasen in der GAATTC-Sequenz spezifische Wechselwirkungen aus. Dabei
entstehen 18 Wasserstoffbrückenbindungen zwischen Protein und DNA, 14 davon
sind Protein-Purin, vier sind Protein-Pyrimidin Wechselwirkungen. Weiterhin bestehen Wasserstoffbrückenbindungen zwischen der Guaninbase, einem Wassermolekül
und den zwei Aminosäureseitenketten Arg200 und Arg203 sowie eine Vielzahl von
van der Waals-Wechselwirkungen zwischen Protein und DNA [Rosenberg, 1991]
(siehe Abbildung 1.3).
8
Einleitung
α5
Asn85
HN87
α4
Asn149
HN89
Asp91
β3
Lys148
Arg145
Glu144
HN142
Ala142
Mg
Glu111
Lys113
Gln115
Lys117
Asn141
Gly140
Extended chain
CO138
Met137
p
p
Lys130
H2O
C
A
T
p
Ile197
Met137
CO138
Extended chain
Gly140
Lys117
A
p
Tp
T
A
T
Ap Mg
Gln115
Lys113
Asn141
Ala142
HN142
Glu144
Arg145
Glu111 Lys148
β3
Asp91 Asn149
C
Gp
H2O
p
HN87
p
Asn85
Lys130
Arg203
Arg200
p
G
p
Ile197
Arg200
Arg203
p
HN89
α4
α5
H-Brücke
Ionenkontakt
van der Waals-Kontakt
Abb. 1.3: Schematische Darstellung aller Kontakte der dimeren EcoRI zur
kognaten Sequenz GAATTC
Zur Ausbildung der Kontakte ist eine strukturelle Adaption von DNA und Enzym nötig
(Induced fit), da erst durch die konformationellen Änderungen optimale Abstände
entstehen. Für die DNA sind diese Strukturänderungen leicht aus einem Vergleich
mit der Struktur des freien Oligodesoxynukleotids [Drew et al., 1981; Rinkel et al.,
1987] zu ersehen. Für das freie Enzym ist bisher keine Strukturuntersuchung im molekularen Detail gelungen. Allerdings zeigen Experimente zur schnellen Reaktionskinetik einen Einfluß zweiwertiger Kationen auf die Geschwindigkeit des Überganges in
den aktiven Zustand [Alves et al., 1989b] und es sind Mutanten generiert worden, die
sogar zweiwertige Kationen wie zum Beispiel Ca2+-Ionen benötigen, um an die DNA
Einleitung
9
binden zu können [Windolph et al., 1997]. Beides spricht eindeutig für verschiedene
Konformationen, die das Enzym einnehmen kann.
Nach Betrachtung aller Wechselwirkungen ergibt sich die Schlußfolgerung, daß es
sich bei dem Erkennungsprozeß der Restriktionsendonuklease EcoRI um ein redundantes System handelt. So kommt es bei Verlust einzelner Wechselwirkungen zwar
zu einer spezifischen Substraterkennung durch die verbleibenden Kontakte, jedoch
resultiert häufig auch eine verminderte Spaltaktivität [Wolfes et al., 1986; Yanofsky
et al., 1987; Geiger et al., 1989; Alves et al., 1989a; Needles et al., 1989; King et al.,
1989; Wright et al., 1989; Osuna et al., 1991; Selent et al., 1992; Jeltsch et al.,
1993a; Flores et al., 1995; Fritz et al., 1998].
1.5
Struktur der Restriktionsendonuklease EcoRI im Vergleich mit anderen Restriktionsendonukleasen
Ein Vergleich der bis heute sequenzierten und biochemisch charakterisierten 50 Typ
II-Restriktionsendonukleasen zeigt keine, beziehungsweise nur geringe Homologien
in den Gesamtsequenzen mit Ausnahme einiger Iso- und Neoschizomere. Klassische
DNA–Bindungsmotive wie Helix-turn-helix oder basische Helix-loop-helix Strukuren,
Zinkfinger oder basische Zipper sind nicht ersichtlich [Pingoud & Jeltsch, 1997]. Bestimmte Teilbereiche enthalten jedoch Übereinstimmungen in Struktur und Funktion
[Siksnys et al.,1995]. Von neun Restriktionsendonukleasen sind die Kristallstrukturen
bekannt. Ihre Eigenschaften zeigt die nachfolgende Tabelle:
Tab. 1.1: Typ II-Restriktionsendonukleasen bekannter Struktur
Restriktionsendonuklease
Autoren der
Röntgenstruktur
Anzahl
Aminosäuren
Erkennungssequenz
EcoRI
Kim et al., 1990
276
G↓AATTC
EcoRV
Winkler et al., 1993
245
GAT↓ATC
BamHI
Newman et al., 1995
213
G↓GATCC
10
Einleitung
PvuII
Athanasiadis et al.,
1994
157
CAG↓CTG
Cfr10l
Bozic et al., 1996
285
Pu↓CCGGPy
FokI
Wah et al., 1997
583
GGATGN9/N14
BglI
Newman et al., 1998
299
GCCNNNN↓NGG
C
MunI
Deibert et al., 1999
203
C↓AATTG
NaeI
Huai et al., 2000
162*
GCC↓CGG
* den Restriktionsenzymen verwandte Domäne des Enzyms
Die Abbildung 1.4 zeigt den strukturellen Aufbau der Restriktionsendonukleasen im
Komplex mit DNA beziehungsweise ohne (Cfr10I und NaeI).
EcoRI
BamHI
MunI
Cfr10I
EcoRV
PvuII
BglI
NaeI
Abb. 1.4: Vergleich der Strukturen von Restriktionsendonukleasen im Komplex mit und ohne DNA
(Cfr10I, NaeI). Die Komplexe sind so angeordnet, daß die große Furche am Mittelpunkt der Erkennungssequenz nach oben weist.
Obwohl es an Sequenzhomologien mangelt, weisen die Enzyme Strukturhomologien
auf. Allen acht Enzymen gemeinsam ist das zentrale Strukturmotiv, bestehend aus
einem fünfsträngigen ß-Faltblatt, welches die für die Katalyse wichtigen Aminosäuren
Einleitung
11
enthält. Hinsichtlich des Spaltverhaltens lassen sich die Enzyme in zwei Gruppen
einteilen. Während sich die Enzyme, die einen 5´-Überhang erzeugen, der DNA von
der großen Furche her nähern (obere Reihe der Abbildung 1.4), befindet sich bei den
blunt end-Schneidern und Enzymen, die einen 3´-Überhang erzeugen, die größte
Masse des Enzyms im Bereich der kleinen Furche (untere Reihe der Abbildung 1.4).
Dieses liegt begründet in den unterschiedlichen relativen Positionen der zu spaltenden Phosphodiesterbindungen. Während die Spaltung von DNA zu glatten Enden
(EcoRV und PvuII) aus der kleinen Furche geschehen kann, ist die kognate Sequenz
bei der Erzeugung eines 5´-Überhanges nur von der großen Furche zugänglich [Anderson, 1993]. Gemeinsamkeiten und Unterschiede der Gruppen werden im Vergleich der Topologien der Enzyme deutlich. In Abbildung 1.5 sind die Sekundärstrukturelemente der Enzymgruppe dargestellt, die sich von der großen Grube her nähert.
EcoRI
BamHI
D91
E111
E111
D94
K113
E113
MunI
E98
D83
K100
Cfr10I
E204
S188
D134
K190
Abb.1.5: Vergleich der Topologien der Sekundärstrukturelemente von EcoRI, BamHI, MunI und Cfr10I,
die sich der DNA von der großen Furche her nähern
12
Einleitung
Das fünfsträngige β-Faltblatt durchzieht die Strukturen (blau markiert). Die vier Enzyme verwenden ein gemeinsames Dimerisierungsmotiv, das durch zwei Helices
gebildet wird (rot markiert in Abb. 1.5). Nach diesen Strukturen erscheint es wahrscheinlich, daß die Ausrichtung des Enzyms zur DNA durch die Dimerisierungsfläche
bestimmt wird. BamHI, EcoRI und MunI enthalten dabei einen Loop in der Dimerisierungsfläche, der die gleiche Ausrichtung zum Faltblatt aufweist.
In Abbildung 1.6 sind die Sekundärstrukturelemente derjenigen Enzyme dargestellt,
die sich von der kleinen Furche her ihrer DNA Sequenz nähern.
EcoRV
PvuII
BglI
NaeI
Abb. 1.6: Vergleich der Topologien der Sekundärstrukturelemente von EcoRV, PvuII, BglI und NaeI,
die sich der DNA von der kleinen Furche her nähern
Einleitung
13
Alle Strukturen zeigen das fünfsträngige β-Faltblattmotiv. Die Enzyme PvuII und die
Endonukleasendomäne der NaeI weisen dabei große Ähnlichkeiten untereinander
auf. Sie zeichnen sich beide durch eine geringe Größe aus. Die Erkennungssequenzen von EcoRI und MunI unterscheiden sich lediglich im äußeren Basenpaar (EcoRI:
G↓AATTC; MunI: C↓AATTG), wobei die zu spaltende Bindung neben dem zentralen
AATT-Motiv gleich positioniert ist. So ergeben sich viele Gemeinsamkeiten zwischen
den Enzymen. Neben dem schon erwähnten ähnlichen Dimerisierungsmotiv zeigt der
strukturelle Vergleich der DNA-Strukturen der spezifischen Sequenzen von MunI und
EcoRI ebenfalls eine große Ähnlichkeit: beide DNA-Sequenzen tragen zentral die
Sequenz AATT, die bei der spezifischen Bindung in gleicher Weise geknickt wird.
EcoRI verwendet für die Erkennung zwei armähnliche Strukturen (Inner arm, Outer
arm). Der Outer arm ist bei MunI nicht vorhanden, der Inner arm ist verkürzt und in
einer anderen Konformation. Während die Erkennung des äußeren Basenpaars von
MunI durch eine einzelne Aminosäure (Arg115) erreicht wird, kontaktiert EcoRI die
DNA an dieser Stelle durch ein gebundenes Wassermolekül an den Aminosäuren
Arg200 und Arg203, das Cytosin direkt durch Met137 und das Peptid-NH von
Ala138.
Aufgrund der Ähnlichkeit der Dimerisierung wurde für EcoRI und BamHI ein gemeinsamer evolutionärer Ursprung postuliert [Newman et al., 1994], der nun auf MunI
ausgedehnt werden kann. Unterschiede zwischen EcoRI und BamHI zeigen sich in
der DNA-Struktur und DNA-Erkennung. Während bei EcoRI eine Verzerrung der
DNA eintritt, ersichtlich durch einen Knick von 28° im zentralen AATT-Motiv, fehlt
diese Erscheinung bei BamHI bei der spezifischen DNA-Bindung. BamHI zeigt keine
vergleichbaren Strukturen zu Inner und Outer arm sowie zum Extended chain-Motiv.
Jedoch wird hier eine zusätzliche C-terminal angeordnete α-Helix nur einer Untereinheit in die kleine Furche der DNA eingelagert. Auf diese Weise kontaktiert BamHI die
Basen eines Stranges und das Phosphatrückrat des jeweils anderen Stranges (überKreuz-Kontakt).
Im Vergleich zu EcoRI nähert sich EcoRV ihrer Erkennungssequenz von der kleinen
Furche her. Sie entwindet die DNA in der Mitte der Erkennungssequenz, wobei ein
Knick von 50° entsteht. Dadurch folgt eine Erweiterung der kleinen Furche sowie
eine Verengung der großen Furche, so daß dem Enzym ein besserer Zugriff auf die
14
Einleitung
zu spaltenden Phosphodiesterbindungen möglich wird. Der größte Teil des Erkennungsmotives von EcoRV wird als Erkennungsschleife bezeichnet (R-loop), die um
die DNA herum in die große Furche gelegt wird. Einen kleineren Anteil an der DNAErkennung trägt die glutaminhaltige Schleife (Q-loop) bei. Der R-loop bildet zwölf der
18 direkten Wasserstoffbrückenbindungen, zwei van der Waals-Kontakte sowie zwölf
wasservermittelte Wasserstoffbrückenbindungen zum Phosphatrückrat. Beim Q-loop
sind es vier Wasserstoffbrückenbindungen zu den Basen der kleinen Grube.
Bei der Restriktionsendonuklease PvuII ist zwar große Ähnlichkeit zu EcoRV vorhanden, es tritt jedoch hier keine Verzerrung der DNA in der spezifischen Bindung auf.
Ein zweisträngiges, antiparalleles Faltblatt mit zwölf direkten Wasserstoffbrückenbindungen und van der Waals-Kontakten zu Basen und Phosphatrückrat dient als Erkennungsmotiv.
Obwohl die einzelnen Restriktionsendonukleasen unterschiedliche Strategien zur
DNA-Bindung und -Erkennung anwenden, gibt es bei der Anordnung der katalytischen Aminosäuren große Ähnlichkeiten, die in der Superposition eine hohe Übereinstimmung aufweisen (siehe Abbildung 1.7). Dies impliziert eine Ähnlichkeit im
Katalysemechanismus. Eine vergleichbare Organisation der aktiven Aminosäuren ist
auch bei anderen DNA-modifizierten Enzymen zu finden, zum Beispiel bei der λ-Exonuklease oder dem Reparaturenzym MutH.
Einleitung
15
BamHI
EcoRI
Asp91
Asp91
Glu111
EcoRV
Glu98
Glu113
Asp56
Asp90
Glu68
Lys92
Ser188
Lys100
BglI
PvuII
Asp74
Asp134
Asp83
Glu111
Lys113
Cfr10I
MunI
NaeI
Asp116
Asp86
Asp142
FokI
Lys190
Lys70
Lys144
MutH
λ-Exo
Asp95
Lys97
Glu56
Asp450
Asp119
Asp467
Lys469
Glu77
Glu129
Lys79
Lys131
Abb. 1.7: Superposition der katalytischen Zentren der Restriktionsendonukleasen bekannter Kristallstruktur und anderer DNA-modifizierter Enzyme
Das katalytische Zentrum ist auf einem β-Faltblatt lokalisiert. Im überwiegenden Fall
werden zwei saure und eine basische Aminosäure verwendet. Dabei gibt es folgende
Ausnahmen: BamHI verfügt über drei saure Aminosäuren (Asp91; Glu111; Glu113).
Bei Cfr10I dagegen steht zwar ein Serin anstelle einer der sauren Aminosäuren
(Asp134; Ser188; Lys190), dafür wird aber von einem anderen Strukturteil ein Glutamat ins aktive Zentrum rekrutiert.
Für die aktiven Zentren von Restriktionsendonukleasen wurde ein allgemein gültiges
Sequenzmotiv entwickelt, das die Zusammensetzung PDX9-18(E/D)ZK aufweist [Selent et al., 1992]. Dabei ist X eine beliebige Aminosäure, während Z eine hydrophobe
Aminosäure darstellt. Das Auftreten des Motivs ist jedoch zu unbestimmt, um definitiv
sein zu können. So weist EcoRI zwei solcher Strukturmotive pro Untereinheit auf,
aber nur ein aktives Zentrum.
16
1.6
Einleitung
Katalyse
Im Vergleich der Kristallstrukturen (siehe Kapitel 1.5 und Abbildung 1.6) wird die
räumliche Anordnung der für die Katalyse entscheidenden Aminosäuren zu den zu
spaltenden Phosphodiesterbindungen deutlich. Die Spaltung der Phosphordiesterbindung entspricht einem Angriff eines Wassermoleküls in Form einer SN2-Reaktion
[Connolly et al., 1984]. Dabei sind folgende Elemente nötig:
1. Erhöhung der Elektrophilie des Phosphoratoms durch eine Lewissäure
2. Aktivierung des Wassers durch eine Base
3. Stabilisierung der negativen Ladung im Übergangszustand durch eine Lewissäure
4. Protonierung der Fluchtgruppe
Ein 1992 entwickeltes Modell der substratunterstützten Katalyse für EcoRI und
EcoRV als möglicher Mechanismus der DNA-Spaltung erfüllt die genannten Forderungen [Jeltsch et al., 1992] (siehe Abbildung 1.8, nächste Seite).
Im Fall der substratunterstützten Katalyse wird das Wasser durch den pro-RpPhosphorylsauerstoff der Phosphatgruppe am 3‘-Ende der zu spaltenden Bindung
aktiviert. Die negative Ladung dieses Sauerstoffatomes ist für die Katalyse bedeutungsvoll, da durch die Aktivierung des Wassermoleküles dessen Nukleophilie erhöht
wird [Jeltsch et al., 1993b]. Spaltexperimente mit sogenannten Missing phosphateSubstraten belegen die Aktivierung des Wassers auf die beschriebene Weise
[Jeltsch et al., 1993b]. Bei Verwendung von H-Phosphonaten tritt demnach eine
Verlangsamung der Spaltgeschwindigkeit um den Faktor 104 ein. Die Phosphatgruppe kann von dem aktivierten Wasser in Richtung der aufzulösenden Phosphatbindung angegriffen werden, wobei die Hydrolyse unter Inversion der Konfiguration
der reaktiven Phosphatgruppe erfolgt [Connolly et al., 1984]. Eine Erhöhung der
Elektrophilie des Phosphoratoms erfolgt dadurch, daß die Aminosäuren Asp91 und
Glu111 das Magnesiumion gegenüber der zu spaltenden Bindung positionieren
[Jeltsch et al., 1992], was wiederum eine Polarisierung der nicht zum DNA-Rückgrat
gehörenden P-O-Bindung des Phosphates bewirkt. Ein Sauerstoffatom der Phos-
Einleitung
17
Modell der substratunterstützten Katalyse
O
P
A
#
O
P
O
:O
H
O
..
H
Lys113
O
H
A
O
H
O
Lys113
Glu111
O
O
P
O
O:
P
O
H
O
Mg
Asp91
O
H
H
O:
G
H
O
Glu111
O
O
P
A
H
Lys113
P
Mg
Asp91
:O
H
H
Glu111
O
O
O
Mg
Asp91
H
O
G
G
Modell der Zwei-Metallionen-Katalyse
#
A
H
O
..
O
P
Glu45
Lys92
Mg
Asp74
O
O
T
H
O
P
O
O
Asp90
O
O:
A
O
Mg
Glu45
Lys92
Mg
Asp74
H
H
Mg
T
H
A
P
O
Asp90
O
O:
H
Glu45
Lys92
Mg
Asp74
O
O
O
H
H
O
:O
Mg
Asp90
H
T
Abb. 1.8: Modell der substratunterstützten Katalyse [Jeltsch et al., 1992] und der Zwei-MetallionenKatalyse [Kostrewa & Winkler, 1995]
phatgruppe wird beim Übergang der tetragonalen Geometrie des Phosphatesters in
den trigonal bipyramidalen Übergangszustand Teil der Koordinationssphäre des Magnesiumatoms [Heitman, 1992]. Bei diesem Übergangszustand tritt zusätzliche negative Ladung auf, welche durch die basische Aminosäure Lys113 neutralisiert wird.
Die Protonierung der Fluchtgruppe erfolgt mit Hilfe eines Wassermoleküls aus der
Koordinationssphäre des Mg2+-Ions.
Für die Restriktionsendonuklease EcoRV existiert, anders als bei EcoRI, ein Protein/DNA-Kokristall mit den zweiwertigen Kationen Mg2+, Mn2+ und/oder Ca2+. Es
konnten in diesen DNA-Kokristallen zwei Metallbindungsstellen lokalisiert werden.
Dabei sind die Aminosäuren Asp74/Asp90 an den Wechselwirkungen zum Kation
beteiligt und weisen eine hohe Elektronendichte auf, während Asp74/Asp45 eine ge-
18
Einleitung
ringe Elektronendichte aufweist und nicht immer alle Kriterien für eine Magnesiumsbindungsstelle erfüllt. Es konnte jedoch eine zweite Bindungsstelle experimentell
nachgewiesen werden: Nach Zugabe von Kalziumionen trat bei Vorhandensein von
Manganionen eine Erhöhung der Spaltgeschwindigkeit ein, auch wenn dieses Resultat durch Kalzium allein nicht erzielt werden konnte [Vipond et al., 1995]. Diese
Ergebnisse führten zur Einführung der Zwei-Metallionen-Katalyse als Alternative zur
substratunterstützten Katalyse [Kostrewa & Winkler, 1995; Vipond et al., 1995] (siehe
Abbildung 1.7).
Bei diesem Mechanismus entstammt das angreifende Wasser der Hydrathülle des
einen Metallions, es wird durch dieses aktiviert, während das zweite Metallion eine PO-Bindung im Phosphat polarisiert.
Bei den Restriktionsendonukleasen EcoRI und PvuII trifft die Zwei-Metallionen-Katalyse nicht zu, weil sich die potentiellen Bindungspartner für ein zweites Metallion
(EcoRI: Asp59; PvuII: Glu55) als katalytisch unbedeutend erwiesen haben
[Grabowski et al., 1996; Nastri et al., 1997].
1.7
Ziel der Arbeit
Die Restriktionsendonuklease EcoRI entwickelt zu ihrer Erkennungssequenz
GAATTC eine hohe Anzahl von Wechselwirkungen, wodurch die hohe Spezifität
vermittelt wird. Hauptverantwortlich für diese spezifischen Interaktionen mit der DNA
sind die Aminosäuren Met137 bis Arg145, die man auch als Extended chain-Motiv
bezeichnet. Diese Aminosäurereste bilden eine Reihe von Wasserstoffbrückenbindungen, hydrophoben Wechselwirkungen und ionischen Interaktionen zu den Basen
und Phosphatresten der DNA.
Die Aminosäure Glycin 140 dieses Extended chain-Motivs bildet eine hydrophobe
Wechselwirkung zum Thymin der Erkennungssequenz [Rosenberg 1991]. Für einen
Aminosäureaustausch des Glycins an der Position 140 zu Alanin konnte gezeigt
werden, daß diese Mutante eine erhöhte Spaltgeschwindigkeit auf einem Oligonukleotid zeigt, dessen äußeres Thymin durch ein Uracil ersetzt wurde [Küster,
1998].
Einleitung
19
Basierend auf diesen Erkenntnissen sollen in dieser Arbeit Mehrfachmutanten hergestellt werden, die in Kombination mit der Mutation an Position 140 eine relaxierte
Spezifität für das dem Thymin komplementäre Adenin zeigen.
Hierbei handelt es sich um die Aminosäuren Asn141 und Arg145.
Diese Aminosäuren wurden in Kombination mit der Aminosäure Glycin 140 ausgewählt, da durch die Röntgenstruktur [Rosenberg, 1991] sowie Mutageneseexperimente [Geiger et al., 1989; Alves et al., 1989b; Fritz et al., 1998] sowohl die Wasserstoffbrückenbindung von Arg145 als auch von Asn141 zu dem äußeren Adenin der
Erkennungssequenz belegt werden konnte.
Mit Hilfe der in dieser Arbeit hergestellten Mehrfachmutanten soll eine Änderung der
Spezifität erzielt werden, die eine Erkennung von GGATCC ermöglichen würde
(BamHI).
20
Material und Methoden
2
MATERIAL UND METHODEN
2.1
Mikrobiologische Methoden
2.1.1 Bakterienstämme
Bei den unterschiedlichen Arbeitsschritten im Verlauf dieser Arbeit werden die nachfolgend aufgeführten Bakterienstämme (Abkömmlinge des Stammes K12) verwendet:
LK111(λ)
Genotyp: (rK- mK+), thi-1, thr-1, leuB6, tonA21, supE44, lacIqYZ ∆M15, Hfr, λ+
Es handelt sich um einen λ-lysogenen Stamm, welcher den λ-Repressor cI konstitutiv exprimiert. Dadurch werden Proteine, die unter der Kontrolle des PL-Promoters
stehen, reprimiert. Verwendung findet er in der Vermehrung von Plasmid-DNA.
TGE900(pEcoR4)
Genotyp: (rK- mK+), F-, su-1, ilv-1, bio[λcI857 ∆Bam ∆H1]
Dieser λ-lysogene Stamm dient der Expression von Mutanten der Restriktionsendonuklease EcoRI, er exprimiert eine thermosensitive Mutante des λ-Repressors
(cl857). Oberhalb einer Temperatur von 42°C liegt dieser Repressor als bindungsinaktives Monomer vor, dadurch kann eine Expression eines plasmidkodierten Gens
unter Kontrolle des PL-Promoters durch Temperaturerhöhung induziert werden [Bottermann & Zabeau, 1985].
Zusätzlich enthält dieser Stamm das Plasmid pEcoR4, welches die zu EcoRI korrespondierende Methylase kodiert. Auf diesem Weg wird die toxische Wirkung des exprimierten Genproduktes EcoRI minimiert.
WK6mutS(λ)
Genotyp: (rK- mK+), ∆[lac proAB], galE, strA, mutS215: Tn 10 [F´, proAB, lacIq Z∆M15], λ+
Hierbei handelt es sich auch um einen λ-lysogenen Stamm, welcher in der Vermehrung von Mismatch-Plasmiden aus der Gapped duplex-Mutagenese eingesetzt wird.
Material und Methoden
21
Es ist ein reparaturdefizienter Stamm, bei dem das für die Mismatch-Reparatur verantwortliche mutS-Gen durch Tn10 zerstört wurde.
2.1.2 Verwendete Vektoren
pRIF309+(His6) (5068Bp) [Wolfes et al., 1986; Rotzal, 1992]
Es handelt sich um ein pBR322-Derivat, welches für die Replikation den CoIE1-Replikationsursprung (Ori) besitzt. Für die Herstellung des einzelsträngigen Plasmids
liegt der Replikationsursprung des filamentösen Phagen f1 vor. pRIF309+ trägt das βLactamasegen. Dieses wird durch den Tn903-TetR-Promotor konstitutiv exprimiert,
wodurch die plasmidhaltigen Zellen über eine Ampicillin-Resistenz verfügen.
Auf dem Plasmid liegt das ecoRI-Gen. Es wird durch den PL-Promotor und den fdTerminator kontrolliert. Dieses System ermöglicht die Haltung des toxischen Gens in
E.coli-Zellen, die den λ-Repressor cl produzieren. Am C-Terminus der codierenden
Sequenz des ecoRI-Gens sind sechs Histidinreste angefügt (Hexahistidintag), um
das Genprodukt (EcoRIHis6) über eine Ni2+-NTA-Affinitätsmatrix aufreinigen zu können. Das Plasmid dient der Mutagenese und der Expression von EcoRI-Mutanten.
pRIF309+ findet Verwendung als Template während der PCR-Mutagenese.
pEcoR4 (5929Bp)
Bei dem Plasmid pEcoR4 handelt es sich um einen Abkömmling des Vektors
pACYC184. Es trägt das ecoRI-Methylasegen, welches konstitutiv exprimiert wird
und eine Chloramphenicol-Resistenz. Durch die EcoRI-Methylase wird die zelleigene
DNA vor dem toxischen Genprodukt EcoRI geschützt, eine Überproduktion wird so
ermöglicht. Das Plasmid enthält den Replikationsursprung p15A und ist dadurch zu
pRIF309+(CH6) kompatibel, welches das ecoRI-Gen trägt.
pRIStrep (5074Bp) [Vennekohl, 1999]
Ausgehend vom Vektor pRIF309+(CH6) erfolgte ein Austausch des C-terminalen Hexahistidintags durch einen Affinitätstag nach Vorlage des StrepTag II, welcher acht
Aminosäuren enthält. Dadurch erhöht sich die Anzahl der Basenpaare auf 5074Bp.
Man bezeichnet das EcoRI-Fusionsprotein mit diesem Affinitätstag als EcoRIStrepII.
22
Material und Methoden
pUC8 (2665Bp) [Viera & Messing, 1982; Pouwels et al., 1985]
pUC8 ist ein käuflicher Klonierungsvektor mit CoIE1-Replikationsursprung. Das
Plasmid trägt ein Ampicillin-Resistenzgen. Es enthält in der Multiple cloning site eine
singuläre EcoRI-Erkennungssequenz und wird hier für kinetische Spaltexperimente
verwendet.
2.1.3 Herstellung kompetenter Zellen
Die in dieser Arbeit verwendeten chemisch kompetenten Zellen werden nach der
Rubidiumchlorid-Methode hergestellt, einem modifizierten Verfahren nach Hanahan
(1993). Bei dieser Methode können Kompetenzen von >107 cfu/µg eingesetzter DNA
erreicht werden. Die Zellen sind dann bis zu einem Jahr bei -70°C stabil.
Aus einer Übernachtkultur in Luria-Bertani-Medium (LB-Medium) wird eine
100ml Kultur des betreffenden E.coli-Stammes angeimpft. Bei OD600nm=0,40,6 werden die Zellen sedimentiert (1300g, 10min, 4°C), in 100ml eiskalter
TFB1-Lösung aufgenommen und 5min auf Eis inkubiert. Die folgenden Arbeitsschritte müssen auf Eis und mit gekühlten Gefäßen ausgeführt werden.
Nach einer erneuten Sedimentation erfolgt eine Resuspension in 10ml eiskalter TBF2-Lösung und anschließender 15-60 minütiger Aufbewahrung auf
Eis.
100µl Aliquots werden in flüssigem Stickstoff schockgefroren und bei -70°C
gelagert.
LB-Medium:
10g
Caseinhydrolysat (Gibco-BRL)
10g
Hefeextrakt (Gibco-BRL)
5g
NaCl
ad 1l ddH2O; pH7,5 einstellen
Material und Methoden
23
TBF1:
30mM
K-Acetat
100mM RbCl
10mM
CaCl2
50mM
MnCl2
15%
Glycerin
pH8,5; einstellen mit 0,1M Essigsäure, sterilfiltrieren
TBF2:
10mM
Mops oder Pipes
75mM
CaCl2
10mM
RbCl
15%
Glycerin
pH6,5; einstellen mit 0,1M KOH, steril filtrieren
2.1.4 Transformation von Bakterienzellen
Da Bakterienzellen normalerweise keine DNA aus dem umgebenden Medium aufnehmen, müssen sie speziell darauf vorbereitet werden (siehe 2.1.3).
Die kompetenten Zellen können dann mit dem Zielplasmid transformiert werden.
Ein 100µl-Aliquot der kompetenten Zellen wird in einem Eisbad aufgetaut.
Nach Zugabe von etwa 100ng der zu überführenden Plasmid-DNA wird der
Ansatz für 45min auf Eis inkubiert. Anschließend erfolgt ein 2minütiger Hitzeschock, welcher die Aufnahme von DNA in die Zellen fördern soll. Die Temperatur ist abhängig vom verwendeten Zelltypus, sie liegt 5-7°C über der optimalen Bebrütungstemperatur.
Nach einer kurzen Abschreckphase auf Eis werden die Zellen mit 900µl LBMedium versetzt und 1h bei optimaler Wachstumstemperatur inkubiert. Nach
schonender Zentrifugation (4°C, 1000g, 5min) werden die Zellen auf festem
Selektivmedium ausplattiert und über Nacht bei optimaler Temperatur bebrütet.
Tabelle 2.1 gibt die Temperaturen für die verwendeten Stämme wider.
24
Material und Methoden
Tab. 2.1: Bebrütungs- und Hitzeschocktemperatur in Abhängigkeit des Bakterienstammes
Stamm
Hitzeschocktemperatur
Bebrütungstemperatur
LK111(λ
λ)
42°C
37°C
TGE900(pEcoR4)
37°C
30°C
WK6mutS(λ
λ)
42°C
37°C
2.2
Molekularbiologische Methoden
2.2.1 Isolierung von Plasmid-DNA
Die Gewinnung von Plasmid-DNA aus E.coli erfolgt mit den Produkten der Firma
Qiagen. Mit dem QIAprep Spin Miniprep System werden bis zu 10µg DNA erhalten
(aus 3ml LB-Kulturen). Eine größere Ausbeute an DNA gewinnt man mit QIAGEN-tip
20 (20ml Kulturvolumen) beziehungsweise QIAGEN-tip 100 (100ml Kulturvolumen).
Die Ausbeute beträgt dann 20µg beziehungsweise 100µg.
Zur Rückgewinnung von DNA-Fragmenten aus Agarosegelen wird mit dem QIAquick
Gel Extraction Kit durchgeführt.
Die Durchführungen richten sich nach den jeweiligen Protokollen des Herstellers.
2.2.2 Restriktionsspaltung von Plasmid-DNA
Enzymatische Plasmidspaltungen werden auf verschiedenen Stufen des Klonierungsprozesses durchgeführt. Sie dienen einerseits der Überprüfung des Klonierungserfolges (analytische Spaltung) andererseits der Gewinnung von DNA für die
Klonierung (präparative Spaltung). Die Trennung erfolgt durch Agarosegelelektrophorese (siehe 2.2.4.1), wobei eine Längenabschätzung der gewonnenen Fragmente
anhand eines Standards vorgenommen wird.
Material und Methoden
25
Analytische Spaltung: 1-2µg Plasmid-DNA werden mit 10U einer Restriktionsendonuklease für eine Stunde bei der für das Enzym optimalen Temperatur
inkubiert.
Präparative Spaltung: 8-10µg Plasmid-DNA werden mit 20U einer Restriktionsendonuklease für mehrere Stunden oder auch über Nacht bei optimaler
Temperatur inkubiert.
2.2.3 Ligation
Zur Verknüpfung von DNA-Fragmenten wurde in dieser Arbeit T4-DNA-Ligase verwendet. Das Enzym ist in der Lage, alle Brüche zu reparieren, die in einer doppelsträngigen DNA vorkommen können.
Die Ligation erfolgt bei einzelsträngigen Überhängen (sticky ends) bei 37°C,
da die DNA-Fragmente schon durch Basenpaarung der Überhänge in Verbindung treten können. Eine Verknüpfung von glatten DNA-Fragmenten
(blunt ends) wird bei niedrigerer Temperatur durchgeführt (etwa 16°C).
Für den Ansatz setzt man äquimolare Mengen der DNA-Fragmente ein.
Weiterhin gibt man den vom Hersteller empfohlenen Puffer und ATP dazu
(um das durch die Knüpfung von Phosphodiesterbindungen verbrauchte ATP
zu ersetzen). Nach Zugabe von 1,5U T4-DNA-Ligase wird der Reaktionsansatz eine halbe Stunde inkubiert.
Nachfolgend muß die Ligase durch 10minütige Erhitzung des Ansatzes auf
65°C inaktiviert werden. Nun können mit dem Ligationsprodukt Zellen transformiert werden (siehe 2.1.4).
2.2.4 Elektrophoretische Trennung von DNA
2.2.4.1
Agarosegel-Elektrophorese
Agarose, ein Polysaccharid aus roten Meeresalgen, ist ein lineares Polymer aus alternierend 1,3-verknüpften ß-D-Galactopyranose- und 1,4-verknüpften 3,6-Anhydro-
26
Material und Methoden
α-L-Galactopyranose-Resten. Es löst sich beim Erhitzen in Wasser. Beim Abkühlen
bildet sich ein Netzwerk, welches die Wanderung der zu trennenden DNAFragmente herabsetzt. Zum Beispiel ist ein 1%iges Gel durch Poren mit einem
mittleren Durchmesser von 150nm gekennzeichnet. Die herzustellende Konzentration richtet sich nach der Anzahl der Basenpaare der zu trennenden DNA-Fragmente: je kleiner das Fragment, desto höher die Gelkonzentration. Agarosegele werden
in einer die Dimension des Gels festlegenden Wanne gegossen.
Für ein 1%iges Gel löst man 1g Agarose in 100ml TPE-Laufpuffer unter Erhitzen auf. Anschließend gießt man die Lösung in die vorbereitete Gelkassette. Nach Erstarren der Masse wird diese mit Laufpuffer überschichtet. Nun
können die mit Agaroseauftragspuffer versetzten Proben aufgetragen werden. Die Elektrophorese läuft etwa zwei Stunden bei 60V und 100mA.
Zur Dokumentation wird das Gel mit Ethidiumbromid (etwa 10µl auf 100ml
warmes Wasser) gefärbt. Die Banden werden auf einem UV-Leuchttisch
(312nm, UV-Transilluminator Chema 4) sichtbar gemacht. Die Dokumentation erfolgt mit E.A.S.Y RH-3 (Enhanced Analysis System, Herolab), die Bilder werden über einen Drucker (Mitsubishi Video copy processor) erhalten.
TPE-Puffer:
(10fach)
900mM
20mM
Agaroseauftragspuffer: 0,25M
(5fach)
1,2%
25%
0,1%
0,1%
2.2.4.2
Tris
EDTA, pH8,8
EDTA
SDS
Saccharose
Bromphenolblau
Xylen Cyanol FF
Polyacrylamidgel-Elektrophorese
Diese Form der Elektrophorese dient der Trennung doppelsträngiger DNA-Fragmente in einem Bereich von 5-1000Bp, wie man sie beispielsweise aus Restriktionsspaltungen oder PCR erhält. Als Gel- und Laufpuffer benutzt man TTE. Stammlösung ist eine 30%ige Acrylamid/Bisacrylamidlösung der Firma AGS.
Material und Methoden
27
Man gießt die vorbereitete Gellösung zwischen zwei Glasplatten und wartet
die durch TEMED und APS eingeleitete Polymerisation ab. Anschließend
kann das Gel in die Elektrophoresekammer eingespannt und die Proben aufgetragen werden. Die Elektrophorese läuft bei 30mA. Angefärbt wird das Gel
auf einer Glasplatte haftend in Ethidiumbromidlösung. Die Dokumentation
der Banden wird wie beim Agarosegel beschrieben durchgeführt (siehe
2.2.4.1).
TTE:
(20fach)
1,8M
575mM
2,7mM
PAA-Auftragspuffer:
(5fach)
10mM
1mM
50% (v/v)
0,2% (w/v)
0,2% (w/v)
0,2% (w/v)
Tris (nicht eingestellt)
Taurin
EDTA
Tris/HCl, pH8,8
EDTA
Glyzerin
Azorubin
Bromphenolblau
Xylen Cyanol FF
2.2.5 Polymerasekettenreaktion (PCR)
Die Polymerasekettenreaktion (Polymerase chain reaction, PCR) beruht auf der zyklischen Amplifikation von DNA-Sequenzen durch eine thermostabile Polymerase.
Dazu sind mehrere Faktoren wichtig. Man benötigt zwei synthetisch hergestellte Oligodesoxynucleotid-Primer mit einer Länge von 15-30 Nukleotiden. Die Sequenzen
der Primer müssen komplementär zu den Anfangs- und Endsequenzen der beiden
Stränge der zu amplifizierenden DNA sein. Weiterhin wird ein Gemisch von Desoxynukleotidtriphosphaten und eine hitzestabile DNA-Polymerase, zum Beispiel aus
Thermus aquaticus [Mullis & Falcona, 1987], benötigt.
Die PCR-Reaktion läuft in drei sich wiederholenden Reaktionsschritten ab. Zunächst
erfolgt eine Denaturierung der Doppelstrang-DNA (Template) der gewünschten Sequenz durch Erhitzen auf 95°C. Dieses bewirkt eine Auftrennung in Einzelstränge. In
der nun folgenden Abkühlphase hybridisieren die Primer auf die Einzelstrang-DNA
(Annealing). Durch die thermostabile DNA-Polymerase werden die neuen Stränge
28
Material und Methoden
bei einer Temperatur von 72°C synthetisiert (Extension). Es sind nun zwei Moleküle
doppelsträngiger DNA entstanden. Diese werden wieder denaturiert, es entstehen
erneut Einzelstränge, die nach dem Abkühlen mit den Primern hybridisieren und
dann wieder von der Polymerase verlängert werden.
Da bei jedem Einzelschritt eine Verdopplung der DNA-Menge erreicht werden sollte,
tritt nach 20 Zyklen theoretisch ein Vermehrungsfaktor von etwa 106 auf.
2.2.6 Mutagenesestrategien
Für die zielgerichtete Herstellung der EcoRI-Mutanten wurden die Gapped duplexMethode [Kramer et al.,1984] und die PCR-Mutagenese [Barettino et al. 1994] verwendet.
2.2.6.1
Gapped duplex-Mutagenese
Die Gapped duplex-Methode ist eine gezielte Mutagenesestrategie.
Um die gewünschte Mutation einführen zu können, wird zunächst ein Oligonukleotid
(Primer) synthetisiert, welches neben der Aminosäuremutation eine stille Mutation
enthält. Diese beinhaltet die Basensequenz zur Erzeugung oder Zerstörung einer
Restriktionsspaltstelle, verändert jedoch nicht die Aminosäuresequenzen der Position. Die stille Mutation dient später der Überprüfung des Mutageneseerfolges und
wird als Screeningsite bezeichnet. Abbildung 2.1 zeigt eine schematisierte Darstellung der Mutagenese.
Material und Methoden
29
+
Transformation
von WK6mutS
ss-pRIF309+
wt-Plasmid
mutiertes Plasmid
Screening:
Schneiden mit BglII
mismatch-Plasmid
Rahmen: SpeI/HindIII
MutageneseOligonukleotid
+
linearisiertes
wt-Plasmid
mutiertes Plasmid
Transformation
in LK111
Abb. 2.1: Schematische Darstellung der Gapped duplex-Mutagenese
Aus einer mit f1-Phagen superinfizierten Bakterienkultur, welche das zu mutierende Plasmid mit f1-Replikon (pRIF309+(CH6)) enthält, wird einzelsträngige Plasmid-DNA aufgereinigt [Vennekohl,1996]. Dann erfolgt auf dieser
Matrize die Hybridisierung des Mutageneseprimers sowie eines Mutageneserahmens, welcher die Bereiche, die in der Auffüllreaktion (Fill in) neusynthetisiert werden müssen, möglichst klein hält. Diesen Rahmen erhält man durch
Spaltung aus dem zu mutierenden doppelsträngigem pRIF309+(CH6) mit
zwei Restriktionsendonukleasen. Der Mutageneseprimer enthält nach der
Synthese kein endständiges Phosphat, so daß eine Phosphorylierung erforderlich wird (siehe unten).
Zur Hybridisierung folgt eine Inkubation von 5min bei 95°C mit anschließender langsamer Abkühlungsphase des Hybridisierungsansatzes auf Raumtemperatur. Einzelsträngige Bereiche werden mit Hilfe von T7-DNA-Polymerase aufgefüllt und dann durch T4DNA-Ligase geschlossen (siehe unten). Mit
dem entstandenen Mismatch-Plasmid werden Zellen des reparaturdefizienten Stammes WK6mutS(λ) transformiert (siehe 2.1.4). Nach der in vivo-
30
Material und Methoden
Amplifikation besitzen höchstens 50% der Tochterplasmide die gewünschte
Mutation, da nur ein Strang des Plasmids die durch den Mutageneseprimer
eingeführte Mutation trägt.
Über die stille Mutation ist dann eine Selektion der positiven Klone möglich,
indem bei Einführung einer Restriktionsspaltstelle die isolierte DNA mit dem
entsprechenden Enzym gespalten wird (siehe 2.2.2). Nach Religation (siehe
2.2.3) erfolgt die Transformation von LK111(λ)-Zellen. Wurde eine Restriktionsspaltstelle vernichtet, können nach der Spaltung durch das ScreeningEnzym direkt LK111(λ) transformiert werden.
Anschließend werden einzelne Klone erneut mit dem Screening-Enzym gespalten. Die daraus hervorgehenden positiven Klone müssen in ihrer Basensequenz verifiziert werden (siehe 2.2.7).
Phosphorylierungsansatz: 2µl
2µl
1µl
1µl
13µl
1µl
10x EcoRI-Puffer (Standardbedingungen)
0,1M DTT
10mM rATP
(20pmol) Primer
ddH20
PNK (1U/µl)
Hybridisierungsansatz:
4µl
10µl
3µl
Hybridisierungspuffer (10fach)
(10pmol) phosphoryliertes Oligonukleotid
(1pmol) einzelsträngige pRif309+(His6)Matrize
10µl
(0,5pmol) verkürzter Doppelstrang (Rahmen)
ad 40ml ddH2O
Auffüllreaktion (Fill in):
und Ligation
40µl
Hybridisierungsansatz
7,5U T7-DNA-Polymerase
7,5U T4-Ligase
Fill in-Puffer (10fach)
8µl
ad 80µl ddH2O
Material und Methoden
2.2.6.2
31
Hybridisierungspuffer:
10mM Tris/HCl, pH7,5
150mM KCl
Fill in-Puffer:
27,5mM
67,5mM
15mM
2mM
50µM
je 25µM
Tris/HCl, pH7,5
KCl
MgCl2
DTE
ATP
dATP, dGTP, dTTP, dCTP
PCR-Mutagenese
Die in vitro-Amplifikationsmethode der Polymerase chain reaction (PCR) [Mullis &
Falcona, 1989] ermöglicht die gezielte Veränderung eines Gens, in das durch die
Verlängerung der eingesetzten mutagenen Primer gleichzeitig eine Mutation auf beiden Strängen des Gens eingebracht wird [Barettino et al., 1993].
Dazu sind zwei Teilschritte notwendig, welche auf der Abbildung 2.2 deutlich gemacht werden.
Abb. 2.2: Schematische Darstellung der PCR-Mutagenese
32
Material und Methoden
In diesem Fall erfolgt im ersten Schritt die Amplifikation eines verkürzten Fragments
des ecoRI-Gens. Der Reaktionsansatz beinhaltet den Mutageneseprimer M, der sowohl die gewünschte als auch eine stille Mutation enthält sowie den Primer A, der auf
dem Hexahistidintag des ecoRI-Gens und angrenzenden Bereichen hybridisiert. Als
Template wird hier pRIF309+(CH6) eingesetzt (Ansatz siehe unten). Das Produkt
dieser 1. PCR-Reaktion dient in der anschließenden 2. PCR-Reaktion als Megaprimer. Dort werden gleichzeitig die Primer A und B sowie pRIF309+(ohne Hexahistidintag) als Template eingesetzt (Ansatz siehe unten).
Der PCR-Ansatz wird nach folgenden Angaben zusammengestellt (siehe
unten) und einer PCR unterzogen. Tabelle 2.2 gibt das Standardprogramm
für die PCR-Mutagenese wider.
Erste PCR:
5µl
5µl
1µl
1µl
1µl
1µl
35µl
10xHigh-Fidelity-Puffer
2mM dNTPs
50µM Primer A
50µM Mutageneseprimer
pRIF309+(His6) (100ng/µl, lin. XmnI)
High Fidelity-DNA-Polymerase (nativ,
2,5U/µl, Firma Boehringer Mannheim)
ddH2O
Tab. 2.2: Standardprogramm für die PCR-Mutagenese
Wiederholungen
Denaturierung
Annealing
Extension
1x
91°C
91°C
45°C
72°C
60s
90s
60s
91°C
45°C
72°C
60s
90s
300s
300s
30x
1x
Material und Methoden
33
Der entstandene Megaprimer wird mit dem PCR Purification Kit der Firma
Qiagen aufgereinigt, in 50µl TE aufgenommen. Das PCR-Produkt wird auf
einem 10%igen Polyacrylamidgel (siehe 2.2.4.2) analysiert.
Das erste PCR-Produkt wird in die zweite PCR eingesetzt (Ansatz siehe unten). Es wird das gleiche Programm wie für die erste PCR (siehe Tabelle 2.2)
verwendet.
Zweite PCR:
5µl
5µl
1µl
1µl
5µl
1µl
1µl
31µl
10xReaktionspuffer
2mM dNTPs
50µM Primer A
50µM Primer B
Megaprimer
pRIF309+(ohne His6) (100ng/µl, lin. PvuI)
High Fidelity-DNA-Polymerase (nativ,
2,5U/µl, Firma Boehringer Mannheim)
ddH2O
Das zweite PCR Produkt wird ebenfalls auf einem Polyacrylamidgel (siehe
2.2.4.2) analysiert und mit dem PCR Purification Kit der Firma Qiagen aufgereinigt.
Anschließend erfolgt eine Restriktionsspaltung des zweiten PCR-Produktes,
welches durch Ligation (siehe 2.2.3) in den vorbereiteten Rahmen des Plasmids pRIF309+(CH6) überführt wird. Der Ligationsansatz wird in LK111(λ)
transformiert und die Klone auf das Vorhandensein der eingeführten Screeningsite geprüft.
Vergleicht man die Gapped duplex-Mutagenese mit der PCR-Mutagenese, liegt der
Vorteil letzterer in einem deutlich geringerem Zeitaufwand sowie der Möglichkeit der
Herstellung von Mehrfachmutanten, deren Mutationen in der Primärsequenz dicht
aufeinander folgen. Dieses ist mit der Gapped duplex- Mutagenese schwierig, da der
Mutageneseprimer mit jedem zusätzlichen Mismatch schlechter auf dem Template
hybridisiert.
34
Material und Methoden
2.2.6.3 Mutageneseprimer
Die Primersequenzen sind in 5‘→3‘-Richtung angegeben. Die in der DNA vorgenommenen Basenaustausche sind fett gedruckt. Die neu eingefügten Aminosäurecodons sind kursiv gedruckt. Mit den Primern wurde jeweils die BglII-Spaltstelle (unterstrichen) entfernt.
Wildtypsequenz
TTA ATG GCT GCT GGT AAT GCT ATC GAA AGA TCT CAT AAG AAT
G140A/N141A (-BglII)
TTA ATG GCT GCT GCT GCT GCT ATC GAA AGG TCT CAT AAG AAT
Ala Ala
G140A/N141S (-BglII)
TTA ATG GCT GCT GCT AGT GCT ATC GAA AGG TCT CAT AAG AAT
Ala Ser
G140S/R145K (-BglII)
TTA ATG GCT GCT AGT AAT GCT ATC GAA AAA TCT CAT AAG AAT
Ser
Lys
G140S/N141S/R145K (-Bglll)
TTA ATG GCT GCT AGT AGT GCT ATC GAA AAA TCT CAT AAG AAT
Ser Ser
Lys
Die Mutanten G140A/N141A und G140A/N141S wurden mit Hilfe der PCR- Mutagenese hergestellt, G140S/R145K und G140S/N141S/R145K mittels der Gapped duplex-Mutagenese.
2.2.6.4 Klonierung der Mutanten mit StrepTag II
Aufgrund der schlechten Aufreinigungserfolge der Mutanten mit dem Hexahistidintag
erfolgte eine Umklonierung zum StrepTag II. Dadurch erhöht sich die Anzahl der Ba-
Material und Methoden
35
senpaare von sechs (His6) auf acht (StrepTag II). Es handelt sich dabei um die Aminosäuresequenz Trp-Ser-His-Pro-Gln-Phe-Glu-Lys.
In dieser Arbeit wurde durch Spaltung mit den Restriktionsenzymen SpeI und HindIII
ein 620Bp großes Insert, welches die Mutation trägt herausgeschnitten und den
4451Bp großen pRSN-Rahmen ligiert (siehe 2.2.3). Anschließend erfolgte die
Transformation von LK111(λ) mit dem Ligationsansatz. Eine Überprüfung des Klonierungserfolges fand auf einem Agarosegel statt. Die positiven Klone konnten nach
Transformation in TGE900(pEcoR4) der Aufreinigung mit dem StrepTag II-System
zugeführt werden (siehe 2.2.6.4).
2.2.7 DNA-Sequenzierung
Zur Bestätigung der Mutationen wird das betreffende Plasmid einer DNA-Sequenzierung unterzogen. Um Sekundärmutationen auszuschließen, muß das gesamte
ecoRI-Gen kontrolliert werden. Hierzu wurde die Didesoxy-Methode nach Sanger
[Sanger et al., 1977] verwendet. Auf die zu sequenzierende DNA (Template) wird ein
kurzes Oligonukleotid (Primer) hybridisiert (Annealing), welches durch die Polymerase verlängert wird. Zusätzlich zu den Desoxynukleotidtriphosphaten wird in vier
Parallelreaktionen je eine der vier Basen als Didesoxynukleotidtriphosphat für die
Polymerisation eingesetzt (Termination). Zu einem Kettenabbruch kommt es, wenn
ein Didesoxynukleotid durch die Polymerase in die Nukleotidkette eingebaut wird, so
daß die für die Synthese der nächsten Phosphordiesterbindung benötigte 3‘OHGruppe fehlt. Auf diese Weise entstehen statistisch unterschiedlich lange DNAFragmente, die durch eine denaturierende Polyacrylamidgel-Elektrophorese (6%iges
Gel) aufgrund ihrer Länge aufgetrennt werden können.
Anschließend kann die Basensequenz der DNA von einem Autoradiogramm
abgelesen werden.
Folgende Primer wurden zur Sequenzierung verwendet (siehe Tabelle 2.3):
36
Material und Methoden
Tab. 2.3: Primersequenzen für die Sequenzierung des ecoRI-Gens nach Sanger
Primer
Sequenz
Position im Gen
(Bp des Plasmids)
lesbarer Bereich
(Aminosäureposition)
H239
TTCAAAGCAGAAGGC
239-253
1-90
H1
GATCTTGGCGGTA
541-528
90-160
M2
TCGAAAGATCTCATAA
729-744
160-240
H955
TGTATTAACAAATTT
953-966
240-284
2.2.7.1 DNA-Vorbereitung und Annealingreaktion
1,5-2µg doppelsträngige Template-DNA wird durch Zugabe von 2µl 2M
NaOH 10min bei Raumtemperatur denaturiert. Zur Neutralisation werden 3µl
Na-Acetat (pH4,5) und 7µl ddH2O zugegeben. Anschließend gibt man 60µl
100% Ethanol dazu, um die DNA zu fällen (-70°C für 15min oder 20°C für
30min).
Nach 10min Zentrifugation bei 12000rpm wird der Überstand verworfen, das
Pellet in 70% Ethanol (eiskalt) resuspendiert und erneut zentrifugiert (10min,
12000rpm, 4°C). Der Überstand wird entfernt, das DNA-Pellet an der Luft
getrocknet und dann in 10µl ddH2O aufgenommen.
Diese Lösung wird nach Zugabe von 2µl Annealingpuffer und 2µl Primer (710ng) 20min bei 37°C inkubiert. Dann läßt man den Ansatz 10min bei
Raumtemperatur stehen. Die Annealingansätze können sofort benutzt oder
bei -20°C aufbewahrt werden.
Annealingpuffer:
0,28M
0,1M
0,35M
Tris/HCl, pH7,5
MgCl2
NaCl
2.2.7.2 Markierungsreaktion
Zum Annealingansatz werden 2µl Labellingmix, 1µl 0,3M DDT und 1µl [α35
S]dATP gegeben. Die Reaktion wird durch Zugabe von 2µl verdünnter T7-
Material und Methoden
37
DNA-Polymerase (1,5U/µl) gestartet. Dann mischt man die Lösung vorsichtig
mit der Pipettenspitze, zentrifugiert kurz an und inkubiert 5min bei Raumtemperatur.
Labellingmix:
2µM dTTP, dGTP und dCTP
2.2.7.3 Terminationsreaktion
Je 2,5µl der vier Terminationsmixe werden bei 37°C vorgewärmt. Nach Beenden der Labellingreaktion werden 4,5µl der Ansätze zu den Terminationsansätzen pipettiert. Die Reaktion wird nach genau 5min durch Zugabe von
5µl Sequenzierauftragspuffer (SAP, Stopplösung) beendet. Vor Auftrag auf
das Sequenziergel müssen die Proben noch 2min bei 95°C denaturiert und
auf Eis abgeschreckt werden. Pro Probentasche setzt man 2,5µl ein.
Terminationsmixe:
15µM
150µM
40mM
10mM
50mM
ddATP bzw. ddTTP, ddGTP oder ddCTP
dATP, dTTP, dGTP und dCTP
Tris/HCl, pH7,5
MgCl2
NaCl
2.2.7.4 Sequenziergel
Zunächst werden die mit Ethanol gereinigten Glasplatten mit Haftsilan beziehungsweise Repellsilan beschichtet. Die Polymerisation der vorbereiteten
Gellösung wird durch Zugabe von 27µl TEMED und 270µl APS (40%) gestartet. Nach etwa einer Stunde kann das Gel verwendet werden.
Es wird dafür zunächst in eine beheizbare, vertikale Elektrophoresekammer
(Temperatur etwa 55°C) eingespannt und die Pufferbehälter mit 1xTTE gefüllt. Für den Vorlauf werden die Taschen mit 2µl SAP beschickt. Der Vorlauf
dauert etwa 30min und wird bei 1500V (maximal 50mA) durchgeführt.
Anschließend werden 2µl der Proben in die gesäuberten Geltaschen pipettiert. Die Trennung der DNA-Fragmente erfolgt bei 1500V für 2-3 Stunden
(bis das zugesetzte Bromphenolblau das Gelende erreicht hat).
38
Material und Methoden
Um den Harnstoff zu entfernen, wird das Gel 1-2 Stunden in 10%ige Essigsäure gelegt und anschließend bei 65°C getrocknet. Die radioaktiv markierten Banden werden durch Auflegen eines Röntgenfilmes (Firma: Kodak;
Kodak BioMax) sichtbar gemacht.
Repellsilan:
10% (v/v) Dichlordimethylsilan in Toluol
Haftsilan:
40µl
SilanA-174
(=τ-Methacryloxypropyltrimethoxysilan, BDH „Electran“)
200µl
10%ige Essigsäure
ad 10ml Ethanol
Die Lösung muß frisch angesetzt werden.
Gellösung (6%):
18,7g
12, 5ml
2,5ml
ad 50ml
Harnstoff
25% Sequenziergel-Fertiglösung
w/w; AGS)
20fach TTE
ddH2O
Auftrags- und Stoppuffer: 95% (v/v)
20mM
0,05%(w/v)
0,05% (w/v)
2.3
(19:1;
deionisiertes Formamid
EDTA, pH7,5
Xylen Cyanol FF
Bromphenolblau
Proteinchemisches Arbeiten
2.3.1 Elektrophorese unter denaturierenden Bedingungen nach
Laemmli
Diese
denaturierende
Polyacrylamidgel-Elektrophorese
mit
Zusatz
von
Sodiumdodecylsulfat (SDS) und ß-Mercaptoethanol in einem diskontinuierlichen
Puffersystem [Laemmli, 1970] dient der Überprüfung der Reinheit einer Präparation
oder der Identifizierung eines Proteins innerhalb eines Gemisches.
Material und Methoden
39
Die meisten Proteine binden die Seife (SDS) zu negativ geladenen SDS-Komplexen
mit konstantem Ladungs- zu Masse-Verhältnis. Durch SDS erfolgt eine Denaturierung
der
Proteine,
insbesondere
wenn
eine
vorherige
Reduktion
mit
Mercaptoethanol oder DDT stattgefunden hat. Der gebildete SDS-Protein-Komplex
wandert bei der Elektrophorese im elektrischen Feld zum Plus-Pol. Durch den
Molekularsiebeffekt einer porösen Polyacrylamidmatrix kommt es dabei zur
Auftrennung der SDS-Protein-Komplexe nach ihrem Molekulargewicht.
Bei der Analyse des Genproduktes EcoRI aus einem Proteingemisch des Zellaufschlusses verwendet man 17,5%ige Gele zur Trennung. Dieses wird mit einem
6%igen Sammelgel überschichtet, welches die Auflösung der Proteinbanden erhöht.
Nach Gießen des Trenngels zwischen zwei vorbereitete Glasplatten, wird es
sofort mit Ethanol überschichtet, um einen waagerechten Abschluß zu erhalten. Ist die Polymerisation erfolgt, wird der Alkohol vorsichtig abgegossen
und das Sammelgel über das Trenngel geschichtet.
Die Elektrophorese erfolgt bei konstant 30mA, bis das Bromphenolblau die
untere Glasplattenkante verlassen hat.
Die zu untersuchenden Proben werden zur Konzentrierung mit dem gleichen
Volumen 20%iger TCA (w/v) versetzt. Nach einer 15minütigen Fällungsphase erfolgt eine 15minütige Zentrifugation (13000rpm, 4°C). Der Überstand wird verworfen und das Präzipitat in 20µl Laemmli-Auftragspuffer aufgenommen. Um die Proben zu neutralisieren, wird ihnen 1-2µl 2M Tris-Lösung hinzugefügt.
Proben mit geringem Volumen werden direkt mit Auftragspuffer versetzt.
Vor dem Auftrag erhitzt man die Proben für 2min auf 95°C und kühlt sie kurz
auf Eis ab.
Stammlösung 17,5%:
58ml
28ml
10ml
4ml
30% AA (w/v), 0,8% BisAA (w/v)
1,5M Tris/HCl, pH8,8
1% (w/v) SDS
ddH2O
40
Material und Methoden
Stammlösung 6%:
20ml
12,5ml
10ml
47,5ml
30% AA (w/v), 0,8% BisAA (w/v)
1M Tris/HCl, pH6,8
1% (w/v) SDS
ddH2O
Laemmli-Auftragspuffer: 50mM
(2fach)
100mM
2%
0,1%
10% (v/v)
Laemmli-Laufpuffer:
(10fach)
0,25M
1%
1,9M
Tris/HCl, pH6,8
DTT
SDS
Bromphenolblau
Glycerin
Tris (pH8,3, nicht eingestellt)
SDS
Glycin
Laemmli-Färbelösung: 0,2% (w/v) Coomassie Blue R 250
0,05% (w/v)Coomassie Blue G 250
42,5% (v/v) Ethanol
5% (v/v)
Methanol
10 % (v/v) 100%ige Essigsäure
2.3.2 Expressionstest
Ein Expressionstest wird durchgeführt, um die Funktionalität des mutierten Genproduktes zu überprüfen bevor dieses der Proteinfermentation im großen Maßstab zugeführt wird.
Zellen des Stammes TGE900(pEcoR4) werden mit den im Verlauf der Arbeit
erhaltenen mutierten pRIF309+-Plasmiden transformiert. Mit einem der gewonnenen Klone wird eine 5ml Kultur angeimpft. Als Selektionsmarker gibt
man dem Nährmedium sowohl Ampicillin (pRIF309+) als auch Chloramphenicol (auf pEcoR4) dazu. Nach Erreichen der exponentiellen Wachstumsphase wird eine Probe von 500µl entnommen. Dann wird zur Wachstumssteigerung 200µl 20%ige Glukose beigefügt und die Temperatur zur Induk-
Material und Methoden
41
tion auf 42°C erhöht. Nach etwa 2 Stunden Wachstumszeit wird erneut ein
Probenvolumen von 500µl abgenommen.
Die Proben vor und nach der Induktion werden zusammen sedimentiert
(13000rpm, 5min), das Zellpellet in 50µl LAP aufgenommen und anschließend auf einem Laemmligel analysiert (siehe 2.3.1).
2.3.3 Fermentation
Die Fermentation dient der Gewinnung größerer Proteinmengen. Sie wird im 10lMaßstab
durchgeführt,
die
Expression
der
EcoRI-Mutanten
erfolgt
in
TGE900(pEcoR4)-Zellen (siehe 2.1.3).
Zunächst wird die Fermentationsapparatur zusammengebaut, mit 8l entionisiertem Wasser befüllt und für mindestens 14 Stunden bei 120°C sterilisiert.
Nach Zugabe von 1l sterilisiertem 10xLB-Medium, 1g Ampicillin, 0,3g Chloramphenicol sowie 3ml Entschäumer wird das Medium durch Hinzufügen von
1l Vorkultur angeimpft. Nun folgt die Anzucht der Zellen, unter ständiger
Kontrolle des pH-Wertes (pH7,5) bei 30°C bis zu OD600nm von etwa 1,5-2
(etwa 2-3 Stunden).
Ist die gewünschte Zelldichte erreicht, werden 500ml sterile Glukoselösung
(200g/l) sowie 500ml sterile Caseinlösung (200g/l) dazugegeben und die
Temperatur auf 42°C erhöht. Nach 2stündiger Expression werden die Zellen
abzentrifugiert (5000rpm, 10min), mit ST-Puffer gewaschen und anschließend in 100ml PDL/0,5M NaCl resuspendiert. Die Zellösung kann nun weiterverwendet oder bei –20°C eingefroren werden.
ST-Puffer:
10mM
100mM
Tris/HCl, pH8,0
NaCl
PDL:
30mM
KPi, pH7,2
0,1mM
DTT
0,01% (v/v) Lubrol
42
Material und Methoden
2.3.4 Ultraschallzellaufschluß
E.coli-Zellen können in unterschiedlichen Verfahren aufgeschlossen werden. Für
größere Mengen eignet sich Ultraschall.
Für den Ultraschallzellaufschluß werden die Zellen in einem Becherglas auf
Eis kühl gestellt und 25min mit Ultraschall behandelt (Duty Cycle: 60%; Output Control: Stufe 6, Branson Sonifier 250, Ultrasonics). Jeweils nach einer
halben Minute Beschallung erfolgt eine halbe Minute Pause, um die Zellösung nicht zu sehr zu erhitzen. Um Zelltrümmer und unversehrte Zellen zu
trennen wird im Anschluß eine 1stündige Ultrazentrifugation durchgeführt
(10000g, 4°C) nach welcher das klare Lysat weiterverwendet werden kann.
2.3.5 Chromatographische Verfahren
2.3.5.1 Affinitätschromatographie mit Hexahistidintag
Affinitätschromatographie nutzt die hohe Affinität bestimmter biologischer Komponenten aus, um eine Aufreinigung eines Zielproteines mit hoher Selektivität zu erreichen. In diesem Fall wurde Metallchelatchromatographie eingesetzt [Hochuli,
1990]. Als Trägermaterial steht Ni2+-NTA-Agarose (Firma Qiagen) zur Verfügung, um
Proteine mit Hexahistidintag zu binden.
Das Material enthält als funktionelle Gruppe Ni2+-Ionen, die mit aufeinanderfolgenden
Histidinen einen Komplex bilden können. Daher werden Proteine, die einen Hexahistidintag (His6) enthalten, selektiv gebunden. Die Elution erfolgt mit Imidazol, das
mit den Histidinen um die Bindungsplätze konkurriert. Alle im Rahmen dieser Arbeit
hergestellten EcoRI-Mutanten wurden unter anderem als C-terminale His6-Fusionsproteine kloniert, und können dadurch über Ni2+-NTA-Agarose aufgereinigt werden.
Um eine Stabilisierung des Proteins zu erreichen wurde in einem zweiten Aufreinigungsverfahren 1mM CaCl2 hinzugefügt.
Für die Aufarbeitung eines 10l-Fermenters werden 1ml Ni2+-NTA-Agarose mit
100ml Äquilibrierungspuffer äquilibriert. Um die Viskosität zu senken, verdünnt man das klare Zellysat mit dem Äquilibrierungspuffer 1:5 und stellt den
Material und Methoden
43
pH-Wert der Lösung mit Ammoniaklösung (100mM) auf pH7,5 ein. Dann erfolgt der Auftrag auf die vorbereitete Säule. Anschließend wird mit 100ml
Äquilibrierungspuffer gewaschen.
Die Elution erfolgt mit einem linearen Imidazolgradienten von 10-200mM Imidazol in PDL-Puffer/0,5M NaCl. Das Eluat fängt man in einzelnen Fraktionen
zu 200 Tropfen (10ml) auf und trägt es zusammen mit Aliquots von Durchlauf, Waschschritt und Säulenmaterial nach TCA-Fällung von je 100µl der
Fraktionen auf ein Laemmli-Gel auf (siehe 2.3.1).
Fraktionen, die das Produkt enthalten, werden vereinigt und der Ionenaustauschchromatographie zugeführt (siehe 2.3.5.3).
2.3.5.2
PDL:
30mM
KPi, pH7,5
0,1mM
DTE
0,01% (v/v) Lubrol
Äquilibrierungspuffer:
PDL, pH7,5
500mM NaCl
10mM
Imidazol
(1mM
CaCl2)
Elutionspuffer:
PDL, pH7,5
500mM NaCl
150mM Imidazol
(1mM
CaCl2)
Affinitätschromatographie mit StrepTag II
Das hier verwendete StrepTag II-System wurde eingesetzt, um eine effektivere Aufreinigung von Fusionsproteinen mit dem StrepTag II-Peptid [Schmidt et al., 1996]
über eine Affinitätsmatrix mit immobilisiertem StrepTactin zu erreichen. Die Dissoziationskonstante des StrepTag II-Peptids von StrepTactin beträgt 1µM [Voss & Skerra,
1997]. Der Affinitätstag kann C- oder N-terminal oder zwischen zwei Domänen kloniert werden.
44
Material und Methoden
Durch die Kompetition mit Desthiobiotin (DTB) wird eine schonende Elution des gereinigten rekombinanten Proteins von der Affinitätsmatrix gewährleistet. Zusätzlich
wurde bei dieser Arbeit 1mM CaCl2 eingesetzt, um das Protein zu stabilisieren.
Zunächst erfolgte die Äquilibrierung der Säule mit 0,5ml StrepTactin, 1ml
Sephadex G-25 Medium mit Äquilibrierungspuffer. Das Zellysat wurde1:5
verdünnt, um die Viskosität herabzusetzen. Anschließend wurde die vorbereitete Säule damit befüllt. Es folgte ein Waschschritt mit fünf Säulenvolumina Äquilibrierungspuffer, anschließend mit desthiobiotinhaltigem Waschpuffer. Die Elution erfolgte mit einem Säulenvolumen des Elutionspuffers.
Waschfraktionen, Säulenmaterial und Eluat wurden auf einem Laemmligel
auf ihren Proteingehalt überprüft (siehe 2.3.1). Das Eluat wurde der Dialyse
zugeführt.
Äquilibrierungspuffer:
500mM
1mM
PDL, pH7,5
NaCl
CaCl2
500mM
1mM
0,1mM
PDL, pH7,5
NaCl
CaCl2
Desthiobiotin
500mM
1mM
5mM
PDL, pH7,5
NaCl
CaCl2
Desthiobiotin
Waschpuffer:
Elutionspuffer:
2.3.5.3
Ionenaustauschchromatographie
Im Anschluß an die Affinitätschromatographie mit Hexahistidintag (siehe 2.3.5.1) erfolgt die weitere Aufreinigung und Konzentrierung der vereinigten Proteinfraktionen
aus der Affinitätschromatographie mittels der hier beschriebenen Ionenaustauschchromatographie (P-Cell, Whatman). Bei EcoRI handelt es sich um ein DNAbindendes Protein, das heißt, es geht wesentlich stärkere Bindungen zu den Phos-
Material und Methoden
45
phatgruppen des Austauschermaterials ein als andere Proteine. DNA wird durch ihre
negative Ladung nicht gebunden, so daß eine quantitative Abtrennung möglich wird.
Ein Säulenvolumen von 5ml Phosphozellulose wird mit 100ml Äquilibrierungspuffer äquilibriert. Um die NaCl-Konzentration der vereinigten Fraktionen der Affinitätschromatographie zu senken, verdünnt man sie 1:5 mit
PEDL-Puffer. Nach Auftrag auf die Säule wird diese mit 50ml Äquilibrierungspuffer (PEDL/0,1M NaCl) gewaschen. Die Elution erfolgt im Batchverfahren mit je 5ml PEDL/0,5M, 0,75M, 1M, 1,5M beziehungsweise 2M NaCl,
die Eluate werden aufgefangen und rezyklisiert.
Die Fraktionen werden auf einem Laemmli-Gel auf ihren Proteingehalt untersucht (siehe 2.3.1). Positive Fraktionen werden vereinigt und der Dialyse zugeführt (siehe 2.3.6).
PEDL:
30mM
0,1mM
0,01%
0,5mM
KPi, pH7,2
DTT
Lubrol
EDTA
0,1M
PEDL
NaCl
Äquilibrierungspuffer:
2.3.6 Dialyse
Die Dialyse der aufgereinigten Proteine dient der Stabilisierung von Enzymlösungen
sowie ihrer Konzentrierung.
Das Eluat wird über Nacht gegen den Dialysepuffer dialysiert (Dialyseschläuche: VISKING, molekulare Ausschlußgrenze 12000-14000 Da) und
kann anschließend bei –20°C gelagert werden.
Dialysepuffer:
PDL, pH7,5
300mM NaCl
70% (v/v) Glycerin (87%ig)
46
2.4
Material und Methoden
Biochemische Charakterisierung der EcoRI-Mutanten
2.4.1 UV-Spektroskopie
UV-Spektren werden verwendet, um die Konzentration von Proteinlösungen zu ermitteln und Proteinpräparationen auf DNA-Verunreinigen zu untersuchen.
Um eine Konzentrationsbestimmung von Proteinlösungen zu ermöglichen,
wird ein Spektrum im Bereich 220-320nm aufgenommen (Spektralphotometer Hitachi U 3210). Es wird bei Raumtemperatur in einer Quarzküvette
gemessen (Schichtdicke 1cm). Die Konzentrationsbestimmung erfolgt nach
dem Lambert-Beerschen Gesetz mit einem Extinktionskoeffizienten von
ε278=52985 M-1 cm-1 für das EcoRI Wildtypenzym [Modrich & Zabel, 1976].
2.4.2 λ-DNA-Kinetiken
Die Spaltung des makromolekularen Substrates λ-DNA (48502Bp) hat sich als Standardtest für die Bestimmung der spezifischen Aktivität der EcoRI-Mutanten etabliert.
Dabei ist 1U/mg Protein Ausdruck der spezifischen Aktivität und beschreibt die
Menge Protein (EcoRI), die 1µg λ-DNA unter Standardpufferbedingungen innerhalb
1h in einem Reaktionsvolumen von 60µl bei 37°C zu spalten vermag.
Die Restriktionsendonuklease spaltet λ-DNA unter Standardbedingungen spezifisch
an fünf Stellen, dadurch entsteht ein charakteristisches Bandenmuster. Das kanonische Spaltmuster enthält Fragmente der Länge: 21226Bp, 7421Bp, 5804Bp,
5643Bp, 4878Bp und 3530Bp. Die spezifische Aktivität wird anhand des Zeitwertes
berechnet, zu dem das vollständige Spaltmuster entstanden ist. Die Trennung der
Fragmente erfolgt durch ein 0,8%iges Agarosegel.
Zur Charakterisierung der Mutanten wird die Spaltung unter verschiedenen Pufferbedingungen ausgeführt. So genannte Starspaltstellen werden gespalten, wenn man
Mangan statt Magnesium oder pH8,8 in Verbindung mit niedriger Ionenstärke oder
Zugabe organischer Lösungsmittel, wie zum Beispiel Glycerin einsetzt. Dieses Spaltstellen weichen in einem Basenpaar von der spezifischen Erkennungssequenz ab.
Material und Methoden
47
In einem 15µl-Ansatz werden zu 1µl λ-DNA (250ng/µl) 1,5µl des entsprechenden Spaltpuffers (10fach) zugesetzt, mit der gewünschten Enzymverdünnung gestartet und bei 37°C inkubiert. Nach definiertem Zeitwert wird die
Reaktion durch Zugabe von 5µl AAP gestoppt.
Nach Erhitzen auf 65°C für 5min werden die Proben auf Eis abgeschreckt
und auf einem Agarosegel (siehe 2.2.4.1) elektrophoretisch getrennt.
EcoRI-Standardspaltpuffer: 20mM
10mM
50mM
Tris/HCl, pH7,5
MgCl2
NaCl
Mn-Starspaltpuffer:
20mM
Tris/HCl, pH7,5
1mM
50mM
MnCl2
NaCl
pH8,8-Staraspaltpuffer:
20mM
1mM
5mM
Tris/HCl, pH8,8
MgCl2
NaCl
pH8,8-Normalsalzpuffer:
20mM
10mM
50mM
Tris/HCl, pH8,8
MgCl2
NaCl
2.4.3 Gelretardationsexperimente (Mobility-Shift-Assays)
2.4.3.1 Bindung an ein 174Bp-Fragment
Grundlage dieser Methode ist die Tatsache, daß proteingebundene DNA im nativen
Polyacrylamidgel ein verändertes Laufverhalten im Vergleich zur freien DNA zeigt.
Dieser Unterschied läßt sich schon bei einer 20cm langen Laufstrecke in einem
6%igen Polyacrylamidgel feststellen. Ein 174Bp langes PCR-Produkt dient als Shiftsubstrat, das in der Mitte die EcoRI-Erkennungssequenz trägt und durch Zugabe von
32
P [αdATP] radioaktiv markiert ist. Als Template für die PCR dient pBR322. Tabelle
2.4 zeigt die Sequenzen des Primerpaares.
48
Material und Methoden
Tab. 2.4: Sequenz der PCR-Primer zur Erzeugung des 174er Shift–Substrates
Primer
Sequenz
Shift hin
GTGCCACCTGACGTCTAAGA
Shift her
ATACACGGTGCCTGACTGCG
Die PCR wird nach dem folgenden Ansatz zusammengestellt und einer PCR
unterzogen (Bedingungen, siehe Tabelle 2.5).
PCR-Ansatz:
10µl
10µl
2µl
2µl
1µl
10x Polymerase-Puffer
2mM dNTP-Lösung
Primer Shift hin (50µM)
Primer Shift her (50µM)
pBR322 (linearisiert;100ng)
32
1µl
P[αdATP] (10µCi, Amersham)
Taq-Polymerase (Firma Qiagen)
1µl
ad 100µl dd H2O
Tab. 2.5: Standardprogramm für die Erzeugung des 174Bp-Fragments
Wiederholungen
Denaturierung
Annealing
Extension
1x
91°C
91°C
63°C
72°C
60s
90s
60s
91°C
63°C
72°C
60s
90s
400s
300s
30x
1x
Das PCR Produkt wird mit dem Aufreinigungssystem der Firma Qiagen aufgereinigt.
Um die Bindungskonstanten zu bestimmen wird eine feste Shiftsubstratkonzentration von 1nM mit verschiedenen Enzymkonzentrationen im Bereich
Material und Methoden
49
0,1nM bis 20nM im Standardshiftpuffer für 30min bei Raumtemperatur inkubiert. Nach einem 30minütigen Vorlauf bei 20mA des nativen Polyacrylamidgels werden die Ansätze direkt aufgetragen.
Die Elektrophorese erfolgt bei 150V, etwa drei Stunden lang bei Raumtemperatur bis der Azorubinpuffer das Ende des Gels erreicht. Anschließend wird
das Gel im Vakuum getrocknet und über Nacht auf eine Phosphoimagerplatte aufgelegt. Diese kann dann in einem Gerät der Firma Fuji (BAS 1000
bioimager) ausgewertet und mit dem Programm MacBAS2,0 quantifiziert
werden.
Man erhält eine Bindungskurve, welche zur Bestimmung der Gleichgewichtskonstanten herangezogen wird. Dazu ist die folgende Formel nötig:
K
ass
=
F
( E − F ×O ) ( 1 − F )
0
0
F= Anteil der gebundenen DNA
E0=Gesamtkonzentration Enzym
O0=Gesamtkonzentration Oligonukleotid
Standardshiftpuffer:
20mM
50mM
10mM
Tris/HCl, pH7,5
NaCl
EDTA
TTE:
(20fach)
1,8M
0,6M
12mM
Tris
Taurin
EDTA
6%ige Gellösung:
8ml
30% AA (w/v), 0,8% BisAA (w/v)
1ml
20xTTE
ad 40ml ddH2O
2.4.3.2 Mobility-Shift-Assay mit modifizierten Oligonukleotiden
Eine Analyse des Bindungsverhaltens der Mutanten ist auch mit Oligonukleotiden
möglich. Sie bieten gleichzeitig die Möglichkeit, modifizierte DNA-Sequenzen anzubieten. Zur Detektion der Oligonukleotide müssen diese radioaktiv markiert werden.
50
Material und Methoden
Markierung von Oligonukleotiden kann am 3´-Ende erfolgen (Terminale Transferase;
αddATP) oder am 5´-Ende (Polynukleotidkinase; γdATP).
Markierungsansatz der 5‘-Phosphorylierung:
1µl
Oligonukleotid [etwa 1mM]
1µl
10fach PNK-Puffer A
1µl
1µl
6µl
32
P[γdATP] (10µCi/µl, Amersham)
PNK (10U/µl, Fermentas)
ddH2O
Der Reaktionsansatz wird etwa 5h bei 37°C inkubiert. Dann erfolgt eine Aufreinigung der Oligonukleotide mit dem Nukleotide Removal Kit der Firma
Qiagen.
Bei konstanter Oligonukleotidkonzentration werden dem Bindungsansatz
verschiedene Enzymkonzentrationen hinzugefügt und in Shiftbindungspuffer
bei Raumtemperatur 30min inkubiert. Nach dem Vorlauf des Gels (etwa 2h
bei 20mA) werden die Proben direkt aufgetragen. Die Elektrophorese (6%
Polyacrylamidgel) läuft bei 200V in 0,5xTTE-Puffer für 1-1,5h.
Gelbehandlung und Detektion der Banden wird wie bei den Mobility-ShiftAssays mit dem 174Bp-Fragment durchgeführt (siehe 2.4.3.1).
Eine Aufstellung über die Oligonukleotidsequenzen findet sich in Tabelle 3.7.
2.4.3.3 Mobility-Shift-Assay unter Ca2+-Zusatz
Um Mutanten, die unter Standardbedingungen keine Assoziation an spezifische
Substrate zeigten die Möglichkeit einer Bindung zu geben, wurden in Anlehnung an
EcoRV-Bindungsexperimente Ca2+-Bindungsansätze verwendet [Vipond et al., 1995;
Windolph, 1996]. Dazu wurden dem Bindungspuffer (Ca-Shiftpuffer), dem Gelsystem
sowie dem Laufpuffer 1mM CaCl2 hinzugefügt und das EDTA weggelassen. Die Einstellung des pH-Wertes erfolgte auf pH7,5. Der Vorlauf des Gels wurde bei 200V für
etwa 2h durchgeführt. Nach Beenden des Vorlaufs wurde der Puffer ausgewechselt.
Material und Methoden
51
Diese Experimente wurden sowohl mit dem 174Bp-Substrat als auch mit den modifizierten Oligonukleotiden durchgeführt (vergleiche 2.4.4).
Ca-Shiftpuffer:
20mM
50mM
1mM
Tris/HCl, pH7,5
NaCl
CaCl2
2.4.4 Spaltung von Oligonukleotiden
Zur Bestimmung der katalytischen Aktivität wurden Kinetiken mit unterschiedlichen
Oligonukleotiden durchgeführt. Eingesetzt wurde die kanonische EcoRI-DNA-Sequenz, modifizierte Oligonukleotide dieser Sequenz, sowie die kanonische Erkennungssequenz von BamHI (vergleiche Tabelle 2.6). Dabei wurden verschiedene
Zeitwerte und Pufferbedingungen verwendet analog zu den Spaltkinetiken auf λ-DNA
(siehe 2.4.2).
Zunächst fand eine radioaktive Markierung der Oligonukleotide durch 5‘-Phosphorylierung mit 32P [γdATP] mit T4-Polynukleotidkinase statt (siehe 2.4.3.2). Anschließend
erfolgte die Aufreinigung nach dem Nukleotide Removal Protokoll der Firma Qiagen.
In einem 50µl Ansatz wurden alle Mutanten mit StrepTag II mit jeweils dem
entsprechenden Oligonukleotid (siehe Tabelle) und Puffer versetzt. Nach
verschiedenen Zeitwerten erfolgte die Abnahme von jeweils 10µl des Inkubationsansatzes und stoppen der Reaktion durch Zugabe von Stoppuffer. Die
Inkubation wurde bei Raumtemperatur durchgeführt.
Nach einem 30minütigen Vorlauf wurden 5µl der Proben auf das Gel aufgetragen werden. Die Trennung von Substrat und Produkt erfolgte durch
Gelelektrophorese in einem denaturierenden 18%igen Polyacrylamidgel (6M
Harnstoff). Die Auswertung der Kinetik fand mit dem Phosphoimager der
Firma Fuji (BAS 1000 bioimager) statt.
52
Material und Methoden
2.4.5 Gelfiltration (HPLC)
Die High performance liquid chromatography (HPLC) liefert Messungen, deren Signale vom Molekulargewicht des zu messenden Stoffes abhängig sind. Auf diese
Weise kann bei einem Enzym eine Bestimmung seines Aggregationszustandes erfolgen.
Die hohe Trennleistung bei HPLC beruht auf der Verwendung kleiner Partikel definierter Größe und hoher Rigidität. Die verwendeten HPLC-Säulen zeichnen sich
durch eine hohe Kapazität aus und erlauben hohe Durchflußgeschwindigkeiten,
welche nur bei hohem Druck erreicht werden können und abhängig von Säulenfüllmaterial und vom Laufmittel sind.
Die HPLC-Messungen wurden nach der von Geiger et al. (1989) beschriebenen
Methode durchgeführt. Als Stammpuffer wurde ein 800mM NaCl-Puffer verwendet,
welcher Anteile monomeren Enzyms zurückdrängen soll. Standardsubstanzen waren
BSA (MR=68kDa), Ovalbumin (MR=43kDa) und Lysozym (MR=14,4kDa). Die Messungen wurden mit den Präparationen der Mutanten mit StrepTag ausgeführt.
2.4.6 Circulardichroismus (CD)
Die Circulardichroismus(CD)-Spektroskopie ist eine spezielle Art der Absorptionsspektroskopie im UV/VIS-Bereich des Spektrums, welche sich aus der Wechselwirkung polarisierten Lichts mit optisch aktiven Substanzen ergibt. Ein wichtiges Anwendungsgebiet der CD-Spektroskopie liegt in der Analyse der Sekundärstruktur von
Proteinen. Bekannt sind die Spektren der Haupttypen der Sekundärstrukturen der
Proteine (α, β und Random coil). Diese unterscheiden sich deutlich voneinander. Die
Spektren wurden mit einem Jobin-Yvon Dichrographen R.J.Mark III zwischen 190 bis
250nm aufgenommen. Die Auswertung erfolgte mit einem Programm von J. Greipel
(CIRC 42) [Peters & Greipel, 1993], welches unter Berücksichtigung von Standardspektren den prozentualen Anteil an α-Helix und β-Faltblatt ermittelt [Chen et al.,
1972].
Eine Messung der aufgereinigten Proteine erfolgte in 0,05cm starken Quarzküvetten.
Anschließend wurden die Spektren mit einem Kurvenanpassungsprogramm ausgewertet.
Ergebnisse
53
3
ERGEBNISSE
3.1
Darstellung der Mutanten
3.1.1 PCR-Mutagenese
zur
Generierung
der
Mutanten
G140A/N141AHis6 und G140A/N141SHis6
Die Mutanten G140A/N141AHis6 und G140S/N141SHis6 wurden mit der in Kapitel
2.2.6.2 beschriebenen PCR-Mutagenese hergestellt. Neben der Aminosäuremutation
wurde eine stille Mutation zur späteren Identifikation der positiven Klone eingeführt,
indem die BglII-Spaltstelle entfernt wurde. Bis zur endgültigen Fertigstellung von Megaprimer und zweitem PCR-Produkt mußten, ausgehend von den Standardbedingungen (siehe Tabelle 2.2), verschiedene PCR-Bedingungen ausprobiert werden.
Positive Ergebnisse wurden schließlich unter Verwendung des Expand High FidelitySystems (High Fidelity-Polymerase), einer Annealingtemperatur von 50°C sowie einer Anzahl von 50 Zyklen erzielt. In einem 50µl PCR-Ansatz wurden etwa 100ng
Template (pRIF309+(CH6), linearisiert mit XmnI), 1µl Primer A (50µM), 1µl Mutageneseprimer (50µM) mit 10U High Fidelity-Polymerase versetzt und nach dem folgenden Programm (Tabelle 3.1) einer PCR unterzogen:
Tab. 3.1: Modifiziertes PCR-Programm zur Erzeugung des Megaprimers
Wiederholungen
Denaturierung
Annealing
Extension
1x
91°C
91°C
50°C
72°C
60 sec
90 sec
60 sec
91°C
50°C
72°C
60 sec
90 sec
300 sec
300 sec
50x
1x
Die Abbildung 3.1 zeigt das Resultat der ersten PCR zur Erzeugung des Mega-
54
Ergebnisse
primers auf einem 10%igen Polyacrylamidgel.
(1)
(2)
(3)
(4)
(5)
500Bp
443Bp
PCR-Produkte zur Herstellung des
Megaprimers
(1) 100Bp, Gene Ruler (Fa. Qiagen)
(2) Standard-PCR-Programm,
G140A/N141AHis6
(3) modifiziertes-PCR-Programm,
G140A/N141AHis6
(4) Standard-PCR-Programm,
G140A/N141SHis6
(5) modifiziertes-PCR-Programm,
G140A/N141SHis6
Abb. 3.1: PCR zur Darstellung des Megaprimers
Als Vergleich wurde eine 100Bp Leiter (Firma Quiagen) aufgetragen. Die 500BpBande ist durch eine größere DNA-Menge hervorgehoben (Pfeil in der Abbildung
3.1). Mit einer Länge von 443Bp liegt das PCR-Produkt in der erwarteten Größe vor.
Die Spuren 2 und 4 zeigen das PCR-Produkt mit dem Standard-PCR-Mutageneseprogramm (siehe Tabelle 2.2), das für diese Mutanten modifiziert wurde.
Um den entstandenen Megaprimer vom Template abtrennen zu können, ist eine Aufreinigung mit dem Qiaquick-Gel-Extraction-Kit der Firma Qiagen erforderlich. Das
zweite PCR-Produkt wird mit den Primern A und B erhalten, die das ecoRI-Gen umschließen. Somit ergibt sich eine Produktlänge des zweiten PCR-Produktes von
1165Bp.
Die Herstellung des zweiten PCR-Produktes erfolgte ebenfalls in einem 50µl Ansatz,
in welchem 0,5µl Template (pRIF309+, ohne Hexahistidintag), 1µl Primer A (50µM),
1µl Primer B (50µM) und 5µl Megaprimer mit 1µl High Fidelity-Polymerase (10U/µl)
versetzt wurden.
Zur Durchführung der PCR wurde das modifizierte Standardprogramm verwendet
(Tabelle 3.1). Abbildung 3.2 zeigt die Produkte der PCR auf einem 10%igen Polyacrylamidgel.
Ergebnisse
55
(1)
(2)
(3)
(4)
1200Bp
(5)
1165Bp
PCR-Produkte zur Herstellung des
mutierten ecoRI-Gens
(1) 100Bp, Gene Ruler (Fa. Qiagen)
(2) Standard-PCR-Programm,
G140A/N141AHis6
(3) modifiziertes-PCR-Programm,
G140A/N141AHis6
(4) Standard-PCR-Programm,
G140A/N141SHis6
(5) modifiziertes-PCR-Programm,
G140A/N141SHis6
Abb. 3.2: PCR-Produkte nach der zweiten PCR in der Mutagenese
Bei der zweiten PCR-Reaktion wurde mit dem modifizierten PCR-Programm ebenfalls mehr Produkt gebildet.
Trotz der Nebenprodukte wurde das PCR-Produkt für die weitere Mutagenese eingesetzt, da nur DNA-Stücke, welche die passenden Schnittstellen enthalten, in den
Rahmen ligiert werden können.
Der Rahmen wurde aus pRIF309+(CH6) mit den Enzymen SpeI und HindIII hergestellt. Nach Spaltung des PCR-Produktes mit entsprechenden Enzymen wurden jeweils 150ng PCR-Produkt und 90ng Rahmen ligiert (siehe 2.2.3).
Die Transformation des Ligationsansatzes erfolgte in den Stamm LK111(λ) (siehe
2.1.4). Nach Vereinzelung auf Selektivmedien wurden die screening-positiven Klone
(keine Spaltung mit BglII) zur Bestätigung des Mutageneseerfolges sequenziert
(siehe 2.2.7). Um Sekundärmutationen ausschließen zu können, wurde nicht nur die
mutierte Region, sondern das gesamte Gen sequenziert und verifiziert.
Die Plasmide, welche die erwünschte Veränderung des ecoRI-Gens trugen, wurden
in den Expressionstamm TGE900(pEcoR4) überführt (siehe 2.1.4).
3.1.2 Gapped duplex-Mutagenese zur Generierung der Mutanten
G140S/R145KHis6 und G140S/N141S/R145KHis6
Die Herstellung der Mutanten G140S/R145KHis6 und G140S/N141S/R145KHis6 erfolgte mittels der unter 2.2.6.1 beschriebenen Gapped duplex-Mutagenese nachdem
56
Ergebnisse
der gewünschte Mutageneseerfolg mit Hilfe der PCR-Mutagenese nicht erzielt werden konnte. Zur Einführung der Mutation wurde jeweils ein 42Bp langer Primer synthetisiert, welcher einerseits die Mutationen an den gewünschten Codons und andererseits eine stille Mutation zur Zerstörung der Spaltstelle von BglII trägt, um eine
Selektion positiv mutierter Klone zu erreichen.
Als Matrize dient das einzelsträngige Plasmid pRIF309+(CH6). Darauf wurden das
Oligonukleotid und der Rahmen hybridisiert. Mit den entstandenen mismatch-Plasmiden wurden Zellen des reparaturdefizienten Stammes WK6mutS(λ) transformiert.
Der Transformationsansatz wurde zur Hälfte auf einer LBAmp-Platte ausplattiert, um
die Klonausbeute abzuschätzen. Die andere Hälfte wurde in eine 100ml-LBAmp-Flüssigkultur überführt. Aus den Zellen der Flüssigkulturen erfolgte die Isolierung der
Plasmid-DNA (siehe 2.2.1) mit anschließender Restriktionsspaltung mit dem Screeningenzym BglII (siehe 2.2.2).
Mit der daraus hervorgehenden ungespaltenen Plasmid-DNA wurde der Stamm
LK111(λ) transformiert. Nach Vereinzelung der Klone und Isolierung der PlasmidDNA wurden die Klone erneut auf die Spaltung durch BglII getestet. Abbildung 3.3
zeigt exemplarisch die Spaltungen für die Mutante G140S/R145KHis6 auf einem
1%ige Agarosegel. Positive Klone erscheinen ungespalten, da die BglII-Spaltstelle
mutiert wurde.
(1) (2)
(4)
(6)
(8)
(10)
Restriktionsspaltung mit BglII für unterschiedliche Klone der Mutante G140S/R145KHis6
(1)
Standard: pRIF309+, nativ
(2, 3)
Klon 1, nativ; Spaltung BglII
(4, 5)
Klon 2, nativ; Spaltung BglII
(6, 7)
Klon 3, nativ; Spaltung BglII
(8, 9)
Klon 4, nativ; Spaltung BglII
(10, 11) Klon 5, nativ; Spaltung BglII
Abb. 3.3: Screening mit BglII von Klonen aus LK111(λ) der Mutante G140S/R145KHis6
Von jeder Mutante wurde eine 100ml LBAmp-Kultur angeimpft, um dann die PlasmidDNA zu isolieren. Es folgte die Sequenzierung mit der Kettenabbruchmethode nach
Sanger (siehe 2.2.7), wodurch die Mutationen und die Basensequenz des Gens veri-
Ergebnisse
57
fiziert werden konnte. Mit den modifizierten Plasmiden wurde der Expressionsstamm
TGE900(pEcoR4) transformiert (siehe 2.1.4).
3.1.3 Klonierung des StrepTag II
Da sich die Aufreinigung der Mutanten mit dem Hexahistidintag als unerwartet
schwierig herausstellte, wurde er durch einen C-terminalen StrepTag II ersetzt. Dieser wurde in dem Plasmid pRSN [Vennekohl, 1999] im direkten Anschluß an das
ecoRI-Gen kloniert. Dieser Tag beinhaltet acht Aminosäuren und ist daher um 6Bp
länger als der Hexahistidintag.
Durch Spaltung mit den Enzymen SpeI und HindIII wurde jeweils ein 620Bp großes
Fragment (Insert) aus den Plasmiden herausgeschnitten, welches die entsprechende
Mutation trägt. In einer analogen Spaltung wurde aus dem Plasmid pRSN ein Rahmen erzeugt und aufgereinigt.
Zur Ligation (siehe 2.2.3) wurden äquimolare Verhältnisse eingesetzt und damit anschließend LK111(λ) transformiert (siehe 2.1.4).
Die erhaltenen Klone wurden auf ihre Größe untersucht. Alle Plasmide richtiger
Größe (5074Bp) enthielten das Insert und erschienen daher bei der Spaltung durch
BglII ungespalten. Auf eine weitere Sequenzierung wurde verzichtet.
Mit jeweils einem positiven Klon wurden Zellen des Expressionsstammes
TGE900(pEcoR4) transformiert (siehe 2.1.4).
3.2
Aufreinigung der Mutanten
3.2.1 Aufreinigung der Mutanten mit Hexahistidintag
Um die Proteinexpression zu überprüfen, wurde mit allen vier Mutanten ein Expressionstest (siehe 2.3.2) durchgeführt, welcher jedoch zu keinem eindeutigen Ergebnis
führte. Alle dargestellten Mutanten enthalten den Hexahistidintag am C-Terminus. So
ist eine Bindung an Nickelionen möglich, was bei der Ni2+-NTA-Affinitätschromatographie ausgenutzt wird [Rotzal, 1992].
58
Ergebnisse
In einem Induktionstest in 3ml Kulturen aus transformierten TGE900(pEcoR4)-Zellen
(siehe 2.3.2) konnte keine eindeutige Expression der Mutanten festgestellt werden.
Aus diesem Grund wurden induzierte Zellen (3ml) sedimentiert und mit Ultraschall
aufgeschlossen. Nach erneutem Sedimentieren der Zelltrümmer wurde der Überstand mit equilibrierter Ni2+-NTA-Agarose versetzt, um durch eine Bindung an das
Affinitätsmaterial das Zielprotein nachzuweisen (siehe 2.3.5.1).
Das Säulenmaterial wurde auf einem 17,5%igen Laemmli-Gel analysiert. Abbildung
3.4 zeigt exemplarisch die Ergebnisse mit den Mutanten G140S/R145KHis6 und
G140S/N141S/R145KHis6.
(1)
(2)
(3)
(4)
(5)
(6)
(7)
Bindung der Proteine G140S/R145KHis6 und
G140S/N141S/R145KHis6 aus einem Expressionstest (3ml) an Ni-NTA-Agarose
(1) G140S/R145KHis6, Klon 1
(2) G140S/R145KHis6, Klon 2
(3) G140S/R145KHis6, Klon 3
(4) G140S/N141S/R145KHis6, Klon 1
(5) G140S/N141S/R145KHis6, Klon 2
(6) Standard: wtEcoRIHis6, BSA
(7) G140S/N141S/R145KHis6, Klon 3
EcoRI
Abb. 3.4: Expressionstest mit den Mutanten G140S/R145KHis6 und G140S/N141S/R145KHis6
Obwohl durch den Expressionstest keine eindeutige Aussage über die Produktion
der Mutanten erzielt werden konnte, ist nach der Abreicherung anderer E.coli-Proteine durch die Bindung der Mutanten an das Affinitätsmaterial eine eindeutige
Bande im Bereich des Standards (wtEcoRI, Spur 6) zu erkennen. Dabei zeigten alle
Klone eine vergleichbare Expression.
Für die Fermentation (siehe 2.3.3) wurden der erste Klon der Mutante
G140S/R145KHis6 sowie der dritte Klon der Mutante G140S/N141S/R145KHis6 ausgewählt. Bei den Mutanten G140A/N141AHis6 und G140A/N141SHis6 wurde für die
Reindarstellung jeweils der dritte Klon herangezogen.
Die Aufreinigung der Mutanten erfolgte mit Hilfe der Ni2+-NTA-Affinitätschromatographie. Sie wurde nach dem Protokoll ausgeführt, das seit Jahren im Labor etabliert
Ergebnisse
59
ist (siehe 2.3.5.1). Allerdings konnte keine angemessene Aufreinigung erzielt werden.
Abbildung 3.5 zeigt exemplarisch den Verlauf einer Affinitätschromatographie mit der
Mutante G140A/N141AHis6.
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
Elutionsprofil (Ni-NTA-Agarose)
der Mutante G140A/N141AHis6
(1) Standard: wtEcoRI
(2-9) Fraktionen 2, 4, 6, 8, 10,
12, 14 und 16
(jeweils 100µl)
(10) Durchlauf
Abb. 3.5: Verlauf
G140A/N141AHis6
der
Affinitätschromatographie
mit
2+
Ni -NTA-Agarose
für
die
Mutante
Es findet eine Bindung des Zielproteines an das Affinitätsmaterial statt, da im Durchlauf keine prominenten Bande mehr im Bereich der EcoRI zu sehen ist. Allerdings
zeigt das Elutionsprofil, daß eine Vielzahl von Proteinen zusammen mit der Mutante
eluiert werden. Die Fraktionen mit der geringsten Verunreinigung wurden vereinigt
und der Ionenaustauschchromatographie zugeführt (siehe 2.3.5.3).
Die Ionenaustauschchromatographie nutzt aus, daß EcoRI als DNA-bindendes Protein an die negativ geladene Phosphozellulose bindet. Dadurch werden normalerweise weitere Verunreinigungen abgetrennt.
Die Proteine, die nach der Affinitätschromatographie als Verunreinigungen auftraten,
konnten aber auch mit der Ionenaustauschchromatographie nicht abgetrennt werden.
Die Elution der Mutanten erfolgte in Vergesellschaftung anderer Proteine, so daß
keine weitere Aufreinigung des Zielproteines erfolgte.
Um die Aufreinigung zu verbessern, wurde eine Umkehrung der Reihenfolge der
Säulen vorgenommen, sowie eine Gradientenelution für die Ionenaustauschsäule
versucht. Leider konnte keine verbesserte Aufreinigung erzielt werden.
Konnten nach einer Ionenaustauschchromatographie Fraktionen gewonnen werden,
in denen EcoRI den größten Anteil ausmachte, wurden diese vereinigt und in die
60
Ergebnisse
Dialyse eingesetzt (siehe Tabelle 3.2, Kapitelende).
Die Elution von Proteinen in so enger Vergesellschaftung mit dem Zielprotein legt die
Vermutung nahe, daß es sich dabei um Chaperone handelt, die an strukturell beeinträchtigte Mutanten gebunden haben. Daher wurde eine Affinitätschromatographie in
Anwesenheit von 100µM rATP versucht. Durch Zusatz des rATPs sollten die Chaperone befähigt werden, ihren Faltungszyklus zu beenden und das Protein zu entlassen. Leider konnte durch den Zusatz des rATP keine Verbesserung der Aufreinigung
erzielt werden.
In einem vergleichenden Laemmligel konnte zusätzlich gezeigt werden, daß es sich
bei den Verunreinigungen in den Mutanten zumindest nicht um die gängigen Chaperone handelt (siehe Abbildung 3.6).
(1)
78kDa
66kDa
42kDa
30kDa
(2)
(3)
(4)
(5)
Vergleich der Molekulargewichte der
gängigen Chaperone mit wtEcoRI
(1) Merck IV Protein-Standard
(2) wtEcoRI
(3) GroES
(4) GroEL
(5) DnaK
17kDa
12,3kDa
Abb. 3.6 : Vergleich der Molekulargewichte gängiger Chaperone mit EcoRI
Der Vergleich zeigt deutlich, daß die Verunreinigungen, die nahe der EcoRI laufen
(vergleiche Abbildung 3.5) nicht zu den hier getesteten Chaperonen gehören. Es ist
jedoch möglich, daß es sich um andere Helferproteine handelt.
Die Ergebnisse der Aufreinigungen sprechen für eine Destabilisierung der Mutanten
durch die eingeführten Aminosäuren. Auch die insgesamt geringe Menge an EcoRI,
die aus den Zellen (jeweils 10l Zellen, OD600nm=3-4) gewonnen werden konnte
spricht für eine strukturelle Instabilität. Bei anderen Mutanten (zum Beispiel K130E
Ergebnisse
61
[Windolph et al., 1997] konnte durch Zusatz von Kalzium eine Stabilisierung der Mutanten bei der DNA-Bindung festgestellt werden. Daher wurde die Aufreinigung der
Mutanten G140A/N141AHis6 und G140A/N141SHis6 in Anwesenheit von Kalziumionen
(1mM CaCl2) versucht. Die Affinitätschromatographie wurde in gleicher Weise wie
zuvor ausgeführt. Abbildung 3.7 zeigt exemplarisch das Elutionsprofil einer Ni2+-NTAAgarosesäule in Anwesenheit von Ca2+-Ionen der Mutante G140A/N141AHis6.
(1)
(2) (3) (4)
(5)
(6) (7)
(8) (9)
(10)
(11)
Elutionsprofil (Ni-NTA-Agarose in
Gegenwart von Ca-Ionen) der
Mutante G140A/N141AHis6,Ca
(1) Standard: wtEcoRI
(2-9) Fraktionen 2, 4, 6, 8, 10, 12, 14
und 16 (jeweils 100µl)
(10) Durchlauf der Säule (5µl)
(11) Waschfraktion (100µl)
2+
Abb. 3.7: Elutionsprofil (Ni -NTA-Agarose) der Mutante G140A/N141AHis6,Ca in Anwesenheit von 1mM
CaCl2
Dabei konnte mit dem Zusatz von Ca2+-Ionen eine höhere Ausbeute an Protein erzielt werden, wobei auch hier eine starke Vergesellschaftung mit anderen Proteinen
zu erkennen ist (Spuren 3 bis 5). Eine Reduktion der Verunreinigungen konnte mit
der nachfolgenden Phophocellulosesäule erreicht werden (siehe Abbildung 3.8), die
ebenfalls in Anwesenheit von Ca2+-Ionen ausgeführt wurde.
Gegenüber der Aufreinigung unter Standardbedingungen ist eine deutliche Verbesserung der Proteinreinheit zu verzeichnen. Diese Proteine werden im folgenden mit
dem Index „His6,Ca“ gekennzeichnet. Nach der Dialyse jedoch, die ebenfalls 1mM
CaCl2 im Puffer aufwies, erschien das Dialysat trübe, so daß von einer Aggregation
der Mutanten ausgegangen werden mußte. Daher wurde auf eine Präparation der
Mutanten G140S/R145KHis6,Ca und G140S/N141S/R145KHis6,Ca verzichtet.
62
Ergebnisse
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
Elutionsprofil (Phosphozellulose in
Gegenwart von Ca-Ionen) der Mutante
G140A/N141AHis6,Ca
(1) Standard: wtEcoRI
(2-8) Elutionspuffer mit steigender NaClKonzentration (0,25M; 0,5M; 0,75M;
1M; 1,5M; 2M; jeweils 100µl)
Abb. 3.8: Elutionsprofil (Phosphozellulose) der Mutante G140A/N141AHis6,Ca unter Zusatz von 1mM
CaCl2
Die Konzentrationsbestimmung aller Dialysate erfolgte im UV-Spektrum (siehe 2.4.1),
allerdings ergaben sich hier Probleme, da die gemessene Absorption aus allen Proteinen (EcoRI und Verunreinigungen) resultiert. Daher erfolgte eine Bestimmung
mittels Laemmligel (siehe 2.3.1), auf das eine Konzentrationsreihe des wtEcoRIHis6
(4,4µM) aufgetragen wurde. Tabelle 3.2 gibt die ermittelten Konzentrationen wider.
Tab. 3.2: Konzentrationen der Mutanten mit Hexahistidintag
Mutante
Proteinkonzentration
Reinheit
G140A/N141AHis6
1µM
30%
G140A/N141SHis6
1µM
40%
G145S/R145KHis6
2,8µM
50%
G140S/N141S/R145KHis6
1µM
55%
G140A/N141AHis6,Ca
ausgefallen
65%
G140A/N141SHis6,Ca
ausgefallen
65%
Ergebnisse
63
3.2.2 Aufreinigung der Mutanten mit StrepTag II
Die Anwesenheit von Kalziumionen hat die Aufreinigung der Mutanten mit Hexahistidintag entscheidend verbessert. Es konnte jedoch gezeigt werden, daß EcoRI mit
Hexahistidintag eine erhöhte Aggregationsneigung aufweist [Küster, 1998; Vennekohl, 1999], die unter Verwendung des StrepTag II-Systemes minimiert werden
konnte. Nach der Umklonierung der mutierten ecoRI-Gene in den StrepTag II wurde
eine Aufreinigung mit diesem System unter 1mM Ca2+-Ionen durchgeführt (siehe
2.3.5.2). Diese Proteine erhalten den Index „StrepII“.
Abbildung 3.9 zeigt exemplarisch die Aufreinigung der Mutante G140A/N141AStrepII.
(1)
(2)
(3)
(4)
(5)
Elutionsprofil (StrepTactin in Gegenwart von
Ca-Ionen) der Mutante G140A/N141AStrepII
(1) Durchlauf
(2) Waschfraktion
(3) Waschfraktion (0,1mM DTB)
(4) Elution (5mM DTB)
(5) Standard: wtEcoRI
Abb. 3.9: Aufreinigung der Mutante G140A/N141AStrepII mit dem Affinitätsmaterial StrepTactin
Der Durchlauf erscheint frei vom Zielprotein EcoRI. Im ersten Waschschritt können
schon wesentliche Verunreinigungen entfernt werden, da der Desthiobiotin-haltige
zweite Waschschritt schon kein Protein mehr eluiert. Das Eluat der Mutante zeichnet
sich durch eine gute Reinheit aus, obwohl einige Proteine nicht abgereinigt werden
können. Als Verunreinigung tritt meistens ein Biotincarboxyl-Carrierprotein aus E.coli
auf, das ebenfalls an die StrepTactin-Matrix bindet.
Eine Bestimmung der Konzentration durch UV-Spektroskopie war bei diesen Mutanten ebenfalls nicht möglich, da das Eluat eine starke Absorption bei 260nm aufwies.
Dies weist auf eine Verunreinigung durch nukleotidisches Material hin, nicht unge-
64
Ergebnisse
wöhnlich für ein DNA-bindendes Protein.
Daher wurde in einem erneuten Ansatz eine DE59-Säule vorgeschaltet. Dieses Material bindet negativ geladene Proteine. Unter geeigneten Pufferbedingungen (PDL,
0,1M NaCl) passiert EcoRI das Säulenmaterial, während DNA gebunden bleibt. Allerdings zeigte sich auch hier im Eluat des StrepTactins eine Absorption von 260nm.
Es muß daher davon ausgegangen werden, daß es sich nicht um DNA handelt. Die
Konzentrationsbestimmung der Proteine erfolgte also auch in diesem Fall durch eine
vergleichende Konzentrationsreihe auf dem Laemmligel (siehe 2.3.1).
Abbildung
3.10
zeigt
dieses
Vorgehen
exemplarisch
für
die
Mutanten
G140A/N141AStrepII und G140A/N141SStrepII aus den ersten Präparationen.
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
Vergleichende Konzentrationsreihe
mit wtEcoRIHis6 für die Mutanten
G140A/N141AStrepII und
G140A/N141SStrepII
(1-8) Konzentrationsreihe wt
EcoRIHis6 (0,377µM) mit
absteigenden Volumina
(10µl; 3µl; 2,5µl; 1,5µl; 1µl;
0,5µl; 0,25µl)
(9)
G140A/N141AStrepII
(10) G140A/N141SStrepII
Abb. 3.10: Vergleichende Konzentrationsreihe mit wtEcoRIHis6 für die Mutanten G140A/N141AStrepII
und G140A/N141SStrepII
Die Bandenstärke der Konzentrationsreihe mit wtEcoRIHis6 und der Proben wurde
mithilfe des Geldokumentationssystemes E.A.S.Y der Firma Herolab ausgewertet.
Durch lineare Regression ergab sich eine Geradengleichung, mit der die Konzentration der Mutanten bestimmt werden konnte (vergleiche Tabelle 3.2).
Insgesamt ergibt jedoch auch die Aufreinigung mit dem StrepTag II eine nur geringe
Proteinausbeute. Daher wurden die Aufarbeitungen mehrfach ausgeführt. Sie sind in
Tabelle 3.3 zusammengestellt.
Ergebnisse
65
Tab. 3.3: Konzentrationen der Mutanten mit StrepTag II
Mutante
Proteinkonzentration
Reinheit
G140A/N141AStrepII
1µM (zweifach präpariert)
>90%
G140A/N141SStrepII
1µM (zweifach präpariert)
>90%
G140S/R145KStrepII
0,270µM; 1,5µM
>90%
G140S/N141S/R145KStrepII
0,213µM; 2µM
>90%
3.3
Charakterisierung der Mutanten mit Hexahistidintag
3.3.1 DNA-Bindung der Mutanten mit Hexahistidintag
Die Ermittlung der DNA-Bindung wurde nach dem Standardprotokoll für EcoRIMutanten (siehe 2.4.3) ausgeführt. Als Substrat dient ein 174Bp großes PCRProdukt, das mittig eine EcoRI-Spaltstelle trägt. Durch die Bindung des Proteins
ergibt sich ein langsamerer Lauf des Fragmentes im nativen Polyacylamidgel (Shift).
Bei konstanter DNA-Konzentration (1nM) wurde eine jeweils unterschiedliche Menge
Protein zugegeben. Sie variiert vom 50fachen Überschuß (50nM Protein) bis zum
10fachen Unterschuß (0,1nM Protein).
Abbildung 3.11 zeigt den Gelshift für die Mutanten mit Hexahistidintag.
Unter
diesen
Bedingungen
zeigte
sich
ausschließlich
bei
der
Mutante
G140S/R145KHis6 eine eindeutige Bindung. Hier ist allerdings eine Berechnung der
spezifischen Bindungskonstante nicht sinnvoll, da es sich um eine unspezifische
Bindung handelt (Leiterbildung wie bei wtEcoRI).
66
Ergebnisse
(1)
(4)
(7)
(10)
(13)(14)
3. Shift
2. Shift
1. Shift
ungebunden
Gelshift mit dem 174Bp-Fragment
für die Mutanten mit Hexahistidintag
(1-3)
G140A/N141AHis6
(4-6)
G140A/N141SHis6
(7-9)
G140S/R145KHis6
(10-12) G140S/N141S/R145KHis6
(13)
174Bp-Fragment, nativ
(14, 15) wtEcoRI
Verhältnis Mutante zu DNA jeweils
50:1, 10:1 und 2:1, für wtEcoRI 20:1
und 10:1
Abb. 3.11: Gelshift mit dem 174Bp-Fragment für die Mutanten mit Hexahistidintag
Durch die Detektion des DNA-Fragments mit dem empfindlichen PhosphoImagerSystem können Shifts ab 10% Bindung detektiert werden. Dies entpricht einer Bindungsstärke von 2x106M-1 (bei 50fachem Überschuß), so daß die Bindung der
Mutanten als kleiner eingestuft werden muß. Eine unspezifische Bindung an das
DNA-Fragment ist mit 105M-1 nicht meßbar.
3.3.2 Kinetische Charakterisierung der Mutanten mit Hexahistidintag
Die kinetische Charakterisierung dient der Untersuchung biochemischer Eigenschaften der Mutanten hinsichtlich ihrer Sequenzspezifität sowie ihrer katalytischen
Aktivität im Vergleich zur wtEcoRI unter verschiedenen Bedingungen. Mit den in dieser Arbeit angefertigten Mutanten wurden kinetische Untersuchungen mit unterschiedlichen Substraten unter verschiedenen Pufferbedingungen und Zeitwerten
durchgeführt.
3.3.2.1
Spaltverhalten auf λ-DNA
Das Spaltverhalten aller vier Mutanten wurde bei 37°C in einem Zeitraum von 1min
bis 18h (über Nacht) unter Standardbedingungen getestet. Als Substrat diente λ-DNA
(48502Bp). Die Spaltung erfolgte unter Standardbedingungen sowie den Starbedin-
Ergebnisse
67
gungen pH8,8 (Niedrigsalz) und Mangan.
Zusätzlich erfolgten Spaltungen mit pH8,8 unter Normalsalzbedingungen. Die Vorgehensweise ist unter 2.4.2 beschrieben. Die Kinetiken zeigten durchgehend einen unspezifischen Abbau von DNA.
Die Abbildung 3.12 zeigt
exemplarisch
eine
λ-DNA
Kinetik der Mutante
G140S/R145KHis6 unter Standardbedingungen.
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
Spaltung von λ-DNA durch die Mutante
G140S/R145KHis6
(1) Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140S/R145KHis6
Zeitwerte: 2,5min, 7min,15min, 30min,
45min, 60min, 75min, 90min
Abb. 3.12: λ-Kinetik mit der Mutante G140S/R145KHis6 unter Standardbedingungen
Der unspezifische Abbau der DNA kann durch eine Nuklease erfolgen, die aus den
Zellen mit aufgereinigt wurde. Aber eine sequenzunabhängige Nukleaseaktivität, die
zu unspezifischem DNA-Abbau führt, ist für Mutanten, die monomer vorliegen auch
möglich [Vennekohl, 1996] und kann in diesem Fall nicht ausgeschlossen werden.
Durch die geringen Konzentrationen der Mutanten mußte eine große Menge der
Präparation eingesetzt werden, so daß auch eventuell vorhandene Verunreinigungen
in erhöhter Konzentration eingeschleppt wurden. Der unspezifische Abbau der DNA
stellt ein weiteres Problem dar, eine eventuell auftretende spezifische Restriktionsaktivität der Mutanten zu detektieren. So ist es unter Umständen nicht möglich, Reaktionsbedingungen zu finden, welche die Detektion spezifischer Spaltung erlauben.
Um einen qualitativen Vergleich zwischen den Mutanten möglich zu machen wurde
jeweils der Zeitwert bestimmt, für den eine diskrete Bande für die zu spaltende λDNA nicht mehr erkennbar war (zum Beispiel 15min in Abbildung 3.12). Tabelle 3.4
stellt die ermittelten Werte gegenüber.
68
Ergebnisse
Tab. 3.4: Bestimmung des Zeitwertes, für den durch unspezifische Nukleaseaktivität keine diskrete λDNA Bande mehr detektiert werden konnte. Verwendet wurde λ-DNA und Mutanten mit Hexahistidintag.
G140A/
N141AHis6
G140A/
N141SHis6
G140S/
R145KHis6
G140S/N141S/
R145KHis6
Standardbedingungen
>2h
>2h
15min
1,5h
Manganbedingungen
18h
5h
30min
3h
pH 8,8
(Niedrigsalz)
>4h
>7h
2h
3h
pH 8,8
(Normalsalz)
2h
18h
30min
18h
Eingesetzt wurden die maximal möglichen Enzymmengen, die durch die Salzkonzentration im Test bestimmt werden, da der Dialysepuffer zur Stabilisierung 300mM
NaCl enthält. Die Salzkonzentration bei den Standardbedingungen sowie für Mangan
und pH8,8 (Normalsalz) beträgt 50mM, für pH8,8 (Niedrigsalz) 5mM. Daher ergeben
sich folgende maximale Enzymkonzentrationen (Tabelle 3.5):
Tab. 3.5: Maximale Enzymkonzentrationen bei unterschiedlichen Reaktionsbedingungen für die Mutanten mit Hexahistidintag
50mM NaCl
5mM NaCl
G140A/N141AHis6
167nM
16,7nM
G140A/N141SHis6
167nM
16,7nM
G140S/R145KHis6
467nM
46,7nM
G140S/N141S/R145KHis6
167nM
16,7nM
Die Degradation der DNA ist sowohl von der eingesetzten Mutante als auch von den
Bedingungen des Spaltansatzes abhängig. Die Nukleaseaktivität der Mutante
G140S/R145KHis6 erscheint ausgeprägter als bei den anderen Mutanten. Bei den
Mutanten läßt sich keine Korrelation zwischen Pufferbedingungen und Stärke der
Ergebnisse
69
Nukleaseaktivität feststellen.
Nach der erneuten Präparation der Mutanten unter Ca-Zusatz wurden keine λ-Kinetiken ausgeführt, da eine Konzentrationsbestimmung nicht möglich war. Außerdem
kann es durch die Aggregation der Mutanten zu einer Einbuße ihrer Funktionsfähigkeit gekommen sein.
3.3.2.2
Spaltkinetiken mit λ(dam-, dcm-)-DNA
Die aus E.coli-Bakterien gewonnene, zuvor eingesetzte λ-DNA ist methyliert durch
die dam- und die dcm-Methylase. Die dam-Methylase methyliert die N6-Position des
Adenins in GATC, die dcm-Methylase die C5-Position im inneren Cytosin von
CCWGG (mit W=A oder T). Die dam-Methylierung blockiert dabei die Restriktionsspaltstelle von BamHI.
Die Mutationen in der EcoRI sind geeignet, einen Austausch in der Erkennungssequenz am äußeren A/T-Basenpaar zu erlauben. Die Zielsequenz ist dabei GGATCC,
die Restriktionsspaltstelle, die von BamHI gespalten wird. Daher ist es möglich, daß
die Mutanten eine veränderte Spezifität aufweisen und eine Spaltung der neuen Zielsequenz (GGATCC) wie bei BamHI durch die Methylierung verhindert wird. Aus diesem Grund wurden die Spaltungen mit unmethylierter λ-DNA ausgeführt (λ(dam-,
dcm-)-DNA). Dabei wurden die gleichen Reaktionsbedingungen verwendet wie zuvor.
Abbildung 3.13 zeigt exemplarisch die Kinetiken bei pH8,8 unter Normalsalzbedingungen.
Bei allen vier Mutanten ist das Fortschreiten der unspezifischen Degradation über
den Verlauf der Kinetik gut zu erkennen. Die Mutante G140A/N141AHis6 erscheint hier
mit der höchsten Nukleaseaktivität.
70
Ergebnisse
(1) (2)
(6)
Spaltung unmethylierter λ-DNA durch die
Mutanten G140A/N141AHis6 und
G140A/N141SHis6
(1)
Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140A/N141AHis6
(6-10) Zeitwerte G140A/N141SHis6
Zeitwerte: 45min, 90min, 3h, 6h, 18h
Spaltung unmethylierter λ-DNA durch die
Mutanten G140S/R145KHis6 und
G140S/N141S/R145KHis6
(1)
Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140S/R145KHis6
(6-10) Zeitwerte G140S/N141S/R145KHis6
Zeitwerte: 45min, 90min, 3h, 6h, 18h
-
-
Abb. 3.13: Spaltung unmethylierter λ-DNA (dam , dcm ) bei pH8,8 unter Normalsalzbedingungen für
alle Mutanten mit Hexahistidintag
Tabelle 3.6 stellt die Nukleaseaktivitäten gegenüber, die analog zur Tabelle 3.4 ermittelt wurden. Eingesetzt wurden die Enzymkonzentrationen aus Tabelle 3.5.
Tab. 3.6: Bestimmung des Zeitwertes, für den durch unspezifische Nukleaseaktivität keine diskrete λDNA-Bande mehr detektiert werden konnte. Verwendet wurden λ(dam , dcm )-DNA und Mutanten mit
Hexahistidintag.
G140A/
N141AHis6
G140A/
N141SHis6
G140S/
R145KHis6
G140S/N141S/
R145KHis6
Standardbedingungen
2h
18h
1h
1,5h
Manganbedingungen
>6h
>18h
>90min
1,5h
pH8,8
(Niedrigsalz)
6h
6h
6h
18h
pH8,8
(Normalsalz)
2h
18h
3h
6h
Ergebnisse
71
Im Vergleich zur korrespondierenden Tabelle 3.4 ergibt sich keine Änderung im
Spaltverhalten der Mutanten. Daher ist auszuschließen, daß es sich um eine BamHISpaltaktivität handelt, die durch die Methylierung blockiert wurde. Unspezifische Nukleaseaktivität der Mutanten sollte unabhängig von der Methylierung sein.
3.4
Charakterisierung der Mutanten mit StrepTag II
Durch die erfolgreiche Reindarstellung der Mutanten konnten zusätzliche biophysikalische Untersuchungen (Gelfiltration (siehe 2.4.5), CD-Spektroskopie (siehe 2.4.6))
ausgeführt werden, die mit den Hexahistidinmutanten aufgrund ihrer geringen Reinheit nicht möglich waren. Allerdings mußten durch die geringe Proteinkonzentration
mehrere Aufarbeitungen durchgeführt werden.
3.4.1 Gelfiltration
Nach der Klonierung des Hexahistidintags an das ecoRI-Gen wurde festgestellt, daß
der Affinitätstag eine Trennung durch die Gelfiltration nicht länger möglich macht
[Vennekohl, 1996]. Es erscheint wahrscheinlich, daß die Histidine dabei eine Interaktion mit dem Gelmaterial eingehen, die eine Trennung verhindert.
Das Protein EcoRI selbst interagiert auch mit dem Säulenmaterial (Sepharose), so
daß monomere und dimere Anteile des Proteins retardiert bei ungefähr dem halben
tatsächlichen Molekulargewicht erscheinen. Die Gelfiltration wurde deshalb mit den
Mutanten des StrepTag II-Systems ausgeführt. Als Vergleich dienten wtEcoRIStrepII
und L158DStrepII. Letzteres Vergleichsprotein liegt nahezu zu 100% als monomeres
Protein vor. Abbildung 3.14 stellt die Gelfiltrationen gegenüber.
Ergebnisse
M
on
Di om
m er
er
M
on
Di om
m er
er
72
G140A/N141A
G140A/N141S
G140S/R145K
G140S/N141S/
R145K
wtEcoRI
L158D
60
40
20
60
40
20
min
Abb. 3.14: Vergleich der Gelfiltrationsläufe der Mutanten mit StrepTag II mit wtEcoRIStrepII und
L158DStrepII
Die Gelläufe von G140S/R145KStrepII und G140S/N141S/R145KStrepII gleichen dem
Spektrum von wtEcoRIStrepII. Sie enthalten etwa 95% dimeres Protein. Dagegen weisen die Mutanten G140A/N141AStrepII und G140A/N141SStrepII einen im Vergleich zum
wt-Enzym erhöhten monomeren Proteinanteil auf (beide Mutanten etwa 75% mono-
Ergebnisse
73
mer).
Der Puffer des Gelfiltrationslaufs enthält Magnesiumchlorid, so daß eine Denaturierung der Proteine aufgrund eines fehlenden zweiwertigen Kations, das zuvor zur
Stabilisierung benötigt wurde, nicht wahrscheinlich ist. Es muß jedoch berücksichtigt
werden, daß vor dem Einspritzen in die Gelfiltrationssäule eine Verdünnung stattgefunden hat, um den Glyzerinanteil herabzusetzen. Durch die Verdünnung wird die
Dissoziation des Proteins begünstigt [Vennekohl, 1996]. Es ist daher anzunehmen,
daß die Proteine G140A/N141AStrepII und G140A/N141SStrepII in ihrer Dimerisierungsfläche durch die Mutationen destabilisiert sind.
Die Messungen wurden bei 230nm vorgenommen. Diese erhöhte Empfindlichkeit
war nötig, da die Proteinlösungen nur eine geringe Konzentration an EcoRI aufwiesen. Dadurch erscheinen in den Spektren mehr Nebenbanden, welche jedoch aufgrund des geringen Materials hingenommen werden mußten. Diese Verunreinigungen sind auf einem Laemmligel nicht so prominent zu sehen, da die Auflösung eines
solchen Gels im Bereich von unterhalb 14kDa nicht gut genug ist.
3.4.2 Circulardichroismus
Eine Messung der Mutanten war erst durch die größere Reinheit der StrepTag IIPräparation sinnvoll, da auch Verunreinigungen in den Präparationen zum Spektrum
beitragen. Abbildung 3.15 stellt die Spektren gegenüber.
Die Spektren der Mutanten stimmen bei G140A/N141SStrepII, G140S/R145KStrepII und
G140S/N141S/R145KStrepII
gut
überein.
Die
Konzentration
der
Mutante
G140A/N141AStrepII ist zu gering, um ein rauschfreies Spektrum zu erzeugen. Es widerspricht jedoch nicht dem Spektrum des wt-Proteins.
Im Vergleich zur Gelfiltration erscheinen die Proteine G140A/N141AStrepII und
G140A/N141SStrepII in ihrer Struktur nicht beeinträchtigt, da sie unverdünnt in der glyzerinhaltigen Lösung gemessen werden konnten.
74
Ergebnisse
Θ [Grad 1/Mm]
0
-4000
-8000
-12000
wtEcoRI
200
220
G140A/N141A
240
200
220
G140A/N141S
240
200
220
240
G140S/R145K
200
220
240
G140S/N141S/R145K
200
220
240
nm
Abb. 3.15: Gegenüberstellung der CD-Spektren der Mutanten mit StrepTag II zu wtEcoRIHis6
3.4.3 Bestimmung der DNA-Bindung der Mutanten mit StrepTag II
3.4.3.1
DNA-Bindung an das 174Bp-Fragment
Analog zu den Bindungsexperimenten mit dem Hexahistidinmutanten wurde die Bestimmung der DNA-Bindung mit den Mutanten mit StrepTag II ausgeführt. Die
Mutanten wurden dabei in einem Überschuß von 50:1, 20:1 und 10:1 zum 174BpDNA-Fragment eingesetzt. Abbildung 3.16 zeigt die Gelshifts für die Mutanten.
Die Mutanten G140A/N141AStrepII und G140A/N141SStrepII zeigen unter den Bedingungen
keinen
Shift.
Die
Mutanten
G140S/R145KStrepII
und
G140S/N141S/R145KStrepII zeigen eine eindeutige DNA-Bindung, die sich jedoch
nicht in einer diskreten Bande äußert, sondern eine Verschmierung des 174BpFragmentes bewirkt. Es ist eine Steigerung in der Retardierung der DNA zu erkennen, welche mit steigender Proteinkonzentration auftritt. Dies spricht für eine unspezifische Bindung der Enzyme, die allerdings nicht stark genug ist, um die DNA über
die Dauer des Gellaufes (etwa 2,5h) festzuhalten.
Ergebnisse
(1)
75
(4)
(7)
(10)
(13)(14)
Gelshift mit dem 174Bp-Fragment
für die Mutanten mit StrepTag II
(1-3)
G140A/N141AStrepII
(4-6)
G140A/N141SStrepII
(7-9)
G140S/R145KStrepII
(10-12) G140S/N141S/R145KStrepII
(13)
174Bp-Fragment, nativ
(14,
15)
wtEcoRI
1. Shift
ungebunden
Verhältnis Mutante zu DNA jeweils
50:1, 20:1 und 10:1, für wtEcoRI
10:1 und 2:1
Abb. 3.16: Gelshift mit 174Bp-Fragment für die Mutanten mit StrepTag II
3.4.3.2
DNA-Bindung an modifizierte Oligonukleotide
Die Aminosäurenaustausche in den Mutanten zielen auf eine veränderte Erkennung
einer DNA-Sequenz, die von der kanonischen Sequenz GAATTC abweicht. Zu diesem Zweck wurden modifizierte Oligonukleotide hergestellt, welche jene veränderten
Kontaktverhältnisse berücksichtigen. Es wurden am äußeren A/T-Basenpaar ein
Austausch des A zum I vorgenommen, vom T zum U und beides. Diese Sequenzen
leiten hin zur BamHI-Erkennungssequenz, die an dieser Stelle ein G/C-Basenpaar
trägt. Eine genauere Beschreibung der Kontakte befindet sich in der Diskussion. Tabelle 3.7 stellt hier die Sequenzen der Oligonukleotide vor. Dabei ist die EcoRI-Erkennungssequenz fett gedruckt, Modifikationen zu dieser Sequenz sind unterstrichen. Die Oligonukleotide sind selbstkomplementär, so daß sie ohne zusätzliches
Annealing für Bindung (siehe unten) oder Spaltung (siehe 3.4.4.2) eingesetzt werden
können, da sie doppelsträngig vorliegen.
76
Ergebnisse
Tab. 3.7: Sequenzen der Oligonukleotide, die für die DNA-Bindung eingesetzt wurden
Oligonukleotid
Sequenz
Dick AT
5‘-TATA GAATTC TAT-3‘
Dick I AT
5‘-TATA GIATTC TAT-3‘
Dick U AT
5‘-TATA GAATUC TAT-3‘
Dick IU AT
5‘-TATA GIATUC TAT-3‘
BamHI AT
5‘-TATA GGATCC TAT-3‘
Die DNA-Bindung wurde mit allen Mutanten (StrepTag II) und dem wt-Enzym für alle
fünf Oligonukleotide getestet. Es wurden 100nM Enzym und 20nM Oligonukleotid
eingesetzt. Die Abbildung 3.17 stellt die Gelshifts der Mutanten gegenüber.
(1)
(7)
Dick AT
(13)
BamHI AT
(19)
Dick I AT
(25)
Dick U AT
Dick IU AT
Shift
nativ
Gelshift mit den modifizierten Oligonukleotiden für die Mutanten mit StrepTag II
BamHI AT
(1-6)
Dick AT
(7-12)
(13-18) Dick I AT
(19-24) Dick U AT
(25-30) Dick IU AT
Reihenfolge jeweils von links nach rechts:
ohne Enzym, G140A/N141AStrepII, G140A/N141SStrepII, G140S/R145KStrepII,
G140S/N141S/R145KStrepII, wtEcoRI
Abb. 3.17: Gelshift der modifizierten Oligonukleotide mit allen Mutanten mit StrepTag II und dem wtEnzym
Ergebnisse
77
Eine Shift-Bande ist nur für das wt-Enzym mit Dick AT zu detektieren, welches die
kanonische Sequenz trägt. Auffällig ist, daß bei den Oligonukleotiden, die mit den
Mutanten G140A/N141AStrepII und G140A/N141SStrepII inkubiert wurden, eine Bande
unterhalb des eigentlichen Oligonukleotids auftritt. Es ist möglich, daß sie durch Degradation von einer Nuklease hervorgerufen wurden. Um einen solchen Nukleaseabbau nachzuweisen, wurde eine Kinetik unter gleichen Bedingungen ausgeführt. Die
Inkubationszeiten für die Bindung wurden von 30min auf 10min, 20min, 30min und
60min varriert. Eingesetzt wurde das Oligonukleotid Dick AT für alle Enzyme. Abbildung 3.18 zeigt den Gelshift.
(1)
(7)
Dick AT
(13)
BamHI AT
(19)
Dick I AT
(25)
Dick U AT
Dick IU AT
Shift
nativ
Gelshift mit den modifizierten Oligonukleotiden für die Mutanten mit StrepTag II
BamHI AT
(1-6)
Dick AT
(7-12)
(13-18) Dick I AT
(19-24) Dick U AT
(25-30) Dick IU AT
Reihenfolge jeweils von links nach rechts:
ohne Enzym, G140A/N141AStrepII, G140A/N141SStrepII, G140S/R145KStrepII,
G140S/N141S/R145KStrepII, wtEcoRI
Abb. 3.18: Gelshift für die Mutanten und das wt-Enzym mit Dick AT nach Inkubation für unterschiedliche Zeitwerte
Für die Mutanten G140A/N141AStrepII und G140A/N141SStrepII ist deutlich eine Kinetik
zu erkennen, die die Ergebnisse der anderen Gelshiftexperimente erhärtet.
Im Verlauf der Inkubation ist eine Zunahme der verkürzten Bande erkennbar (Spuren
2 bis 5 für G140A/N141SStrepII und Spuren 6 bis 8 für G140A/N141SStrepII). Auch bei
G140S/R145KStrepII und in geringem Maße auch bei G140S/N141S/R145KStrepII sind
78
Ergebnisse
Banden in der gleichen Höhe detektierbar, die sich jedoch erst nach einer Inkubation
von einer Stunde zeigen (Spur 13 beziehungsweise Spur 17). Für das wt-Enzym ergibt sich in den Zeiten von 10min bis 30min eine Zunahme des Shiftproduktes (Spuren 18 bis 20), wobei eine Degradation des Oligonukleotids nicht erkennbar wird.
Bei der Degradation des Oligonukleotids Dick AT kann es sich nicht um eine Aktivität
der Mutanten handeln. Es ist gezeigt worden, daß EcoRI mit Ca2+-Ionen allein nicht
in der Lage ist, eine Spaltung auszuführen [Woodhead et al., 1981]. Dies muß
ebenso für die Mutanten gelten, die unter verschiedensten Bedingungen auf Spaltaktivität getestet wurden. Es ist daher anzunehmen, daß es sich bei dieser DNA-Degradation um eine Verunreinigung in den Enzympräparationen handelt, die durch die
Aufreinigung mit dem StrepTag II-System nicht abgetrennt werden konnte. Diese
Verunreinigung tritt stärker bei G140A/N141AStrepII und G140A/N141SStrepII in Erscheinung, sie ist jedoch auch bei G140S/R145KStrepII und G140S/N141S/R145KStrepII
vorhanden.
Die Reaktion wurden unter 10mM EDTA ausgeführt, welches eine Bindungskonstante von 4x1010M-1 für Ca2+-Ionen aufweist. Bei einer eingesetzten Enzymkonzentration von 100nM im Test, die 1mM CaCl2 enthält, ergibt sich somit eine Konzentration von freiem Ca2+-Ionen von 0,25pM im Reaktionsansatz. Diese geringe Konzentration reicht dem Enzym, um diese Degradation hervorzurufen. In dem nativen
Gelsystem ist eine Abschätzung der Länge der degradierten Banden schwer
möglich. Es ist jedoch anzunehmen, daß weder das Enzym, welches den Abbau hervorruft noch die Mutante gebunden sind, da die Bande unterhalb des nativen Oligonukleotids läuft. Analoge Ansätze wurden ebenfalls auf einem 18% denaturierenden
Gel analysiert. Die Ergebnisse entsprechen denen des nativen Gels.
Insgesamt konnte für die Mutanten mit StrepTag II unter den Shift-Bedingungen mit
keinem der Oligonukleotide eine Bindung festgestellt werden.
Ergebnisse
79
3.4.4 Charakterisierung der Spaltaktivität der Mutanten mit StrepTag II
3.4.4.1
Spaltaktivität auf λ(dam-, dcm-)-DNA
Die Charakterisierung des Spaltverhaltens auf λ-DNA wurde mit den Mutanten mit
StrepTag II ausschließlich auf unmethylierter λ-DNA (λ(dam-, dcm-)) ausgeführt, da
durch die Tests mit der methylierten DNA keine zusätzliche Information zu erwarten
war. Die Reaktionsbedingungen sind analog zu den vorherigen Experimenten (3.3.2)
gewählt worden. Eine Wiederholung der Experimente mit diesen Präparationen erschien sinnvoll, da sie eine höhere Reinheit als die korrespondierenden Enzyme mit
Hexahistidintag aufwiesen. Abbildung 3.19 zeigt die Spaltungen von λ(dam-, dcm-)DNA bei pH 8,8 (Normalsalz)-Bedingungen.
(1) (2)
(6)
Spaltung unmethylierter λ-DNA durch die
Mutanten G140A/N141AStrepII und
G140A/N141SStrepII
(1) Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140A/N141AStrepII
(6-10) Zeitwerte G140A/N141SStrepII
Zeitwerte: 45min, 90min, 3h, 6h, 18h
Spaltung unmethlierter λ-DNA durch die
Mutanten G140S/R145KStrepII und
G140S/N141S/R145KStrepII
(1) Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140S/R145KStrepII
(6-10) Zeitwerte G140S/N141S/R145KStrepII
Zeitwerte: 45min, 90min, 3h, 6h, 18h
-
-
Abb. 3.19: Spaltung unmethylierter λ-DNA (dam , dcm ) durch die Mutanten mit StrepTag II bei pH8,8
(Normalsalz)-Bedingungen
80
Ergebnisse
Für die Mutanten G140A/N141AStrepII und G140A/N141SStrepII ergibt sich ein unspezifischer Abbau der DNA. Bei G140A/N141AStrepII ist nach 3h keine vollständige λ-DNA
mehr detektierbar, während bei G140A/N141SStrepII ein vergleichbarer Abbau schon
bei
90min
auftritt.
Bei
den
Mutanten
G140S/R145KStrepII
und
G140S/N141S/R145KStrepII sind deutlich Bandenmuster zu erkennen, die unter der
unspezifischen Nukleaseaktivität liegen. Eine genaue Bestimmung dieser Spaltaktivität erwies sich aufgrund der unspezifischen Degradation als sehr schwierig. Spaltaktivität konnte bei G140S/R145KStrepII unter keinen anderen Bedingungen detektiert
werden, bei G140S/N141S/R145KStrepII jedoch zusätzlich unter Standardbedingungen
(siehe Abbildung 3.20). Dabei erscheint das gebildete Bandenmuster weder EcoRI
noch BamHI ähnlich.
(1) (2)
(6)
(14)
Spaltung unmethylierter λ-DNA durch die
Mutanten G140A/N141AStrepII und
G140A/N141SStrepII
(1)
Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140A/N141AStrepII
(6-10) Zeitwerte G140A/N141SStrepII
Zeitwerte: 45min, 90min, 3h, 6h, 18h
Spaltung unmethylierter λ-DNA durch die
Mutanten G140S/R145KStrepII und
G140S/N141S/R145KStrepII
(1)
Standard-Spaltmuster: wtEcoRI
(2-9) Zeitwerte G140S/R145KStrepII
(6-10) Zeitwerte G140S/N141S/R145KStrepII
(14) Standard-Spaltmuster wtEcoRI
Zeitwerte: 45min, 90min, 3h, 6h, 18h
-
-
Abb. 3.20: Spaltung unmethylierter λ-DNA (dam , dcm ) durch die Mutanten mit StrepTag II unter
Standardbedingungen
Für die Mutante G140S/N141S/R145SStrepII ist deutlich in den ersten Zeitwerten (bis
3h) ein Bandenmuster zu erkennen, das im Laufe der weiteren Kinetik durch unspezifische Nuklease abgebaut wird. Um eine genauere Abschätzung der Bandengröße
Ergebnisse
81
vorzunehmen, wurden Hilfslinien in eingefügt, die korrespondierende Banden in beiden Standardspaltmustern verbinden. Auf diese Weise kann ein ungleichmäßiges
Laufverhalten über die Breite des Agarosegels ausgeglichen werden.
(1)
(14)
(6)
Spaltung unmethylierter λ-DNA
durch die Mutanten
G140S/R145KStrepII und
G140S/N141S/R145KStrepII
(1)
Standard-Spaltmuster:
wtEcoRI
(6-10) Zeitwerte
G140S/N141S/R145KStrepII
(14) Standard-Spaltmuster:
wtEcoRI
Zeitwerte: 45min, 90min, 3h, 6h,
18h
-
-
Abb. 3.21: Spaltung unmethylierter λ-DNA (dam , dcm ) durch die Mutante G140S/N141S/R145KStrepII
und Standardspaltbedingungen (Abbildung 3.20) mit Hilfslinien zur Abschätzung der Bandengröße
Obwohl es sich um ein ähnliches Bandenmuster handelt, ist deutlich zu erkennen,
daß die DNA-Fragmente, die durch die Mutante erzeugt werden, nicht der Größe der
Fragmente der wtEcoRI-Spaltung entsprechen. Allerdings erscheinen die Banden
auch nicht im BamHI-Spaltmuster dieses Substrates, da die Fragmente für eine
BamHI-Spaltung (16841BP, 7233Bp, 6771Bp, 6527Bp, 5626Bp, 5505Bp) einen zu
großen Längenunterschied aufweisen.
Daher muß angenommen werden, daß die Dreifachmutante eine gänzlich andere
DNA-Sequenz erkennt und spaltet.
Für die weiteren Mutanten wurde die Aktivität wie zuvor daran gemessen, wie schnell
λ-DNA degradiert wurde. Tabelle 3.8 stellt dabei die zugrundeliegenden Enzymkonzentrationen zusammen, die für die unterschiedlichen Bedingungen in Tabelle 3.9
gelten (5mM NaCl für pH 8,8 Niedrigsalz, 50mM für alle anderen Bedingungen).
82
Ergebnisse
Tab. 3.8: Maximale Enzymkonzentrationen der StrepTag II- Mutanten unter unterschiedlichen Reaktionsbedingungen
50mM NaCl
5mM NaCl
G140A/N141AStrepII
167nM
16,7nM
G140A/N141SStrepII
167nM
16,7nM
G140S/R145KStrepII
45nM; 250nM
4,5nM; 25nM
G140S/N141S/R145KStrepII
36nM; 333nM
3,6nM; 33,3nM
Tab. 3.9: Bestimmung des Zeitwertes, für den durch unspezifische Nukleaseaktivität keine diskrete λDNA-Bande mehr detektiert werden konnte. Verwendet wurden λ(dam , dcm )-DNA und StrepTagIIMutanten.
G140A/
N141AStrepII
G140A/
N141SStrepII
G140S/
R145KStrepII
G140S/N141S/
R145KStrepII
Standardbedingungen
1,5h
1,5h
6h
6h
Manganbedingungen
3h
1,5h
6h
18h
pH8,8
(Niedrigsalz)
1,5h
1,5h
3h
3h
pH8,8
(Normalsalz)
3h
1,5h
6h
6h
Die Spaltaktivität für die Mutante G140S/N141S/R145KStrepII konnte auf λ-DNA nicht
weiter charakterisiert werden, daher wurden für die folgenden Experimente Oligonukleotide eingesetzt (siehe 3.4.4.2).
Bei den anderen Mutanten kann keine Korrelation zwischen Nukleaseaktivität und
Pufferbedingungen festgestellt werden.
3.4.4.2
Spaltaktivität auf modifizierten Oligonukleotiden
Um auf λ-DNA Spaltaktivität mit einem Agarosegel zu detektieren, müssen viele
Spaltereignisse an der gleichen Spaltstelle zusammenkommen, so daß eine diskrete
Bande entsteht. Für Mutanten mit geringer Spaltaktivität ist dies unter Umständen
Ergebnisse
83
nicht erreichbar, ohne daß eine unspezifische Degradation des Substrats auftritt.
Wird die Spaltung auf einem Oligonukleotid verfolgt, führt schon eine geringe Anzahl
von Spaltereignisse zu einer sichtbaren Bande, wenn das Oligonukleotid radioaktiv
markiert wurde. Daher kann eine schwächere Spaltaktivität mit diesem System detektiert werden. Außerdem wird das Enzym auf die Oligonukleotidsequenz konzentriert und kann sich nicht in einer Bindung an viele andere Sequenzen verlieren.
Da mit den Mutanten G140A/N141AStrepII und G140A/N141SStrepII auf λ-DNA unter
keiner der Versuchsbedingungen eine Spaltaktivität nachgewiesen werden konnte
und für G140S/R145KStrepII und G140S/N141S/R145KStrepII nur partielle Spaltmuster,
wurden als Substrate verschiedene Oligonukleotide verwendet. Hierbei handelt es
sich um modifizierte Oligonukleotide des Typs Dick AT. Dabei sind ausgehend von
der EcoRI-Erkennungssequenz (GAATTC) Basenaustausche am äußeren A/T-Basenpaar vorgenommen worden zu Dick I AT Dick U AT und Dick IU AT (Sequenzen
siehe Tabelle 3.7). Zusätzlich wurde das Basenpaar durch G/C ausgetauscht, so daß
die BamHI-Erkennungssequenz entsteht (GGATCC). Die Oligonukleotide sind
selbstkomplementär und bilden einen 12Bp langen Doppelstrang mit einem 5‘-überhängenden Thymidin zur leichteren radioaktiven Markierung mit der Polynukleotidkinase.
Bevor das Spaltverhalten der hier hergestellten Mutanten mit den Oligonukleotiden
getestet wurde, erfolgte eine Testspaltung mit wtEcoRI. Das Verhältnis Oligonukleotid zu Enzym betrug bei Dick AT 50nM zu 60nM, bei den anderen Oligonukleotiden
500nM zu 600nM. Durch die Erhöhung der absoluten Menge bei gleichem Verhältnis
ist eine Bindung des Oligonukleotids begünstigt. Diese Bedingungen wurden für die
modifizierten Oligonukleotide gewählt, da hier mit einer sehr langsamen Spaltung zu
rechnen ist. Die Reaktionen wurden wegen besserer Handhabung bei Raumtemperatur vorgenommen. Für die Sequenz mit Uracil (Dick U AT) ist bekannt, daß eine
Spaltung möglich ist [Jeltsch et al., 1993a; Küster, 1998]. Abbildung 3.22 zeigt die
Spaltungen der fünf Oligonukleotide für wtEcoRI.
84
Ergebnisse
(1) (2)
(5)
(8)
(11)
(16)
13Bp
5Bp
Spaltung modifizierter Oligonukleotide durch wtEcoRI
(1)
Positivkontrolle
(2-4)
(5-7)
Zeitwerte Dick IU AT
(8-10)
(11-15)
Zeitwerter Dick U AT
(16-20)
Zeitwerte Dick I AT
Zeitwerte BamHI AT
Zeitwerte Dick AT
Zeitwerte für Dick I AT, Dick IU AT und BamHI AT: Nullwert, 10min, 3h
Zeitwerte für Dick U AT und Dick AT:
Nullwert, 15s, 30s, 1min, 5min
Abb. 3.22: Spaltung der modifizierten Oligonukleotide durch wtEcoRI
Für die Oligonukleotide Dick I AT, Dick IU AT und BamHI AT konnte selbst für einen
Zeitwert von 3h keine Spaltung erreicht werden. Auffällig ist hier, daß selbst für das
wt-Enzym, das in hoher Reinheit vorliegt, bereits eine leichte Leiterbildung bei den
3h-Inkubationen zu erkennen ist (Spuren 4, 7 und 10). Daher sind Inkubationen über
längere Zeitwerte nicht sinnvoll.
Für das Oligonukleotid Dick U AT ergibt sich schon ab 15s eine Spaltung, die bis
zum Zeitwert von 5min deutlich zunimmt. Ebenso verhält es sich beim Oligonukleotid
Dick AT, das die kanonische Sequenz trägt. Auch hier nimmt die Spaltung deutlich
von 15s fortschreitend bis 5min zu. Die Spaltung dieses Oligonukleotids wurde für
alle folgenden Spaltanalysen als Positivkontrolle (Spur 1) eingesetzt, um die
Laufstrecke der zu erwartenden Spaltung abschätzen zu können.
Für die Mutanten konnte ein vergleichbares Verhältnis von Enzym zu Oligonukleotid
nicht eingesetzt werden, da die Präparationen geringere Proteinkonzentrationen enthielten. Eingesetzt wurden daher die höchstmöglichen Konzentrationen der Enzyme
Ergebnisse
85
(vergleiche Tabellen 3.10 bis 3.13).
Die Kinetiken wurden zunächst unter Standardspaltbedingungen ausgeführt. Dabei
wurden mehrere Zeitwerte genommen, um eine Entwicklung der Spaltung zu detektieren. Analog zum Experiment mit dem wt-Enzym wurden zunächst Inkubationszeiten von 3h gewählt. Dabei konnte für keine der Mutanten bei irgendeinem der Oligonukleotide eine Spaltung detektiert werden. Daher wurden im Folgenden Zeitwerte
bis zu 18h genommen (über Nacht). Abbildung 3.23 zeigt exemplarisch die Spaltung
der modifizierten Oligonukleotide mit den Mutanten G140A/N141AStrepII und
G140A/N141SStrepII unter Standardspaltbedingungen.
(1) (2)
(5)
(8)
13Bp
5Bp
(11)
Spaltung modifizierter Oligonukleotide
durch G140A/N141AStrepII und
G140A/N141SStrepII, jeweils 18h
(1)
Positivkontrolle
(2-4)
Dick I AT
(5-7)
Dick U AT
(8-10)
Dick IU AT
(11-13) Dick AT
Reihefolge jeweils:
Nullwert, G140A/N141AStrepII,
G140A/N141SStrepII
Abb. 3.23: Oligonukleotidspaltung durch die Mutanten G140A/N141AStrepII und G140A/N141SStrepII
unter Standardbedingungen
Spur 1 zeigt die Positivkontrolle, die Spaltung von Dick AT durch das wt-Enzym. Für
alle vier Oligonukleotide ist ein Abbau detektierbar, der nukleotidweise erfolgt. Somit
ergibt sich eine Leiter von 13Bp bis 7Bp. Eine Spaltung des Oligonukleotids zum 5Bp
großen Produkt, das von einer Restriktionsaktivität erwartet wird, tritt nicht auf. Es ist
unwahrscheinlich, daß eine solche Aktivität von den Mutanten ausgeht, da es sich
hier um eine Exonukleaseaktivität handelt. Abbildung 3.24 zeigt die Sequenzen in
doppelsträngigen Oligonukleotiden.
86
Ergebnisse
5´
*T A T A G A A T T C T A T
T A T C T T A A G A T A T*
5´
Abb. 3.24: Darstellung des 5‘-markierten selbstkomplementären Oligonukleotids Dick AT
Möglicherweise handelt es sich bei der Nukleaseaktivität in diesen Proben um eine
Polymerase mit Proofreading-Aktivität. Sie würde in Ermangelung von Nukleotiden
zur Vervollständigung des einzelsträngigen Überhanges vom 3‘-Ende her das doppelsträngige Oligonukleotid abbauen. In Abbildung 3.24 sind die möglichen Abbauprodukte durch Pfeile gekennzeichnet. Dieser Abbau schreitet fort, bis die Stränge
des Oligonukleotids nicht länger hybridisieren können, so daß das 7Bp-Fragment das
kürzeste Produkt darstellt.
Für ein schnelles Restriktionsenzym stellt diese Art der Verunreinigung einer Präparation keine Komplikation dar. Bei Enzymen so geringer Aktivität jedoch, wie sie hier
vorliegen, kann diese Nebenaktivität detektiert werden. Die Endonukleaseaktivität
der Enzyme sollte in jedem Fall ein kürzeres Produkt hervorbringen, so daß hier
keine Spaltung durch die Mutanten vorliegt.
Die Spaltungen aller Oligonukleotide wurden mit den vier Mutanten mit StrepTag II
mit maximalem Enzymeinsatz durchgeführt. Tabelle 3.10 stellt die Ergebnisse für die
Mutanten und das wt-Enzym zusammen.
Für keine der Mutanten konnte die Bildung des 5Bp-Produktes unter Standardbedingungen beobachtet werden. Die maximalen Konzentrationen der Enzyme ergeben
sich aus den Präparationen der Mutanten. Aufgrund des hohen Verbrauchs der Enzyme bei den Messungen konnten die Spaltungen nicht mit allen Präparationen ausgeführt
werden,
so
daß
bei
den
Enzymen
G140S/R145KStrepII
und
G140S/N141S/R145KStrepII nicht die letzten Präparationen berücksichtigt werden
konnten, welche eine höhere Konzentration aufwiesen (vergleiche Tabelle 3.3).
Ergebnisse
87
Tab. 3.10: Oligonukleotidspaltungen durch die Mutanten und das wt-Enzym unter Standardbedingungen. Die Konzentrationsverhältnisse geben Enzym zu Oligonukleotid in nM an.
Mutante
Enzym/Oligonukleotid [nM]
Zeitwerte
Spaltung
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
wtEcoRIHis6
60/50
15s bis 5min
600/500
10min bis 3h
600/500
15s bis 5min
600/500
10min bis 3h
600/500
10min bis 3h
Spaltung zum 5Bp
kein Produkt
Spaltung zum 5Bp
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141AStrepII
284/500
2min bis 18h
284/500
2min bis 18h
284/500
2min bis 18h
284/500
2min bis 18h
284/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141SStrepII
64/500
2min bis 18h
64/500
2min bis 18h
64/500
2min bis 18h
64/500
2min bis 18h
64/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/R145KStrepII
191/500
10min bis 18h
191/500
10min bis 18h
191/500
10min bis 18h
191/500
10min bis 18h
191/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/N141S/R145KStrepII
151/500
10min bis 18h
151/500
10min bis 18h
151/500
10min bis 18h
151/500
10min bis 18h
151/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
88
Ergebnisse
Von einigen Mutanten ist bekannt, daß eine langsame oder nicht vorhandene Spaltaktivität durch Starspaltbedingungen verbessert wird. Daher wurden für die Mutanten
die klassischen Starspaltbedingungen Manganzusatz und pH8,8 (Niedrigsalz) getestet. Um einen möglichst geringen Enzymverbrauch zu erreichen, wurden einzelne
lange Zeitwerte (über Nacht, also etwa 18h) verwendet. Im Fall einer Spaltung sollte
eine ausführliche Kinetik angeschlossen werden. Tabelle 3.11 zeigt die Ergebnisse
für die Spaltungen unter Mangan-Starbedingungen.
Tab. 3.11: Oligonukleotidspaltungen durch die Mutanten unter Mangan-Starbedingungen. Die Konzentrationsverhältnisse geben Enzym zu Oligonukleotid in nM an.
Mutante
Enzym/Oligonukleotid [nM]
Zeitwerte
Spaltung
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141AStrepII
284/500
5h bis 18h
284/500
5h bis 18h
284/500
5h bis 18h
284/500
5h bis 18h
284/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141SStrepII
64/500
5h bis 18h
64/500
5h bis 18h
64/500
5h bis 18h
64/500
5h bis 18h
64/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/R145KStrepII
191/500
5h bis 18h
191/500
5h bis 18h
191/500
5h bis 18h
191/500
5h bis 18h
191/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/N141S/R145KStrepII
151/500
5h bis 18h
151/500
5h bis 18h
151/500
5h bis 18h
151/500
5h bis 18h
151/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Ergebnisse
89
Unter Mangan-Starbedingungen konnte kein unspezifischer Abbau der Oligonukleotide zu einer Leiter festgestellt werden. Allerdings zeigte sich auch keine Spaltung
zum 5Bp-Produkt nach einer Spaltung bei Raumtemperatur über Nacht (etwa 18h).
Für den Test der pH8,8-Starbedingungen unter Niedrigsalz muß das Enzym zuvor in
pH8,8-Puffer äquillibriert werden. Die Bedingungen fordern nicht mehr als 5mM
NaCl, so daß sich insgesamt eine geringere Enzymkonzentration ergibt (vergleiche
Tabelle 3.8). Tabelle 3.12 gibt die Spaltungen unter diesen Bedingungen wider.
Tab. 3.12: Oligonukleotidspaltungen durch die Mutanten unter pH8,8-Starbedingungen (Niedrigsalz).
Die Konzentrationsverhältnisse geben Enzym zu Oligonukleotid in nM an.
Mutante
Enzym/Oligonukleotid [nM]
Zeitwerte
Spaltung
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141AStrepII
28,4/500
5h bis 18h
28,4/500
5h bis 18h
28,4/500
5h bis 18h
28,4/500
5h bis 18h
28,4/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140A/N141SStrepII
6,4/500
5h bis 18h
6,4/500
5h bis 18h
6,4/500
5h bis 18h
6,4/500
5h bis 18h
6,4/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/R145KStrepII
19/500
5h bis 18h
19/500
5h bis 18h
19/500
5h bis 18h
19/500
5h bis 18h
19/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
Dick AT
Dick I AT
Dick U AT
Dick IU AT
BamHI AT
G140S/N141S/R145KStrepII
15/500
5h bis 18h
15/500
5h bis 18h
15/500
5h bis 18h
15/500
5h bis 18h
15/500
18h
kein Produkt
kein Produkt
kein Produkt
kein Produkt
kein Produkt
90
Ergebnisse
Wie unter Mangan-Starbedingungen wurde für pH8,8-Starbedingungen keine Spaltung zum 5Bp-Produkt beobachtet. Eine Leiterbildung wurde ebenfalls nicht detektiert. Durch die größere Verdünnung des Enzyms wurden auch Verunreinigungen,
die mit eingeschleppt wurden, weiter verringert. Allerdings beträgt der Konzentrationsunterschied zu den Standardbedingungen den Faktor 10. Bei einer so langen Inkubationszeit von etwa 18h sollte dies unerheblich sein. Daher ist es wahrscheinlicher, daß die Standardpufferbedingungen für die abbauende Verunreinigung günstiger sind als die EcoRI-Starbedingungen.
Insgesamt konnte unter keiner der getesteten Bedingungen eine Spaltung des unmodifizierten Oligonukleotids Dick AT oder der modifizierten Sequenzen von Dick I
AT, Dick U AT oder Dick IU AT, sowie BamHI AT gespalten werden. Zwar entzieht
der unspezifische Abbau dem Enzym immer mehr Substrat, aber da nach 18h auch
immer noch Oligonukleotid der Ausgangslänge vorhanden war, sollte eine spezifische Spaltung zum 5Bp-Produkt detektiert worden sein.
Diskussion
4
91
DISKUSSION
In der vorliegenden Arbeit wurden Mutationen an der Restriktionsendonuklease
EcoRI durchgeführt, die sowohl zum erweiterten Verständnis der Struktur dieses Enzyms und seiner Wechselwirkung mit der DNA, als auch zur Grundlage der Erweiterung der Sequenzspezifität dienen sollen.
Auswahl geeigneter Mutanten
Nach der Röntgenstrukturanalyse werden die nebeneinanderliegenden AT-Basenpaare von Gly140 und Asn141 der einen Untereinheit sowie Arg145 der anderen
Untereinheit erkannt [Rosenberg, 1991]. Für Gly140 ist dabei eine hydrophobe
Wechselwirkung zum äußeren Thymin der Erkennungssequenz beschrieben worden.
Dieser Kontakt konnte durch zielgerichtete Mutageneseexperimente bestätigt werden
[Küster, 1998]. In diesem Fall wurden Aminosäureaustausche an Position 140 von
Glycin zu Alanin beziehungsweise Serin durchgeführt. Die Mutanten sind deutlich in
ihrer katalytischen Aktivität beeinträchtigt (G140A 1000fach, G140S inaktiv). Allerdings war die Aktivität der G140A-Mutante auf Oligonukleotiden mit Uracil anstelle je
eines Thymins deutlich erhöht. Daraus folgt, daß die Reduktion der Aktivität der
G140A-Mutante vor allem auf einer sterischen Behinderung durch die zusätzliche
Methylgruppe beruht und daß ein Kontakt zu beiden Thyminbasen gleichzeitig erfolgt. Die Aminosäureposition 141 bildet Wasserstoffbrückenbindungen zu den Adeninen der Erkennungssequenz aus. Dieser Kontakt wurde auch bereits charakterisiert [Fritz et al., 1998]. Während die N141A-Mutante nur unter Starbedingungen aktiv ist, konnte für die Einzelmutante N141S eine spezifische Aktivität bestimmt werden, die um den Faktor 100 unter der des Wildtypenzyms liegt.
Arg145 nimmt neben der Bildung von Wasserstoffbrückenbindungen zu zumindest
einem der beiden Adenine der Erkennungssequenz eine zentrale Stellung in der
Wechselwirkung der Untereinheiten ein, indem es über einen Ionenkontakt mit
Glu144 der gegenüberliegenden Untereinheit die Dimerbildung der Restriktionsendonuklease EcoRI stabilisiert. Außerdem ist die Seitenkette von Arg145 im Wasserstoffbrückenbindungsabstand zu dem gegenüberliegenden Asn141 und dem zu
92
Diskussion
spaltenden Phosphat, so daß ein Beitrag zur Kopplung von Erkennung und Katalyse
wahrscheinlich ist. Für die R145K-Mutante ist aber nur eine Reduktion der spezifischen Aktivität um den Faktor 50 beschrieben worden [Wolfes et al., 1986].
Die folgenden Abbildungen illustrieren als Stereobilder die Abstände und Ausrichtungen der interessierenden Bereiche. Dabei kennzeichnen a und b die beiden
Untereinheiten des Enzyms.
A
B
G140(a)
N141(a)
G140(a)
N141(a)
R145(b)
R145(b)
G140(a)
N141(a)
G140(a)
N141(a)
R145(b)
R145(b)
Abb. 4.1: Stereobild der Kontakte des wt-Enzyms zur kanonischen EcoRI-Sequenz (A)
und zur BamHI-Sequenz (B)
Wie oben bereits beschrieben und in Abbildung 4.1/A dargestellt, tragen die hier zur
zielgerichteten Mutagenese ausgewählten Aminosäurereste wie folgt bei: Gly140
bildet sowohl zur Methylgruppe des inneren als auch des äußeren Thymins van der
Waals-Wechselwirkungen aus. Asn141 erkennt die beiden Adenine der Erkennungssequenz über insgesamt drei Wasserstoffbrückenbindungen. Darüber hinaus bildet
Arg145 der anderen Untereinheit zwei Wasserstoffbrückenbindungen zum äußeren
Adenin der Erkennungssequenz aus. Bei der Bindung des Wildtypenzyms zu seiner
spezifischen Erkennungssequenz wird von diesen drei Aminosäuren also insgesamt
ein „Netzwerk“ von fünf Wasserstoffbrückenbindungen und zwei van der Waals
Wechselwirkungen gebildet. Ein mögliches Ziel der Spezifitätsänderung von EcoRI
Diskussion
93
ist die Erkennung der Sequenz GGATCC, die einer BamHI-Spezifität entspricht. Dies
wurde durch die verbesserte Aktivität von der G140A-Mutante auf einem GAATUCSubstrat nahegelegt [Küster, 1998]. Deshalb wird in Abbildung 4.1/B die Wechselwirkung mit dem analogen Ausschnitt aus der BamHI-Sequenz gezeigt. Für das wt-Enzym ergibt sich neben dem Verlust einer hydrophoben Wechselwirkungen (das Cytosin hat keine 5‘-Methylgruppe) auch der Austausch einer Wasserstoffbrückenbindung
gegen eine elektronische Abstoßung (Guanin hat an Position 6 eine Carbonyl- statt
einer Aminogruppe).
Aus diesem Unterschied zwischen den Interaktionen mit den Sequenzen GAATTC
und GGATCC sowie den Eigenschaften der Einzelmutanten an den Positionen 140
und 141 erschienen die Doppelmutanten G140A/N141A und G140A/N141S als vielversprechende Kandidaten für eine Spezifitätsänderung.
A
A140(a)
A141(a)
A140(a)
A141(a)
B
R145(b)
R145(b)
A140(a)
A141(a)
A140(a)
A141(a)
R145(b)
R145(b)
Abb. 4.2: Stereobild der Kontakte der Mutante G140A/N141A zur kanonischen EcoRISequenz (A) und zur BamHI-Sequenz (B)
Wie auf Abbildung 4.2/A zu erkennen ist, kommt es durch die Einführungen der Aminosäure Alanin an den Positionen 140 und 141 zu Destabilisierungen des ProteinDNA Netzwerkes auf einer GAATTC-Sequenz. Aus sterischen Gründen kann die
Aminosäure Alanin 140 keine van der Waals-Wechselwirkungen mehr zu den Me-
94
Diskussion
thylgruppen der Thymine ausbilden. Es kommt dagegen aufgrund der räumlichen
Lage zu sterischen Behinderungen. Ferner ist der Alaninrest an Position 141 nicht in
der Lage, Wechselwirkungen zur DNA zu bilden. Diese Mutationen haben jedoch
keinen Einfluß auf die beiden Wasserstoffbrückenbindungen des Arginins. Der
Verlust dreier Wasserstoffbrückenbindungen und eine sterische Behinderung lassen
sicherlich keine Wechselwirkung mit der GAATTC-Sequenz mehr zu. Schon die Einzelmutante N141A war ja unter kanonischen Pufferbedingungen inaktiv [Fritz et al.,
1998]. Bei einer GGATCC-Sequenz ist die sterische Behinderung aufgehoben und
durch einen hydrophoben Kontakt ersetzt (siehe Abb. 4.2/B). Allerdings trägt Ala141
nicht zur Wechselwirkung bei. Immerhin könnte man sich eine Spaltung von
GGATCC unter Starbedingungen vorstellen, so wie die Einzelmutante N141A auf der
Sequenz GAATTC unter diesen Bedingungen aktiv war.
A
A140(a)
S141(a)
A140(a)
S141(a)
B
R145(b)
A140(a)
S141(a)
A140(a)
S141(a)
R145(b)
R145(b)
R145(b)
Abb. 4.3: Stereobild der Kontakte der Mutante G140A/N141S zur kanonischen EcoRISequenz (A) und zur BamHI-Sequenz(B)
In Abbildung 4.3/A ist die Situation, wie sie in der Doppelmutante G140A/N141S vorliegen sollte, zu erkennen. Hier kommt es ebenfalls aufgrund der räumlichen Lage
des Alaninrestes an Position 140 zu den Methylgruppen der Thymine zu Destabilisierungen in der Protein/DNA-Wechselwirkung. Durch das Serin an Position 141 ent-
Diskussion
95
stehen zwei Möglichkeiten zur Ausbildung von Wasserstoffbrückenbindungen, wobei
es fraglich bleibt, ob die Entfernungen von Donor und Akzeptor ausreichen, eine Bindung zu generieren. Die erhöhte Aktivität der Einzelmutante N141S gegenüber
N141A spricht sehr dafür [Fritz et al., 1998]. Diese Mutationen haben auch hier keinen Einfluß auf die Wasserstoffbrückenbindungen des Arginin 145. Auf der BamHISequenz sieht die Situation noch besser aus (siehe Abb. 4.3/B). Vom Alanin an Position 140 sollte jetzt zumindest ein hydrophober Kontakt ohne sterische Behinderungen beigetragen werden, so daß insgesamt nur eine Wasserstoffbrückenbindung
weniger als bei der Erkennung der GAATTC-Sequenz durch das wt-Enzym resultiert.
Die beiden beschriebenen Doppelmutanten fassen jeweils zwei Mutationen zusammen, die schon als Einzelmutanten charakterisiert wurden. Um auch die dritte, die
AT-Basenpaare kontaktierende Aminosäure Arg145 mit einzubeziehen, wurde die
Tripelmutante G140S/N141S/R145K gewählt. Außerdem sollte die Doppelmutante
G140S/R145K mit in die Untersuchungen einbezogen werden, um den Beitrag der
drei Einzelmutationen etwas besser abschätzen zu können.
A
B
S140(a)
N141(a)
S140(a)
N141(a)
K145(b)
S140(a)
N141(a)
S140(a)
N141(a)
K145(b)
K145(b)
K145(b)
Abb. 4.4: Stereobild der Kontakte der Mutante G140S/R145K zur kanonischen EcoRISequenz (A) und zur BamHI-Sequenz (B)
Bei der Generierung der Doppelmutante G140S/R145K ist die Situation wie folgt
(siehe Abb. 4.4/A): Neben der sterischen Behinderung durch die Hydroxymethyl-
96
Diskussion
gruppe des Serinrestes, liegt hier auch eine starke elektronische Abstoßung zwischen der Alkoholgruppe des Serins und zumindest einer Carbonylgruppe des Thymins vor. Zusätzlich zu den drei Wasserstoffbrückenbindungen des Asn141 ist das
Lysin an Position 145 in der Lage, drei weitere Wasserstoffbrückenbindungen zu
beiden Adeninen der Erkennungssequenz auszubilden, wobei den starken Behinderungen durch das Serin insgesamt sechs Wasserstoffbrückenbindungen gegenüberstehen. Wie stark sich allerdings der Verlust der Kontakte von Arg145 zu Glu144 der
anderen Untereinheit und zum zu spaltenden Phosphat auswirken, ist schwer einzuschätzen. Immerhin ist die Einzelmutante R145K nur um den Faktor 50 langsamer
[Wolfes et al., 1986]. Das Serin an Position 140 hat auf einer BamHI-Sequenz die
Möglichkeit, sowohl einen hydrophoben Kontakt als auch eine Wasserstoffbrücke
zum Cytosin auszubilden (siehe Abb. 4.4/B). Es muß sich dazu aber leicht umorientieren. Das Asparagin an Position 141 trägt nur zwei Wasserstoffbrücken bei und
interferiert mit der Carbonylgruppe am Guanin, während das Lysin an Position 145
keinen Unterschied zwischen einem Guanin und einem Adenin an dieser Nukleotidposition macht. Im günstigsten Fall würde also die Interferenz des Carbonylsauerstoffs von Guanin und Asparagin durch eine zusätzliche Wasserstoffbrücke ausgeglichen. Allerdings kann man die Konsequenzen der notwendigen Umorientierungen
einzelner Aminosäuren in einem verzahnten Wasserstoffbrückennetzwerk, wie wir es
in der Interaktionsfläche der EcoRI mit der DNA vorliegen haben, in keiner Weise
vorhersagen.
In der Mutante G140S/N141S/R145K kommt es neben den oben bereits erwähnten
Abstoßungen durch G140S und Wasserstoffbrückenbindungen durch R145K zum
Verlust von mindestens einer Wasserstoffbrückenbindung aufgrund der Substitution
von Asn141 durch Serin (siehe Abb. 4.5/A). In dieser Tripelmutante sind nun gegenüber einem GC-Basenpaar einer BamHI-Sequenz keine sterischen oder elektronischen Behinderungen sichtbar (siehe Abb. 4.5/B). Alle drei neuen Seitenketten sollten positive Wechselwirkungen mit dem Basenpaar ausbilden können, so daß eine
Situation resultiert, die der Erkennung der kanonischen Sequenz durch die wtEcoRI
entspricht.
Diskussion
A
B
97
S140(a)
S141(a)
S140(a)
S141(a)
K145(b)
S140(a)
K145(b)
S140(a)
S141(a)
S141(a)
K145(b)
K145(b)
Abb. 4.5: Stereobild der Kontakte der Mutante G140S/N141S/R145K zur kanonischen
EcoRI-Sequenz (A) und zur BamHI-Sequenz (B)
Alle diese Bedingungen beruhen auf einer einzelnen Röntgenstruktur, die die notwendige Dynamik eines Enzyms bei dem Übergang vom freien Zustand über einen
erst unspezifisch und dann spezifisch gebundenen Zustand zur Spaltung außer Acht
lassen muß. Erst die Generierung und Untersuchung der entsprechenden Mutanten
kann zeigen, inwieweit diese der Modellvorstellung nahekommen. Zu diesem Zweck
wurden folgende Mehrfachmutanten hergestellt: G140A/N141A, G140A/N141S,
G140S/R145K und G140S/N141S/R145K.
Expression und Aufreinigung der Mutanten
Die Aufreinigung der Mutanten mit Hexahistidintag erfolgte zunächst nach dem Standardprotokoll. Dabei konnte keine saubere Aufreinigung erzielt werden. Es wurden
größere Mengen an Fremdprotein mitgeschleppt, welche sich auch durch die
Ionenaustauschchromatographie nicht abtrennen ließen. Diverse Veränderungen wie
Vertauschen der Säulenreihenfolge brachten nicht den erwünschten Erfolg. Da zunächst vermutet wurde, daß es sich bei den mitgeschleppten Verunreinigungen um
Chaperone handele, wurde ATP zugesetzt, welches ein Freisetzen des Proteins
durch die Chaperone bewirken sollte. Da das ATP jedoch keinen Einfluß auf die
98
Diskussion
Proteinreinheit nehmen konnte und die drei hauptsächlichen Chaperone der E.coliZelle auf anderer Höhe als die Verunreinigungen laufen, handelt es sich bei diesen
vermutlich nicht um Chaperone, vergleiche Abbildung 3.6.
Trotzdem könnte bei den hier vorgestellten Mutanten eine Beeinträchtigung ihrer
strukturellen Stabilität und/oder Konformation zur schlechten Aufreinigung beitragen.
Im Gegensatz zur wtEcoRI ist aus dem Rohextrakt keine Spaltaktivität erkennbar.
Vermutlich erfolgt keine so starke Produktion in den Zellen wie es beim Wildtyp der
Fall ist. Die Transkription der Mutanten sollte unbeeinflußt sein, da der Promotor unverändert ist. Es wird jedoch entweder weniger Protein hergestellt oder dieses in den
Zellen sofort wieder abgebaut. Durch den Zusatz von zweiwertigen Kationen wurden
schon in früheren Experimenten positive Auswirkungen auf die Stabilität und Bindungsfähigkeit [Windolph et al., 1997] sowie auf eine schnellere Katalyse [Alves et
al., 1989] von Restriktionsendonukleasen beschrieben. Aus diesem Grund wurde
dem Aufreinigungsprozeß der Mutanten Ca2+ zugefügt. Daraus resultierte eine deutlich verbesserte Aufreinigung, eine fast saubere Präparation wurde erhalten. Die
Bindungsstelle für ein stabilisierendes Ca2+-Ion ist nicht bekannt. Es ist sicherlich
nicht die Bindungsposition des katalytisch essentiellen Mg2+-Ions, da Ca2+ eine DNASpaltung nicht ermöglicht [Woodhead et al., 1981], bei der Mutante K130E aber in
geringen Konzentrationen die Mg2+-induzierte Spaltung stimulierte [Windolph et al.,
1997].
Die
dort
vermutete
Bindungsstelle
an
den
sauren
Aminosäuren
Asp133/Asp135 konnte inzwischen ausgeschlossen werden [Rosati, 1999].
Die strukturelle Stabilisierung dieser Mutanten durch Ca2+ ist für sich allein schon ein
sehr wichtiges Ergebnis dieser Arbeit. Sie konnte in der Arbeitsgruppe auch bereits
auf weitere Mutanten erfolgreich übertragen werden.
Nach der abschließenden Dialyse, die zum Umpuffern auf einen glycerinhaltigen
Aufbewahrungspuffer dient und mit einer Konzentrierung der Enzymlösung einhergeht, kam es aber zum Ausfallen der in Gegenwart von Ca2+ aufgereinigten Mutanten. Diese verstärkte Aggregationneigung der EcoRI-Mutanten mit Hexahistidintag
wurde schon in anderen Arbeiten beobachtet [Vennekohl, 1999]. In diesem Fall
könnte es auch ein weiteres Indiz auf eine strukturelle Beeinträchtigung der Mutanten
sein. Die durch den Hexahistidintag bedingte Aggregationsneigung wird demnach
durch die Mutationen noch verstärkt.
Diskussion
99
Auf der Grundlage dieses Ergebnisses erfolgte eine Umklonierung der Mutanten mit
anschließender Aufreinigung mit dem StrepTag II-System. Nach den positiven Erfahrungen bei der Hexahistidintagaufreinigung erfolgte gleich ein Zusatz von Kalzium.
Das Ergebnis war eine saubere Präparation der Mutanten (Reinheitsgrad etwa 80 bis
90%) mit allerdings geringer Enzymmenge, die auch nach mehreren Aufreinigungen
nicht verstärkt werden konnte.
Biophysikalisch chemische und biochemische Charakterisierung der Mutanten
Durch den Reinheitsgrad der StrepTag-Mutanten wurden biophysikalische Untersuchungen erst möglich. Der Hauptteil der Charakterisierungen wurde aus diesem
Grund auch mit diesen Mutanten durchgeführt. Beim Circulardichroismus wiesen die
Enzyme keine Besonderheiten auf. Die Spektren sind durch die nur gering einsetzbare Konzentration zum Teil verrauscht. Ein Widerspruch zum Wildtypenzym tritt
aber in der Sekundärstruktur nicht auf.
Die weiterhin durchgeführte Gelfiltration zeigte eindeutig, daß die Mutanten
G140A/N141A und G140A/N141S in ihrem Monomer-Dimer-Gleichgewicht in Richtung des Monomers verschoben sind. Beide Enzyme sind zu 50 bis 75% monomer.
Diese Instabilität des nativen Dimerstatus kann sehr einfach die erhöhte Aggregationsneigung erklären, die auch schon für andere Mutanten beobachtet wurde [Vennekohl, 1999]. Sie könnte auch der Grund für die geringere Expressionsausbeute
sein, da Aggregate zumindest dem löslichen Teil des Zytosols entzogen sind. Die
Mutanten G140S/R145K und G140S/N141S/R145K dagegen erscheinen analog zum
Wildtypenzym als Dimere, also nicht in ihrem Gleichgewicht gestört. Interessanterweise sind die Mutanten mit einer Mutation von Arg145, welches in der Röntgenstruktur über eine Wasserstoffbrücke mit Glu144 der anderen Untereinheit verknüpft
ist, weniger beeinträchtigt als diejenigen, die nur an den Positionen 140 und 141 mutiert sind. Allerdings kennen wir die Struktur des freien Enzyms nicht in einem ähnlichen Detail. Es ist sehr wohl möglich, daß ohne eine Stabilisierung durch die gebundene Erkennungssequenz verschiedene Konformationen möglich sind, bei denen
auch die nicht mehr Basen-gebundenen Aminosäuren für einen Monomer-MonomerKontakt wichtig sind.
Der Monomer-Dimer-Status ist weiterhin wichtig für die DNA-Bindungsfähigkeit und
100
Diskussion
die katalytische Aktivität der Mutanten. Mutanten mit größeren Anteilen an Monomeren zeigten nur das Ausmaß an spezifischer Doppelstrangspaltung, das dem Anteil
an Enzymdimeren entsprach [Vennekohl, 1996]. Die DNA-Bindungsfähigkeit war
gleichermaßen an den dimeren Zustand geknüpft, so daß zum Beispiel für die
Mutante L158D, die in dieser Arbeit als Vergleich in der Gelfiltration eingesetzt
wurde, keine DNA-Bindung detektierbar war. Für die Messung der Affinität der
Mutanten für DNA wurde hier der Gelretardationsassay eingesetzt, weil darin im Gegensatz zur Nitrozellulosefilterbindung als zusätzliche Information die Art des Komplexes an den Laufeigenschaften zu erkennen ist. So führt eine sequenzspezifische
Bindung zu einem definierten Komplex, während sequenzunspezifische Bindung in
der Regel zu verschiedenen Komplexen mit 1, 2, 3... gebundenen Enzymdimeren
führt, die im Gel unterschieden werden können. Das Standardsubstrat für diesen
Assay in der Arbeitsgruppe ist ein 174Bp PCR-Produkt mit einer zentralen GAATTCSequenz. Man kann nicht unbedingt erwarten, daß es auch für die untersuchten
Mutanten eine spezifische Sequenz bereithält. So ist zum Beispiel keine GGATCCSequenz vorhanden. Demgemäß wurde auch für die G140A/N141S-Mutante der Ansatz einer Leiter von Banden und damit eine unspezifische Bindung gefunden. Für
die G140A/N141A-Mutante reichten die eingebrachten Konzentrationen nicht für die
Detektion einer Bindung aus.
Das Verhalten der G140S/R145K und der G140S/N141S/R145K-Mutanten ist noch
schwerer zu deuten, weil sie zwar eine Retardation des Shiftsubstrates verursachen,
aber nicht zu definierten Banden führten. Eine mögliche Erklärung ist, daß diese Enzyme zwar an die DNA binden, diese Komplexe aber während der Elektrophorese
nicht stabil sind, sondern das Shiftsubstrat sukzessive verlieren. So kommt es zu
einem Schmier zwischen der Wanderungsposition der freien DNA und der Position
des Komplexes mit dem höchsten Molekulargewicht, der nach den Gelen bei etwa
sechs Enzymdimeren auf einem DNA-Substrat liegt. Die als Shiftsubstrate getesteten
Oligonukleotide, mit denen aufgrund ihrer geringen Größe nur ein Bindungskomplex
gebildet werden kann, zeigen, daß weder die GAATTC- noch die GGATCC-Sequenz
gebunden werden. Daß mit diesen Substraten, die ja in 10fach höherer molarer Konzentration eingesetzt wurden, im Gegensatz zum längeren 174Bp-Shiftsubstrat keine
Bindung zu sehen war, ist nicht verwunderlich, da letzteres für eine unspezifische
Diskussion
101
Bindung bei einer Bedeckungslänge von gut 10Bp etwa 160 unspezifische Bindungsstellen und damit dann doch wieder eine höhere Konzentration von ihnen bereitstellt. Allerdings gab es die Möglichkeit, daß die modifizierten Oligonukleotide eine
sequenzspezifische Bindung ermöglichen würden. Eine solche Bindung war aber
nicht detektierbar.
Als typischer Test hinsichtlich der katalytischen Aktivität wurde den Enzymen λ-DNA
(48,5kBp) als Substrat zur Verfügung gestellt, auf welcher nur wenige Restriktionsenzyme ihre spezifische Sequenz nicht finden. Weiterhin wurden Kinetiken mit nicht
methylierter λ-DNA (dam-, dcm-) durchgeführt. Die dam-Methylierung dient in E.coliZellen der gerichteten Mismatch-Reparatur nach der Replikation und auch der Kontrolle des Replikationsstartes. Bei der palindromen Sequenz GATC erfolgt die Methylierung am Adenin. Diese Sequenz entspricht dem Zentrum der BamHI-Erkennungssequenz, so daß die Methylierung vor einer BamHI-Spaltung schützt.
Bei beiden DNA-Typen als Substrat kam es bei den Mutanten mit dem Hexahistidintag zu einem unspezifischen Abbau der DNA, ohne daß ein spezifisches Bandenmuster erkennbar gewesen wäre. Das kann unter anderem in der unsauberen Qualität dieser Enzyme begründet liegen.
Spaltaktivitäten der StrepTag II-Mutanten wurden nur mit unmethylierter λ-DNA als
Substrat getestet. Auch hier wurde ein unspezifischer Abbau beobachtet, wenn auch
nicht in so starkem Ausmaß wie bei den Hexahistidin-Mutanten. Bei den Mutanten
G140S/R145KStrepII und G140S/N141S/R145KStrepII trat zum ersten Mal ein transientes Bandenmuster auf, welches allerdings durch den unspezifischen Abbau überlagert wurde. Verunreinigungen mit unspezifischer Nuklease sind zwar nicht ungewöhnlich, stören normalerweise aber nicht, da die spezifische Spaltaktivität früher
einsetzen sollte als ein unspezifischer Abbau durch Nukleasen. Bei den hier vorgestellten Enzymen kommt es aufgrund ihrer stark eingeschränkten Spaltaktivität zu
einer sehr starken Konkurrenzsituation zwischen unspezifischer und spezifischer
Spaltung.
Bei den Mutanten G140A/N141A und G140A/N141S liegt ein erhöhter Monomeranteil vor, was sich in einem unspezifischen DNA-Abbau durch die Enzyme selbst
äußern könnte. Für Mutanten mit stark beeinträchtigter Dimerisierungsfähigkeit
wurde nachgewiesen, daß sie selber Einzelstrangspaltungen mit nicht detektierbarer
102
Diskussion
Sequenzspezifität durchführen [Vennekohl, 1999]. Sie verhalten sich also so, als ob
ihr katalytisches Zentrum ohne eine Kopplung an eine Sequenzerkennung aktiv
würde. Diese „Nicking“-Aktivität wird nur durch die geringe Affinität für DNA gezügelt.
Es ist also nicht auszuschließen, daß ein Teil des unspezifischen Abbaus der DNA
auf den Mutanten selbst beruht.
G140S/R145K und G140S/N141S/R145K zeigen zwar ein vor dem Hintergrund des
unspezifischen Abbaus kurzzeitig auftretendes Bandenmuster, dieses ist jedoch nicht
analog zu dem des Wildtypenzyms und läßt sich nicht definierten Bandengrößen zuordnen. Es ist auch nicht klar, ob dieses Muster der vollständigen Spaltung oder nur
einer Partialspaltung zuzuordnen ist. Immerhin ist das Angebot an unspezifischen
Sequenzen in einem so langen Substrat so groß, daß ein derart inaktives Enzym wie
diese Mutanten Schwierigkeiten hat, eine spezifische Sequenz zu finden. Aus diesem Grund wurden Spaltungen mit kürzeren DNA-Sequenzen durchgeführt (Oligonukleotide). Die Spaltaktivität wurde mit den verschiedenen Oligonukleotiden (siehe
Tabelle 3.7) und allen Mutanten getestet. Bei den modifizierten Oligonukleotiden
wurde Thymin durch Uracil und/oder Adenin durch Inosin substituiert. Die Erwartungen an eine Uracilsubstitution bestand darin, bei einem Aminosäureaustausch an
Position 140 mehr Raum zu schaffen für längere Seitenketten. Im Fall des Inosins
besteht ein potentieller Kontaktpunkt an Position 141 für das Serin, welches Wasserstoffbrückenbindung sowohl geben als auch empfangen kann. Die Kombination beider Austausche beeinhaltet beide Effekte. Als weiteres Substrat wurde die BamHISequenz angeboten.
Keines der getesteten Oligonukleotide wurde von den Mutanten gespalten. Beim
Wildtypenzym trat eine residuelle Aktivität auf dem Uracil-substituierten Oligonukleotid auf, beschrieben wurde dieses schon früher [Jeltsch et al., 1993]. Zusammenfassend sprechen die hier angeführten Ergebnisse hinsichtlich der katalytischen Aktivität der Mutanten dafür, daß es sich bei dem Bandenmuster der Mutanten
G140S/R145K und G140S/N141S/R145K auf λ-DNA weder um ein EcoRI-spezifisches noch um ein BamHI-spezifisches Spaltmuster handeln kann. Es muß eine
neue Spaltaktivität entstanden sein, die von unspezifischer Spaltung maskiert wird
und nur geringe Aktivität besitzt, so daß mit den bis jetzt getesteten Bedingungen
keine eindeutige Aussage gemacht werden kann, an welcher Position diese Katalyse
Diskussion
103
stattfindet.
Dieses Ergebnis mag auf den ersten Blick enttäuschend erscheinen. Es ist aber tatsächlich ein großer Schritt vorwärts, da es bisher nicht gelungen ist, irgendein Restriktionsenzym in seiner Sequenzspezifität so zu verändern, daß eine veränderte
natürliche DNA-Sequenz gespalten wurde. Die meisten Mutanten spalten mit zum
Teil drastisch verringerter Aktivität die kanonische Sequenz. So konnte von der PvuII
eine Mutante generiert werden, die eine starke Bindung zu der degenerierten Sequenz CANNTG zeigte, aber auch nur in der spezifischen Erkennungssequenz
CAGCTG spalten konnte [Nastri et al., 1997].
Eine bevorzugte Spaltung synthetischer DNA-Sequenzen mit unnatürlichen Basen
wie zum Beispiel Uracil [Lanio et al., 1996; Küster, 1998] war das bisher beste Ergebnis einer Spezifitätsänderung.
Dies zeigt, daß neben der direkten Basenerkennung noch weitere Faktoren eine
Rolle für die Sequenzspezifität der Restriktionsenzyme spielen. Bei der EcoRI sind
das im Wesentlichen vier Faktoren, die bei der Planung der hier vorgestellten Mutanten erst einmal bewußt außer Acht gelassen wurden.
1. Die Erkennungssequenz wird von dem Enzym so deformiert, daß die große Furche für die Kontaktaufnahme mit den Basen aufgeweitet wird. Dazu sind Phosphatkontakte direkt neben und genau in der Mitte der Erkennungssequenz wichtig
[Kurpiewski et al, 1996]. Dabei wird die Stapelwechselwirkung zwischen den zentralen AT-Basenpaaren teilweise aufgehoben und diese erscheinen zum nächstäußeren AT-Basenpaar gekippt. Diese Stellung wird durch eine Dreizentren-Wasserstoffbrücke stabilisiert, die so nur in der Sequenz AATT möglich erscheint. Der
Beitrag der DNA-Feinstruktur und ihrer Flexibilität auf eine so intensive Interaktion
mit einem Protein ist noch weitgehend unerforscht. So kann nicht vorhergesagt
werden, ob zum Beispiel die in dieser Arbeit angestrebte innere Erkennungssequenz GATC den Anforderungen der Deformierbarkeit durch eine EcoRI-Mutante
genügen kann.
2. Die Bedeutung der Phosphatkontakte für die Sequenzerkennung und ihre Wechselwirkung mit den Basenkontakten ist auch noch wenig untersucht. Immerhin
sind die Phosphodiesterbindungen des äußeren AT-Basenpaares, dessen Kontakte in dieser Arbeit verändert wurden, direkt (GpA wird gespalten) oder indirekt
104
Diskussion
(ApA aktiviert das angreifende Nukleophil) in die Katalyse involviert. Die R145KMutation betrifft auch den Kontakt zum zu spaltenden Phosphat, allerdings ohne
daß diese Einzelmutation die Katalyse zu stark beeinträchtigen würde (die
R145K-Mutante hat eine nur 50fach verringerte Aktivität [Wolfes et al., 1986]). Die
Lysinreste 117 und 130, die den Phosphodiesterbindungen zwischen den Pyrimidinen der Erkennungssequenz nahe kommen, konnten beide mit nur geringem
Aktivitätsverlust gegen Glutamatreste ausgetauscht werden [Windolph et al.,
1997; Rosati, 1999]. So scheint dieser Beitrag nicht so kritisch für den Kontakt
des Enzyms zur DNA zu sein.
3. Aufgrund der Kürze der Erkennungsequenz sind die Basenkontakte alle auf engem Raum lokalisiert und durch direkte oder Wasser-vermittelte Kontakte untereinander verzahnt. Eine gegenseitige Beeinflussung ist deshalb zu erwarten.
Allerdings darf die Möglichkeit einer Adaption an die geänderte Struktur nicht
außer Acht gelassen werden.
4. Die Kopplung der Spaltung an die Bindung einer DNA-Sequenz stellt die größte
Hürde für die Generierung einer neuen Spezifität eines Restriktionsenzyms dar.
Sie ist der wichtigste Faktor für ihre hohe Genauigkeit. So werden abweichende
Sequenzen zum Teil gebunden aber nur sehr langsam oder gar nicht gespalten
[Thielking et al., 1990; Lesser et al., 1990]. Die Spaltung ist dann auch nicht mehr
konzertiert in beiden Einzelsträngen, sondern ein Einzelstrang wird deutlich vor
dem anderen gespalten, so daß eine Dissoziation des Enzyms von dieser Sequenz vor der Spaltung des zweiten Stranges wahrscheinlich ist. In vivo gibt das
Anlaß für eine einfache Reparatur solch fehlerhafter Ereignisse durch die DNALigase [Taylor et al., 1990]. Diese strikte Kopplung ist molekular noch wenig verstanden. Gln115, das im gleichen Faltblattstrang neben den Aminosäuren des
katalytischen Zentrums steht (Glu111, Lys113), spielt dadurch eine wichtige
Rolle, daß es Wasserstoffbrückenbindungen zu Peptidbindungen in der Extended
chain ausbildet [Jeltsch et al., 1993]. Gleichzeitig macht es aber auch einen hydrophoben Kontakt zum inneren Thymin. Weitere Faktoren müssen für die Kopplung eine Rolle spielen, da in den asymetrischen Starsequenzen das katalytische
Zentrum der Untereinheit zuerst spaltet, die weniger Kontakte zu dieser Sequenz
ausbilden kann [Thielking et al., 1990]. Das setzt eine Kopplung zwischen den
Diskussion
105
beiden Untereinheiten voraus, die unabhängig von Gln115 sein sollte. Außerdem
waren in einem heterodimeren Enzym aus einer Wildtypuntereinheit und einer im
katalytischen Zentrum inaktivierten Mutante beide Untereinheiten katalytisch inaktiv [Vennekohl, 1999]. Wie stark sich die Beeinträchtigung von Basenkontakten
auf die Kopplung an die DNA-Spaltung auswirkt, ist deshalb nur schwer vorherzusagen. Allerdings kann man erwarten, daß kürzere Aminosäureseitenketten
eher die Möglichkeit haben, sich strukturellen Anforderungen anzupassen, vor
allem wenn so wie bei den hier untersuchten Mutanten mehrere Austausche
nebeneinander durchgeführt werden.
Insofern ist es sehr positiv, daß für die G140S/N141S/R145K-Mutante eine, wenn
auch sehr schwache Spaltaktivität detektierbar war. Sie zeigt, daß eine Spezifitätsänderung der EcoRI überhaupt möglich ist. Hauptteil anschließender Experimente
muß sein, die Spaltaktivität zu steigern. So wurden EcoRI-Mutanten beschrieben,
welche die Stringenz der Kopplung mindern und so zu einer Aktivierung des Enzyms
führen [Heitman et al., 1990]. Solche Mutationen führen auch im Kontext mit Mutationen von Basenkontakten zu einer Steigerung der Spaltaktivität [Küster, 1998].
Außerdem ist es möglich, die hier beschriebenen Kombinationen von Mutationen in
den Kontext eines heterodimeren Enzyms so zu überführen, daß nur eine Halbseite
der Erkennungssequenz betroffen ist. Das wäre zum Beispiel die Kombination einer
Untereinheit einer G140S/N141S-Doppelmutante mit einer Untereinheit einer R145KEinzelmutante [Vennekohl, 1999]. Das könnte die Beeinträchtigung der katalytischen
Aktivität mildern, da dann nur die Hälfte der Kontakte verändert wären. So wurde mit
den in dieser Arbeit untersuchten Mutanten die Grundlage geschaffen, die
Veränderbarkeit der DNA-Erkennung durch die Restriktionsendonuklease EcoRI
weiter zu untersuchen und zu Enzymen zu kommen, die auch im Routinelaborbetrieb
einsetzbar sind.
106
5
Zusammenfassung
ZUSAMMENFASSUNG
Die Restriktionsendonuklease EcoRI erkennt spezifisch die DNA Sequenz GAATTC
über ein sehr komplexes und redundantes Netzwerk von Wasserstoffbrückenbindungen, ionischen und van der Waals-Kontakten. Innerhalb dieses Netzwerkes bilden
Gly140, Asn141 und Arg145 Kontakte zum äußeren A/T Basenpaar. Um eine Spezifitätsänderung des Enzyms in Richtung eines G/C Basenpaars herbeizuführen, was
in der Erkennung der BamHI Sequenz GGATCC resultieren würde, wurden vier
Mutanten erzeugt: die Doppelmutanten G140A/N141A, G140A/N141S und
G140S/R145K sowie die Tripelmutante G140S/N141S/R145K. Diese Aminosäureaustausche erscheinen geeignet, ein G/C-Basenpaar gegenüber einem A/T-Basenpaar zu bevorzugen.
Nach zielgerichteter Mutagenese wurden die beschriebenen Mutanten mit einem Hexahistidintag für die Affinitätschromatographie aufgereinigt. Es konnte jedoch keine
saubere Aufreinigung erzielt werden, was in einer strukturellen Instabilität der
Mutanten begründet liegt.
Durch die Zugabe von Kalzium während des Aufreinigungsverfahren konnte zwar
eine verbesserte Stabilität der Mutanten beobachtet werden, es kam jedoch zur Aggregation der aufgereinigten Enzyme. Aus diesem Grund erfolgte eine Umklonierung
in das StrepTag II-System, das eine nahezu homogene Aufreinigung ermöglichte.
Die Stabilisierung strukturell beeinträchtigter Mutanten durch Kalzium-Zugabe während des Aufreinigungsprozesses kann als wichtige Errungenschaft dieser Arbeit angesehen werden.
Die aufgereinigten Proteine zeigten nur eine sehr geringe, unspezifische Bindung auf
den bis jetzt getesteten Substraten. Sequenzspezifische DNA-Spaltung konnte nur
für die Mutanten G140S/R145KStrepII und G140S/N141S/R145KStrepII detektiert werden.
Die Dreifachmutante zeigt auf unmethylierter λ-DNA ein Bandenmuster, welches weder dem normalen oder dem relaxierten Muster der EcoRI noch dem BamHI-Muster
zugeordnet werden kann. Durch die sehr geringe Spaltaktivität verbunden mit einer
Kontamination mit unspezifischer Nuklease, läßt sich keine eindeutige Aussage über
die gespaltene Sequenz machen. Um eine Restspaltaktivität der Mutanten zu finden,
wurden kurze Oligonukleotide mit der EcoRI-Sequenz und Modifikationen davon (am
äußeren A/T Basenpaar zu Inosin, Uracil sowie zu beiden) als Substrat eingesetzt.
Weiterhin wurde die BamHI-Erkennungssequenz getestet. Auch unter verschiedenen
Pufferbedingungen konnte bei keinem der Oligonukleotidsubstrate eine Spaltung
durch die Mutanten beobachtet werden.
Daraus folgt, daß die Mutante G140S/N141S/R145K eine andere, bis jetzt noch nicht
identifizierte DNA Sequenz erkennt und spaltet, was als vielversprechender Ausgangspunkt für weitere Untersuchungen in der Zukunft angesehen werden kann.
Summary
6
107
SUMMARY
Daniela Gerschon
Proteindesign in order to change the sequence specifity of the restriction endonuclease EcoRI
The restriction endonuclease EcoRI recognizes very specifically the DNA sequence
GAATTC via a highly complex and redundant network of hydrogen bonds, ionic and
van der Waals contacts. Within this network Gly140, Asn141 and Arg145 contact the
outer A/T basepair. To change the specifity of the enzyme towards a G/C basepair
resulting in the recognition of a BamHI canonical sequence GGATCC, four mutants
were created: the double mutants G140A/N141A, G140A/N141S and G140S/R145K
as well as the triple mutant G140S/N141S/R145K. These amino acid exchanges are
likely to favour a G/C basepair above an A/T basepair.
After site directed mutagenesis the described mutants have been expressed with a
hexahistidine tag to perform affinity chromatography. Unfortunately structural instability led to a poor yield of mutant proteins that could not be purified without contamination. Addition of calcium ions to purification buffers increased their stability but the
purified proteins tended to aggregate. Therefore the StrepTag II has been cloned to
the mutants allowing an effective purification almost to homogeneity. Stabilisation of
structurally impaired mutants by calcium ions in the stage of purification is a major
achievement of this work.
The purified proteins showed only a weak DNA binding ability which appear to be
without sequence preference on the substrates used so far. Sequence specific DNA
cleavage could only be detected for the mutants G140S/R145KStrepII and
G140S/N141S/R145KStrepII. The triple mutant cuts unmethylated λ DNA with a unique
cleavage pattern that resembles neither an EcoRI canonical or star pattern nor a
BamHI pattern. The very low cleavage activity together with a contamination by an
unspecific nuclease prevents the identification of the sequences cleaved. In order to
detect a residual cleavage activity, short oligonucleotides comprising the EcoRI recognition site and sequences modified at the outer A/T basepair to inosine, uracil or
both were used as a substrate. In addition the BamHI canonical site was tested.
None of the oligonucleotide substrates has been cleaved by the mutants under varied buffer conditions.
Therefore the triple mutant G140S/N141S/R145K have to recognize and cut an entirely different DNA sequence, which has not been identified yet. It is a very promising
starting point for further investigations.
108
7
Literaturverzeichnis
LITERATURVERZEICHNIS
Alves, J., Pingoud, A., Langowski, J., Urbanke, C., and Maass, G. (1982)
Two identical subunits of the EcoRI restriction endonuclease co-operate in the binding and cleavage of the palindromic substrate
Eur. J. Biochem. 124, 139-142
Alves, J., Rüter, T., Fliess, A., Maass, G., and Pingoud, A. (1989a)
Changing the hydrogen bonding potential in the DNA binding site of EcoRI by site
directed mutagenesis drastically reduces the enzymatic activity, not however, the
preference of this restriction endonuclease for cleavage within the site -GAATTCBiochemistry 28, 2678-2684
Alves, J., Urbanke, C., Fliess, A., Maass, G., and Pingoud, A. (1989b)
Fluorescence stopped-flow kinetics of the cleavage of synthetic oligodeoxynucleotides by the EcoRI restriction endonuclease
Biochemistry 28, 7879-7888
Anderson, J.E. (1993)
Restriction endonucleases and modification methylases
Curr. Opin. Struct. Biol. 3, 24-30
Athanasiadis, A., Vlassi, M., Kotsfaki, D., Tucker, P.A. Wilson, K.S. and Kokkinids, M.
(1994)
Crystal structure of PvuII endonuclease reveals extensive structural homologies to
EcoRV
Nat. Struct. Biol. 1, 469-475
Barettino, D., Feigenbutz, M., Valcarcel, R., and Stunnenberg, H.G. (1994)
Improved method for PCR-mediated site-directed mutagenesis
Nucleic Acids Res. 22, 541
Bickle, T.A. (1993)
The ATP-dependent restriction enzymes in Nucleases
(Linn, S.M., Lloyd, R.S., Roberts, R.J., Eds): 89, Cold Spring Harbor, New York
Botterman, J. and Zabeau, M. (1985)
High level production of the EcoRI endonuclease under the control of the PL-promotor of bacteriophage λ
Gene 37, 229-239
Bozic, D., Grazullis, S., Siksnys, V. & Huber, R. (1996)
Crystal structure of Citrobacter freundii restriction endonuclease Cfr10I at 2.15Å
resolution
J. Mol. Biol. 255, 176-186
Literaturverzeichnis
109
Chen, Y.H., Yang, J.T., and Martinez, H.M. (1972)
Determination of secondary structure of proteins by circular dichroism and optical
rotatory dispersion
Biochemistry 22, 4120-4131
Cheng, X. (1995)
Structure and function of DNA methyltransferases
Annu. Rev. Biophys. Biomol. Struct. 24, 293-318
Connolly, B.A., Eckstein, F., and Pingoud, A. (1984)
The stereochemical course of the restriction endonuclease EcoRI catalyzed reaction
J. Biol. Chem. 259, 10760-10763
Deibert, M., Grazulis, S., Janulaitis, A., Siksnys, V., and Huber, R. (1999)
Crystal structure of MunI restriction endonuclease in complex with cognate DNA at
1.7 Å resolution
EMBO J. 18, 5805-5816
Drew, H.R., Wing, R.M., Takano, T., Broka, C., Tanaka, S., Itakura, K., and Dickerson, R.E. (1981)
Structure of a B-DNA Dodecamer: Conformation and Dynamics
Proc. Natl. Acad. Sci. USA 78, 2179-2183
Ehbrecht, H.-J., Pingoud, A., Urbanke, C., Maass, G., and Gualerzi, C. (1985)
Linear diffusion of restriction endonucleases on DNA
J. Biol. Chem. 260, 6160-6166
Flores, H., Osuna, J., Heitman, J., and Soberón, X. (1995)
Saturation mutagenesis of His114 od EcoRI reveals relaxed-specificity mutants
Gene 157, 295-301
Fritz, A., Küster, W., and Alves, J. (1998)
Asn141 is essential for DNA recognition by EcoRI restriction endonuclease
FEBS Letters. 438, 66-70
Geiger, R., Rüter, T., Alves, J., Fliess, A., Wolfes, H., Pingoud, V., Urbanke, C.,
Maass, G., Pingoud, A., Düsterhöft, A., and Kröger, M. (1989)
Genetic engineering of EcoRI mutants with altered amino acid residues in the DNA
binding site. Physico-chemical investigations give evidence for an altered monomer/dimer equilibrium for the Gln144Lys145 and Gln144Lys200 mutants
Biochemistry 28, 2667-2677
Goodman, H.M., Greene, P.J., Garfin, D.E., and Boyer, H.W. (1978)
DNA site recognition by the EcoRI restriction endonuclease and modification methylase
in Nucleic acid - protein recognition (Vogel, H., J., Ed), Academic Press, New York,
239-259
110
Literaturverzeichnis
Grabowski, G. (1993)
Charakterisierung des aktiven Zentrums der Restriktionsendonuklease EcoRI mithilfe
zielgerichtet hergestellter Mutanten
Diplomarbeit, Universität Hannover
Grabowski, G., Jeltsch, J., Wolfes, H., Maass, G., and Alves, J. (1995)
Site-directed mutagenesis on the catalytic center of the restriction endonuclease
EcoRI
Gene 157, 113-118
Grabowski, G., Maass, G., and Alves, J. (1996)
Asp-59 is not important for the catalytic activity of the restriction endonuclease EcoRI
FEBS Lett. 381, 106-110
Greene, P.J., Gupta, M., Boyer, H.W., Brown, W.E., and Rosenberg, J.M. (1981)
Sequence analysis of the DNA encoding the EcoRI restriction endonuclease and
methylase
J. Biol. Chem. 256, 2143-2153
Hanahan, D. (1983)
Studies on transformation of Escherichia coli with plasmids
J. Mol. Biol. 166, 557-580
Heitman, J. and Model, P. (1990)
Mutants of the EcoRI endonuclease with promiscuos substrate specifity implicate
residues involved in substrate recognition
EMBO. J. 9, 3369-3378
Heitman, J. (1992)
How the EcoRI Endonuclease recognizes and cleaves DNA
BioEssays 14, 445-454
Heitman, J. (1993)
On the origins, structures and functions of restriction-modification enzymes
in Genetic engineering, Principles and Methods (Setlow, J.K., Ed.) 15, Plenum Press,
New York, 57-108
Hochuli, E. (1990)
Purification of recombinant proteins with metal chelate absorbents
in Genetic Engineering, Principles and Methods (Setlow, J.K., Ed.) 12, Plenum
Press, New York, 87-98
Hsu, M. and Berg, P. (1978)
Altering the specificity of restriction endonuclease: Effect of replacing Mg2+ with Mn2+
Biochemistry 17, 131-138
Literaturverzeichnis
111
Huai, Q., Colandene, J.D., Chen, Y., Luo, F., Zhao, Y., Topal, M.D., and Ke, H.
(2000)
Crystal structure of NaeI-an evolutionary bridge between DNA endonuclease and
topoisomerase
EMBO J. 19, 3110-3118
Janulaitis A., Petrusyte M., Timinskas A., Klimasauskas S., and Butkus V. (1992)
Purification and properties of the Eco571 restriction endonuclease and methylase-Prototypes of a new class (type IV)
Nucl. Acids Res. 20, 6043-6049
Jeltsch, A., Alves, A., Maass, G., and Pingoud, A. (1992)
On the catalytic mechanism of EcoRI and EcoRV
FEBS Letters 304, 4-8
Jeltsch, A., Alves, J., Oelschläger, T., Wolfes, H., Maass, G., and Pingoud, A.
(1993a)
Mutational analysis of the function of Gln115 in the EcoRI restriction endonuclease, a
critical amino acid for recognition of the inner thymidine residue in the sequence GAATTC- and for coupling specific DNA binding to catalysis
J. Mol. Biol. 229, 221-234
Jeltsch, A., Alves, J., Wolfes, H., Maass, G., and Pingoud, A. (1993b)
Substrate-assisted catalysis in the cleavage of DNA by the EcoRI and EcoRV restriction enzymes
Biochemistry 90, 8499-8503
Jeltsch, A., Alves, J., Wolfes, H., Maass, G., and Pingoud, A. (1994)
Pausing of the restriction endonuclease EcoRI during linear diffusion on DNA
Biochemistry 33, 10215-10219
Jeltsch, A., Alves, J., Urbanke, C., Maass, G., Eckstein, H., Lianshan, Z., Bayer, E.,
and Pingoud, A. (1995)
A dodecapeptide comprising the extended chain-α4 region of the restriction endonuclease EcoRI specifically binds to the EcoRI recognition site
J. Biol. Chem. 270, 5122-5129
Jen-Jacobson, L., Engler, L.E., Lesser, D.R., Kurpiewski, M.R., Yee, C., and
McVerry, B. (1996)
Structural adaptions in the inteaction of EcoRI endonuclease with methylated
GAATTC sites
EMBO J. 15, 2870-2882
Jost, J.P. and Saluz, H.P. (1993)
DNA methylation: molecular biology and biological significance
Birkhäuser Verlag, Basel
112
Literaturverzeichnis
Kim, Y., Grable, J.C., Love, R., Greene, P.J., and Rosenberg, J.M. (1990)
Refinement of EcoRI endonuclease crystal structure: A revised protein chain tracing
Science 249, 1307-1309
King, K., Benkovic, S.J., and Modrich, P. (1989)
Glu-111 is required for activation of the DNA cleavage of EcoRI endonuclease
J. Biol. Chem. 264, 11807-11815
Kong, H., Morgan, R.D., Maunus, R.E., and Schildkraut, I. (1993)
A unique restriction endonuclease, BcgI, from Bacillus coagulans
Nucl. Acids Res. 21, 987-991
Kostrewa, D. and Winkler, F.K. (1995)
Mg2+ binding to the active site of EcoRV endonuclease: A crystallographic study of
complexes with substrate and product DNA at 2Å resolution
Biochemistry 34, 683-696
Kramer, W., Drutsa, V., Jansen, H.W., Kramer, B., and Fritz, H.J. (1984)
The gapped-duplex DNA approach to oligonucleotide-directed mutation construction
Nucl. Acids Res. 12, 9441-9456
Krüger, D.H., Kupper, D., Meisel, A., Reuter, M., and Schroeder, C. (1995)
The significance of distance and orientation of restriction endonuclease recognition
sites in viral DNA genomes
FEMS Microbiol. Rev. 17, 177-184
Kurpiewski, M.R., Koziolkiewicz, M., Wilk, A., Stec, W.J., and Jen-Jacobson, L.
(1996)
Chiral phosphorothioates as probes of protein interactions with individual DNA phosphoryl oxygens: Essential interactions of EcoRI endonuclease with the phosphate at
pGAATTC
Biochemistry 35, 8846-8854
Küster, W. (1998)
Bedeutung hydrophober Kontakte für die sequenzspezifische DNA-Erkennung der
Restriktionsendonuklease EcoRI
Dissertation, Universität Hannover
Laemmli, U.K. (1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4
Nature 227, 680-685
Langowski, J., Urbanke, C., Pingoud, A., and Maass, G. (1981)
Transient cleavage kinetics of the EcoRI restriction endonuclease measured in a
pulsed quench-flow apparatus: Enzyme concentration-dependent activity change
Nucl. Acids Res. 9, 3483-3490
Literaturverzeichnis
113
Lanio, T., Selent, U., Wenz, C., Wende, W., Schulz, A., Adiray, M., Katti, S.B., and
Pingoud, A. (1996)
EcoRV-T94V: a mutant restriction endonuclease with an alterd substrate specifity
towards modified oligonucleotides
Protein Eng. 9, 1005-1010
Lesser, D. R., Kurpiewski, M. R., and Jen-Jacobson, L. (1990)
The energetic basis of specificity in the EcoRI endonuclease-DNA interaction
Science 250, 776-786
Luke, P.A. and Halford, S.E. (1985)
Solubility of the EcoRI restriction endonuklease and its purification from an overproducing strain
Gene 37, 241-246
Luria, S.E. and Human, M.L. (1952)
A nonhereditary, host-induced variation of bacterial viruses
J. Bacteriol. 64, 557-569
McClarin, J.A., Frederick, C.A., Wang, B.-C., Greene, P., Boyer, H.W., Grable, J.,
and Rosenberg, J.M. (1986)
Structure of the DNA-EcoRI endonuclease recognition complex at 3Å resolution
Science 234, 1526-1541
McClelland, M., Nelson, M., and Raschke, E. (1994)
Effect of site-specific modification on restriction endonucleases and DNA modification
methyltransferases
Nucl. Acids Res. 22, 3640-3659
Meisel, A., Mackeldanz, P., Bickle, T.A., Krüger, D.H., and Schroeder, C. (1995)
Type III restriction endonucleases translocate DNA in a reaction driven by recognition
site-specific ATP hydrolysis
EMBO J. 14, 2958-2966
Modrich, P. and Zabel, D. (1976)
EcoRI endonuclease physical and catalytic properties of the homogenous enzyme
J. Biol. Chem. 256, 5866-5874
Mullis, K. and Faloona, F. (1987)
Specific synthesis of DNA in vitro via a polymerase chain reaction
Methods Enzymology 155, 335-350
Murray, N.E. (2000)
Type I Restriction Systems: Sophisticated Molecular Machines (a Legacy of Bertani
and Weigle)
Microbiol. Mol. Biol. Rev. 64, 412-434
114
Literaturverzeichnis
Nastri, H.G., Evans, P.D., Walker, I.H., and Riggs, P.D. (1997)
Catalytic and DNA binding properties of PvuII restriction endonuclease mutants
J. Biol. Chem. 272, 25761-25767
Needles, M.C., Fried, S.R., Love, R., Rosenberg, J.M., Boyer, H.W., and Greene,
P.J. (1989)
Determinants of EcoRI endonuclease sequence discrimination
Proc. Natl. Acad. Sci. USA 86, 3579-3583
Newman, A.K., Rubin, R.A., Kim, S.H., and Modrich, P. (1981)
DNA sequences of structural genes for EcoRI DNA restriction and modification enzymes
J. Biol. Chem. 256, 2131-2139
Newman, M., Strzelecka, T., Dorner, L., Schildkraut, I., and Aggarwal, A.K. (1995)
Structure of BamHI endonuclease bound to DNA: partial folding and unfolding on
DNA binding
Science 269, 656-663
Newman, M., Lunnen, K., Wilson, G., Greci, J., Schildkraut, I., and Phillips, E.V.
(1998)
Crystal structure of restriction endonuclease BglI bound to its interrupted DNA recognition sequence
EMBO J. 17, 5466-5476
Osuna, J., Flores, H., and Soberon, X. (1991)
Combinatorial mutagenesis of three major groove-contacting residues of EcoRI: single and double amino acid replacements retaining methyltransferase-sensitive activities
Gene 106, 7-12
Peters, F. and Greipel, J. (1993)
“Computerprogramm Circular”
Handbuch der Biophysikalischen Meßgeräteabteilung, Medizinischen Hochschule
Hannover
Pouwels, P.H., Enger-Valk, B.E., and Brammar, W.J. (1985)
Cloning Vectors
Pingoud, A. and Jeltsch, A. (1997)
Recognition and cleavage of DNA by type II restriction endonucleases
Eur. J. Biochem. 246, 1-22
Polisky, B., Greene, P., Garfin, D.E., McCarthy, B.J., Goodman, H.M., and Boyer,
H.W. (1975)
Specificity of substrate recognition by the EcoRI restriction endonuclease
Proc. Natl. Acad. Sci. USA 72, 3310-3314
Literaturverzeichnis
115
Pouwels, P.H., Enger-Valk, B.E., and Brammar, W.J. (1989)
Cloning Vectors: A Laboratory Manual
Elsevier Science Ltd, Amsterdam
Rosati, O. (1999)
Untersuchung und Design von DNA-Kontakten der Restriktionsendonuklease EcoRI
inner- und außerhalb der Erkennungssequenz
Dissertation, Universität Hannover
Rinkel, L.J., Van der Marel, G.A., Van Boom, J.H., and Altona, C. (1987)
Influence of N6-methylation of residue A(5) on the conformational behaviour of d(CC-G-A-A-T-T-C-G-G) in solution studied by 1H-NMR spectroscopy, 1. The duplex
form
Eur. J. Biochem. 163, 275-286
Rosenberg, J.M. (1991)
Structure and function of restriction endonucleases
Curr. Op. Struct. Biol. 1, 104-113
Rossman, M.G., Lilfas, A., Branden, C.L., and Banszak, L.J. (1975)
Evolutionary and structural relationships among dehydrogenases
in The Enzymes (Boyer, P., Ed.), 61-75
Rotzal, L.-U. (1992)
Molekulargenetische Konstruktion, Aufreinigung und biochemische Charaktrisierung
des EcoRI-His6 Fusionsproteins
Diplomarbeit, Universität Hannover
Sanger, F., Nicklen, S., and Coulson, A.R. (1977)
DNA sequencing with chain-terminating inhibitors
Proc. Natl. Acad. Sci. USA 74, 5463-5467
Schmidt, T.G.M., Koepke, J., Frank, R., and Skerra, A. (1996)
Molecular interaction between the strep-tag affinity peptide and its cognate target
streptavidin
J. Mol. Biol. 255, 753-766
Selent, U., Rüter, T., Köhler, E., Liedtke, M., Thielking, V., Alves, J., Oelgeschläger,
T., Wolfes, H., Peters, F., and Pingoud, A. (1992)
A site-directed mutagenesis study to identify amino acid residues involved in the
catalytic function of the restriction endonuclease EcoRV
Biochemistry 31, 4808-4815
Siksnys, V., Timinskas, A., Klimasauskas, S., Butkus, V., and Janullaitis, A. (1995)
Sequence similarity among type II restriction endonucleases, related by their recognized 6-bp target and tetranucleotid-overhang cleavage
Gene 157, 311-314
116
Literaturverzeichnis
Taylor, J.D., Goodall, A.J., Vermote, C.L., and Halford, S.E. (1990)
Fidelity of DNA recognition by the EcoRV restriction/modification system in vivo
Biochemistry 29, 10727-10733
Terry, B.J., Jack, W.E. and Modrich, P. (1985)
Facilitated diffusion during catalysis by EcoRI endonuclease
J. Biol. Chem. 260, 13130-13137
Thielking, V., Alves, J., Fliess, A., Maass, G., and Pingoud, A. (1990)
Accuracy of the EcoRI restriction endonuclease: binding and cleavage studies with
oligodeoxynucleotide substrates containing degenerate recognition sequences
Biochemistry 29, 4681-4692
Vennekohl, P. (1996)
Bedeutung hydrophober Wechselwirkungen für die Stabilisierung der dimeren Restriktionsendonuklease EcoRI
Diplomarbeit, Universität Hannover
Vennekohl, P. (1999)
Bedeutung der Dimerisierung für Spezifität und Katalyse der Restriktionsendonuklease EcoRI
Dissertation, Universität Hannover
Vieira, J. and Messing, J. (1982)
The pUC plasmid, an M13mp7-derived system for insertion mutagenesis and sequencing with universal primers
Gene 19, 259-268
Vipond, I.B. and Halford, S.E. (1995)
Specific DNA recognition by EcoRV restriction endonuclease induced by calcium
ions
Biochemistry 34, 1113-1119
Voss, S. and Skerra, A. (1997)
Mutagenesis of a flexible loop in streptavidin leads to a higher affinity for the Streptag II peptide and improved performance in recombinant protein purification
Protein Eng. 10, 975-982
Wah, D., Hirsch, J.A., Dorner, L.F., Schildkraut, I., and Aggarwal, A.K. (1997)
Structure of the multimodular endonuklease FokI bound to DNA
Nature 388, 97-100
Windolph, S. and Alves, J. (1997)
Influence of divalent cations on inner-arm mutants of restriction endonuclease EcoRI
Eur. J. Biochem. 244, 134-139
Literaturverzeichnis
117
Winkler, F.K., Banner, D.W., Oefner, C., Tsernoglou, D., Brown, R.S., Heathman,
S.P., Bryan, R.K., Martin, P.D., Petratos, K., and Wilson, K.S. (1993)
The crystal structure of EcoRV endonuclease and its complexes with cognate and
non-cognate DNA fragments
EMBO J. 12: 1781-1795
Wolfes, H., Alves, J., Fliess, A., Geiger, R., and Pingoud, A. (1986)
Site directed mutagenesis experiments suggest that Glu111, Glu144 and Arg145 are
essential for endonucleolytic activity of EcoRI
Nucl. Acid Res. 14, 9063-9080
Woodhead, J.L. and Malcolm, A.D.B. (1980)
Non-specific binding of restriction endonuclease EcoRI to DNA
Nucl. Acids Res. 8, 389-402
Woodhead, J.L., Bhave, N., and Malcolm, A.D.B. (1981)
Cation dependence of restriction endonuclease EcoRI-activity
Eur. J. Biochem. 115, 293-296
Wright, D.J., King, K. and Modrich, P. (1989)
The negative charge of Glu-111 is required to activate the cleavage center of EcoRI
endonuclease
J. Biol. Chem. 264, 11816-11821
Yanofsky, S.D., Love, R., McClarin, J.A., Rosenberg, J.M., Boyer, H.W. and Greene,
P.J. (1987)
Clustering of null mutations in the EcoRI endonuclease
Proteins 2, 273-282
DANKSAGUNGEN
Mein Dank gilt
meinem Doktorvater Herrn Prof. Dr. Jürgen Alves für die Möglichkeit, diese Arbeit in
seiner Arbeitsgruppe anfertigen zu können, seine hervorragende Betreuung und
große Hilfsbereitschaft
Frau Prof. Dr. Töpfer-Petersen für die wissenschaftliche Betreuung dieser Arbeit
Frau Dr. Petra Vennekohl für alles, wofür ein Dankeschön an dieser Stelle eigentlich
nicht ausreicht und ihre geduldige Art...“Peeeeetraaa....“
Herrn Dr. Wolfgang Küster für seine Freundschaft und die Hinführung zur
wissenschaftlichen Arbeit...
Frau Urbana Kayßer (Rosi), die mir oft mit Rat und Tat zur Seite stand, für lustige
Stunden im Labor und darüber hinaus....
Herrn Rolf Mull-Grotefend für die technische Assistenz „in letzter Minute“ und die
„netten Pausen“
Herrn Dr. Olaf Rosati für seine Hilfsbereitschaft und Geduld
allen nicht erwähnten Mitgliedern der Abteilungen Biophysikalische Chemie und
Biochemisch-Biophysikalische Verfahren, die durch ein seeeeehr nettes Arbeitsklima
zum Gelingen dieser Arbeit beigetragen haben
den Mitgliedern des Chemikaliencenters für das „Einspringen in der Not“ und die
große Zuneigung, die sie Lisa entgegengebracht haben
meiner Familie und meinen Freunden für ihre Unterstützung in allen Lebenslagen
Herunterladen
Random flashcards
Medizin

5 Karten Sophia Gunkel

Literaturepochen

2 Karten oauth2_google_55780ed8-d9a3-433e-81ef-5cfc413e35b4

Erstellen Lernkarten