Strategien zur Charakterisierung von ausgesuchten Streptomyces

Werbung
was du nicht willst
das man dir tu
das füg auch keinem anderen zu
Strategien zur Charakterisierung von
ausgesuchten Streptomyces lividans
Genen und deren Funktionen
Dissertation
zur Erlangung des akademischen Grades
Doktor der Naturwissenschaften (Dr. rer. nat.)
des Fachbereiches Biologie/Chemie
der Universität Osnabrück
vorgelegt von
Jens Overbeck
September 2006
Dekan:
1. Berichterstatter:
2. Berichterstatter:
Prof. Dr. Karl Altendorf
Prof. Dr. Hildgund Schrempf
PD Dr. Ullrich Keller
Inhaltsverzeichnis
1. EINLEITUNG
2. MATERIALIEN UND METHODEN
I
1-9
11-46
2.1. Chemikalien und Enzyme
2.2. Bakterienstämme, Vektoren, Konstrukte, Phagen und Oligos
2.2.1. Bakterienstämme
2.2.2. Vektorplasmide
2.2.3. Rekombinante Konstrukte
2.2.4. Bakteriophagen (Lambda-Derivate)
2.2.5. Im Rahmen der Arbeit erwähnte Oligos
11
13
13
14
14
19
20
2.3. Protein- und DNA-Standards
2.4. Medien
2.5. Mikrobiologische Methoden
2.5.1. Kulturbedingungen und Stammhaltung von Streptomyceten
2.5.2. Kulturbedingungen und Stammhaltung von Escherichia coli
24
25
30
30
30
2.6. Biochemische Methoden
2.6.1. Gewinnung von His-Tag Proteinen
2.6.1.1. Gewinnung von His-Tag Proteinen (denaturierend)
2.6.1.2. „Native“ Gewinnung von His-Tag Proteinen
2.6.2. Konzentration von Proteinen und Wechsel des Puffers
2.6.3. Gelfiltration
2.6.4. Massenspektrometischer Nachweis von FAD
2.6.5. Bestimmung von Proteinkonzentrationen
2.6.6. Spektrophotometrische Messungen
2.6.7. Bestimmung des FAD/KsuF-Verhältnisses
31
31
31
31
33
33
33
33
33
34
2.7. Elektrophoretische Techniken
2.7.1. Agarose-Gelelektrophorese
2.7.2. SDS Polyacrylamid-Gelelektrophorese (PAGE)
2.7.3. Denaturierende Gelelektrophorese in Schägger/v.Yagow Gelen
2.7.4. Färbung mit Coomassie-Brilliant-Blau
2.7.5.Silbernitratfärbung
2.7.6. Proteintransfer auf Membranen („Semidry-Electro-Blotting“)
34
34
35
35
35
35
36
Inhaltsverzeichnis
II
2.8. Immunologische Nachweismethoden
2.8.1. Immunologischer Nachweis von Proteinen auf Nylonmembranen
(„Western Blot“)
36
2.9. Molekulargenetische Methoden
2.9.1. Aufreinigung von DNA
2.9.1.1. Plasmidisolierung aus E.coli (alkalische Lyse)
2.9.1.2. Plasmidaufreinigung aus E.coli („Quick and dirty“)
2.9.1.3. Plasmidaufreinigung aus E.coli (Ionenaustauscher)
2.9.1.4. Schnelltest zum Nachweis von Plasmiden in E.coli (SCFSB)
2.9.1.5. Aufreinigung von einzelsträngiger Phagen-DNA (M13)
2.9.1.6. Isolierung von Plasmiden aus Streptomyceten
2.9.1.7. Isolierung von chromosomaler DNA aus Streptomyceten
2.9.1.8. Aufreinigung von DNA-Fragmenten aus Agarosegelen
2.9.2. Transformation von Plasmiden
2.9.2.1. Transformation von E.coli (CaCl2-Methode)
2.9.2.2. Transformation von E.coli (Elektroporation)
2.9.2.3. Transformation von Streptomyceten (PEG-Methode)
2.9.2.4. Integration von Genen in das Chromosom von S.lividans
2.9.3. Enzymatische in vitro Reaktionen von DNA
2.9.3.1. Restriktion von DNA
2.9.3.2. Ligation
2.9.3.3. Klenow-Behandlung
2.9.3.4. Polymerasekettenreaktion (PCR)
2.9.3.5. Herstellung von „Sonden“-DNA
2.9.4. DNA-DNA Hybridisierung
2.9.5. Sequenzierung
37
37
37
37
37
38
38
38
39
39
39
39
40
40
41
42
42
42
42
43
43
44
44
2.10. Fluoreszensmikroskopie
2.11. Verwendete biologische Softwareprogramme
45
45
3. ERGEBNISSE
36
47-137
3.1. Analyse der Sequenzen
47
3.2. Klonierung der Gene des untersuchten Bereiches und Produktion der kodierenden
Genprodukte in E.coli
49
3.2.1. Strategie zur Gewinnung des C-Terminus von KcsA und der Antikörper
49
3.2.2. Produktion von KsuB und von gegen KsuB gerichteten Antikörpern
53
3.2.3. Herstellung von Konstrukten für die Synthese und Reinigung von KsuL
54
3.2.4. Gewinnung von KsuC und von gegen KsuC gerichteten Antikörpern
56
Inhaltsverzeichnis
III
3.3. Physiologische Studien von S.lividans und ausgewählten Mutanten
3.3.1. Immunologischer Nachweis der Proteine in S.lividans WT
3.3.2. Synthese der Proteine in S.lividans TK21 pJO1
3.3.3. Analyse von S.lividans NI Transformanten
3.3.3.1 Herstellung der Konstrukte
3.3.3.2. Nachweis der Protein-Produktion
3.3.4. Produktion der Proteine in einer sigH-Mutante
3.3.5. Abhängigkeit der Synthese von KsuF vom Vorhandensein des Thiostrepton
Resistenzproteins
58
58
60
62
62
64
66
3.4. Gewinnung von His-Tag Proteinen aus S.lividans
3.4.1. Konstruktion der Plasmide pOVV1, pOVV2 und pOVE3
3.4.2. Konstruktion der bifunktionellen Plasmide pOVE4 und pOVE5
3.4.3. Herstellung kcsA-haltiger Konstrukte und Analyse der S.lividansTransformanten
3.4.4. Produktion von KsuB in S.lividans-Transformanten
3.4.5. Produktion von KsuC in S.lividans-Transformanten
3.4.6. Produktion von KsuF in S.lividans-Transformanten
68
69
70
3.5. Studien von S.lividans-Transformanten mit ausgewählten Konstrukten
3.5.1. Herstellen der Konstrukte
3.5.2. „In vivo“ Nachweis der Synthese von EGFP (enhanced green fluorescent
protein)
67
72
74
75
77
80
80
85
3.6. Charakteristika der Proteine
3.6.1. Klassifizierung des abgeleiteten Flavo-Proteins (KsuF)
3.6.2. Reinigung und Charakterisierung des Flavoproteins
3.6.3. Analyse des extrazellulären Proteins KsuL
3.6.4. Analyse der Aldo-Keto Reduktasen KsuC und KsuB
3.6.5. Analyse des abgeleiteten ORFI-Proteins
88
88
93
100
103
107
3.7. Disruption verschiedener Gene in S.lividans
3.7.1. Auswahl der Strategien zur Disruption von Genen
3.7.2. Disruption der Gene in mit Hilfe des Vektors pGM160
3.7.3. Disruption von kcsA
3.7.4. Disruption von ksuF
3.7.5. Disruption von ksuL
3.7.6. Disruption von orfI
3.7.7. Disruption von ksuB
3.7.8. Disruption von ksuC
108
108
109
110
111
113
114
116
118
3.8. Charakteristika der Mutanten
3.8.1. Wachstumseigenschaften
3.8.2. Immunologischer Nachweis der relevanten Proteine
3.8.3. Analyse der Pigment-Produktion
120
120
120
123
IV
Inhaltsverzeichnis
3.9. Konstruktion von chromosomalen Fusionsgenen in S.lividans
3.9.1. Herstellung von Konstrukten und Analyse der Transformanten
3.9.2. Herstellen von Hygromycin-resistenten Mutanten mit chromosomalen
Fusionsgen
4. DISKUSSION
4.1. Sequenzanalyse und Charakteristika der abgeleiteten Proteine
4.2. Synthese von drei Proteinen unter verschiedenen physiologischen
Bedingungen
4.3. Undecylprodigiosin-Überproduktion in Mutanten
5. ZUSAMMENFASSUNG
6. LITERATURVERZEICHNIS
ANHANG
Anhang A: Der sequenzierte 13920 Bp lange Abschnitt aus S.lividans 66
Anhang B: Terminatorstruktur zwischen ksuF und ksuL
Anhang C: Konstruktion von pACYC001 bis pACYC010
Anhang Tabelle D: Messwerte der FAD/KsuF Verhältnisbestimmung
Anhang E: Sequenzvergleich von KsuL mit den homologen Proteinen
128
128
130
139-167
139
157
161
169
171-194
i-xi
ii
iv
xvi
xx
xi
Abkürzungsverzeichnis
Abb.
Act
Bp
BSA
CAPS
Casa.
CDA
DIG
DMSO
DNA
dNTP
DTT
ECF
EDTA
EGFP
EtOH
FAD
FPLC
GuHCl
HEPES
HPLC
IPTG
kBp
kDa
Lsg.
MBp
MeOH
MW
MWCO
NAD(P)
Ni-NTA
OD
Oligo
Orf
PAA
PAGE
PCR
PEG
PHBH
pI
RED
RNA
RT
SARP
SDS
seradest H2O
SSAO
TES
Tir
Tris
ü.N.
UpM.
UV
WT
V
Abbildung
Actinorhodin
Basenpaare
bovine serum albumine
3-Cyclohexylamino-1-propansulfonsäure
casaaminoacids, Casaaminosäuren
calcium-dependend antibiotic
Digoxygenin
Dimethylsulfoxid
deoxyribonucleic acid, Desoxyribonukleinsäure
Desoxynucleotidphosphat
Dithiothreitol
extra-cytoplasmic function
Ethyldiamintetraessigsäure
enhanced green fluorescent protein
Ethanol
Flavin-adenin-dinucleotid
fast protein liquid chromatography
Guanidin-Hydrochlorid
N-(2-Hydroxyethyl)piperazin-N`-ethansulfonsäure
high pressure liquid chromatography
Isopropyl-β-D-Thiogalactopyranosid
Kilo-Basenpaare
Kilo-Dalton
Lösung
Mega-Basenpaare
Methanol
molecular weight, Molekulargewicht
molecular weight cut-off
Nicotinamid-adenin-dinucleotid(-phosphat)
nickel-nitrilotriacetic acid, Nickel Nitrilotriessigsäure
optische Dichte
Oligonukleotid
open reading frame, offenes Leseraster
Polyacrylamid
Polyacrylamid-Gelelektrophorese
polymerase chain reaction, Polymerase-Ketten-Reaktion
Polyethylenglycol
p-Hydroxybenzoat Hydroxylase
isoelektrischer Punkt
Undecylprodigiosin/Butyl-meta-Cycloheptylprodiginin
ribonucleic acid, Ribonukleinsäure
Raumtemperatur
Streptomyces antibiotic regulatory proteins
Laurylsulfat, Natrium Salz
über Ionenaustauscher gereinigtes H2O
Semicarbizide sensitive Amin-Oxidasen
n-Tris(hydroxymethyl)methyl-2-aminoethansulfonsäure
terminal inverted repeats
Tris-(hydroxymethyl)aminomethan
über Nacht
Umdrehungen pro Minute
Ultraviolett
Wildtyp
Einleitung
-1-
1. EINLEITUNG
Streptomyceten sind Gram-positive, aerobe, saprophytische, frei lebende Bodenbakterien, die
sich durch einen komplexen Lebenszyklus mit morphologischer Differenzierung in Substrat-,
Luftmycel, und Sporen, auszeichnen. Sie sind mit 104 bis 107 Kolonie-formenden Einheiten
pro Gramm Boden zu finden und bilden 1-20 % oder mehr der gesamten Lebend-Zellmasse.
Sie sind auch in Sedimenten des Seebodens, in marinen Sedimenten, als vermutliche
Symbionten in der Rhizosphäre von Pflanzen und in Pflanzengeweben oder im Darmtrakt von
Würmern und Insekten auffindbar. Streptomyceten gehören zur Ordnung der Actinomycetales
(im Weiteren mit dem gebräuchlicheren Synonym „Actinomyceten“ bezeichnet). Neben den
Streptomyceten, die zu den Streptomycetaceae gehören, sind auch weitere, wie die
Actinomycetaceae,
Arthrobacteriaceae,
Bifidobacteriaceae,
Cellulomonadaceae,
Corynebacteriaceae, Dermathopylaceae, Frankiaceae, Microbacteriaceae, Mycobacteriaceae,
Propionobacteriaceae,
Nocardiaceae,
Nocardioidaceae,
Pseudonocardiaceae
und
Streptosporangiaceae, Mitglieder dieser Ordnung. Alle haben sie einen sehr hohen GC Gehalt
gemeinsam, Streptomyceten einen mit mehr als 70 %. Wie zuerst für Streptomyces lividans
nachgewiesen, besitzen Streptomyceten, anders als die meisten anderen Prokaryoten, ein
lineares Chromosom (Lin, Y.-S., et al.; 1993). Weitere Beispiele linearer Chromosomen bei
Bakterien, außerhalb der Familie der Actinomyceten, finden sich auch bei Borrelia
burgdorferi und Agrobacterium tumefaciens (Fraser, C.M. et al.; 1997, Goodner, B., et al.;
2001). An den Enden des Chromosoms von Streptomyceten finden sich häufig „terminal
inverted repeats“ (TIRs), die, je nach Stamm, 20-550 kBp umspannen. Die von Streptomyces
coelicolor A3(2) sind ca. 20 kBp lang, die des 356 kBp langen linearen Plasmides SCP1
jeweils 75 kBp (Bentley, S.D., et al.; 2004; Bentley, S.D., et al.; 2002). TIRs wurden jedoch
im Rahmen des Sequenzierungsprojektes von Streptomyces avermitilis nicht gefunden
(Hopwood, D.A.; 2003; Ikeda, H., et al.; 2003). Für die äußersten ca. 200 Bp langen 3’ Enden
der linearen Chromosomen und Plasmide wird eine für die Replikation bedeutsame
Sekundärstruktur postuliert (Bentley, S.D., et al.; 2004). Nicht alle Mitglieder der
Actinomyceten besitzen lineare Chromosomen, z.B. die der Mitglieder der Unter-Ordnung
Einleitung
-2-
der Corynebacterineae, zu denen die Coryne- und Mycobakterien gehören, sind circulär (Li,
L., et al.; 2005; Kalinowski, J., et al.; 2003; Cerdeňo-Tárranga, A. M., et al.; 2003, Cole, S.T.,
et al.; 1998). Des Weiteren finden sich bei Streptomyceten lineare aber auch circuläre und ins
Chromosom integrierte Plasmide. So trägt S.coelicolor A3(2) das lineare 356 kBp große
Plasmid SCP1 (Bentley, S.D., et al.; 2004, Vivian, A. and Hopwood, D.A.; 1970), daneben
noch das 31 kBp lange circuläre Plasmid SCP2 (Haug, I., et al.; 2003, Schrempf, H., et al.;
1975), ein ins Chromosom integriertes Plasmid mit einer Länge von 17,2 kBp (SLP1INT; Lee,
S.C., et al.; 1988) und vermutlich SLP4, ein Plasmid unbekannter Struktur (Hopwood, D.A.,
et al.; 1983). SCP1 und SCP2 sind sequenziert (Bentley, S.D., et al.; 2004; Haug, I., et al.;
2003). Wie lange bekannt und durch die Sequenzierungsprojekte von S.coelicolor A3(2),
S.avermitilis und Streptomyces scabies gezeigt, besitzen Streptomyceten ein außergewöhnlich
großes Genom. So ist das von S.avermitilis 9 MBp lang. Es wurden 7574 potentielle offene
Leseraster identifiziert. Das von S.coelicolor besitzt eine Länge von 8,7 MBp, mit 7825
potentiellen offenen Leserastern (Ikeda, H., et al.; 2003; Bentley, S.D., et al.; 2002). Eigene
Erkenntnisse zeigen, dass die hohe Zahl der potentiellen offenen Leseraster für S.coelicolor
etwas zu optimistisch postuliert ist. Die Sequenz von S.scabies ist veröffentlicht, jedoch noch
nicht
ausgewertet.
Das
Genom
besitzt
eine
Länge
von
10,15 MBp
(http://www.sanger.ac.uk/Projekts/S_scabies). Wie vergleichende Sequenzanalysen des
S.coelicolor A3(2) (Bentley, S.D., et al.; 2002) und S.avermitils Genoms (Ikeda, H., et al.;
2003), jeweils untereinander und teilweise zu vier weiteren Actinomyceten Genomen, zweier
Mycobacterium tubercolosis Stämmen (H37Rv und CDC1551; Cole, S.T., et al.; 1998;
Fleischmannn, R.D., et al.; 2002), Mycobacterium leprae TN (Cole, S.T., et al.; 2001) sowie
Corynebacterium
diphteriae
(http://www.sanger.ac.uk/Projects/C_diphtheriae/)
zeigten,
besitzen Streptomyceten einen zentralen, im Rahmen der Zusammensetzung und der
Anordnung der Gene hoch konservierten Abschnitt, der alle bekannten essentiellen Gene
enthält (Hopwood, D.A.; 2003; Ikeda, H., et al.; 2003; Bentley, S.D., et al.; 2002) und den
vollständigen Genombereich von M.tuberculosis und C.diphteriae umfasst (Bentley, S.D., et
al.; 2002). Dieser betrifft den ca. 6,5 MBp zentralen Abschnitt des S.avermitilis und den ca.
5 MBp zentralen Bereich des S.coelicolor Genoms (Ikeda, H., et al.; 2003; Bentley, S.D., et
al.; 2002). Die äußeren Armbereiche, diese umfassen die äußeren 1,5 MBp (linker Arm) und
2,3 MBp (rechter Arm) von S.coelicolor A3(2) und 0,5 MBp (rechter Arm) und 2,0 MBp
(linker Arm) von S.avermitilis, tragen nicht essentielle Gene, hiervon einen Großteil der für
die Sekundärmetabolit Synthese determinierenden. Die Anordnung und Zusammensetzung
der Gene ist deutlich geringer konserviert und nimmt zu den Telomeren hin ab (Ikeda, H., et
Einleitung
-3-
al.; 2003). 44,5 % aller Gene von S.avermitilis und 42,1 % von S.coelicolor sind in den
Armregionen lokalisiert (Ikeda, H., et al.; 2003).
Seit im Labor von S.Waksman im Jahre 1940 das Antibiotikum Actinomycin und im Jahre
1944 Streptomycin, das erste effektive Medikament zur Behandlung der Tuberkulose,
entdeckt wurden, sind die die Actinomyceten und hier besonders die Streptomyceten als
Produzenten von Antibiotika und anderer biologisch wirksamer Sekundärmetaboliten
bekannt. Von Mitgliedern der Actinomyceten produzierte Sekundärmetabolite finden als
Antibiotika,
antifungale-,
antiparasitäre-,
cytostatische-/Antitumorund
immunsupprimierende- Medikamente und Substanzen mit weiteren biologischen
Bedeutungen, wie z.B. Acarbose (Pseudomaltotetraose) zur Behandlung von Diabetes und
agro-aktiven Substanzen, Verwendung. Des Weiteren besitzen sie ihre Bedeutung als
Produzenten von Enzymen, Aminosäuren und bei der Degradation von Polymeren.
Entsprechend ist die großtechnische Fermentation von Actinomyceten, vor allem von
Streptomyceten, gut etabliert. Heutzutage sind Tausende von Antibiotika und
Sekundärmetabolite mit biologisch wirksamer Aktivität bekannt.
Aufbauend auf den Daten des Jahres 2002 nennt Berdy eine Zahl von 33485 entdeckten
antibiotisch wirksamer Substanzen. Von diesen werden ca. 25 % (8700) von Actinomyceten
produziert und unter diesen ca. 70-80 % von Mitgliedern der Streptomyceten (Berdy, J.;
2005). Als Folge wurden vor allem die der Streptomycyten in den letzten Jahrzehnten
systematisch und bevorzugt nach neuen Antibiotika und biologisch aktiven Substanzen
untersucht. Neuere Erkenntnisse zeigen, dass noch viele zu finden sein werden und es werden
Fragen nach den bisher verwendeten Methoden aufgeworfen. Vor Beginn des
Sequenzierungsprojektes des am Besten untersuchten Streptomycetenstammes, S.coelicolor
A3(2), waren 4 (Hopwood, D.A.; 2003) bzw. 6 (Challis, G.L., Hopwood, D.A.; 2003)
chromosomal determinierte Sekundärmetabolite bekannt. Im Rahmen des Projektes wurden
24 für Sekundärmetabolite determinierende Cluster gefunden, die ca. 4,5 % des Genoms
einnehmen (Hopwood, D.A.; 2003, Bentley, S.D., et al.; 2002), in S.avermitilis, dem zweiten
Streptomycetenstamm, dessen Genom sequenziert und ausgewertet ist, sogar 30 (Hopwood,
D.A.; 2003; Ikeda, H., et al.; 2003). Acht (16 %) von 50 willkürlich ausgesuchten
Actinomycetenstämmen tragen eine Kassette von 5 Genen für die Synthese von Antitumor„Antibiotika“ der Enediyne-Klasse. Für keinen der untersuchten 50 Stämme war die
Produktion von Antibiotika dieser Klasse zuvor bekannt, noch ist es möglich, sie unter den
üblichen Testbedingungen zu synthetisieren. Es ist anzunehmen, dass diese Stämme sehr
wohl zur Produktion dieser Antibiotika in der Lage sind (Zazopoulos, E., et al.; 2003).
Die Synthese der Sekundärmetabolite ist zumeist abhängig von der Wachstumsphase und
Nährstofflimitationen. Es wird postuliert, dass viele der Sekundärmetabolite die Funktion
eines alternativen chemischen Verteidigungsmechanismus besitzen und so die
Überlebenschance der Organismen erhöhen (Maplestone, R.A., et al.; 1992). Aber warum
sind Streptomyceten so potente Sekundärmetabolit-Produzenten, auch im Vergleich zu
-4-
Einleitung
anderen Actinomyceten? Streptomyceten sind (außer als Sporen) als Hyphen-bildende
Bodenbakterien immobil. Ihr Lebensraum ist komplex, mit unzähligen chemischen,
physikalischen und biologischen Stressfaktoren und unterliegt mit der Zeit großen
Veränderungen. Sie sind in der Lage, mit Hilfe ihrer zahlreichen Abbauwege verschiedenste
Substrate als Nährstoffquellen zu verwenden, um in diesem Lebensraum zu bestehen; sie sind
Generalisten. Sie sind nicht in der Lage, den Stressbedingungen auszuweichen, optimale
Lebensbedingungen zu suchen oder der räumlichen Veränderung der optimalen Bedingungen
zu folgen, anders als optimal für bestimmte Bedingungen angepasste mobile Spezialisten. Die
große Zahl der in den S.coelicolor A3(2) und S.avermitilis Sequenzierungsprojekten
gefundenen Gene, die für Regulatorproteine, Transporter und Nährstoffverwertung
determinieren, liegt hierin vermutlich begründet (Bentley, S.D., et al.; 2002). So besitzt
S.coelicolor z.B. 84 für Sensor-Kinasen determinierende Gene. Hiervon liegen 67 als SensorKinase/Antwort-Regulator Paare vor (Hutchings, M.I., et al.; 2004). S.avermitilis besitzt 60
für Sigma-Faktoren determinierende Gene, hiervon 45 zur Familie der ECF-Sigma Faktor
(extra-cytoplasmic function) gehörend, (Ikeda, H., et al.; 2003), S.coelicolor 65, hievon 45 der
ECF-Familie (Bentley, S.D., et al.; 2002). Weitere 3 Sigmafaktoren der ECF-Gruppe fanden
sich auf dem linearen Plasmid SCP1 (Bentley, S.D., et al.; 2004). Dies ist eine deutlich höhere
Zahl als bei allen anderen Bakterienstämmen. Die nächst höhere Zahl findet sich mit 23 bei
Mesorhizobium loti (Kaneko, T., et al.; 2000). ECF-Sigma Faktoren sind in S.coelicolor an
der Reaktion auf externen Stimuli, wie Osmo- oder Salz-Stress, beteiligt und aktivieren Gene,
die in der Stressantwort, Sekundärmetabolitsynthese, Zell-Wand Homeostasis und in der
Zelldifferenzierung involviert sind (Helmann, J.D.; 2002). Es wird postuliert, dass
Streptomyceten zur Verteidigung ihres Lebensraumes und der Nährstoffquellen Antibiotika
und andere Sekundärmetabolite, wie Siderophore, produzieren. Zur Abwehr möglicher
resistenter Konkurrenten werden von einigen Stämmen auch synergistisch sowohl Antibiotika
als auch Antibiotikaresistenzprotein-Hemmer synthetisiert. So produzieren Streptomyces
clavigulus, Streptomyces jumonjinensis, Streptomyces katsurahamanus und ein nicht
klassifizierter Streptomyces spec. zugleich sowohl das β-Lactam Cephamycin C als auch den
β-Lactamase Inhibitor Clavulansäure (Challis, G.L. and Hopwood, D.A.; 2003; Jensen, S.E.
and Paradkar, A.S.; 1999). Nach Ausbildung des Substratmycels (vegetative Phase) folgt,
nach einer Übergangsphase (transiente Phase), die Ausbildung des Luftmycels und der Sporen
(Vermehrungsphase). Hierbei kommt es zur teilweisen Autolyse des Substratmycels, um mit
Hilfe des Recyclings von Makromolekülen das Wachstum des Luftmycels und der Sporen zu
verbessern (Miguélez, E.M., et al.; 1999). Es wird vermutet, dass die durch die Autolyse
freigesetzten Aminosäuren, Zucker und weitere Nährstoffe, Konkurrenten anlocken, die durch
Antibiotika abgetötet und von den Streptomyceten-Kolonien wiederverwertet werden, als
„fatal attraction“ bekannt (Challis, G.L. and Hopwood, D.A.; 2003, Shi, W. and Zusman,
D.R.; 1993).
Streptomyces violaceus-ruber, auch S.violaceoruber genannt, S.coelicolor A3(2) und der in
dieser Arbeit verwendete Stamm S.lividans 66, sind Mitglieder der S.violaceoruber Familie.
Einleitung
-5-
Sie sind sehr nahe miteinander verwandt, S.coelicolor A3(2) und S.lividans 66 sind genetisch
nahezu identisch. Sie unterscheiden sich, wie auch von S.violaceoruber, vorwiegend durch
den Besitz unterschiedlicher Plasmide. Wie das Sequenzierungsprojekt gezeigt hat, besitzt
S.coelicolor A3(2) 24 für Sekundärmetabolite determinierende „Cluster“ und Gene,
plasmiddeterminiert ein weiteres „Cluster“ (Bentley, S.D., et al.; 2004; Bentley, S.D., et al.;
2002). Hierunter finden sich neben für Antibiotika, Siderophore, Pigmente, Carotine,
Geosmin, γ-Butyrollactone und z.B. Hopanoid und Eicosapentaenoidsäuren (mit postulierter
Funktion der Membranstabilisierung unter niedrigen Temperaturen und zum Schutz vor
Wasserverlust der Sporen) determinierenden „Clustern“ und Genen auch weitere mit
unbekannten Funktionen. S.coelicolor A3(2) produziert vier Antibiotika, die, wie für die
Synthese von Sekundärmetaboliten typisch, von in „Clustern“ zusammengefassten Genen
determiniert werden. Die Mischung aus Actinorhodin, γ-Actinorhodin (Lactonform von
Actinorhodin) und weiteren Actinorhodin-Derivaten (Bystrykh, L.v., et al.; 1996) wird kurz
als Act bezeichnet. Sie sind aromatische Polyketid-Antibiotika, determiniert vom TypII
Polyketidsynthesecluster SCO5071-5092, mit einer Länge von 22 kBp. OligopyrrolProdiginine, die eine Mischung des linearen Tripyrrols Undecylprodigiosin und des
cyklischen Derivates Butyl-meta-Cycloheptylprodiginin sind und in einem 2 zu 1 Verhältnis
vorliegen (Cerdeno, A.M., et al.; 2001; Tsao, S.W., et al.; 1985), werden von SCO5877-5898
(33 kBp) determiniert. Sie werden in „Kurzform“ als RED bezeichnet. Mitglieder der
Prodiginine und Prodigiosine besitzen anti-fungale, anti-bakterielle, anti-Protozoen/antiMalaria, immunsuppressive und cytostatische Wirkungen. Sie sind von großem potentiellen
pharmakologischen Interesse, jedoch auf Grund starker Zytotoxidität bisher nicht in
pharmakologischer Anwendung (Williamson, N.R., et al.; 2005). Das „nicht-ribosomale“
cyclische Lipo-Peptidantibiotika CDA (calcium-dependend antibiotic, determiniert vom
80 kBp langen „Cluster“ SCO3210-3249), besitzt eine anti-fungale Wirkung.
Methylenomycin A ist ein Cyclopentanon Antibiotikum, mit antibakterieller Wirkung gegen
Gram-positive, wie auch Gram-negative Bakterien. Methylenomycin A, vor allem ein Derivat
hiervon, Methylenomycin B, unterliegen wachsendem pharmakologischem Interesse. Die
Methylenomycin-Synthese ist in S.coelicolor (SCP1) wie auch S.violaceoruber (pSV1), wo es
ursprünglich identifiziert wurde, plasmiddeterminiert. Zusammen mit zwei pSAL2-L
determinierten Polyketiden aus S.rochei (Mochizuki, S., et al.; 2003; Suwa, M., et al.; 2000)
sind dies bisher die einzigen Beispiele einer plasmiddeterminierten Antibiotikasynthese.
S.lividans 66 besitzt keine für Methylomycin determinierenden Gene. Somit ist S.lividans 66
nur in der Lage, Act, RED und CDA zu produzieren. Anders als S.coelicolor zeigt S.lividans
im Verhältnis eine deutlich geringere Antibiotika-Produktion, die einer unterschiedlichen
Regulation unterliegt; sie wird teilweise als „silent“ beschrieben, jedoch ist die Bezeichnung
„strikt reguliert“ eher zutreffend. Sowohl Act, als auch RED sind farbig. Act wird als
lösliches rot gefärbtes Molekül ausgeschieden, das unter basischem pH einen Farbumschlag
zu blau zeigt. RED ist rotfarbig und mycelassoziiert. Die pH-Indikator Eigenschaft von Act
wurde schon 1947 beschrieben (Brockmann, H. und Pini, H.; 1947). Auf Grund der einfachen
-6-
Einleitung
Nachweisbarkeit und der Möglichkeit einer relativ einfachen Konzentrationsbestimmung, mit
Hilfe spektrophotometrischer Messmethoden, ist die Regulation der Act- und REDBiosynthese am Besten von allen Antibiotikasynthesen untersucht.
Die Gene der Sekundärmetabolitsynthese werden zumeist direkt von Biosynthesewegspezifischen Transkriptionsaktivatoren reguliert. Die der Antibiotikasynthese sind häufig
Mitglieder der SARP Regulator Familie (Streptomyces antibiotic regulatory proteins,
Wietzorrek, A. and Bibb, M.; 1997). Die Biosyntheseweg-spezifischen Regulatoren der Act-,
CDA- und RED-Synthese sind das von actII-orf4 determinierte ActII-ORF4 (Act), das von
cdaR determinierte Regulatorprotein CdaR (CDA) und das Regulatorprotein RedD, von redD
determiniert und der dazugehörige Transkriptionsaktivator von RedD, RedZ, von redZ
determiniert (RED). ActII-ORF4, CdaR und RedD sind Mitglieder der SARP Familie.
Neueste Erkenntnisse zeigen für diese Biosyntheseweg-spezifischen Regulatoren eine
pleiotrope, regulatorische Funktion untereinander, wie auch auf eine Reihe weiterer von der
Biosynthese unabhängiger Gene, als auch für RedZ auf das höherrangige Regulatorpaar
afsR2/afsS (Huang, J., et al.; 2005).
Wie die der meisten anderen Sekundärmetabolite ist die Produktion von Act und RED
abhängig von der Wachstumsphase. In der vegetativen Phase erfolgt keine Produktion. Sie
beginnt in der Zwischenphase, auch transiente Phase genannt und ist in der
Vermehrungsphase mit Beginn der Ausbildung des Luftmycels deutlich erhöht. Die
Differenzierung wird hierbei vor allem durch Verminderung der vorhandenen
Nährstoffquellen ausgelöst. Mutationen in bestimmten Genen (bld), die die Ausbildung des
Luftmycels verhindern und eine glatte „bald“ Kolonieausbildung zur Folge haben, korellieren
zum Teil mit dem Fehlen der Antibiotikasynthese. Hierzu gehört z.B. bldC, determinierend
für ein DNA-Bindeprotein der MerR Familie (Hunt, A.C., et al.; 2005) und der globale
Regulator bldA, das für die t-RNA des raren Leucin Codons UUA determiniert (Takano, E., et
al.; 2003; White, J. and Bibb, M.; 1997). Die Reduktion der Wachstumsgeschwindigkeit in
der transienten Phase zeichnet sich durch eine Erhöhung der Konzentration des intrazellulären
Signalmoleküls ppGpp, synthetisiert von der Synthetase RelA und Reduzierung der GTPKonzentration aus. Hohe Konzentrationen an ppGpp induzieren die Act- und REDProduktion; die Transkription von actII-orf4 wird erhöht, jedoch nicht die von redD. Die
RED-Produktion ist von weiteren regulatorischen Faktoren abhängig (Hesketh, A., et al.;
2001; Martinez-Costa, O.H., et al.; 1996). Eine Reihe weiterer Substrate, Nährstoffe,
Stickstoffquellen, Signalmoleküle, pleiotrope und globale Regulatoren, Transportproteine und
Zweikomponentensysteme haben Einfluss sowohl auf die Act- als auch die RED-Produktion.
Hierzu gehören das extrazelluläre Signalmolekül γ-Butyrollacton SCB1 und die
regulatorischen SCB1-Bindeproteine ScbR, ScbR2, CrpA und CprB (Butler, M.J., et al.;
2003; Takano, E., et al.; 2001; Onaka, H., et al.; 1998). Des Weiteren das DNA-Bindeprotein
AfsS, das vom globalen Regulator AfsR (auch als AfsR2 bezeichnet) reguliert wird, der
wiederum von den Sensor-Kinasen PkaG, AfsL und AfsK phosphoryliert wird, dessen Kinase
Aktivität von KbpA moduliert wird (Horinouchi, S.; 2003; Bibb, M.; 1996). Ebenso Einfluss
Einleitung
-7-
haben die Antibiotika Thiostrepton und Apramycin (Beeinflussung der Transkription von
absB, Huang, J., et al.; 2005), hohe Salzkonzentrationen (Sevcikova, B. and Kormanec, J.;
2004) und die Phosphatkonzentration, reguliert durch das Sensor Protein PhoR und das DNABindeproteins PhoP der OmpR-Familie (Sola-Landa, A., et al.; 2003). Der an der
Stressregulation involvierte Sigma-Faktor σB und sein Anti-Sigmafaktor RbsA sind ebenfalls
an der Regulation der Antibiotikasynthese beteiligt (Lee, E.-J., et al.; 2004a; Cho, Y.-H., et
al.; 2001), direkt über die Regulation der Transkription von redZ und actIV (Lee, E.-J., et al.;
2005), wie auch indirekt über σL und σM (Lee, E.-J., et al.; 2005) durch die Katalase CatB
(Cho, Y.-H., et al.; 2001; Cho, Y.-H., et al.; 2000). Beteiligt sowohl an der Act- als auch
RED-Synthese sind das ribosomale Protein S12 (Okamoto-Hosoya, Y., et al.; 2003a und b)
und die S−Adenosylmethionin Synthetase wie auch die Gabe von S−Adenosylmethionin im
Medium (Okamoto, S., et al.; 2003). Ebenso beteiligt sind Prolin-Transportmutanten (Hood,
D.W, et al.; 1992) und die Rifampicin resistente Mutante rif-10 der RNA Polymerase βUntereinheit des S.lividans 66 DV-1 Stammes, determiniert von rpoB (Hu, H., et al.; 2002).
Auch die Polyphosphat Kinase (Chouayekh, H and Virolle, M.-J.; 2002) und das an der
Sporulation beteiligte amfC (Yonekawa, T. et al.; 1999) sind für die Antibiotikasynthese
bedeutsam. Der Promoterbereich des zur LysR Familie gehörenden Transkriptionsregulators
AbaB aus S.antibioticus ATCC11891 zeigt in hoher Kopienzahl in S.lividans Einfluss auf die
Act- und RED-Produktion (Scheu, A.-K., et al.; 1997). Ebenso Einfluß haben die
Phosphotyrosin Protein-Phosphatase (Umeyama, T., et al.; 1996) und der pleiotrope Regulator
AbsB, ein Endoribonuklease RNaseIII-Homolog (Price, B., et al.; 1999; Champness, W., et
al.; 1992). Die für „Zwei-Komponenten Systeme“ determinierenden absA1/A2 (Anderson,
T.B., et al.; 2001; Adamidis, T. and Champness, W.; 1992), cutR/S (Chang, H.M., et al.;
1996) und afsQ1/Q2 (Ishizuka, H., et al.; 1992) sind an der Antibiotikaproduktion beteiligt.
Die Disruption von afsB inhibiert die Act- und RED-Produktion (Hara, O., et al.; 1983), durch
eine erhöhte Expression des Hauptsigmafaktors, determiniert von hrdB, kann diese
supprimiert werden (Aigle, B., et al.; 2000). Des Weiteren scheint die Poly-3-Hydroxybutyrat
Konzentration der Zellen für Antibiotika-Produktion bedeutsam zu sein (Verma, S., et al.;
2002). Eine Reihe von Nährstoffquellen haben einen Einfluss auf die Antibiotikaproduktion,
wie Stickstofflimitation, Zucker oder Aminosäuren (Hobbs, G., et al.; 1990), auch Mutanten,
die in den Pentose Phosphat Weg eingreifen und so vermutlich die Effektivität der Glycolyse
erhöhen (Butler, M.J., et al.; 2002). Auch fördert „…die Farbstoffbildung...“ „…ganz
wesentlich…“ der „…Zusatz eines wässrigen Maisauszugs“ (Plotho, O.v., 1947).
Auswirkungen ausschließlich auf die Act- jedoch nicht auf die RED-Produktion haben, neben
Mutanten des Act-Biosyntheseweges, folgende Faktoren und Proteine. Die Deletion des
Biosyntheseweg-spezifischen Regulators ActII-Orf4 inhibiert, die Überproduktion erhöht die
Produktion von Act (Gramajo, H.C., et al.; 1993; Strauch, E., et al.; 1991). Durch die Deletion
von atrA, das für den Transkriptionsfaktor AtrA determiniert, ist die Act-Produktion reduziert
(Uguru, G.C., et al.; 2005). Zwei ATP-abhängige Proteasen, determiniert von clp1 und clp2,
sind ebenfalls indirekt an der Act-Produktion beteiligt. Überexpression des dazugehörigen
-8-
Einleitung
von clpX determinierten Transkriptionsregulators führt zur erhöhten Act-Produktion (de
Crécy-Lagard, V., et al.; 1999). Die rif-2, rif-15 und rif-17 Mutanten des für die RNA
Polymerase β-Untereinheit determinierenden rpoB Gens von S.lividans 66 zeigen eine
deutliche Erhöhung der Act-Produktion (Hu, H., et al.; 2002, Lai, C., et al.; 2002) Die ActSynthese ist abhängig von der Ammoniumkonzentration. Schon geringe Konzentrationen
hemmen vollständig die Act-Produktion in S.coelicolor (Hobbs, G., et al.; 1990; Doul, J.L.
and Vining, L.C.; 1990).
Eine Reihe von Proteinen hat ausschließlich Einfluss auf die RED-Biosynthese, aber
beeinflusst nicht die Act-Produktion. Mutationen und Deletionen von den an der REDBiosynthese involvierten Genen unterbrechen die Synthese von RED. Die Deletion der
Biosyntheseweg-spezifischen Regulatoren RedD und RedZ, determiniert von redD und redZ,
inhibiert die RED-Biosynthese (Feitelson, J.S., et al.; 1985; Narva, K.E. and Feitelson, J.S.;
1990; White, J. and Bibb, M.; 1997). Durch hohe Kopienzahlen von redD und redZ wird die
RED-Produktion erhöht (Malpartida, F., et al.; 1990; Narva, K.E. and Feitelson, J.S.; 1990;
White, J. and Bibb, M.; 1997). Auch ein „Zwei Komponenten System“ mit unbekannter
Funktion, determiniert von ercA1/A2, der Antwort-Regulator wird hierbei von
ercA1determiniert, die Sensor-Kinase von ercA2, zeigt eine positive regulatorische Funktion
für die RED-Biosynthese (Li, Y.-q., et al.; 2004). Des Weiteren ist in der rif-9 Mutante der
RNA Polymerase β−Untereinheit, determiniert von rpoB, die RED-Produktion deutlich erhöht
(Hu, H., et al.; 2002).
Die Regulation der Act- und RED-Synthese in S.coelicolor und S.lividans ist äußerst komplex
und, wenn auch am Besten untersucht, bei weitem noch lange nicht vollständig verstanden. Es
ist anzunehmen, dass die Regulation der Antibiotikasynthese anderer Streptomyceten-Stämme
vergleichbar komplex ist.
Wie beschrieben, tragen die äußeren Armbereiche vorwiegend nicht essentielle Gene und
zeichnen sich durch eine hohe Variabilität aus. In unserer Arbeitsgruppe konnte aus den
äußeren Armbereichen von S.lividans WT ein Genomabschnitt isoliert werden. Dieser
zeichnet sich durch die Eigenschaft aus, unter hohen Konzentrationen an Chloramphenicol
amplifiziert zu werden und den so entstandenen Mutanten eine deutlich erhöhte Resistenz
gegenüber dem Antibiotikum zu verleihen. Auf diesem Genomabschnitt wurden neben dem
für das Chloramphenicol Efflux-Protein determinierenden Gen, ein offenes Leseraster mit
unbekannter Funktion (ORFI) und das für den Kaliumkanal KcsA determinierende Gen
gefunden. Des Weiteren wurde das 3’ Ende eines weiteren Gens identifiziert, das den Namen
ksuF erhielt. Nach Vervollständigung von ksuF, der Überproduktion und Aufreinigung des
Genprodukts aus E.coli im Rahmen der Diplomarbeit, wurde KsuF zur Herstellung von
Antikörpern verwendet und die Synthese in einer das Gen auf einem Konstrukt tragenden
S.lividans Transformante nachgewiesen.
Einleitung
-9-
Ziel der Arbeit war, die Rolle dieser und benachbarter Gene und deren Genprodukte
aufzuschlüsseln. Deshalb sollten Strategien entwickelt werden, um größere Mengen dieser
Produkte zu gewinnen. Die gezielte Erstellung von Promoterfusionen und
Disruptionsmutanten, sowie deren Analyse, sollten diese Studien ergänzen.
Materialien und Methoden
- 11 -
2. MATERIALIEN UND METHODEN
2.1. Chemikalien und Enzyme
AppliChem GmbH, Darmstadt
Dodecyl-β-D-maltosid, Harnstoff
Amersham Biosciences Europe GmbH, Freiburg
Superdex 75
ARK Scientific GmbH, Darmstadt (jetzt Sigma-Genosys)
Oligonukleotide
BioWhittaker Molecular Applications, Rockland, USA
LE-Agarose
Carl Roth GmbH & Co., Karlsruhe
Rotiphorese Gel30, Guadinin HCl, Phenol-Chloroform, Laurylsulfat Natrium-Salz (SDS,
Ultra pur)
Difco Laboratories, Detroit, USA
Agar, Aminosäuren aus Casein (Casaminoacids), Hefeextrakt, Trypton, Pepton
Eurogentec Deutschland GmbH, Köln
DNA-Größenstandard (SmartLadder), Low-meltig Agarose
Fermentas GmbH, St. Leon-Rot
Restriktionsenzyme
Gibco/BRL Ltd. Eggenstein
T4-Ligase, Restriktionsenzyme, Taq-Polymerase
Henselwerk GmbH, Magstadt
Sojamehl
- 12 -
Materialien und Methoden
Millipore Corp., Bedford, USA
Ultrafiltrationsmembranen und -einheiten, Filtereinheiten
MWG-Biotech AG, Ebersberg
Oligonukleotide
New England Biolabs GmbH, Frankfurt/M.
Restriktionsenzyme, Protein-Größenstandard 8S
Pall Europe Ltd., Portsmouth, Großbritannien
FluoroTrans®-Membran für Proteintransfer, Biodyne B für DNA-Transfer
Promega GmbH, Mannheim
Restriktionsenzyme, Pfu-Polymerase
Qiagen GmbH, Hilden
Taq PCR Core Kit, Qiafilter Plasmid Midi Kit, Qiagen Plasmid Midi Kit, QIAprep Spin M13
Kit, QIAquick PCR Purification Kit, QIAquick Gel Extraction Kit, QIAEX II Gel Extraction
Kit, QIAquick Nucleotide Removal Kit, Ni-NTA-Agarose
Roche Diagnostics GmbH, Mannheim
Restriktionsenzyme, Dig-DNA Labeling and Detection Kit, Blocking-Reagenz
Schleicher & Schuell, Dassel
Faltenfilter, Papierfilter, Membranfilter, Filtereinheiten
Serva Feinbiochemika GmbH & Co., Heidelberg
Agar, Ammoniumpersulfat, Aminosäuren, Coomassie Brilliant Blue R-250, Coomassie
Brilliant Blue G-250, Bromphenolblau, n-Dodecylsulfat-Natrium-Salz (Laurylsulfat, SDS),
Isopropyl-β-D-Thiogalactopyranosid (IPTG)
Squibb E. R. & Sons, Princeton, USA
Thiostrepton
Stratagene, La Jolla, USA
SanDI
Whatman International Ltd., Maidstone, Großbritannien
Filterpapiere
Alle nicht gesondert aufgeführten Chemikalien wurden von den Firmen Sigma Aldrich
Chemie (Steinheim), F. Merck (Darmstadt), Fluka/Riedel-de-Haën (Seelze) und Serva
(Heidelberg) bezogen.
Materialien und Methoden
- 13 -
2.2. Bakterienstämme, Vektoren, Konstrukte, Phagen und Oligos
2.2.1. Bakterienstämme
Stamm
E.coli DH5α
S.lividans 66
Phänotyp/Genotyp
F , φ80d/lacZ∆M15, recA1, endA1, gyrA96,
thi−, hsdR17 (rK-,mK+), supE44, relA1, deoR,
∆ (lacZYA-argF) U169
recA1, endA1, gyrA96, thi-1,
hsdR17,supE44, relA1, lac, [F proAB,
lacIqZ∆M15, Tn10 (tetR)]
hsdR-, hsdM+, gal-, met-, supE, recAnalS, strS, rifS, thi-, lac-, ara+, gal+, mtlrecA+, uvr+, lon+ [pREP4: lacIq, neoR]
rpsL (Strr), thr, leu, thi-1, lacY, galK, galT,
ara, tonA, tsx, dam, dcm, supE44 ∆(lacproAB), [F´ traD36 proAB lacIqZ∆M15].
Wildtyp, SLP2+, SLP3+
S.lividans TK21
SLP2-, SLP3+
S.lividans TK24
SLP2-, SLP3-
S.lividans NI
arg, Ntr, cmlS, tetS
S.coelicolor M145
SCP1-, SCP2-
S.coelicolor M145
sigH:tsr
S.coelicolor J1984
SCP1-, SCP2-, sigH:tsr
S.lividans 66 ∆kcsA
(∆kcsA9, 13 und 14)
S.lividans 66 ∆ksuF
(∆ksuF2, 6 und 7)
S.lividans 66 ∆ksuL
(∆ksuL17, 20, 21 und
24)
S.lividans 66 ∆orfI
(∆orfI35, 36, 37 und
39)
S.lividans 66 ∆ksuB
(∆ksuB21, 22, 24, 25,
26, 28, 29, 31 und 32)
S.lividans 66 ∆ksuC
(∆ksuC1, 3, 4, 5, 6, 7,
8, 11, 12, 15, 19 und
20)
kcsA:Ωhyg, Disruption von kcsA, hygR,
Integration des Ωhyg-Fragmentes,
ksuF:Ωhyg, Disruption von ksuF, hygR,
Integration des Ωhyg-Fragmentes
ksuL:Ωhyg, Disruption von ksuL, hygR,
Integration des Ωhyg-Fragmentes
E.coli XL1-blue
E.coli K802 recAE.coli M15 [pREP4]
E.coli JM110
-
[M145] SCP1-, SCP2-, sigF:tsr
Referenz
Woodcock, D.M., et
al.; 1989
Bullock, W.O., et
al.; 1987
Wood, W.B.; 1966
Villarejo M.I. and
Zabin, I.; 1974
Yanisch-Perron, C.,
et al.; 1985
Lomovskaya et al.,
1972
Hopwood, D.A., et
al.; 1985
Hopwood, D.A., et
al.; 1985
Dyson und
Schrempf, 1987
Hopwood, D.A., et
al.; 1985
Sevcikova, B., et al.;
2001
Keleman, G.M.; et
al.; 1998
Diese Arbeit
Diese Arbeit
Diese Arbeit
orfI:Ωhyg, Disruption von orfI, hygR,
Integration des Ωhyg-Fragmentes
Diese Arbeit
ksuB:Ωhyg, Disruption von ksuB, hygR,
Integration des Ωhyg-Fragmentes
Diese Arbeit
ksuC:Ωhyg, Disruption von ksuC, hygR,
Integration des Ωhyg-Fragmentes
Diese Arbeit
Materialien und Methoden
- 14 S.lividans 66 KEH5
(K ,L und M)
S.lividans 66 FEH11
(A, B, C, D, E, F, G,
H, I, und N)
S.lividans 66 FEH4
(P, Q, R, S, T, U, V,
W, Y und Z)
kcsA::EGFP-GenΩhyg, hygR, Integration
von EGFP-Gen „in Frame“ hinter kcsA
ksuF::EGFP-GenΩhyg, hygR, Integration
von EGFP-Gen „in Frame“ hinter ksuF
ksuF::EGFP-GenΩhyg, hygR, Integration
von EGFP-Gen „out of Frame“ hinter ksuF
Diese Arbeit
Diese Arbeit
Diese Arbeit
2.2.2. Vektorplasmide
Vektor
pBR322
pUC18
pUC19
pUS18
pBSK(+)
Grösse
4,4 kBp
2,7 kBp
2,7 kBp
2,7 kBp
2,96 kBp
Selektion
bla, tet
bla, lacZ
bla, lacZ
bla, lacZ
bla, lacZ
pACYC184
M13mp18
pHP45Ωhyg
4,25 kBp cat, tetZ
7,1 kBp
lacZ
unbekannt hygR, cat, trägt
Ωhyg-Fragment
pQE32
pQE70
pEGFP1
3,5 kBp
3,4 kBp
4,2 kBp
pIJ702
pGM160
5,7 kBp
7,8 kBp
pWHM3be
7,1 kBp
bla
bla
kanR/neoR, trägt
EGFP-Gen
tsr, melC1, melC2
bla, tsr, aacC1,
Temps
bla, lacZα, tsr
Referenz
Balbas, P., et al.; 1988
Yanisch-Perron, C., et al.; 1985
Yanisch-Perron, C., et al.; 1985
Yanisch-Perron, C., et al.; 1985
Alting-Mees, M. A. and Short,
J.M.: 1989
Rose, R.E.; 1988
Yanisch-Perron, C., et al.; 1985
Saito, A.
Blondelet-Rouault, M.H., et al.;
1997
Qiagen, Hilden
Qiagen, Hilden
Clontech Laboratories inc.
Katz, E., et al.; 1983
Muth, G., et al.; 1989
Vara, J., et al.; 1989
2.2.3. Rekombinante Konstrukte
Konstrukte
pOBH23
pOSP13
pK8
pBRS1
pBRS2
Beschreibung
Rekombinante E.coli Konstrukte
4,5 kBp BglII/HindIII Fragment aus CCM1 ligiert mit
HindIII/BamHI geschnittenen pUC18
1,05 kBp PvuII/SstI Fragment aus pOBH23, mit SmaI/SstI
geschnittenen pUC18 ligiert
4,2 kBp SphI/HindIII-Fragment aus CCM1, ligiert mit
pBSK(+)
2,1 kBp NotI/KpnI-Fragment aus CCM3, mit pBSK(+) ligiert
4,3 kBp PstI/NotI-Fragment aus CCM3, mit pBSK(+) ligiert
Referenz
Diplomarbeit
Diplomarbeit
Diese Arbeit
Ralf Steger
Ralf Steger
Materialien und Methoden
- 15 -
Rekombinante E.coli/S.lividans-Konstrukte (pACYC/pOVE-Reihe)
pACYC001 Aus den Oligos Pr184I und Pr184II fusionierte 55 BpDiese Arbeit
Fragment, ligiert mit AvaI/XbaI-geschnittenen pACYC184
pACYC002 1,9 kBp SstI/HindIII-Fragment aus pJO1, mit pACYC001
Diese Arbeit
ligiert
pACYC003 3,2 kBp SstI/SgfI-Fragment aus pOBH23, mit pACYC002
Diese Arbeit
ligiert
pACYC004 4,2 kBp SgfI/PstI-Fragment aus pBRS2, mit pACYC003
Diese Arbeit
ligiert
pACYC005 4,6 kBp BglII/MluI-Fragment aus pACYC006 mit
Diese Arbeit
pACYC004 ligiert
pACYC006 3,5 kBp Bpu1102I/MluI-Fragment aus pK8 mit pACYC002
Diese Arbeit
ligiert
pACYC007 4,6 kBp BglII/MluI- Fragment aus pACYC006 mit
Diese Arbeit
pACYC003 ligiert
pACYC008 3,2 kBp SstI/SgfI-Fragment aus pOBH23 mit pACYC001
Diese Arbeit
ligiert
pACYC009 4,2 kBp SgfI/PstI-Fragment aus pBRS2 mit pACYC001
Diese Arbeit
ligiert
pACYC010 4,2 kBp SgfI/PstI-Fragment aus pBRS2 mit pACYC008
Diese Arbeit
ligiert
pOV001
50 Bp PstI/XbaI-Fragment aus pACYC001 mit pWHM3be
Diese Arbeit
ligiert
pOV002
2 kBp PstI/XbaI-Fragment aus pACYC002 mit pWHM3be
Diese Arbeit
ligiert
pOV003
5,1 kBp PstI/XbaI-Fragment aus pACYC003 mit pWHM3be Diese Arbeit
ligiert
pOV004
9,3 kBp PstI/XbaI-Fragment aus pACYC004 mit pWHM3be Diese Arbeit
ligiert
pOV005
12,1 kBp PstI/XbaI-Fragment aus pACYC005 mit
Diese Arbeit
pWHM3be ligiert
pOV006
4,7 kBp PstI/XbaI-Fragment aus pACYC006 mit pWHM3be Diese Arbeit
ligiert
pOV007
7,9 kBp PstI/XbaI-Fragment aus pACYC007 mit pWHM3be Diese Arbeit
ligiert
pOV008
3,2 kBp PstI/XbaI-Fragment aus pACYC008 mit pWHM3be Diese Arbeit
ligiert
pOV009
4,2 kBp PstI/XbaI-Fragment aus pACYC009 mit pWHM3be Diese Arbeit
ligiert
pOV010
7,4 kBp PstI/XbaI-Fragment aus pACYC010 mit pWHM3be Diese Arbeit
ligiert
Sonstige rekombinante E.coli/S.lividans-Konstrukte
pJO1
2,1 kBp StuI/Bpu1102 Fragment aus CCM1 in Diplomarbeit
Ecl136/Bpu1102 Schnittstelle von pWH115 (2,8 kBp Insert)
pWH115
pWHM3be-Derivat, trägt ein 1,2 kBp HindIII/EcoRII. Borovok,
Fragment, mit 5’-Teil von ksuF, kcsA und 5’-Teil von orfI
H. Schrempf,
nicht
veröffentlicht
- 16 pWH297
pOVH101
Materialien und Methoden
pWHM3be-Derivat, trägt ein 3,05 kBp SstI/XbaI-Fragment,
mit 5’-Teil von ksuF, kcsA, orfI und 5’-Teil von cmlR
I. Borovok,
H. Schrempf,
nicht
veröffentlicht
Diese Arbeit
Ωhyg-Fragment, BamHI-geschnitten, mit pOV001 ligiert,
Leserichtung von hygR entgegegesetzt von tsr
pOVH201
Ωhyg-Fragment, BamHI-geschnitten, mit pOV001 ligiert,
Diese Arbeit
Leserichtung von hygR in Richtung von tsr
Überproduktion von Proteinen in E.coli M15 [pREP4] oder XL1blue
Heiner Splitt
pQE837
pQE32-Derivat, trägt ein 0,57 kBp Fragment (kcsA), für die
Produktion von His-KcsA in E.coli M15 [pREP4] oder
XL1blue
pORFZ
0,9 kBp SphI/HindIII PCR-Fragment ligiert mit pUC18
Diese Arbeit
pQE309
0,9 kBp SphI/HindIII PCR-Fragment aus pORFZ, ligiert mit Diese Arbeit
pQE32, für Produktion von His-KsuB in E.coli M15
[pREP4]
pQE709
0,9 kBp SphI/HindIII PCR-Fragment aus pORFZ, ligiert mit Diese Arbeit
pQE70, für Produktion von KsuB in E.coli M15 [pREP4]
pQE314
1,38 kBp SphI/MscI Fragment aus pJO1 in SmaI/SphI Diplomarbeit
geschnittenen pQE32, für Produktion von His-KsuF in E.coli
M15 [pREP4]
pQE714
1,4 kBp SphI/HindIII Fragment aus pQE314 in pQE70, für
Diplomarbeit
Produktion von KsuF in E.coli M15 [pREP4]
pORFX1
1,76 kBp SphI/HindIII PCR-Fragment, ligiert mit pUC18
Diese Arbeit
pORFX2
1,7 kBp SphI/HindIII PCR-Fragment, ligiert mit pUC18
Diese Arbeit
Diese Arbeit
pQE315
1,76 kBp SphI/HindIII Fragment aus pORFX1, ligiert mit
pQE32, ermöglicht die Produktion von His-KsuL mit
Signalpeptid in E.coli M15 [pREP4]
Diese Arbeit
pQE715
1,76 kBp SphI/HindIII Fragment aus pORFX1, ligiert mit
pQE70, ermöglicht die Produktion von KsuL mit
Signalpeptid in E.coli M15 [pREP4]
Diese Arbeit
pQE316
1,76 kBp SphI/HindIII Fragment aus pORFX2, ligiert mit
pQE32, ermöglicht die Produktion von His-KsuL ohne
Signalpeptid in E.coli M15 [pREP4]
Diese Arbeit
pQE716
1,76 kBp SphI/HindIII Fragment aus pORFX2, ligiert mit
pQE32, ermöglicht die Produktion von KsuL ohne
Signalpeptid in E.coli M15 [pREP4]
Diese Arbeit
pQE317
0,2 kBp SphI/HindIII PCR-Fragment, ligiert mit pQE32, für
Produktion des His-C-terminalen-KcsA in E.coli M15
[pREP4]
pORS1
0,9 kBp SphI/HindIII PCR-Fragment ligiert mit pWHM3be
Ralf Steger
Ralf Steger
pQE321
0,9 kBp SphI/HindIII PCR-Fragment aus pORS1 ligiert mit
pQE32, für Produktion von His-KsuC in E.coli M15
[pREP4]
pQE721
0,9 kBp SphI/HindIII PCR-Fragment aus pORS1 ligiert mit
Ralf Steger
pQE70, für Produktion von KsuC in E.coli M15 [pREP4]
Materialien und Methoden
pOVV1
pOVV2
pOVE3
pOVE4
pOVE5
pOVE31
pOVE41
pOVE51
pOVE32
pOVE42
pOVE52
pWRS1
pOVE54
pOVE33
pOVE43
pOVE53
pOVG1
pOVG11
pOVG12
pOVG13
pOVG14
pOVG15
pOVG17
Protein-Produktionskonstrukte in S.lividans TK21
80 Bp XbaI/HindIII PCR-Fragment aus pQE32, ligiert mit
pWHM3be
356 Bp EcoRI/Mph1103I PCR-Fragment (Bereich vor ksuF),
ligiert mit pOVV1
158 Bp HindIII/MluI PCR-Fragment (Terminator-Bereich),
ligiert mit pOVV2
336 Bp EcoRI/SphI PCR-Fragment (Bereich vor ksuF),
ligiert mit pOVE3
Aus den Oligos PrPoly3I und PrPoly3II fusionierte 34 Bp
Fragment, ligiert mit dem Mph1103I/BamHI geschnittenen
pOVE3
560 Bp SphI/HindIII-Fragment aus pQE837, ligiert mit
pOVE3
560 Bp SphI/HindIII-Fragment aus pQE837, ligiert mit
pOVE4
560 Bp SphI/HindIII-Fragment aus pQE837, ligiert mit
pOVE5
929 Bp SphI/HindIII-Fragment aus pORFZ, ligiert mit
pOVE3
929 Bp SphI/HindIII-Fragment aus pORFZ, ligiert mit
pOVE4
929 Bp SphI/HindIII-Fragment aus pORFZ, ligiert mit
pOVE5
897 Bp SphI/HindIII Fragment aus pQE321, ligiert mit
pOVE3
897 Bp SphI/HindIII Fragment aus pWRS1, ligiert mit
pOVE5
1,4 kBp SphI/HindIII Fragment aus pQE314, ligiert mit
pOVE3
1,4 kBp SphI/HindIII Fragment aus pQE314, ligiert mit
pOVE4
1,4 kBp SphI/HindIII Fragment aus pOVE33, ligiert mit
pOVE5
EGFP-Promoter Test-Konstrukte in S.lividans TK21
0,73 kBp Mph1103I/XbaI PCR-Fragment aus pEGFP1 mit
pOVE3 ligiert
1 kBp BglII/Mph1103I PCR-Fragment (Bereich vor kcsA),
Ligation mit pOVG1
0,35 kBp BglII/Mph1103I PCR-Fragment (Bereich vor
cmlR), Ligation mit pOVG1
1 kBp BglII/Mph1103I PCR-Fragment (Bereich vor ksuF),
Ligation mit pOVG1
0,98 kBp BglII/Mph1103I-Fragment (Bereich vor ksuL),
Ligation mit pOVG1
0,53 kBp Mph1103I/BglII-Fragment (Bereich vor ksuC),
Ligation mit pOVG1
0,5 kBp Mph1103I/BglII PCR-Fragment (Kontrolle),
Ligation mit pOVG1
- 17 -
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Ralf Steger
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
- 18 -
pTSK
pUTSK1H
pGMK
pTSF
pUTSF1H
pGMF
pTSL
pUTSL1H
pGML
pTSO
pUTSO1H
pGMO
pTSB
pUTSB1H
pGMB
pTSC
pUTSC1H
pGMC
Materialien und Methoden
Disruption von Genen in S.lividans 66
725 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor kcsA)
und 696 Bp KpnI/SnaBI PCR-Fragment (hinter kcsA),
Ligation mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSK
3,6 kBa HindIII/NcoI Fragment aus pUTSK1H, Ligation mit
pGM160
758 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor ksuF)
und 672 Bp KpnI/SnaBI PCR-Fragment (hinter ksuF),
Ligation mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSF
3,7 kBa HindIII/NcoI Fragment aus pUTSF1H, Ligation mit
pGM160
764 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor ksuL)
und 723 Bp KpnI/SnaBI PCR-Fragment (hinter ksuL),
Ligation mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSL
3,7 kBa HindIII/NcoI Fragment aus pUTSL1H, Ligation mit
pGM160
731 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor orfI) und
539 Bp KpnI/SnaBI PCR-Fragment (hinter orfI), Ligation
mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSO
3,5 kBa HindIII/NcoI Fragment aus pUTSO1H, Ligation mit
pGM160
755 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor ksuB)
und 642 Bp KpnI/SnaBI PCR-Fragment (hinter ksuB),
Ligation mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSB
3,7 kBa HindIII/NcoI Fragment aus pUTSB1H, Ligation mit
pGM160
731 Bp HindIII/ SnaBI PCR-Fragment (Bereich vor ksuC)
und 593 Bp KpnI/SnaBI PCR-Fragment (hinter ksuC),
Ligation mit dem HindIII/KpnI geschnittenen pUC18
2,3 kBp DraI-Ωhyg Fragment aus pHP45Ωhyg, Ligation mit
SnaBI geschnittenen pTSC
3,6 kBa HindIII/NcoI Fragment aus pUTSC1H, Ligation mit
pGM160
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Diese Arbeit
Materialien und Methoden
- 19 -
Integration vom EGFP-Gen hinter kcsA in S.lividans 66
Diese Arbeit
pBSK2
2 kBp PvuII/PstI Fragment (melC1/melC2) aus pIJ702 und
2,2 kBp DraI Fragment aus pHP45Ωhyg (Ωhyg), zugleich
ligiert mit SmaI/PstI geschnittenen pBSK(+)
Diese Arbeit
pBSK3
740 Bp SstI/KpnI PCR-Fragment (Bereich vor kcsA und
kcsA), ein 529 Bp NotI/XbaI PCR-Fragment (Bereich hinter
kcsA) und ein 757 Bp KpnI/NotI Fragment aus pEGFP1
(EGFP-Gen) wurden zugleich mit SstI/XbaI geschnittenen
pBSK(+) ligiert
Diese Arbeit
pGM4
2 kBp XbaI/partiell NcoI-Fragment aus pBSK3, 4,2 kBp
XbaI/HindIII-Fragment, ligiert zugleich mit NcoI/HindIII
geschnittenen pGM160
Integration von EGFP-Gen und hygR hinter Genen in S.lividans 66
Diese Arbeit
pUCK1K2 762 Bp BamHI/XbaI PCR-Fragment (Bereich vor kcsA und
kcsA) und 721 Bp BamHI/HindIII PCR-Fragment (Bereich
nach kcsA), zugleich ligiert mit XbaI/HindIII pUC18
Diese Arbeit
pUCKEH
1,56 kBp SanDI/NotI Fragment aus pHP45Ωhyg, 757 Bp
KpnI/NotI Fragment aus pEGFP1, zugleich ligiert mit
SanDI/partiell KpnI geschnittenen pUCK1K2
pGMKEH
3,8 kBp HindIII/XbaI Fragment aus pUCKEH, ligiert mit
Diese Arbeit
pGM160
Diese Arbeit
pUCF1F2
706 Bp BamHI/XbaI PCR-Fragment (3’ Bereich von ksuF)
und 576 Bp BamHI/HindIII PCR-Fragment (Bereich nach
ksuF), zugleich ligiert mit XbaI/HindIII pUC18
Diese Arbeit
pUCFEH
1,56 kBp SanDI/NotI Fragment aus pHP45Ωhyg, 757 Bp
KpnI/NotI Fragment aus pEGFP1, zugleich ligiert mit
SanDI/partiell KpnI geschnittenen pUCF1F2
pGMFEH
3,6 kBp HindIII/XbaI Fragment aus pUCFEH, ligiert mit
Diese Arbeit
pGM160
pUCFEH2
pUCFEH ApaI geschnitten, 3’ Ende mit T4 Polymerase
Diese Arbeit
abverdaut und wieder aufgefüllt, religiert
Diese Arbeit
pUCFEH4
pUCFEH2 NcoI geschnitten, 5’ Ende mit „Klenow“
aufgefüllt,
religiert
pGMFEH4 3,6 kBp HindIII/XbaI Fragment aus pUCFEH4, ligiert mit
Diese Arbeit
pGM160
2.2.4. Bakteriophagen (Lambda-Derivate)
Phage
Charon
35
CCM1
CCM3
(RS1)
Beschreibung
λsbhI1°, lac5, srI, lacZ, srIλ3, ∆WL113, KH54,
nin5, shndIII, λ6°, srIλ5°
9,65 kBp partiell verdautes Sau3A Fragment aus
S.lividans 66 Chromosom ligiert mit BamHI
geschnittenen Charon 35
Ca. 9kBp partiell verdautes Sau3A Fragment aus
S.lividans 66 Chromosom ligiert mit BamHI
geschnittenen Charon 35
Referenz
Loenen, W.A. and
Blattner, F.R.; 1983
Michael Betzler, unsere
Arbeitsgruppe, 1986
Ralf Steger, unsere
Arbeitsgruppe, nicht
veröffentlicht
Materialien und Methoden
- 20 2.2.5. Im Rahmen der Arbeit erwähnte Oligos
Oligo
Sequenz
Beschreibung
Konstruktion von pOVV1, pOVV2, pOVE3 und pOVE4
PrPCR1HI
GAGCGTTCTGAACAAATCC
Konstruktion von pOVV1
2RPCR1XN
GAGGAGATCTAGATGCATAGAG
Konstruktion von pOVV1, trägt
zusätzlich eine Mph1103I und
GATCTCAC
XhoI- Schnittstelle
Pr70
GTTGTAGTCGTGGATGTCC
pOVV2 und pOVE4,
Amplification Promoterbereich
von ksuF
Pr71
GCAGTTTGACCAATCTGG
pOVV2, Amplification
Promoterbereich von ksuF
PRPCR2E
GACAGGAATTCAGATCTGCTCC
pOVV2 und pOVE4,
Amplification Promoterbereich
GCCACCGG
von ksuF, zusätzlich EcoRI und
BglII
PRPCR2N
CAGGGGTATGCATGGTGGCTCC
pOVV2, Amplification
Promoterbereich von ksuF,
TTCGGG
zusätzlich Mph1103I
(Startkodon)
pRPCR3MH
CACACGAACGCGTTAACGCGAA
pOVE3, Amplifikation des
Terminators, zusätzlich MluI
CTGACCC
und HpaI
pRPCR3SX
GATCAAGCTTCTAGACTAGTGAG pOVE3, Amplifikation des
Terminators, zusätzlich HindIII,
CAGGGAGGGC
XbaI und SpeI
Konstruktion von pOVE5
PrPoly3I
TCGCGGCTCCCACCACCACCACC Für N-terminalen His-Tag,
Verschmelzung mit PrPoly3II
ACCACGG
PrPoly3II
GATCCCGTGGTGGTGGTGGTGGT Für N-terminalen His-Tag,
Verschmelzung mit PrPoly3I
GGGAGCCGCGATGCA
Konstruktion von pOVG1
pREGFPmp
CGCCACCATGCATAGCAAGGGCG Amplifikation des EGFP-Gens,
AGGAGCTG
zusätzlich Mph1103I
(Startkodon)
pREGFPxb
CACTCAACCCTATCTCGG
Amplifikation des EGFP-Gens,
zusätzlich XbaI
Konstruktion von pOVG11, pOVG12, pOVG13, pOVG14, pOVG15 und pOVG17
pkcsam1
GTTTGACATGCATGGCCAGAAGA pOVG11, Amplifikation
Promoterbereich von kcsA,
CCGGAC
zusätzlich Mph1103 im
Startkodon
Pr23
GCCCAGCCGTCGAATTCC
pOVG11, Sequenzierungsoligo,
Amplifikation Promoterbereich
von kcsA
PcmlRm1
CATGGCGCAATGCATCACGGCGA pOVG12, Amplifikation
Promoterbereich von cmlR,
GCAGGTAC
zusätzlich Mph1103 im
Startkodon
Materialien und Methoden
PcmlRb2
pksuFm1
pksuFb2
Pksulm1
Pksulb2
PorfYm1
PorfYb2
pkontm1
pkontb1
pkcsas1
pkcsah2
orfZstart
orfZende
orfX1Start
orfX2start
orfXende
CCGGTCAAGATCTCGGTGACGAA
GGG
- 21 -
pOVG12, Amplifikation
Promoterbereich von cmlR,
zusätzlich BglII
GTCCGCCATGCATGGCGCCGATG pOVG13, Amplifikation
Promoterbereich von ksuF,
ATCGTG
zusätzlich Mph1103 im
Startkodon
GTCCACCGAGATCTGCCAGCCGC pOVG13, Amplifikation
Promoterbereich von ksuF,
CGTG
zusätzlich BglII
CAGTGGATGCATCAGCCGGGTGG pOVG14, Amplifikation
Promoterbereich von ksuL,
TGCGCG
zusätzlich Mph1103 im
Startkodon
GCCGCGCAGATCTCGGACCTCCC pOVG14, Amplifikation
Promoterbereich von ksuL,
GCTC
zusätzlich BglII
TCGCGGAATGCATCCGGCCGCCG pOVG15, Amplifikation
Promoterbereich von ksuC,
ATGGTG
zusätzlich Mph1103 im
Startkodon
GCCCGCTAGATCTGCGGGGACGC pOVG15, Amplifikation
Promoterbereich von ksuC,
GCTC
zusätzlich BglII
GACTGCTATGCATCCACGACTAC pOVG17, Amplifikation eines
internen Abschnittes von ksuF,
AAC
zusätzlich Mph1103
CACCCGCAGATCTCGGTGATCAG pOVG17, Amplifikation eines
internen Abschnittes von ksuF,
GTC
zusätzlich BglII
Konstruktion von pQE317
CCGCGCGCATGCCCTGGTTCGTC Amplifikation des 3’ Endes von
kcsA, Mph1103 im Startkodon
GGCCG
CGCACAAGCTTCGCAGACTCATC Amplifikation des 3’ Endes von
kcsA, HindIII
GGTGC
Konstruktion von pQE309 und pQE709
GCCGCATGCAGACCTTCACCCTG Amplifikation von ksuB,
zusätzlich SphI im Startkodon
CC
GCGCCGAAGCTTACGGCACCGTG Amplifikation von ksuB,
zusätzlich HindIII
TAGC
Konstruktion von pQE315, pQE715, pQE316 und pQE716
GGGATGCATGCCCAGAACGCGC
Amplifikation von ksuL, 5’
Ende mit Signalpeptid,
ACC
zusätzlich SphI
CGCCGGCATGCCCGTGACCGCC
Amplifikation von ksuL, 5’
Ende ohne Signalpeptid,
GGACTC
zusätzlich SphI
CCGAGGAAGCTTCAGTTCGCGTT Amplifikation von ksuL, 3’
Ende, zusätzlich HindIII
CACC
- 22 -
Pr184I
Pr184II
PrkcsAIHin
PrkcsAISna
PrkcsAIISna
PrkcsAIIKpNc
PrksuFIHin
PrksuFISna
PrksuFIISna
PrksuFKpNc
PrksuLIHin
PrksuLISna
PrksuLIISna
PrksuLIIKpNc
ProrfIHin
Materialien und Methoden
Konstruktion von pACYC001
CCGACTGCAGCGGCCGCGCGATC Verschmelzung mit Pr184II,
GCGCATGCGAGCTCATGCATAAG intern
PstI, NotI, SgfI, SphI,
CTTACGCGT
Mph1103I, HindIII und MluI,
überhängende
Enden: XbaI und AvaI
CTAGACGCGTAAGCTTATGCATG Verschmelzung mit Pr184I,
AGCTCGCATGCGCGATCGCGCGG intern
PstI, NotI, SgfI, SphI,
CCGCTGCAG
Mph1103I, HindIII und MluI,
überhängende
Enden: XbaI und AvaI
Disruption von kcsA, ksuF, ksuL, orfI, ksuB und ksuC
ACGGCTAAGCTTGTGACCCCACC ∆kcsA, Amplifikation Bereich
fluss-aufwärts von kcsA,
GCAC
+HindIII
ATCTGGTACGTAGACCGGACAGC ∆kcsA, Amplifikation Bereich
flussATGGG
aufwärts von kcsA, +SnaBI
CCACTCTACGTAGGCCGCCGAGG ∆kcsA, Amplifikation Bereich
fluss-abwärts von kcsA, +SnaBI
AGGCG
GGCTCCGGTACCATGGGAATCGC ∆kcsA, Amplifikation Bereich
fluss-abwärts von kcsA, +KpnI
CCCGTCGG
+NcoI
CAGCGCAAGCTTCACCAGACCGA ∆ksuF, Amplifikation Bereich
fluss-aufwärts von ksuF,
AGGAGG
+HindIII
GCGCGCTACGTAGGTGACGAGTC ∆ksuF, Amplifikation Bereich
fluss-aufwärts von ksuF,
GGCC
+SnaBI
GACGGGTACGTACTGGGTACGGC ∆ksuF, Amplifikation Bereich
fluss-abwärts von ksuF, +SnaBI
CCTCG
CCGACCGGTACCATGGAATGGGA ∆ksuF, Amplifikation Bereich
fluss-abwärts von ksuF, +KpnI
CC
+NcoI
GCTGGCAAGCTTGCCGGACGCCG ∆ksuL, Amplifikation Bereich
fluss-aufwärts von ksuL,
AACCGC
+HindIII
CGACCGTACGTATGCCTGTGAGC ∆ksuL, Amplifikation Bereich
fluss- aufwärts von ksuL,
AGTGGAC
+SnaBI
CTGCCTTACGTACACCGACGCGA ∆ksuL, Amplifikation Bereich
fluss-abwärts von ksuL, +SnaBI
TCGAC
GGGGTGGGTACCATGGGCGACGC ∆ksuL, Amplifikation Bereich
fluss-abwärts von ksuL, +KpnI
GGCCCACC
+NcoI
GTGAAGAAAGCTTACGGACCGTA ∆orfI, Amplifikation Bereich
fluss-aufwärts von orfI,
AAGG
+HindIII
Materialien und Methoden
ProrfISna
GCCGTGTACGTAGCCGCTCTCGG
CGTCCTC
- 23 -
∆orfI, Amplifikation Bereich
fluss- aufwärts von orfI,
+SnaBI
ProrfIISna
GACGTCTACGTACTGGCAGAACT ∆orfI, Amplifikation Bereich
fluss- abwärts von orfI, +SnaBI
CGACCC
ProrfIIKpNc
TCCGAGGGTACCATGGCGCAGAC ∆orfI, Amplifikation Bereich
fluss-abwärts von orfI, +KpnI
GGCCAC
+NcoI
PrksuBIHin
CGCGAGAAGCTTGCGGCCGGCGC ∆ksuB, Amplifikation Bereich
fluss-aufwärts von ksuB,
CGACGTC
+HindIII
PrksuBISna
GGATGCTACGTAGGCCGAGGAC
∆ksuB, Amplifikation Bereich
fluss- aufwärts von ksuB,
GATGTTG
+SnaBI
PrksuBIISna
GAGCGATACGTACGGCGTGCCG
∆ksuB, Amplifikation Bereich
fluss-abwärts von ksuB, +SnaBI
GCCGAG
PrksuBIIKpNc CTCGCCGGTACCATGGCTGAGCG ∆ksuB, Amplifikation Bereich
fluss-abwärts von ksuB, +KpnI
GCAGTTCCG
+NcoI
PrksucIHin
ACCCGGAAGCTTCAGGGGGCAG
∆ksuC, Amplifikation Bereich
fluss-aufwärts von ksuC,
GACCGCG
+HindIII
PrksuCISna
CACGCTTTACGTATGCGGGGTCC ∆ksuC, Amplifikation Bereich
fluss-aufwärts von ksuC,
CCGTTG
+SnaBI
PrksuCIISna
CGCTCGTACGTATCGCCAACGCC ∆ksuC, Amplifikation Bereich
fluss-abwärts von ksuC, +SnaBI
AAGG
PrksuCIIKpNc CTGGCGGGTACCATGGTTCGAGA ∆ksuC, Amplifikation Bereich
fluss-abwärts von ksuC, +KpnI
CGCCGAAG
+NcoI
Konstruktion von pBSK3 (pGM4), Integration des EGFP-Gens hinter kcsA
PrIEK
GACGGCGAGCTCCATGGAGCCAC Bereich von kcsA und
flussaufwärts liegender
CGACATCCGAC
Abschnitt, +SstI +NcoI
PrIIEK
CGGCGGGGTACCCGGCGGTTGTC Bereich von kcsA und
flussaufwärts liegender
GTCGAG
Abschnitt, +KpnI
PrIIIEK
ACGACAGCGGCCGCTGACTCCGC Bereich des flussabwärts
liegenden Abschnittes von
CGGTGACC
kcsA, +NotI
PrIVEK
GGTACTTCTAGACGAGGCCGTGC Bereich des flussabwärts
liegenden Abschnittes von
CGCATG
kcsA, +XbaI
pUCK1K2 und pUCF1F2, Integration des EGFP-Gens hinter kcsA und ksuF
PrkcsAK
CGGTCAGGATCCGGGTACCCGG
pUCK1K2, Amplifikation
Bereich von kcsA und Bereich
CGGTTGTCGTCG
flussaufwärts, +KpnI, BamHI
PrkcsAX
GCCACCTCTAGAAGGTGACGGC
pUCK1K2, Amplifikation
Bereich von kcsA und
TGTC
flussaufwärts liegenden
Abschnitt, +XbaI
Materialien und Methoden
- 24 PrkcsAS
AATGCTGGATCCCGGGACCCGG
TGACTCCGCCGGTGACC
PrkcsAH
GGCACCAAGCTTCCTCCGGCGTC
CTAG
PrksuFK
GAAGCCGGATCCGGGTACCCCG
CCGTTCTCGGTG
PrksuFX
GACGTTTCTAGACGGCGGCACG
GTCGTCAC
TCGACCGGATCCCGGGACCCGG
CGGGTGAGCAGGGAG
PrksuFS
PrksuFH
GCACTGAAGCTTCACCGACTTCG
CCAG
pUCK1K2, Amplifikation
Bereich flussabwärts von kcsA,
+SanDI +BamHI
pUCK1K2, Amplifikation
Bereich flussabwärts von kcsA,
+HindIII
pUCF1F2, Amplifikation
Bereich von ksuF, +KpnI,
BamHI
pUCF1F2, Amplifikation
Bereich von ksuF, +XbaI
pUCF1F2, Amplifikation
Bereich flussabwärts von ksuF,
+SanDI +BamHI
pUCF1F2, Amplifikation
Bereich flussabwärts von ksuF,
+HindIII
2.3. Protein- und DNA-Standards
Protein-Standards:
7B (prestained, Sigma Aldrich Chemie, Steinheim)
Apparente Moleculargewichte: 172,5 kDa, 112,5 kDa, 86 kDa, 62,5 kDa, 53 kDa, 33,5 kDa
und 31,5 kDa
8S (prestained, New England Biolabs GmbH, Frankfurt/M.)
Apparente Molekulargewichte: 175 kDa, 83 kDa, 62 kDa, 47,5 kDa, 32,5 kDa, 25 kDa,
16,5 kDa und 6,5 kDa
DNA-Standards:
Digoxygenin markierter Molekulgewichtsmarker II (Roche Diagnostics GmbH,
Mannheim)
23130 Bp, 9416 Bp, 6557 Bp, 4361 Bp, 2322 Bp, 2027 Bp und 564 Bp
Digoxygenin markierter Molekulgewichtsmarker III (Roche Diagnostics GmbH,
Mannheim)
21226 Bp, 5148 Bp, 4973 Bp, 4268 Bp, 3530 Bp, 2027 Bp 1904 Bp, 1584 Bp, 1375 Bp,
947 Bp, 831 Bp und 564 Bp
Materialien und Methoden
- 25 -
2.4. Medien
R-S Medium (nach Hopwood, D.A., et al.; 1985)
-zur Stammhaltung von Streptomyceten
K2SO4
MgCl2 x 6 H2O
Glucose
Casaminoacids
Hefeextrakt
Tris
Serva-Agar
(für festes Medium)
0,25 g
10,12 g
10 g
0,10 g
5g
3,03 g
14 g
auf 1 l mit seradest H2O auffüllen, den pH-Wert auf 7,6 einstellen und autoklavieren.
Anschließend erfolgt Zugabe von:
Spurenelementlsg.
KH2PO4 (0,5 %)
CaCl2 x 2 H2O (5 M)
2 ml
1 ml
0,4 ml
R+S Medium (Hopwood, D.A., et al.; 1985)
- zur Regeneration von Protoplasten
Zusammensetzung wie R-S Medium mit zusätzlich 103 g Sucrose, jedoch Verwendung von
Difco-Agar und 5,73 g Tes statt Tris, nach Autoklavieren Zusatz von:
Spurenelementlsg.
KH2PO4 (0,5 %)
CaCl2 x 2 H2O (5 M)
L-Prolin 20 %
2 ml
10 ml
4 ml
15 ml
Materialien und Methoden
- 26 Vollmedium (nach Jasenka Pigac, pers. Mitteilung)
- zur Anzucht von Streptomyceten in Flüssigkultur
Sucrose
Tryptic Soy Broth
Hefeextrakt
100 g
20 g
5g
auf 990 ml mit seradest H2O auffüllen; nach Autoklavieren, Zugabe von:
MgCl2 x 6 H2O (5 M)
10 ml
Yeme Medium (ohne Sucrose)
- zur Anzucht von Streptomyceten in Flüssigkultur
Hefeextrakt
Pepton (Oxoid)
10 g
5g
mit seradest H2O auf 1 l auffüllen, pH auf 7,5 einstellen und nach Autoklavieren erfolgt
Zugabe von:
MgCl2 x 6 H2O (2,5 M)
Glucose (50 %)
2 ml
20 ml
Sojamehl-Mannit Medium (SM Medium)
- zur Stammhaltung und zur Sporenbildungsförderung von Streptomyceten
Sojamehl
Mannit
Agar
10 g
10 g
7,5 g
mit seradest H2O auf 500 ml auffüllen, in eine 1 l Flasche geben, pH-Wert auf 7,6 einstellen
und autoklavieren.
Achtung! Kocht in der Mikrowelle sehr schnell über, Flaschen immer nur maximal zur Hälfte
füllen. Spitznamen: „Saubermach-Medium“!
Materialien und Methoden
- 27 -
RSM-Medium
- zur Stammhaltung und zur Sporenbildungsförderung von Streptomyceten
Nach Autoklavieren 2 Anteile (500 ml) Sojamehl-Mannit Medium mit einem Anteil (250 ml)
R-S Festmedium mischen. Anschließend Zugabe von:
Spurenelementlsg.
KH2PO4 (0,5 %)
CaCl2 x 2 H2O (5 M)
0,5 ml
0,25 ml
0,1 ml
MM40 Medium - zur Anzucht von Streptomyceten.
KH2PO4
(NH4)2SO4
Asparagin
Agar (für festes Medium)
1g
3,5 g
1,5 g
14 g
mit seradest H2O auf 1 l auffüllen, den pH-Wert auf 7,2 einstellen; für Festmedium auf
500 ml auffüllen, Agar (14 g) auf 500 ml auffüllen, jeweils getrennt autoklavieren und
anschließend zusammengeben. Nach Autoklavieren und Erkalten, Zusatz von:
NaCl (10 %)
1 ml
CaCl2 (10 %)
1 ml
MgSO4 (5 %)
10 ml
Spurenelementlsg.
1 ml
Glycerin (80 %)
12,5 ml
(Zugabe von 35 µg/l Arginin für S.lividans N1-Stämme)
Spurenelementlsg. (10x) - benötigt für R-S, R+S und MM40 Medium
ZnCl2
FeCl3 x 6 H2O
CuSO4 x 2 H2O
MnCl2 x 4 H2O
Na2B4O7 x 10 H2O
(NH4)6Mo7O24 x 4 H2O
40 mg
200 mg
10 mg
10 mg
10 mg
10 mg
auf 100 ml mit seradest H2O auffüllen, sterilfiltrieren.
Materialien und Methoden
- 28 -
LB (Luria-Bertani) Medium (Maniatis, T., et al., 1982)
- Für die Stammhaltung, Plasmidisolierung und Proteinüberproduktion (E.coli)
Trypton
Hefeextrakt
NaCl
Agar (für festes Medium)
10 g
5g
10 g
14 g
auf 1 l mit seradest H2O auffüllen, den pH-Wert auf 7,5 einstellen; anschließend
autoklavieren.
NZY Medium
- zur Propagierung von Phagen in E.coli
NZ-Amin
Hefeextrakt
NaCl
MgCl2 x 6 H2O
CaCl2
Agar (für feste Medien)
10 g
5g
5g
2,5 g
0,37 g
14 g
mit seradest H2O auf 990 ml auffüllen, den pH-Wert auf 7,0 einstellen und autoklavieren;
anschließend Zugabe von:
Maltose (20 %)
10 ml
SOB/SOC Medium (Maniatis, T., et al.; 1982)
- zur Transformation von E.coli
- SOB Medium Bacto Trypton
Hefeextrakt
NaCl
KCl
20 g
5g
0,584 g
0,186 g
auf 1 l mit seradest H2O auffüllen und autoklavieren.
Materialien und Methoden
- 29 -
- SOC Medium zu 98 ml SOB Medium werden nach Autoklavierung hinzugefügt:
Mg2+ Stocklsg. (2 M)
Glucose (2 M)
1 ml
1 ml
Mg2+ Stocklsg. (2 M)
- benötigt für SOC Medium
MgCl2 x 6 H2O
MgSO4 x 7 H2O
20,33 g
24,65 g
auf 100 ml seradest H2O auffüllen, anschließend autoklavieren.
Protoplastenpuffer (P-Puffer, Hopwood, D.A. and Wright, H.M.; 1978)
-Zur Transformation von Streptomyceten
Sucrose
K2SO4
MgCl2 x 6 H2O
103 g
0,25 g
2,02 g
auf 800 ml auffüllen, autoklavieren in 10 Portionen (20 Min. bei 121 °C), für P-Puffer fest
vorher Zugabe von 0,4 % Agarose pro Portion. Anschließend je 80 ml Zugabe von:
KH2PO4 (0,5 %)
1 ml
CaCl2 x 2 H2O (3,68 %)
10 ml
TES-Puffer pH 7,2 (5,73 %)10 ml
Spurenelementlösung 2 m
- 30 -
Materialien und Methoden
2.5. Mikrobiologische Methoden
2.5.1. Kulturbedingungen und Stammhaltung von Streptomyceten
Die Anzucht von Streptomyceten in Flüssigkultur erfolgte durch Zugabe von Sporen im
Erlenmeyerkolben mit grober Schikane in Jasenka-Medium (mit Sucrose). Nach Wachstum
ü.N. bei 30°C als Standkultur erfolgte die Inkubation der Kulturen für ca. 6-8 h bei 140 UpM.
als Schüttelkulturen.
Zur Stammhaltung wurden RSM-Agarplatten mit Sporen oder Mycelien beimpft, bis zur
Sporulation bei 30°C inkubiert und anschließend bei 4°C gelagert. Für eine längerfristige
Lagerung wurden Mycelien aus Flüssigkulturen nach Abzentrifugation in 50 % Glycerin oder
mit Wasser abgeschwemmte Sporen von RSM-Agarplatten im identischen Volumen 100 %
Glycerin oder 1,2 Volumen 80 % Glycerin gelöst und bei -20°C aufbewahrt. Bei Stämmen,
die Plasmidderivate von pWHM3 enthielten, wurde dem Medium bei Flüssigkultur
12,5 µg/ml und bei Agarplatten 25 µg/ml Thiostrepton zugesetzt, Stämmen, die Derivate von
pGM160 mit einer integrierten Ωhyg-Kassette trugen, wurde zusätzlich zu Thiostrepton auch
25 µg/ml Hygromycin zugesetzt.
2.5.2. Kulturbedingungen und Stammhaltung von Escherichia coli
E.coli XL1-Blue, DH5α und M15[pREP4] wurden ü.N. bei 37°C mit LB Medium auf Platten
oder in Flüssigkultur (120 UpM.) angezogen. E.coli K802 recA- wurde zur
Phagenpropagierung in NZY Medium bei 37°C ü.N. auf Platten oder in Flüssigkultur
(150 UpM.) kultiviert. Zur Lagerung wurden die Bakterien bis zu einer OD600 von 0,8
angezogen, mit dem identischen Volumen an 100 % Glycerin oder mit 1,2 Volumen 80 %
Glycerin versetzt und bei -20°C aufbewahrt. Auf Platten ausgestrichene Stämme konnten für
einige Wochen bei 4°C gelagert werden. Zur Überprüfung der fehlenden
Rekombinationsfähigkeit von E.coli K802 recA- wurde dieser auf einer NZY-Platte
ausgestrichen und mit UV-Licht bis zu 10“ bestrahlt. Anschließend wurde die Platte mit
Alufolie umwickelt und bei 37°C ü.N. inkubiert. (Die Zellen wurden bereits nach 4-6“ UVBestrahlung vollständig abgetötet).
Materialien und Methoden
- 31 -
2.6. Biochemische Methoden
2.6.1. Gewinnung von His-Tag Proteinen
2.6.1.1. Gewinnung von His-Tag Proteinen aus E.coli (denaturierend)
Anzucht, Induktion und Aufschluß: 50 ml LB-Medium mit 100 mg/l Ampicillin und 25 mg/l
Kanamycin wurden angeimpft und ü.N. inkubiert (37°C, 150 UpM.). 1 l LB-Medium mit den
entsprechenden Antibiotika in einem 2 Kolben mit grober Schikane wurden 1/50 von der
ü.N. Kultur angeimpft und bei 37°C bis zu einer OD600 von ca. 0,6-0,7 (140-150 UpM.)
angezogen, dann erfolgte die Induktion mit 1 mM IPTG. Nach weiteren 3-4 h Inkubation
(37°C, 140-150 UpM) wurden die Zellen abzentrifugiert, in 3,5-5 Volumen/g Nassgewicht
Ultraschallpuffer (50 mM NaPO4-Puffer, 300 mM NaCl, pH 7,5) aufgenommen und mit
Ultraschall aufgeschlossen (Sonifier 250, Branson, ca. 40 Watt, ca. 2’ Beschallungszeit).
Reinigung der Inclusionbodies: Inclusionbodies sedimentieren deutlich schneller als
Zelltrümmer. Die aufgeschlossenen Zellen wurden bei ca. 1000 UpM. abzentrifugiert, der
Überstand und die Zelltrümmerfraktion wurde vorsichtig von dem weißlichen oder leicht
gräulichen Inclusionbodie-Niederschlag abgenommen und verworfen. Der Niederschlag
wurde erneut in 3,5-5 Volumen/g Nassgewicht aufgenommen. Dieser Waschschritt wurde
mehrfach wiederholt. Teilweise erfolgten die Waschschritte mit Zusatz von 0,01 % Triton
X100.
Solubilisierung der Inclusionbodies und Aufreinigung über Ni-NTA: Der gereinigte
Inclusionbodie-Niederschlag wurde in 3,5-5 Volumen „Lysis“-Puffer (50 mM NaPO4, 6 M
GuHCl, pH 7,5) aufgenommen, unlösliche Reste wurden anschließend bei 35000 g
sedimentiert, der Überstand mit ca. 0,75 ml Ni-NTA versetzt und auf 50 ml mit dem oben
erwähnten Puffer aufgefüllt. Nach mehrstündigem Anbinden oder Anbinden ü.N., jeweils bei
RT, wurde das Material auf eine entleerte Qiagen Plasmid Midi Säule aufgetragen, mit ca.
30−50 Volumen 50 mM NaPO4-Puffer, 8 M Harnstoff, 25 mM Imidazol pH 7,5 gewaschen
und anschließend erfolgte die mehrfache Elution mit 50 mM NaPO4, 8 M Harnstoff, 500 mM
Imidazol, pH 7,5. Die eluierten Fraktionen wurden vereinigt, 0,75 oder 0,5 ml Ni-NTA
hinzugegeben und mit 8 M harnstoffhaltigen Puffer ohne Imidazol auf ca. 50ml aufgefüllt, so
dass eine Imidazol-Endkonzentration von 20-30 mM erreicht wurde. Nach Anbinden über
mehrere Stunden und Auftragen auf eine Säule erfolgten erneute Waschschritte und Elution,
wie oben beschrieben.
2.6.1.2. „Native“ Gewinnung von His-Tag Proteinen
Anzucht, Induktion und Aufschluß von E.coli Überexpressionsstämmen: 50 ml LB-Medium
mit 100 mg/l Ampicillin und 25 mg/l Kanamycin wurden angeimpft und ü.N. inkubiert (30°C,
150 UpM.). Je 1 l LB-Medium mit den entsprechenden Antibiotika in 2 l Kolben mit grober
Schikane wurden 1/50 von der ü.N. Kultur angeimpft und bei 30°C bis zu einer OD600 von
- 32 -
Materialien und Methoden
ca. 0,3 (140-150 UpM.), dann bis zu einer OD600 von 0,5 bei 25°C inkubiert (140150 UpM.), anschließend bei 16°C im Wasserbad (ca. 120 UpM.). Bei Erreichen einer OD600
von ca. 0,8-1,2 (je nach Versuch) erfolgte die Induktion mit 0,1 mM IPTG. Nach Wachstum
ü.N. bei 16°C und Zentrifugation wurde das Nassgewicht der Zellen bestimmt und diese in
3,5-5 Volumen Ultraschallpuffer (50 mM NaPO4-Puffer mit 300 mM NaCl, pH 7,5)
aufgenommen (teilweise wurden bei diesem Schritt Protease-Inhibitoren hinzugefügt) und die
Zellen mit Hilfe von Ultraschall aufgeschlossen. Zur Trennung der Cytoplasmafraktion von
den Zelltrümmern und anderen unlöslichen Produkten, erfolgten zwei Zentrifugationsschritte
bei 5000 g und anschließend bei ca. 35000 g.
Expression von His-Tag-Proteinen aus S.lividans Stämmen und Aufschließen der Zellen:
20 ml Jasenka-Medium mit Sucrose und 12,5 mg/l Thiostrepton in 100 ml Kolben wurden mit
Sporen von Platte oder aus Glycerinkultur „dick“ angeimpft und ü.N. bei 30°C als
Standkultur inkubiert. Diese wurde in 250 ml Kolben mit grober Schikane übertragen, auf
50 ml mit dem oben erwähnten Medium mit Thiostrepton aufgefüllt und nach Inkubation von
ca. 4-6 h bei 30°C als Schüttelkultur, abzentrifugiert und die Zellen in 1 l MM40 Medium mit
300 mM KCl oder NaCl in einen 2 l Kolben mit grober Schikane übertragen. Nach Inkubation
ü.N. als Schüttelkultur (30°C, ca. 150 UpM) wurden die Zellen abzentrifugiert.
Diese wurden in 3,5-5 Volumen Ultraschallpuffer (50 mM NaPO4-Puffer mit 300 mM NaCl)
pro Gramm Nassgewicht mit 5 mg Lysozym/ml und einer Tablette Proteaseinhibitor
([email protected] Mini, EDTA-free, Roche) aufgenommen und ca. 30’ -1h bei 30°C inkubiert,
anschließend durch Ultraschall aufgeschlossen (ca. 40 Watt, ca. 2’). Die Zelltrümmer wurden
in zwei Zentrifugationsschritten (ca. 10’ bei 4000 UpM und 15’ bei 35000 g) von der
Cytoplasmafraktion getrennt.
Zur Aufreinigung von His-Tag KcsA wurde die Membranfraktion durch Ultrazentrifugation
(ca. 1 h bei 300000 g) von der Cytoplasmafraktion getrennt und in Ultraschallpuffer (50 mM
NaPO4-Puffer mit 300 mM NaCl) und 1 mg/ml Dodecylmaltosid (DDM) aufgenommen.
Native Aufreinigung von Proteinen über Ni-NTA: Die Cytoplasmafraktion wurde mit 0,51 ml reinem Ni-NTA versetzt und mit Ultraschallpuffer und Ultraschallpuffer mit 500 mM
Imidazol so auf 50 ml aufgefüllt, dass sich eine Endkonzentration von 20 mM ergab. Nach
Anbindung der Proteine an Ni-NTA (3-4 h bei RT oder ü.N. bei 4°C, Roller), wurde die Probe
auf eine entleerte Säule (Qiagen Plasmid Midi) gegeben, eluiert und mit 25-50 Volumen des
Ni-NTA-Volumens mit Ultraschallpuffer mit 20 mM Imidazol gewaschen. Anschließend
erfolgte die Elution entweder mit Ultraschallpuffer mit 500 mM Imidazol oder mit
Ultraschallpuffer mit 100-500 mM Imidazol in 100 mM Imidazolschritten. Zur erneuten
Aufreinigung wurden die eluierten Fraktionen mit dem höchsten Anteil an His-Tag Protein
vereinigt und nach Zugabe von 0,5-1 ml Ni-NTA mit Hilfe von Ultraschallpuffer so auf 50 ml
verdünnt, dass eine Imidazol-Endkonzentration von 25-30 mM Imidazol erreicht wurde. Nach
Anbindung (3-4 h bei RT oder ü.N. bei 4°C, Roller), Auftragung auf eine Säule und
Waschung mit Ultraschallpuffer mit 20 mM Imidazol (25-50 Volumen Ultraschallpuffer mit
20 mM Imidazol) erfolgte die Elution mit Ultraschallpuffer mit 500 mM Imidazol.
Materialien und Methoden
- 33 -
2.6.2. Konzentration von Proteinen und Wechsel des Puffers
Die Ankonzentration und Pufferwechsel von Proteinen erfolgte mit Hilfe von
Zentrifugationsfiltersystemen. Verwendet wurden, je nach aufzureinigendem Protein,
Filtrationssysteme mit einem Ausschlussvolumen von 3000, 10000 und 30000 Dalton
(Centricon YM3, YM10 und YM30, Millipore), jeweils nach Vorschrift des Herstellers.
2.6.3. Gelfiltration
Fraktionen von His-Tag KsuF, nach Aufreinigung aus S.lividans pOVE33 und E.coli
M15[pREP4]
pQE314
über
Ni-NTA,
wurden
über
Centricon
YM30
Zentrifugationskonzentratoren ankonzentriert und auf 50 mM Hepespuffer mit 200 oder
300 mM NaCl (pH 7,5) umgepuffert. Anschließend erfolgte eine Gelfiltration. Verwendet
wurden SUPERDEX 75 HR 10/30 und SUPERDEX 200 HR 10/30 Säulen (Pharmacia
Biotech), als Laufpuffer (Flussrate 0,4 ml/min) wurde jeweils der oben erwähnte, für die
Umpufferung verwendete Hepes-Puffer verwendet.
2.6.4. Massenspektrometischer Nachweis von FAD
Über Gelfiltration aufgereinigtes His-Tag KsuF der gelbgefärbten monomeren Fraktionen
(aus S.lividans TK21 pOVE33) und käuflich erworbenes FAD wurde jeweils mit 30 %
Acetonitril versetzt. Nach Zentrifugation der proteinhaltigen Proben, um ausgefallenes
Protein zu sedimentieren (15’, 30000 g), wurden die Proben über HPLC aufgetrennt (Agilent
1100 Series, ThermoQuest 250 x 4,6 mm, 5 µm HyPURITY Elite C18) und anschließend
massenspektrometrisch analysiert (esquire HCT, Bruker Daltonics).
2.6.5. Bestimmung von Proteinkonzentrationen
Die Proteinkonzentrationsbestimmungen erfolgten mit Hilfe von Lowry- (Dulley, J. R. and
Grieve, P. A.; 1975), Bradford- (Bradford, M. M.; 1976) und BCA-Tests von „Novagen“
(Smith, P.K, et al.; 1985; Kessler, R.J. and Fanestil, D.D.; 1986), jeweils nach Vorschrift, mit
BSA als Referenz.
2.6.6. Spektrophotometrische Messungen
Die spektrophotometrischen Messungen von FAD und His-Tag KsuF erfolgte an einem
Spektrophotometer in der Biophysik. Gemessen wurde jeweils das Spektrum von 200/230 nm
bis 650/700 nm. Alle Messungen erfolgten in 50 mM Hepespuffer mit 300 mM NaCl
(pH 7,5), FAD wurde in einer 0,01 mM Konzentration eingesetzt, His-Tag KsuF wurde nach
Aufreinigung aus E.coli M15[pREP4] pQE314 und aus S.lividans pOVE33 über Gelfiltration
- 34 -
Materialien und Methoden
weiter aufgereinigt und die Fraktionen, die dimeres und die monomeres His-Tag KsuF
enthielten, wurden unverdünnt eingesetzt. Die weitere Bearbeitung der Daten erfolgte mit
Hilfe des Computerprogramms „EXEL“.
2.6.7. Bestimmung des FAD/KsuF-Verhältnisses
In Versuchen wurde gezeigt, dass, anders als die beiden Absorptionsmaxima von FAD bei
265 nm und 375 nm, das bei 450 nm nur geringfügig durch die Bindung an das Protein und
die durch Protein hervorgerufenen Absorption in der Stärke beeinflusst wurde (um ca. 8,8 %
reduziert; Palfey, B.A., et al, 2003). Dieses wurde im Vergleich mit 0,01 mM FAD zur
Konzentrationsbestimmung verwendet, der bestimmte Wert wurde mit dem Korrekturfaktor
1,097 multipliziert, um die FAD-Konzentration zu erhalten. Die Proteinkonzentration wurde
mit Hilfe des BCA-Tests im Vergleich zu BSA (geeicht, Novagen) bestimmt. Der BCA-Test
zeigt eine im Verhältnis zur Reaktion mit Protein sehr schnell abgeschlossene und schwache
Farbreaktionen mit FAD, zur Bestimmung der Proteinkonzentration wurde die hierdurch
hervorgerufene Absorption jeweils durch Vergleich mit FAD und der spektophotometrisch
bei 450 nm bestimmten FAD-Konzentration der Fraktionen berechnet und von der Absorption
subtrahiert. Nach Bestimmung der jeweiligen molaren Konzentrationen wurde die FAD durch
die Proteinkonzentration geteilt.
2.7. Elektrophoretische Techniken
2.7.1. Agarose-Gelelektrophorese
Zur Auftrennung wurden 0,7-1,2 % Agarosegele, für die Auftrennung von sehr kleinen
Fragmenten (Fragmentgrößen von ca. 100 Bp und kleiner) wurden „Low-melting“
Agarosegele mit einer Konzentration von bis zu 2,5 % verwendet, als Laufpuffer 1 x TBEPuffer (0.89 M Tris/HCl, 0,89 M Borsäure, 25 mM Na2EDTA, pH 8,0). Die DNA-Proben
wurden 1 zu 4 mit Gelladepuffer III (0,25 % Bromphenol Blau, 0,25 % Xylene Cyanol, 30 %
Glycerin in H2O) versetzt und bei 60-80 V in ca. 2-3 h oder ü.N. bei 12 V in horizontalen
Elektrophoresekammern (Pharmacia, Owl oder Institutseigenbau) aufgetrennt. Anschließend
konnte die DNA mit Ethidiumbromid-Lösung (4 µg/ml) oder (seltener) in SYBRE Green
Lösung (1/10000 der Stammlösung) in jeweils 1x TBE-Puffer angefärbt und durch UV-Licht
bei 302 nm sichtbar gemacht und fotografisch ausgewertet werden.
Materialien und Methoden
- 35 -
2.7.2. SDS Polyacrylamid-Gelelektrophorese (PAGE)
Die SDS-Gelelektrophorese erfolgte nach Laemmli (Laemmli, U.K.; 1970). Verwendet
wurden 12,5 % und 15 % Gele. Als Ladepuffer wurde ein 4x SDS-Probenpuffer (200 mM
Tris/HCl, pH 6,8; 4 % SDS (Laurylsulfat); 20 % Glycerin), reduzierende Agenzien
(Mercapthoethanol und Dithiothreitol(DTT)) wurden bei Bedarf frisch zugesetzt. Um
unerwünschte Signale nach immunologischem Nachweis so weit wie möglich zu
reduzieren, wurden das Tris in Ultra- und SDS in Elektrophorese- oder in Ultra-Qualität
eingesetzt.
2.7.3. Denaturierende Gelelektrophorese in Schägger/v.Yagow Gelen
Die Gelelektrophorese erfolgte nach Schägger und von Jagow (Schägger, H. and Jagow, v.G.;
1987). Verwendet wurden 15 % denaturierende Gele mit 8 M Harnstoff. Tris wurde in Ultra-,
SDS (Laurylsulfat) in Elektrophorese-Qualität eingesetzt.
2.7.4. Färbung mit Coomassie-Brilliant-Blau
Nach der Elektrophorese wurden die SDS und Nativen PAA-Gele mit 0,1 %iger CoomassieBrillant-Blau R 250 Lösung in 10 % Essigsäure und 50 % Methanol gefärbt. Nach 10-30’
erfolgte eine Entfärbung in 10 % Essigsäure und 50 % Methanol.
2.7.5.Silbernitratfärbung
Nach der SDS Polyacrylamid-Gelelektrophorese wurden die Gele für 20’ in Lösung I (10 %
Trichloressigsäure) fixiert. Nach 2 x 10’ Waschen mit seradest H2O erfolgte eine weitere
10minütige Fixierung in Lösung II (1 g Na2B4O7 x 10 H2O, 2 ml Glutaraldehyd (50 %),
98 ml H2O). Nach anschließendem dreimaligem Waschen mit seradest H2O für jeweils 10’
und Wechseln der Wanne, wurden die Gele für 15’ in einem kurz zuvor angesetztem Gemisch
aus Lösung III (0,8 g Silbernitrat, 4 ml seradest H2O) und Lösung IV (70 ml H2O, 1,84 ml
NaOH (1 M), 1,96 ml NH4 konzentriert) inkubiert. Nach 7’ Waschen in seradest H2O, erfolgte
eine sehr kurze Inkubation in Lösung V (100 ml H2O, 6 mg Citronensäure, 50 µl
Formaldehyd), bis die ersten Proteinbanden zu erkennen waren. Um eine zu starke
„Nachfärbung“ zu verhindern, wurde die Färbereaktion durch mehrmaliges Waschen in
seradest H2O beendet.
- 36 -
Materialien und Methoden
2.7.6. Proteintransfer auf Membranen („Semidry-Electro-Blotting“)
Die Übertragung von Proteinen aus einem SDS-Polyacryamid-Gel auf eine PVDF-Membran
(Fluorotrans-Membran, Pall, Pourtsmouth, England) erfolgte mit einer GrafitplattenTransferkammer (CTI, Idstein) durch „Semidry-Electro-Blotting“ nach der von Burnette,
W.N. modifizierten Methode (Towbin, H., et al.; 1979; Burnette, W.N.; 1981). Als
Transferpuffer wurde 10 mM Caps-Puffer pH 11 mit 10 % Methanol verwendet. Die
Transferzeit betrug ca. 1h bei 1 mA/cm2. Zum Transfer von KcsA, His-Tag KcsA und dem
His-Tag C-terminalen Ende von KcsA wurde 25 mM Tris/Glycin-Puffer mit 7 % MeOH und
0,07 % SDS als Transferpuffer verwendet, die Transferzeit betrug ca. 3 h bei 1 mA/cm2
Membranfläche.
2.8. Immunologische Nachweismethoden
2.8.1. Immunologischer Nachweis von Proteinen auf Nylonmembranen („Western Blot“)
Nach Transfer wurde die Membran von der Gelmatrix getrennt und für 1 h in einer Schale mit
100 ml „Blocking-Puffer“ (1 % Blocking-Reagenz (Boehringer) und 0,5 % BSA oder 5 %
Milchpulver) in 1x PBS-Puffer (8,18 g NaCl, 0,2 g KCl, 1,798 g Na2HPO4, 0,245 g KH2PO4,
auf 1 l mit seradest H2O auffüllen) inkubiert. Danach erfolgte eine Inkubation der Membran
ü.N. bei 4°C oder für 4 h bei RT mit dem primären, in 1 x PBS-Puffer verdünnten Antikörper.
Die Membran wurde dreimal für 10-15’ mit 1 x PBS-Puffer gewaschen und anschließend für
2-3 h bei RT mit dem entsprechenden sekundären, in 1 x PBS-Puffer verdünnten Antikörper
(1/30000) inkubiert. Nach Entfernung des ungebundenen sekundären Antikörpers durch
zweimaliges Waschen mit 1 x PBS-Puffer für je 10’ wurde die Membran kurz in
Substratpuffer (25 mM Tris/HCl, pH 8,3) äquilibriert. Die Farbreaktion erfolgte durch
Inkubation mit der Entwicklungslösung, bis die Farbsignale erschienen.
Entwicklungslösung:
Lösung A: 2 mg Naphtol-AS-E-Phosphat in 200 µl DMSO
Lösung B: 10 mg Fast Violett B in 10 ml Substratpuffer
- Lösung A und B erst kurz vor Gebrauch zusammengeben.
Nach Erscheinen der Farbsignale wurde die Membran mehrfach mit H2O gewaschen und
getrocknet.
Materialien und Methoden
- 37 -
2.9. Molekulargenetische Methoden
2.9.1. Aufreinigung von DNA
2.9.1.1. Plasmidisolierung aus E.coli (alkalische Lyse)
3 ml LB Medium mit einem entsprechenden Antibiotikum wurden mit einer E.coliEinzelkolonie angeimpft und ü.N. bei 37°C inkubiert. 2 x 1,5 ml der Kultur wurden für eine
Min. bei 14000 UpM. in einem Eppendorfröhrchen abzentrifugiert und der entstandene
Niederschlag in 100 µl Lösung 1 (50 mM Glucose, 25 mM Tris/HCl pH 8, 25 mM
Na2EDTA) resuspendiert. Nach 2’ bei RT erfolgte eine Zugabe von 200 µl Lösung 2 (1 %
SDS, 0,2 M NaOH). Nach einer 5minütigen Inkubation bei RT wurden 150 µl Lösung 3 (3 M
Kalium- oder Natriumacetat, 11,5 % Essigsäure, pH 5,5) hinzugegeben und bei 14000 UpM.
(15’) zentrifugiert. Zum Überstand wurde ein Volumen Phenol/Chloroform gegeben. Nach
kräftigem Mischen und Zentrifugation, wurde die wässrige Phase entnommen, ein Volumen
Chloroform zu dieser hinzugegeben, wiederum gut gemischt und nach Zentrifugation die
Plasmid-DNA mit Hilfe von 0,7 Volumen Isopropanol aus dieser gefällt. Der nach
Zentrifugation und Abnahme des Überstandes zurückbleibende Niederschlag wurde
anschließend einmal mit 70 % Ethanol gewaschen und nach Trocknen in 50 µl seradest H2O
oder in einmal TE-Puffer (10 mM Tris/HCl, 1 mM EDTA, pH 7,4) aufgenommen.
2.9.1.2. Plasmidaufreinigung aus E.coli („Quick and dirty“)
Diese Methode entspricht im Prinzip der oben beschriebenen Plasmidaufreinigung
(Alkalische Lyse), jedoch wurden jeweils 420 µl der Lösungen I, II und III eingesetzt, nach
Zentrifugation erfolgte kein Phenolisierungsschritt, sondern es wurde 0,7 Volumen
Isopropanol dem Überstand hinzugesetzt, der nach Zentrifugation zurückbleibende
Niederschlag wurde zweimal mit 70 % EtOH gewaschen, getrocknet und in 50 µl seradest
H2O aufgenommen. Die über diese Methode gereinigte DNA zeigte teilweise deutlich bessere
Ergebnisse bei enzymatischen Reaktionen, wie z.B. Sequenzierung und Restriktionen als die
über die klassische alkalische Lyse aufgereinigte DNA.
2.9.1.3. Plasmidaufreinigung aus E.coli (Ionenaustauscher)
Für Aufreinigungen von Plasmiden aus E.coli, für die größere Mengen an DNA und
besonders saubere DNA benötigt wurde (z.B. Sequenzierung), wurde das Qiagen Plasmid
Midi Kit und das Qiafilter Plasmid Midi Kit (Qiagen, Hilden) nach Vorschrift der Hersteller
verwendet, mit folgenden Änderungen: Statt einer 25 ml Kultur in der logarithmischen Phase
wurden 30-50 ml einer ü.N.-Kultur verwendet, das Volumen der Puffer P1, P2 und P3 wurde
auf 6 ml erhöht, die DNA-Pellets wurde in je 25 µl seradet H2O aufgenommen, da Tris-Puffer
die Sequenzierung störten.
- 38 -
Materialien und Methoden
2.9.1.4. Schnelltest zum Nachweis von Plasmiden in E.coli (SCFSB)
Single colony final sample buffer (SCFSB-Puffer):
2,5 % Ficoll 400 (w/v)
1,25 % SDS (w/v)
0,015 % Bromphenolblau (w/v)
In 1 x TBE-Puffer (0.89 M Tris/HCl, 0,89 M Borsäure, 25 mM Na2EDTA, pH 8,0)
aufnehmen.
Mit Hilfe dieser Methode können relativ schnell Anhaltspunkte gewonnen werden, welche
E.coli-Kolonien nach Ligation und Transformation Plasmide tragen, bei denen ein DNAFragment korrekt inseriert sein könnte. Hierzu wurden die Zellen mit Hilfe des SCFSBPuffers lysiert und die Plasmide durch Agarose-Gelelektrophorese der Größe nach
aufgetrennt. Durch zusätzliches Auftragen von E.coli Zellen mit Plasmiden bekannter Größe
als Kontrolle und/oder Plasmiden bekannter Größe in SCFSB-Puffer, wurde eine ungefähre
Bestimmung der Plasmidgrößen ermöglicht.
Mit einem Zahnstocher wurde eine ungefähr stecknadelkopfgroße Menge der zu testenden
E.coli-Zellen von einer LB-Agarplatte mit dem entsprechendem Antibiotika „abgekratzt“ und
in 100 µl SCFSB-Puffer aufgenommmen. Nach einer 10minütigen Inkubation bei 37°C
erfolgte eine Zentrifugation von 15’ bei 14000 g, der wässerige Überstand wurde
anschließend auf ein 0,7 % Agarosegel aufgetragen. Hierbei war zu beachten, dass der 1 x
TBE-Pufferstand in der Gelelektrophoresekammer knapp unter der Agarosegeloberfläche
gehalten werden musste, da sonst die detergenzhaltige Probe herausgespült würde. Nach 510minütigen Einlaufen ins Gel (60 V), konnte der TBE-Pufferstand auf normale Werte erhöht
werden. Die weitere Arbeitsmethode erfolgte wie unter Agarose-Gelelektrophorese
beschrieben.
2.9.1.5. Aufreinigung von einzelsträngiger Phagen-DNA (M13)
Zur Aufreinigung von einzelsträngiger M13 Phagen-DNA aus E.coli wurde das „QIAprep
Spin M13 Kit“ der Firma „Qiagen“, Hilden nach Vorschrift der Hersteller eingesetzt.
2.9.1.6. Isolierung von Plasmiden aus Streptomyceten
5 ml Vollmedium mit einem entsprechenden Antibiotikum wurden mit Mycel angeimpft, ü.N.
als Standkultur und weitere 24 h als Schüttelkultur bei 30°C inkubiert. 1,5 ml der Kultur
wurden in ein Eppendorfgefäß überführt und das Mycel (ca. 70 mg) abzentrifugiert.
Anschließend wurde es in 500 µl Lysozym- und RNAse- haltiger Lösung I (15 mM Glucose,
25 mM Tris/HCl, 10 mM EDTA, pH 8,0; 5 mg/ml Lysozym, 1 mg/ml RNAse) resuspendiert.
Nach 30’ bei 37°C, erfolgte die Zugabe von 300 µl alkalischem SDS (2 % SDS in 0,3 M
NaOH), nach 5’ auf Eis erfolgte die Zugabe von 270 µl 3 M Kaliumacetat, pH 4,8. Nach
weiteren 5’ auf Eis wurde die Mischung zentrifugiert (14000 UpM., 4°C) und der Überstand
mit einem ungefähr identischen Volumen an saurem Phenol versetzt und erneut zentrifugiert
Materialien und Methoden
- 39 -
(14000 UpM., 4°C). Der Überstand wurde abgenommen und der Phenolisierungsschritt wurde
so oft wiederholt, bis sich keine Interphase mehr bildete, anschließend erfolgte ein
Chloroformschritt. Die Plasmid-DNA wurde mit 0,7 Volumen Isopropanol gefällt, mit 70 %
EtOH gewaschen und in 50 µl TE-Puffer aufgenommen.
2.9.1.7. Isolierung von chromosomaler DNA aus Streptomyceten
Die S.lividans Stämme, aus denen die chromosomale DNA aufgereinigt werden sollte,
wurden für ca. 24 h in Jasenka-Medium + Sucrose als Standkultur inkubiert (30°C),
anschließend ü.N. als Schüttelkultur (30°C, 150 UpM.). 50-70 µg Zellen wurden in einem
1,5 ml Reaktionsgefäß abzentrifugiert (4000 g), in 700 µl Lösung I (50 mM Glucose, 25 mM
Tris/HCl pH 8, 25 mM Na2EDTA) mit 2 mg/ml Lysozym resuspendiert und 30’ bei 37°C
protoplastiert. Nach Zugabe von 35 µl 20 % SDS erfolgte ein 5’ Schritt bei RT, anschließend
wurde die Suspension mehrfach mit 500 µl Phenol/Chloroform phenolisiert, bis keine
Interphase mehr sichtbar war. Nach einem Chloroform-Schritt (500 µl) wurde der Überstand
mit 80 µl 3 M NaAc und 600 µl Isopropanol versetzt und das Reaktionsgefäß mehrfach
gewendet, bis die chromosomale DNA ausgefallen war. Die DNA wurde vorsichtig mit einer
Pipette angesaugt, in 1 ml 70 % EtOH gewaschen, anschließend getrocknet und in 50 µl TEPuffer aufgenommen.
2.9.1.8. Aufreinigung von DNA-Fragmenten aus Agarosegelen
Hierzu wurden, nach Anfärbung mit Ethidiumbromid, die über Agarose-Gelelektrophorese
aufgetrennten DNA-Fragmente mit Hilfe eines Skalpells ausgeschnitten und
weiterverarbeitet.
Aufreinigung mittels Glasmilch: Die Elution der DNA-Fragmente aus den Agaroseblöckchen erfolgte mit dem „QIAEX-Kit“ der Firma Qiagen, Hilden, nach Vorschrift des
Herstellers.
Aufreinigung mittels Säulen: Die Elution der DNA-Fragmente aus den Agaroseblöcken
erfolgte mit Hilfe des „QIAquick Gel Extraction Kit“ der Firma Qiagen, Hilden, nach
Vorschrift des Herstellers.
2.9.2. Transformation von Plasmiden
2.9.2.1. Transformation von E.coli (CaCl2-Methode)
Die E.coli-Stämme JM109 und JM110 konnten mit Hilfe von Elektroporation nicht
transformiert werden. Zur Herstellung CaCl2 kompetenter Zellen wurden 50 ml LB-Medium
mit 0,5 ml einer ü.N. Kultur angeimpft und bei 37°C (Schüttler, 120 Upm.) inkubiert, bis eine
OD600 von 0,6-0,7 erreicht war. Nach 10’ auf Eis wurden die Zellen abzentrifugiert
(6000 Upm., 4°C), in 0,5 ml 0,1 M CaCl2 (eiskalt) aufgenommen und 20 % Glycerin (eiskalt)
wurden hinzugegeben. Nach >20’ auf Eis wurden je 100 µl Portionen bei -70°C eingefroren.
- 40 -
Materialien und Methoden
Für die Transformation wurde zu einer 100 µl Portion Zellen die zu transformierende DNA
gegeben, nach 30’ auf Eis erfolgte ein Hitzeschock (2’ bei 42°C oder 5’ bei 37°C), die Zellen
wurden anschließend in 100 µl SOC-Medium aufgenommen und nach 45’ bei 37°C auf den
entsprechenden Selektionsmedien ausgestrichen.
2.9.2.2. Transformation von E.coli (Elektroporation)
Die Herstellung elektrokompetenter Zellen erfolgte, wie im Electroporator II Manual, Version
3.0 (Invitrogen) beschrieben.
Die Elektroporation erfolgte in Elektroporationsküvetten mit einem Spaltmaß von 0,1 cm
(Invitrogen), verwendet wurde ein Invitrogen Elektroporator II, nach dem offiziellen Rückruf
des Gerätes auf Grund von Sicherheitsmängeln, ein Gene PulserTM und Pulse Controller
(BioRad). Je 80 µl der elektrokompetenten Zellen wurden mit der DNA gemischt und in eine
eisgekühlte Küvette gegeben. Nach Elektroporation (Einstellungen: 10 W, 100 mA, 1500 V
für die Stromquelle, 150 Ω, 50 µF für den Elektroporator (Elektroporator II, Invitrogen),
1200 V, 200 Ω, 25 µF für den Gen Pulser/Pulse Controller (BioRad)) wurden die Zellen in
1 ml SOC-Medium aufgenommen und nach ca. 45’ bei 37°C auf den entsprechenden
Seleltionsmedien ausgestrichen.
2.9.2.3. Transformation von Streptomyceten (PEG-Methode)
Herstellung von Protoplasten: 10-20 ml Jasenka-Medium mit Sucrose wurden von Platte mit
Sporen angeimpft und ü.N. bei 30°C als Standkultur inkubiert, anschließend erfolgte eine
Inkubation als Schüttelkultur (30°C, 150 Upm.) für ca. 24 h. Die Kultur wurde abzentrifugiert
(10’, 4500 Upm.), zweimal mit je 5 ml 10,3 % Sucroselösung gewaschen und anschließend
das Mycel in 3,5 ml P-Puffer/g Mycel mit 7 mg Lysozym/g Mycel resuspendiert und für 3060’ bei 30°C (oder 37°C) inkubiert, bis etwa 90 % des Mycels protoplastiert waren. Nach
dreimaligem vorsichtigen Aufziehen der Suspension in einer 5 ml Pipette, zum Lösen der
Protoplasten voneinander, wurde die Suspension zentrifugiert (1’, 1000 Upm.), der
Überstand, der die Protoplasten enthielt, abgenommen und erneut zentrifugiert (7’,
3000 Upm.). Das Protoplastenpellet wurde in 1 ml P-Puffer resuspendiert und nach
Bestimmung der Protoplastenkonzentration (Auszählen in einer Thomakammer) und mit PPuffer auf eine Endkonzentration von 3-6x109 Protoplasten/ml verdünnt. Nach Aliquotierung
(100-300 µl jeweils) und 30’ auf Eis wurden die Protoplasten bei -70°C gelagert.
Materialien und Methoden
- 41 -
Transformation:
Lösung A:
25 ml 10,3 % Sucrose
0,2 ml Spurenelementlösung
1 ml
2,5 % K2SO4
0,2 ml 5 M CaCl2
0,5 ml 1 M Tris/Maleinsäure Puffer pH 8,0
Transformationspuffer (T-Puffer) modifiziert:
2 Teile Lösung A, 1 Teil P-Puffer und 1 Teil PEG1000 (autoklaviert, vor Gebrauch
aufschmelzen und etwas abkühlen lassen)
Zu 50 µl der Protoplastensuspension wurden 1-10 µl DNA-Lösung pipettiert, vorsichtig
gemischt und nach mehren Minuten auf Eis erfolgte die Zugabe von 200 µl T-Puffer. Nach
ca. 20’’ wurde der Ansatz von 10-1 bis 10-2 mit P-Puffer verdünnt und je 100 µl auf R+S
Platten mit 2 ml Weichagar (P-Puffer mit 0,4 % Agarose, 40°C) ausplattiert. Nach ca. 24 h
Inkubation bei 30°C waren die Protoplasten regeneriert (Ausbildung von Mycel,
mikroskopische Kontrolle) und konnten mit 2,5-3 ml Weichagar, der das zur Selektion
geeignete Antibiotikum enthielt, überschichtet werden.
2.9.2.4. Integration von Genen in das Chromosom von S.lividans
Nach Austreichen und Vereinzeln der Transformanden auf RSM-Medium Platten mit
25 µg/ml Thiostrepton und 25 µg/ml Hygromycin, wurden die Transformanden, entweder
über Stempeln oder Ausstreichen als Rasen, auf RSM Medium Platten mit 25 µg/ml
Hygromycin übertragen und für mehrere Tage bei 37°C inkubiert, bis Kolonien gewachsen
waren. Diese wurden auf RSM Hygromycin- und RSM Hygromycin/Thiostrepton-Platten
ausgestrichen und bei 30°C inkubiert. Die Kolonien, die auf RSM Hygromycin-Platten
wuchsen, jedoch nicht auf RSM Hygromycin/Thiostrepton Platten, hatten das hygRResistenzgen über eine Doppelrekombination ins Chromosom integriert, die auch auf
Hygromycin/Thiostrepton Platten wuchsen, hatten das temperatursensitive pGM160-Derivat
Konstrukt nicht komplett verloren. Es wurden nie „Einzel-Rekombinationen“ gefunden, die
das vollständige Konstrukt integriert hatten. Der Nachweis der korrekten Integration erfolge
nach Aufreinigung und Restriktion der chromosomalen DNA mit Hilfe von Hybridisierung
gegen verschiedene Proben.
- 42 -
Materialien und Methoden
2.9.3. Enzymatische in vitro Reaktionen von DNA
2.9.3.1. Restriktion von DNA
Plasmid- oder Phagen-DNA wurde in den passenden Reaktionspuffern verschiedener
Hersteller (Gibco, Roche, Invitrogen, Promega, MBI, Stratagene und New England Biolabs)
nach Vorschrift der Hersteller gespalten, eingesetzt wurden 5-10 U der entsprechenden
Restriktionsenzyme, die Inkubationszeit betrug ca. 4 h. Sollte mit mehr als einem
Restriktionsenzym gleichzeitig geschnitten werden, wurde ein Restriktionspuffer verwendet,
der die optimale Restriktionbedingungen der Enzyme ermöglichte. Im Falle, dass kein
optimaler Reaktionspuffer für mehrfach-Restriktionen vorhanden war, erfolgte eine
sequentielle Reaktion, hierfür wurde der Restriktionsansatz nach der ersten Reaktion gefällt
und in dem für das zweite Enzym geeigneten Puffer aufgenommen.
2.9.3.2. Ligation
Vektor und Fragmente wurden im Verhältnis 1 zu 4 für überhängende Enden, 1 zu 1 bei
glatten Enden, gemischt, nach Zugabe von 4 µl 5 x T4-Ligasepuffer (250 mM Tris/HCl
pH 7,6, 50 mM MgCl2, 5 mM ATP, 5 mM DTT, 25 % PEG8000) auf ein Volumen von 20 µl
mit seradest H2O aufgefüllt. Anschließend wurde 1 U T4 DNA-Ligase hinzugegeben. Die
Ligation erfolgte bei cohesiven Enden der Fragmente für 1h bei RT, bei glatten Enden über
Nacht bei 16 °C.
Desweiteren wurde das T4-Quick-Ligase Kit (NEB-Biolabs) nach Vorschrift des Herstellers
verwendet.
Da die hohe Ionenstärke von Ligationsansätzen sowie die darin enthaltenen Konzentrationen
an PEG auf Transformationen einen störenden Einfluß ausüben, wurden diese wie folgt
aufgereinigt: Der Reaktionsansatzes wurde mit seradest H2O auf 50 µl aufgefüllt, 500 µl nButanol zugegeben und der Ansatz kurz gemischt. Nach Zentrifugation bei 14000 UpM. für
10’ wurde der Rückstand getrocknet und in 5-10 µl seradest H2O aufgenommen. Diese
Lösung wurde dann direkt für die Transformation eingesetzt.
2.9.3.3. Klenow-Behandlung
Um 3’ überstehende Enden von Vektor oder Fragment aufzufüllen oder 5’ überstehende
Enden zu hydrolisieren, wurde die DNA nach der Restriktion gefällt und in Klenow-Puffer
(10 mM Tris/HCl, pH 7,5, 10 mM MgCl2, 50 mM NaCl) aufgenommen. Nach Zugabe von
dNTP's in einer Endkonzentration von je 0,125 mM und 1 U Klenow-Enzym/µg DNA wurde
der Ansatz 30’ bei RT inkubiert.
Materialien und Methoden
- 43 -
2.9.3.4. Polymerasekettenreaktion (PCR)
Die Amplifikation von DNA-Fragmenten mittels PCR wurde in einem Trio-Termocycler oder
Mono-Termocycler (jeweils Biometra, Göttingen) durchgeführt (nach: Mullis, K.B. and
Faloona, F.A.; 1987). Verwendet wurden Taq-Polymerase (Qiagen, Hilden oder
Eigenaufreinigung der Arbeitsgruppe) und die „proof-reading“ Polymerasen Vent (New
England Biolabs) und Pfu (Promega). Kontrollsequenzierung mit Vektoren ligierter
Fragmente ergab bei der Vent-Polymerase eine unerwartet hohe Fehlerrate von einem Fehler
auf ungefähr 1500-1600 Bp (sequenzierte Gesamtlänge ca. 10000 Bp), auf Grund dessen
wurde in späteren Versuchen nur die Pfu-Polymerase für „proof-reading“-Reaktionen
verwendet. Für eine Standardreaktion wurde die DNA für 3’ bei 96°C geschmolzen,
anschließend erfolgten 25-30 Zyklen mit Aufschmelzen bei 96-97°C für 40-45’’, Anbindung
der Oligos für 40’’ bei von den Oligos abhängiger Temperatur und Verlängerung der
Fragmente bei 72°C mit einer Zeit von 1 min/1000 Bp. Für die Pfu-Polymerase wurde eine
Verlängerungszeit von 2 min/1000 Bp gewählt. Um die Amplifikation der erwarteten
Fragmente zu optimieren und die Bildung nicht erwünschter Fragmente zu
verringern/verhindern, wurde in seltenen Fälle eine so genannte „Touch-Down“ PCR
durchgeführt, hierzu wurde eine ca. 6°C höhere Temperatur als die theoretische, für die
Anbindung verwendet und nach 3 Zyklen auf eine 3°C höhere, nach weiteren 3 Zyklen auf die
theoretische Anbindungstemperatur gesenkt. Zur Auflösung von Sekundärstrukturen wurde
DMSO in Konzentrationen von 5-10 % und „Q-Solution“ (Qiagen, Hilden) in
Konzentrationen bis maximal 20 % eingesetzt. Zur Aufreinigung der Fragmente nach PCR
wurde, wenn benötigt, das „QIAquick PCR Purification Kit“ der Firma „Qiagen“, Hilden,
verwendet, nach Vorschrift des Herstellers.
2.9.3.5. Herstellung von „Sonden“-DNA
Es wurden zwei Methoden zur Herstellung von Proben-DNA verwendet.
„random primed“ DNA-Markierungsmethode: Die Methode wurde, wie in der Vorschrift:
„DNA Labeling and Detection Kit, Nonradioactive“ (Roche/Boehringer Mannheim)
beschrieben, durchgeführt. Linearisierte DNA wurde durch Hitze denaturiert, markierte
Proben DNA wurde mit Hilfe des Klenow-Enzyms, Hexanukleotid-Mix (als Oligos) und
dNTP-Markierungsgemisch (mit Digoxigenin markierten dUTP) hergestellt.
Herstellung von Proben-DNA mittels PCR: Die Proben-DNA wurde mit Hilfe von PCR
hergestellt, als Polymerase wurde die Taq-Polymerase verwendet, jedoch wurden statt 1 µl
dNTP’s, 3 µl dNTP-Markierungsgemisch (mit DIG-dUTP) eingesetzt. Der Erfolg der
Markierung konnte durch Agarose-Gelelektrophorese kontrolliert werden, die markierte
Proben-DNA läuft deutlich langsamer als die vergleichbaren unmarkierten Fragmente.
- 44 -
Materialien und Methoden
2.9.4. DNA-DNA Hybridisierung
Transfer: Nach Auftrennung der DNA in Agarosegelen wurde der Teil, der große DNAFragmente enthielt (>2 kBp), für 10’ mit UV-Licht (260 nm) bestrahlt, um Einzelstrangbrüche
zu erzeugen. Eine Denaturierung der DNA erfolgte durch leichtes Schwenken in
Denaturierungspuffer (0,5 M NaOH, 1,5 M NaCl) für zweimal 20’. Der Transfer der
einzelsträngigen DNA auf Nylonmembranen erfolgte mit 20 x SSC (3 M NaCl, 0,3 M
Na2Citrat; pH 7,0). Die Membran wurde vor dem Auflegen auf das Gel kurz in 20 x SSC
gespült. Das Übertragen der DNA erfolgte ü.N. bei RT durch Kapillarkräfte. Anschließend
wurde die Nylonmembran kurz in 2 x SSC geschwenkt, zwischen zwei Whatman-Filtern
luftgetrocknet und zur Anbindung der DNA entweder bei 80°C für 1 h gebacken oder für 10’
mit UV-Licht (260 nm) bestrahlt.
Hybridisierung und immunologischer Nachweis: Die DNA-DNA Hybridisierung und der
immunologischer Nachweis erfolgte wie im Protokoll „DNA Labeling and Detection Kit
Nonradioactive“ (Boehringer/Roche) beschrieben, verwendet wurden Dig-dUTP markierte
Proben-DNAs und Hybridisierungs- und Waschtemperaturen zwischen 72°C und 68°C. 72°C
wurde für über PCR hergestelle Sonden verwendet, nach mehrmaligem Gebrauch wurde die
Temperatur sukzessive auf bis zu 68°C gesenkt, für über „random primed“ DNAMartkierungsmethode hergestellt Proben-DNA wurde eine Temperatur von 68°C verwendet.
Alkalische Phophatase Antikörper-Konjugat wurde für den immunologischen Nachweis
verwendet, für die Farbreaktion NBT und X-Phosphat, die Farbreaktion wurde, anders als
beschrieben, mit seradest H2O gestoppt, sobald die Signale erschienen waren. Sollte die
Membran wieder verwendet werden, durfte sie nicht getrocknet werden.
Entfärbung: Die Entfärbung erfolgte, wie im Protokoll „DNA Labeling and Detection Kit
Nonradioactive“ (Boehringer/Roche) beschrieben, verwendet wurde DMF bei 50-60°C. Die
Probe wurde, wie in der Methode I beschrieben mit Hilfe von NaOH abgewaschen. Nach
Trocknung konnte die Membran wieder verwendet werden.
2.9.5. Sequenzierung
Für die erste Methode wurden die Reaktionen mit dem „GATC-BioCycle Sequencing Kit“
der GATC GmbH, Konstanz und der Thermo SequenaseTM der Firma Amersham LIFE
SCIENCE, Cleveland Ohio, USA, durchgeführt. Für die Sequenzierung wurden unmarkierte
Primer verwendet, die Reaktion über „Cycle Sequencing“ mit Digoxigenin-markierten
ddNTP`s durchgeführt, hierbei wurden 10 % DMSO zugesetzt. Die Reaktions-Produkte
wurden mit Hilfe des GATC 1500-Systems aufgetrennt und mittels Farbreaktion
nachgewiesen (jeweils nach Vorschrift des Herstellers).
Die zweite Methode mit dem „Cy5TM-dATP Labelling Mix“ der Firma Pharmacia (Uppsala,
Schweden), ist im Prinzip eine Sequenzreaktion mit radioaktiv markierten alpha S35 dATP,
nur das statt der radioaktiven eine Markierung mit dem Fluoreszensfarbstoff Cy5TM an den
Materialien und Methoden
- 45 -
dATP`s verwendet wird. Die Sequenzreaktion erfolgte nach Vorschrift des Herstellers, alle
weiteren Arbeiten wurden auf einem „ALFexpressTM“ DNA Sequenzierer (Fa. Pharmacia)
durch Doris Hörnschemeyer, Arbeitsgruppe Genetik durchgeführt.
Bei der dritten Methode erfolgte die Rektion wie bei der ersten Methode über „Cycle
Sequencing“ allerdings mit Fluoreszens-markierten ddNTP`s (ABI Big Dye Cycle
Sequencing Kit). Die Sequenzreaktion erfolgte nach Vorschrift des Herstellers. Der
Sequenzlauf wurde von Ulrike Coja (Spezielle Botanik) auf einem ABI-Sequenzer
durchgeführt.
Des Weiteren wurden auch zeitweilig als Auftragsarbeit Konstrukte zur Sequenzierung an
einen kommerziellen Anbieter (MWG-Biotech AG, Ebersberg) verschickt.
2.10. Fluoreszensmikroskopie
Die Fluoreszensmikroskopie erfolgte an einem Zeiss Axiovert 10 Fluoreszensmikroskop, für
alle dargestellten Abbildungen wurde ein Achroplan 40x/0,65 Objektiv verwendet. Ein HQFilter-Satz der Firma „AHFanalysentechnik“ (Tübingen) für den Nachweis von FITC fand
Verwendung (F41-001, Anregungsfilter HQ480/40, Strahlungsteiler Q505LP, Sperrfilter
HQ535/50), die Aufnahmen wurden mit Hilfe einer Phothometrix Sensys 1400 Kamera
aufgenommen und mit Hilfe der Softwareprogramme IPLap 5.32 und IPLap 3.00 der Firma
„Scananalytics“ verarbeitet.
2.11. Verwendete biologische Softwareprogramme
Die Sequenzauswertung erfolgte mit Hilfe des Programms „Chromas“, Version 1.42 von
„Conor McCarty“ und „DNA-Manager“ in verschiedenen Versionen, die weitere Bearbeitung
wurde in „Clone Manager“ in verschiedenen Versionen durchgeführt, wie auch die
Konstruktion von Plasmiden und z.B. der Disruptionsmutanten.
Die Bestimmung offener Leseraster erfolgte mit Hilfe des Programms „FramePlot“ in
unterschiedlichen Versionen von „Jun Ishikawa“. Zur Suche nach verwandten Proteinen oder
DNA-Sequenzen wurden primär verschiedene „Blast“-Versionen der NCBI- und EMBL-EBIServer verwendet, des weiteren „Blitz“ und „Fasta“ (EMBL-EBI-Server). Alignments
verschiedener Proteine erfolgten primär mit Hilfe der Programme „ClustalW“ in
verschiedenen Versionen und auf unterschiedlichen Servern und „MultAlin“ von „Florence
Corpet“, das sich besonders geeignet bei Untersuchungen von KsuF erwies. Die graphische
Darstellung von Alignments wurde mit Hilfe des Programms „Boxshad“ durchgeführt, mit
anschließender Bearbeitung in CorelDraw. Die Bestimmung von Signalpeptiden erfolgte mit
- 46 -
Materialien und Methoden
einem Programm auf Basis des „Neural Networks-“ und des „Hidden Markov-Modells“ auf
dem SignalP 3.0 Server. Die theoretische Berechnung von Kristallstrukturen auf Basis von
Homologien erfolgte mit Hilfe des „First Approach Mode“ und „Alignement Interfaces“ des
„Swiss-Modell Servers“ des „SIB Biozentrums Basel“.
Ergebnisse
- 47 -
3. ERGEBNISSE
3.1. Analyse der Sequenzen
Vor Beginn meiner Diplomarbeit war der in Abb. 3.1 mit schwarz markierte Bereich
sequenziert. Im Rahmen der Diplomarbeit wurde die Sequenz von ksuF vervollständigt, des
Weiteren wurde die 3’ Hälfte von KsuL sequenziert (Abb. 3.1., in grün dargestellt). In dieser
Arbeit erfolgte die Sequenzierung des restlichen Teils des auf CCM1 lokalisierten Fragmentes
(in rot dargestellt), des Weiteren wurde der in früheren Arbeiten sequenzierte Abschnitt (in
schwarz dargestellt) zur Korrektur der wenigen vorhandenen Fehler erneut einzelsträngig
sequenziert. Zur Vervollständigung von ksuC erfolgten, in Zusammenarbeit im Rahmen der
Diplomarbeit von Ralf Steger, die Isolierung und Sequenzierung des entsprechenden
Abschnitts (in blau) aus einer Charon 35 S.lividans 66 Phagenbank (CCM3). Mit einer Länge
von 13920 Bp unterscheidet sich die S.lividans 66 Sequenz von der entsprechenden aus
S.coelicolor A3(2) nur an 66 Stellen, ein Zeichen der nahen Verwandtschaft dieser beiden zur
S.violacoeruber-Familie gehörenden Stämme. Es findet sich ein offenes Leseraster, orfP
benannt, mit einer Länge von 1472 Bp, das für ein putatives extrazelluläres Protein mit einer
Länge von 490 Aminosäuren determiniert, ein N-terminales putatives Signalpeptid ist zu
identifizieren. OrfP zeigt Homologien zu extrazellulären Hydrolasen, vor allem zu
Triaminopeptidasen. Flussabwärts und in entgegengesetzter Flussrichtung von orfP endet, nur
durch 1 Base getrennt, orfT (612 Bp), das für einen 204 Aminosäuren langen
Transkriptionsregulator der TetR-Familie determiniert. orfT folgt in entgegengesetzter
Richtung, mit einem intergenischen Abstand von 51 Bp, ein 549 Bp langes offenes Leseraster
mit dem Namen orf?ace. Dieses determiniert für eine 183 Aminosäuren lange
Acetyltransferase der GNAT Acetyltransferase Familie. orfP, orfT und orf?ace wurden im
Rahmen dieser Arbeit nicht weiter betrachtet. Alle weiteren Gene und hiervon
determinierenden Proteine werden in folgenden Kapiteln besprochen. Die vollständige
Sequenz ist in Anhang A dargestellt.
- 48 -
Ergebnisse
Abb. 3.1: Der 13920 Bp lange Abschnitt des S.lividans 66 Chromosoms. Die in den beiden Charon 35 Phagen
CCM1 und CCM3 (RS1) und dem Konstrukt pJO1 integrierten Abschnitte sind im unteren Bereich als schwarze
Linien dargestellt, die gefundenen Gene und offenen Leseraster als rote Pfeile. Der in früheren Arbeiten
sequenzierte Bereich ist als schwarzer, der im Rahmen der Diplomarbeit sequenzierte als grüner, im Rahmen
dieser Arbeit sequenzierte als roter und in Zusammenarbeit mit Ralf Steger sequenzierte als blauer Balken
dargestellt.
Anders als in den potentiellen Promoterbereichen von ksuC/ksuB, ksuL und cmlR, finden sich
im intergenischen 325 Bp langen Abschnitt zwischen den Startkodons von ksuF und kcsA
eine auffällig hohe Anzahl von Palindromen, „direct-“ und „invertet repeats“ (siehe auch
Anhang A und Abb. 3.2). Es können zwei identische palindromische Sequenzen (schließen
den DNA-Bereich, der die restlichen repetitiven Sequenzen enthält, ein), acht „inverted
repeats“, mit einer Mindestlänge von 7 Nukleotiden und vier verschiedene „direct repeat“Sequenzen, identifiziert werden. Repetitive Strukturen im intergenischen Bereich vor Genen
besitzen oft eine Funktion als Operator-Bindestellen von regulatorischen Proteinen. Auf
Grund des zumeist verhältnismäßig großen Abstandes zwischen den repetitiven Sequenzen
von 50 und mehr Basenpaaren ist die Funktion als Operatorsequenzen für die „inverted
repeats“ und die palindromische Sequenzwiederholung unwahrscheinlich. Eine Ausnahme
bildet „inverted repeat 11“ mit einem Abstand von 22 Bp. Die „direct repeats“ sind auffällig.
Das Hexamer „direct repeat 1“ mit der Consensus-Sequenz CCG/tACA/g findet sich
siebenmal, davon fünfmal mit der Sequenz CCGACA. Die „repeats“ sind fünfmal durch 5
Nukleotide getrennt, einmal durch 4. Das Hexamer CGACGG „direct repeat 2“ ist viermal,
durch 10, 9 und 10 Nukleotide, das Hexamer AGGAGT „direct repeat 3“ dreimal, durch 6
und 22 Bp und das Nonamer „direct repeat 4“ ACCGCCGCC zweimal, durch 9 Basen
voneinander getrennt, auszumachen.
Ergebnisse
- 49 -
Abb. 3.2: Repetitive Sequenzen im intergenischen Abschnitt zwischen ksuF und kcsA. Dargestellt sind die
repetitiven „direct-“, „inverted repeat“ und „palindromischen“ Sequenzen. Die Positionen sind jeweils den
Sequenzen vorangestellt (siehe auch Anhang A). Die jeweils identischen Basen sind in Grossbuchstaben
dargestellt und unterstrichen. Der Abstand zwischen der letzen Base des vorherigen und der ersten des
nachfolgenden „repeats“ ist jeweils zwischen den „repeats“ eingetragen. Der Abstand zwischen der jeweiligen
ersten Base ist vorangestellt.
3.2. Klonierung der Gene des untersuchten Bereiches und Produktion der
kodierenden Genprodukte in E.coli
3.2.1. Strategie zur Gewinnung des C-Terminus von KcsA und der Antikörper
Die in früheren Arbeiten hergestellten Antikörper gegen KcsA (H. Splitt) zeigten eine relativ
geringe Antigenität gegen KcsA, jedoch relativ starke Kreuzreaktionen mit den Proteinen der
Membranfraktionen aus E.coli und S.lividans (nicht dargestellt). Die membrandurchspannenden Teile eines Membranproteins sind häufig wenig antigen. Deshalb sollte als
Antigen der aufgereinigte cytoplasmatische C-Terminus von KcsA verwendet werden.
Hierzu wurde ein 217 Bp Fragment mit Hilfe von PCR (Vent-Polymerase) amplifiziert und
nach SphI/HindIII-Restriktion das entstandene 199 Bp Frg. mit dem ebenso geschnittenen
Vektor pQE32 (Qiagen) ligiert. Unter Induktion mit IPTG sollte ein 63 Aminosäuren langes
Peptid hergestellt werden, das N-terminal einen 6x His-Tag und dahinter den 48 Aminosäuren
langen vorwiegend cytoplasmatischen C-terminalen Teil von KcsA trägt. Anschließend wurde
- 50 -
Ergebnisse
das entstandene Konstrukt (erhielten den Namen pQE317, Abb. 3.3) in E.coli M15[pREP4]
transformiert.
Abb. 3.3: Produktionsvektor pQE317. Für die Amplifikaton des für den C-terminalen Teil von KcsA
kodierenden Bereiches wurden die Oligos pkcsas1 (enthält zusätzlich eine SphI-Schnittstelle) und pkcsah2
(enthält zusätzlich eine HindIII-Schnittstelle) verwendet.
Nach Überproduktion (1 mM IPTG, 4 h, 37°C) und Aufreinigung über Ni-NTA unter nativen
oder denaturierenden Bedingungen zeigte sich, dass neben dem erwarteten Protein mit einer
Größe von ca. 6,3 kDa, auch zwei weitere Proteine bei ca. 9 kDa und ca. 30 kDa aufgereinigt
wurden (Abb. 3.4 a). Verschiedene Kolonien zeigten ein ähnliches Produktionsverhalten. Das
bei 9 kDa migrierende Protein verhält sich wie das erwartete bei 6,3 kDa. Beide eluieren z.B.
unter identischen Bedingungen und sind schwer aus einem Gel auf Membranen transferierbar
(siehe Abb. 3.4 b). Weder durch Erhitzen (wie bei KcsA), noch durch reduzierende Agenzien
(DTT/ Mercaptoethanol) konnte die 9 kDa Bande aufgetrennt werden (Abb. 3.4 a und b).
Sowohl das 6,3 kDa Protein, als auch das bei 9 kDa laufende Protein zeigten Kreuzreaktionen
gegen Anti-His-Tag-Antikörper, nicht jedoch das bei 30 kDa (nicht dargestellt). Unter
„nativen“ und stringenteren (Erhöhung der Imidazolkonzentration beim Anbinden)
Bedingungen konnte die Co-Aufreinigung des Proteins bei ca. 30 kDa verhindert werden,
jedoch nicht die des bei 9 kDa migrierenden Proteins (Abb. 3.4 c).
Ergebnisse
- 51 -
Abb. 3.4 a-d): Aufreinigung des C-terminalen Bereiches von KcsA. In allen 4 Abbildungen sind mit
Coomassie gefärbte Gele dargestellt, links jeweils die Mobilität der Proteine. a) und b) Aufgetragen wurden
jeweils 4 Proben von unter denaturierenden Bedingungen (8 M Harnstoff) aufgereinigtem Protein. In b) ist das
Gel nach Transfer der Proteine auf eine Membran gezeigt. Zu sehen sind die nicht transferierten Proteine. Spur
1: Probe nicht aufgekocht, Spur 2: Probe aufgekocht, Spur 3: Probe nicht aufgekocht mit Mercaptoethanol, Spur
4: Probe aufgekocht mit Mercaptoethanol c) Spur 1: aufgetragen wurde unter „nativen“ und stringenten
Bedingungen aufgereinigtes Protein und in d), Spur 1: nach Aufreinigung des 6,3 kDa Peptid über ein Biorad
Modell 422 Electro-Eluter-System. 8S: Proteinstandard
Die Cytoplasmafraktion von E.coli M15[pREP4] pQE317 (4 Liter Kultur) wurde nach
Überproduktion (Induktion mit 1 mM IPTG, ca. 4 h bei 37°C) unter „nativen“ Bedingungen
zweimal über Ni-NTA aufgereinigt (siehe Material und Methoden). Nach Auftrennung über
ein denaturierendes Gel (Schägger-von Yagow) wurde die bei ca. 6,3 kDa migrierende
Proteinbande ausgeschnitten, über ein Electro-Eluter-System eluiert (Abb. 3.4 d) und ca.
100 µg für die Immunisierung in Meerschweinchen eingesetzt.
Um die Menge der Antikörper zu erhöhen, erfolgte, nach dem Test der zweiten gelieferten
Antikörper-Charge („grand bleeding“), eine weitere Immunisierungsrunde mit 100 µg Peptid.
Spätere Analysen zeigten, dass die nach dieser weiteren Immunisierung ausgelieferten
Antikörperchargen eine deutlich geringere Kreuzreaktion gegen KcsA besaßen, als die der
zweiten Charge (Ergebnisse nicht dargestellt). Sowohl gegen KcsA (Abb. 3.5 a), als auch
- 52 -
Ergebnisse
gegen den C-terminalen Teil (Abb. 3.5 c) werden gute Kreuzreaktionen gefunden. Gegen
E.coli M15[pREP4] pQE317-Zellextrakt finden sich keine unspezifischen Signale (Abb. 3.5.
c), gegen S.lividans NI-Zellextrakt erscheinen einige unspezifische Kreuzreaktionen
(Abb. 3.5 b).
Abb. 3.5 a-c): Test der gegen den C-terminalen Teil von KcsA hergestellten Antikörper. Getestet wurden
jeweils drei verschiedene Antikörperkonzentrationen. Aufgetragen wurden: Membran a) Spuren 1-3: His-Tag
KcsA aufgereinigt, nicht aufgekocht; Spuren 5-7: His-Tag KcsA aufgereingt, aufgekocht (nicht vollständig
monomerisiert). Membran b) Spuren 1-3: S.lividans NI Membranfraktion. c) Spuren 1, 3 und 5: Aufgereinigtes
His-Tag C-term KcsA; Spuren 2, 4 und 6: Zellextrakt von E.coli M15[pRep4] pQE317. 8S: Proteinstandard. Die
Laufhöhe der Tetramerform von His-Tag KcsA ist in a) durch ein X markiert, die der Monomer-Form mit einem
Punkt. Um die Erkennbarkeit des 8S-Proteinstandards zu verbessern, wurde der Kontrast des entsprechenden
Abschnittes in b) verstärkt.
Wie in zahlreichen Versuchen gezeigt wurde, kann KcsA unter Standard-Bedingungen
(„Semi-dry-Transfer“, Puffer: 10 mM Caps/NaOH, 10 % MeOH, pH 11, ca. 1 h bei
1 mAmp/cm2) nur sehr schlecht auf Membranen übertragen werden, wobei das His-Tag
Protein schlechter übertragen wird als das native, die Tetramer-Formen schlechter als die
Monomere (siehe Abb.3.5 a). Auch das His-Tag C-terminale Ende von KcsA, das bei ca.
6,3 kDa migriert und die Bande bei 9 kDa, können unter diesen Bedingungen nur sehr
schlecht transferiert werden (Abb. 3.4 b). Vermutlich verantwortlich sind die ungewöhnlich
hohen pK-Werte der Proteine (theoretische pI für KcsA: 10,3; für His-Tag KcsA: 10,76; für
His-Tag C-term KcsA: 11) und die Eigenschaft, dass KcsA ohne Detergenz offensichtlich
aggregiert und nicht transferierbare Komplexe bildet. Dies hat zur Folge, dass geringere
Mengen an KcsA-Protein besser zu transferieren sind als größere. Höhere Konzentrationen an
Protein führen dazu, dass bei Transfer nur die Randbereiche der Monomer und TetramerBanden auf die Membran übertragen wird; der Zentralbereich ist maskiert, hier ist kein
Transfer zu erkennen (Abb. 3.5. a).
Ergebnisse
- 53 -
Zur Optimierung des Transfers wurden verschiedene Bedingungen getestet.
Tris/Glycin/Methanol-Puffer zeigte eine leichte Verbesserung im Transfer gegenüber dem
CAPS/Methanol Standardpuffer. Bei Gegenwart der Detergenzien Dodecylmaltosid (DDM,
5 mM) und Triton X100 (0,4 %) wurde die Bindung von Proteinen an die Membran
verhindert und die Elution von KcsA aus dem Gel nicht verbessert. Steigende SDSKonzentrationen im Transferpuffer verbessern den Transfer aus dem Gel in Tris/GlycinPuffer. Die Bindung an die Membran wurde bei höheren Konzentrationen reduziert, eine
Konzentration von 0,07 % SDS erwies sich als optimal. Methanol wird für die Aktivierung
der Membran benötigt, Konzentrationen ab ca. 10 % führten zur Reduzierung des Transfers
aus dem Gel. Bei 20 % war der Transfer sehr stark eingeschränkt. Bei einer Konzentration
von 7 % konnte keine Einschränkung des Transfers beobachtet werden. Die Methode des
„Semi-Dry“-Transfers erwies sich gegenüber der des „Nass“-Transfers bei allen getesteten
Bedingungen als effektiver.
Die optimalen Bedingungen sind: „Semi-Dry“-Transfer, Transferpuffer: 25 mM Tris/GlycinPuffer pH 7,5 mit 7 % MeOH und 0,07 % SDS, 1 mAmp/cm2. Durch eine Verlängerung der
Transferzeit auf ≥3 h gelang es, sowohl die Monomere, als auch die Tetramer-Form fast
vollständig zu transferieren.
3.2.2. Produktion von KsuB und von gegen KsuB gerichteten Antikörpern
Für die Synthese von KsuB in E.coli wurden das Gen jeweils in die Überproduktionsvektoren
pQE32 und pQE70 integriert. Nach Induktion mit IPTG sollte die Produktion einer Nterminalen His-Tag-Form der Proteine (pQE32-Derivat) und einer Form in Originallänge
ohne zusätzlichen His-Tag erfolgen (pQE70-Derivat). Das Gen ksuB wurde vom Plasmid
pOBH23 amplifiziert (Vent-Polymerase), als HindIII/SphI Fragment mit den ebenso
geschnittenen Vektor pUC18 ligiert. Nach Kontrollsequenzierung wurde aus diesem pORFZ
benannten Konstrukt wieder über HindIII/SphI-Restriktion das Fragment ausgeschnitten, mit
den ebenso geschnittenen Vektoren pQE32 und pQE70 ligiert und in E.coli M15[pREP4]
transformiert. Die Konstrukte erhielten den Namen pQE309 (pQE32-Derivat, Abb. 3.6) und
pQE709 (pQE70-Derivat, Abb. 3.6). Nach Induktion durch IPTG sollte der pQE309
Transformant ein 323 Aminosäuren langes Protein synthetisieren mit einem N-terminalen
His-Tag, der pQE709 Transformant das 310 Aminosäuren lange dem aus dem Wildtypstamm
entsprechende Protein.
- 54 -
Ergebnisse
Abb. 3.6: Konstrukte pQE309 und pQE709. Das in die Vektoren pQE32 und pQE70 integrierte Fragment ist
in gelb dargestellt. Für die Amplifikation des Fragmentes wurden die Oligos orfZstart und orfZende verwendet,
das HindIII/SphI- Fragment besitzt eine Größe von 929 Bp.
Bei der Produktion von KsuB und His-Tag KsuB aus den Stämmen E.coli M15[pREP4]
pQE709 und pQE309, zeigte sich, dass bei Induktion mit 1 mM IPTG und Inkubation bei
37°C die gesuchten Proteine mehr oder weniger vollständig in Form von „Inclusion-Bodies“
vorlagen. Durch Senkung der Inkubationstemperatur und der IPTG-Konzentration verbesserte
sich die Löslichkeit, bei Inkubation bei 16°C, Induktion mit 0,1 mM IPTG und weitere
Inkubation bei 16°C, konnte erreicht werden, dass die Proteine vollständig löslich vorlagen.
Zur Antikörperherstellung wurden die „Inclusion-Bodies“ aus E.coli M15[pREP4] pQE309
mit Triton X100 gewaschen und unter denaturierenden Bedingungen zweimal über Ni-NTA
aufgereinigt (siehe Abb. 3.8 a). Nach Konzentration wurde das Protein über SDS-Page
aufgetrennt, über das „Biorad“ Modell 422 Electro-Eluter-System aufgereinigt und zur
Herstellung von Antikörpern in Meerschweinchen versendet (siehe Abb. 3.8 b).
3.2.3. Herstellung von Konstrukten für die Synthese und Reinigung von KsuL
Vom Konstrukt pOBH23 wurde ksuL, sowohl mit, als auch ohne den für die Signalsequenz
kodierenden Bereich, amplifiziert (Vent-Polymerase) und nach HindIII/SphI-Restriktion
jeweils mit dem ebenso geschnittenen Vektor pUC18 ligiert; die Konstrukte erhielten die
Namen pORFX1 (Originallänge, mit dem für die Signalsequenz kodierenden Bereich) und
pORFX2 (ohne den für die Signalsequenz kodierenden Bereich). Nach Verifizierung des in
pORFX1 und in pORFX2 integrierten Bereiches durch Sequenzierung, wurde das Insert durch
eine HindIII/SphI Restriktion ausgeschnitten, mit den ebenso geschnittenen Vektoren pQE32
und pQE70 ligiert und in E.coli M15[pREP4] transformiert. Die Konstrukte erhielten die
Namen pQE315 (mit Signalsequenz und His-Tag, 598 Aminosäuren), pQE715 (Mit
Signalsequenz, 585 Aminosäuren), pQE316 (Ohne Signalsequenz, mit His-Tag, 576
Ergebnisse
- 55 -
Aminosäuren) und pQE716 (Ohne Signalsequenz, 563 Aminosäuren) und sind in Abb. 3.7
dargestellt.
Abb. 3.7: Konstrukte pQE315, pQE715, pQE316 und pQE716. Die in die Vektoren pQE32 und pQE70
integrierten Fragmente sind in gelb dargestellt. Für die Amplifikation von ksuL mit Signalsequenz wurden die
Oligos orfX1Start und orfXende verwendet (pQE315 und pQE715), für ksuL ohne Signalsequenz orfX2start und
orfXende (pQE316 und pQE716).
Bei der Synthese von KsuL in den verschiedenen Formen (KsuL mit und ohne Signalsequenz,
jeweils mit oder ohne His-Tag) zeigte sich, das nur bei den Stämmen, die KsuL mit His-Tag
synthetisieren sollten, eine Produktion nachgewiesen werden konnte (E.coli M15[pREP4]
pQE315 und pQE316). Eine Kontrollsequenzierung der Konstrukte pQE715 und pQE716
zeigte weder im integrierten Bereich, noch im Promoter/Operator-Abschnitt des Vektors
Fehler, es konnte nicht geklärt werden, warum keine Synthese nachweisbar war. Bei
Inkubation bei 37°C und Induktion mit 1 mM IPTG wurden His-Tag-KsuL mit und ohne
Signalsequenz wie bei KsuB vollständig in Form von „Inclusionbodies“ gefunden. Anders als
bei KsuB konnte jedoch die Löslichkeit der Proteine, z.B. durch Inkubation bei 16°C und
Induktion mit geringeren Konzentrationen an IPTG, nicht erhöht werden. Für die
Immunisierung wurde His-Tag KsuL mit Signalsequenz (E.coli M15[pREP4] pQE315) aus
„Inklusionbodies“, wie schon für KsuB beschrieben, aufgereinigt und zur Herstellung von
Antikörpern versendet; als Tierart wurde Ratte gewählt (siehe Abb. 3.8 c und d).
- 56 -
Ergebnisse
Abb. 3.8 a bis d): Aufreinigung von His-Tag KsuB und His-Tag KsuL aus E.coli und Test der gegen KsuB
und KsuL hergestellten Antikörper. Dargestellt sind in a) und c) mit Commassie gefärbte Gele. Aufgetragen
wurden, nach Aufreinigung über Ni-NTA, in a) vier verschiedene His-Tag KsuB- und in c) vier verschieden HisTag KsuL- (mit Signalsequenz) Elutionen. Jeweils Spur 1: Elution mit 200 mM NaCl, Spur 2: 300 mM NaCl,
Spur 3: 400 mM NaCl und Spur 4: 500 mM NaCl. In b) und d) ist der Nachweis der Antikörperaktivität der
Antikörper gegen KsuB in b) und gegen KsuL in d) gezeigt. Verwendet wurden 1/10000 Verdünnungen der
jeweiligen Antikörper. Aufgetragen wurden: Aus E.coli aufgereinigtes His-Tag KsuB- in b), Spur 1 und His-Tag
KsuL-Protein mit Signalsequenz in c), Spur 1. 7B und 8S: Proteinstandards. Zur Verbesserung der Erkennbarkeit
wurde jeweils der den 8S-Standard tragende Abschnitt bildlich bearbeitet.
3.2.4. Gewinnung von KsuC und von gegen KsuC gerichteten Antikörpern
Die Herstellung der Konstrukte, die Überproduktion und Aufreinigung der Proteine und die
Aktivitätskontrolle der erhaltenen Antikörper erfolgte unter direkter Betreuung im Rahmen
der Diplomarbeit von Ralf Steger. Vom Konstrukt pBRS1 wurde ksuC als 0,9 kBp Fragment
amplifiziert, mit einer eingefügten SphI- und HindIII-Schnittstelle im Start- bzw hinter dem
Stopcodon. Nach entsprechender Restriktion erfolgte die Ligation mit dem Vektor
pWHM3be, das Konstrukt wurde pORS1 benannt. Nach Verifizierung der Sequenz wurde das
Insert nach SphI/HindIII-Restriktion mit den ebenso geschnittenen Vektoren pQE32 und
pQE70 ligiert und in E.coli M15[pREP4] transformiert. Die Konstrukte erhielten die Namen
pQE321 und pQE721 (Abb. 3.9).
Ergebnisse
- 57 -
Abb. 3.9: KsuC-Überproduktionskonstrukte pQE321 und pQE721 Das in die beiden Vektoren pQE32 und
pQE70 integrierte ca. 900 Bp lange ksuC- tragende Fragment ist in Gelb dargestellt. Von pQE321 sollte unter
Induktion ein 298 Aminosäuren langes His-Tag KsuC synthetisiert werden, von pQE721 ein 285 Aminosäuren
langes Protein, das in der Sequenz und Länge dem Wildtyp KsuC entspricht.
Nach Induktion mit IPTG erfolgte von E.coli M15[pREP4] pQE321 die Produktion eines HisTag KsuC-Proteins, von pQE721 eines KsuC in Originallänge (nicht dargestellt). Nach
Synthese fanden sich His-Tag KsuC und KsuC ohne His-Tag anscheinend vollständig in
„Inklusionbodies“ wieder; ähnlich wie für KsuL gelang es nicht, die Solubilisierung durch
Reduzierung der IPTG-Induktionsmenge und Senkung der Kultivierungstemperatur zu
erreichen.
Die Aufreinigung von His-Tag KsuC für die Immunisierung erfolgte ähnlich, wie für die
Aufreinigung von His-Tag KsuB und His-Tag KsuL beschrieben. Nach Waschen der
Inklusionbodies erfolgte die Aufreinigung unter denaturierenden Bedingungen über Ni-NTAAffinitätschromatographie (nicht dargestellt), anschließend über ein „Mini-Prep-CellSystem“. Die Immunisierung wurde in Meerschweinchen und in Huhn durchgeführt.
Während aus Meerschweinchen spezifische Antikörper erhalten werden konnten, waren die
Antikörper aus Huhn auf Grund einer zu großen Unspezifität unbrauchbar (nicht dargestellt).
- 58 -
Ergebnisse
3.3. Physiologische Studien von S.lividans und ausgewählten Mutanten
3.3.1. Immunologischer Nachweis der Proteine in S.lividans WT
S.lividans 66 WT wurde in Minimalmedium ohne zusätzlich Salz, 100 mM, 200 mM,
300 mM, 400 mM, 500 mM und 700 mM NaCl angezogen und die Produktion von KsuB,
KsuC und KsuF immunologisch untersucht (Abb. 3.10 b bis d). Für KsuB und KsuC zeigt
sich jeweils eine sehr hohe Synthese der Proteine bei NaCl-Konzentrationen über 300 mM
NaCl, wobei die Produktion bei 700 mM NaCl vermutlich auf Grund geringer
Wachstumsraten reduziert ist. Bei der Synthese von KsuB ist eine leichte Steigerung bei
Erhöhung der NaCl-Konzentration auf 200 mM zu erkennen und eine deutlich stärkere ab
300 mM NaCl. Für KsuC findet sich erst ein Nachweis bei 200 mM NaCl und eine deutliche
Steigerung der Synthese bei 300 mM NaCl.
Eine Produktion von KsuF kann im Wildtyp nicht nachgewiesen werden (Abb. 3.10 d). Sie
findet sich nur in der Kontrolle S.lividans TK21 pJO1 (Abb. 3.10 d, Spuren 8 und 9, siehe
auch nächstes Kapitel). Vergleichbare Ergebnisse finden sich bei Anzucht in Minimalmedium
mit identischen KCl-Konzentrationen statt NaCl (nicht dargestellt).
Ergebnisse
- 59 -
Abb. 3.10 a-d): Nachweis der Synthese von KsuB, KsuC und KsuF in S.lividans 66 WT unter
verschiedenen Salzbedingungen. Dargestellt ist in a) ein Coomassie gefärbtes Gel. In den weiteren
Abbildungen ist der Nachweis der Synthese in verschiedenen Cytoplasmafraktionen nach Transfer auf
Membranen mit Antikörpern gegen KsuB in b), gegen KsuC in c) und gegen KsuF in d), dargestellt.
Aufgetragen wurden auf Spur 1: S.lividans 66 WT nach Wachstum in MM40-Medium ohne Salz, auf Spur 2: mit
100 mM NaCl, auf Spur 3: mit 200 mM NaCl, auf Spur 4: mit 300 mM NaCl, auf Spur 5: mit 400 mM NaCl, auf
Spur 6: mit 500 mM NaCl und auf Spur 7: mit 700 mM NaCl. 7B Proteinstandard. Auf Spur 8 und 9 sind
Cytoplasmafraktionen von S.lividans TK21 pJO1 nach Wachstum in MM40-Medium ohne Salz auf Spur 8 und
500 mM KCl auf Spur 9, dargestellt. Aus einer Jasenka Medium mit Sucrose ü.N. Standkultur und nach
Schütteln für ca. 5 h, wurden die Zellen in die unterschiedlichen MM40 Kulturen mit unterschiedlichen
Salzkonzentrationen überführt und für eine weitere Nacht als Schüttelkultur inkubiert.
- 60 -
Ergebnisse
3.3.2. Synthese der Proteine in S.lividans TK21 pJO1
Das Konstrukt pJO1 ist ein pWHM3be Derivat, das ein 2,75 kBp Insert mit dem 5’ Teil von
orfI, vollständig kcsA und ksuF und dem 3’ Ende von ksuL trägt. Die Synthese des Plasmidund Chromosomal- determinierten KsuF und KcsA und des nur Chromosmal- determinierten
KsuB und KsuC wurde in der S.lividans TK21 pJO1 Transformante bei Wachstum in
Minimalmedium mit verschiedenen Salzkonzentrationen zwischen 0 mM und 700 mM KCl
oder 300 mM Sucrose untersucht (Abb. 3.11 a-d). Vergleichbare Ergebnisse finden sich bei
Synthesen in Minimalmedium mit NaCl (nicht dargestellt).
Für KsuB, KsuC und KsuF ist eine von der KCl-Konzentration abhängige Produktion
nachweisbar. Die höchste wird jeweils bei Wachstum bei KCl Konzentrationen zwischen 200
und 500 mM KCl erreicht. Sie reduziert sich jeweils bei 700 mM KCl; KCl-Konzentrationen
von mehr als 500-600 mM KCl reduzieren die Wachstumsrate der Zellen, bei 700 mM KCl ist
das Wachstum deutlich reduziert. Für KsuB zeigt sich bei steigenden Konzentrationen bis
300 mM KCl eine deutliche Steigerung der Synthese (Abb. 3.11 b). Für KsuC ist in diesem
Fall bei Wachstum in Minimalmedium ohne zusätzlich Salz oder mit 100 mM Salz nur eine
gleich bleibend sehr geringe Produktion nachweisbar (in Abb. 3.11 c, Spuren 1 und 2). KsuF
wird bei Plasmid determinierter Synthese in so großen Mengen produziert, dass die
Produktion auf einem mit Coomassie gefärbten Gel deutlich zu erkennen ist (Abb. 3.11 a,
Laufhöhe mit Pfeilen markiert). Auch hier steigt die Synthese von KsuF mit Erhöhung der
KCl-Konzentration im Medium an, was aufgrund der sehr hohen Syntheserate am
deutlichsten auf dem mit Coomassie gefärbten Gel zu erkennen ist. KsuF findet sich
vorwiegend in drei Formen, jeweils mit gering unterschiedlicher Migration. Bei Wachstum in
200-700 mM KCl sind primär zwei Signale mit Laufhöhen von ca. 40 und 36 kDa
nachzuweisen (siehe Abb. 3.11 a und d, Spuren 3-7). Bei Wachstum, in Medium ohne Zusatz
von Salz, in 100 mM KCl oder in 300 mM Sucrose, ist vor allem ein Signal mit einer
Migration von 38 kDa zu finden. Die bei 40 und 36 kDa migrierenden Formen des KsuF sind
nur bei Synthese in Minimalmedien mit hohen Salzkonzentrationen nachweisbar. Jedoch
finden sich auch Versuche, bei denen nur die bei 38 kDa migrierende Form nachweisbar ist
(nicht dargestellt).
Die Zugabe von 300 mM Sucrose hat keinen Effekt auf die Synthese von KsuB, KsuC und
KsuF (Abb. 3.11 a-d, Spur 8). Sie entspricht jeweils der gefundenen Produktionsmenge in
Minimalmedium ohne Zusatz (Abb. 3.11 a-d, Spur 1). KcsA konnte in der Membranfraktion
nicht nachgewiesen werden (nicht dargestellt).
Ergebnisse
- 61 -
Abb. 3.11 a-d): Nachweis der Synthese von KsuB, KsuC und KsuF in S.lividans TK21 pJO1 unter
verschiedenen Salzbedingungen und Sucrose. Dargestellt ist in a) ein mit Coomassie gefärbtes Gel. In den
Abbildungen b-d) wurden verschiedenen Cytoplasmafraktionen auf Membranen transferiert und mit Antikörpern
gegen KsuB in b), gegen KsuC in c) und gegen KsuF in d), untersucht. Aufgetragen wurden jeweils
Cytoplasmafraktionen von S.lividans TK21 pJO1 nach Wachstum in MM40 Medium mit verschiedenen
Salzkonzentrationen und Sucrose. Spur 1: nach Wachstum in MM40-Medium ohne Salz. Auf Spur 2: mit
100 mM KCl. Auf Spur 3: mit 200 mM KCl. Auf Spur 4: mit 300 mM KCl. Auf Spur 5: mit 400 mM KCl. Auf
Spur 6: mit 500 mM KCl. Auf Spur 7: mit 700 mM KCl und auf Spur 8: mit 10,3 % Sucrose (300 mM Sucrose).
8S Proteinmarker. Das mit drei leicht unterschiedlichen Migrationen laufende KsuF ist in a) und d) mit drei
Pfeilen markiert. Die Anzucht erfolgte jeweils, wie in der Legende zu Abb. 3.10 beschrieben.
- 62 -
Ergebnisse
3.3.3. Analyse von S.lividans NI Transformanten
3.3.3.1 Herstellung der Konstrukte
S.lividans N1 ist ein Stamm, in dem, neben dem um kcsA liegenden Bereich, nach Puls- Feld
Gelelektrophorese- Ergebnissen, mindestens 300 kBp des Chromosoms deletiert sind (pers.
Mitteilung von H. Schrempf). Neuere Erkenntnisse deuten auf großräumige Deletionen beider
äußerer Armbereiche des Chromosoms hin. In diesen Stamm sollte ein Großteil des um kcsA
liegenden sequenzierten Bereiches auf Plasmiden als Subfragmente und als Gesamtfragment
transformiert werden, um die Produktion verschiedener, auf den jeweiligen Abschnitten
liegenden Genen, in S.lividans NI zu untersuchen.
Der für die Propagierung in S.lividans NI vorgesehene Vektor pWHM3be konnte, aufgrund
unpassender Schnittstellen, nicht direkt für die verschiedenen Konstruktionen verwendet
werden. Hierfür wurde das den p15A ori tragende „low-copy“-Plasmid pACYC184
verwendet, das dafür bekannt ist, auch nach Integration größerer Fragmente stabil in E.coli
propagiert werden zu können. Das Tetracyclin-Resistenzgen wurde durch einen neu
konstruierten Polylinker ersetzt, in den die unterschiedlichen Fragmente integriert werden
konnten. Die verschiedenen „Inserts“ wurden anschließend mit dem E.coli/StreptomycesTransfer-Vektor pWHM3be ligiert und in S.lividans NI transformiert.
Zur Konstruktion des benötigten Polylinkers wurden 2 Oligos mit einer Länge von jeweils
55 Bp verwendet. Nach 5’ Phosphorylierung und Verschmelzung der beiden Oligos, wurde
ein doppelsträngiges Fragment erhalten, mit den überhängenden Enden einer XbaI und einer
AvaI-Schnittstelle an den Flanken und den internen Schnittstellen PstI, NotI, SgfI, SphI,
Mph1103I, HindIII und MluI. Dieses Fragment wurde mit dem AvaI/XbaI geschnittenen
Vektor pACYC184 ligiert und anschließend in E.coli transformiert. Erhalten wurde der
Vektor pACYC001 (siehe Abb. 3.12).
Ergebnisse
- 63 -
Abb. 3.12: Vektor pACYC001 Im Vektor pACYC184 wurde das Tetracyklin-Resistenzgen durch einen neu
konstruierten Polylinker ersetzt, hergestellt aus den beiden Oligos Pr184I und Pr184II. Der eingesetzte Bereich
ist in gelb dargestellt.
In den Vektor pACYC001 sind nacheinander verschiedene Fragmente integriert worden, so
dass 9 verschiede Konstrukte erhalten wurden, die unterschiedliche Bereiche des um kcsA
liegenden Bereiches enthalten (siehe Abb. 3.13 und „Klonierungsstrategie“ im Anhang C).
Die Namen der Konstrukte setzen sich jeweils aus dem Namen pACYC und einer
fortlaufenden Nummer von 002 bis 010 zusammen. Aus dem Vektor pACYC001 und den 9
Konstrukten wurde jeweils der Linker (pACYC001), bzw. das Insert mit Hilfe einer
PstI/XbaI-Restriktion ausgeschnitten und mit dem ebenso geschnittenen E.coli/StreptomycesShuttle-Vektor pWHM3be ligiert und in E.coli transformiert. Die Konstrukte erhielten jeweils
die Namen pOV001 bis pOV010. Nach Aufreinigung erfolgte die Transformation in
S.lividans N1.
Versuche, die größeren pOV-Konstrukte (pOV003, pOV004, pOV005, pOV006, pOV007
und pOV010) in S.lividans 66 Wildtyp oder TK21 Wildtyp zu transformieren, scheiterten, da
die inserierten Fragmente innerhalb kurzer Zeit offensichtlich mit den homologen Bereichen
des Chromosoms rekombinierten. Es waren nur noch Konstrukte mit ungefähr der Größe des
„Leervektors“ pOV001 nachweisbar.
- 64 -
Ergebnisse
Abb. 3.13: Konstrukte pACYC/pOV002 bis pACYC/pOV010. Dargestellt ist im oberen Teil der vollständige
bisher sequenzierte um kcsA gelegene Bereich, mit einer Länge von ca. 14 kBp, mit den als Pfeile dargestellten
Genen und den für die Konstruktionen verwendeten Restiktionsschnittstellen. Im unteren Teil ist die Lage, der in
die pACYC002 bis pACYC010 und pOV002 bis pOV010 integrierten Fragmente, durch Striche dargestellt.
Senkrechte Striche ( | ) an den Flanken zeigen in der Sequenz vorkommende Restriktionsschnittstellen, schräge
Striche( / ) Restriktionsschnittstellen aus dem Vektorteil.
pACYC002: Ein 1,9 kBp langes SstI/HindIII-Fragment aus pJO1 wurde mit dem ebenso geschnittenen Vektor
pACYC001 ligiert. pACYC003: In pACYC002 ist ein 3,2 kBp langes SstI/SgfI-Fragment aus pOBH23
eingefügt worden. pACYC004: Aus pBRS2 wurde ein 4,2 kBp langes SgfI/PstI-Fragment in pACYC003
integriert. pACYC006: Aus dem Konstrukt pK8 ist ein 3,5 kBp langes Bpu1102I/MluI-Fragment mit dem
ebenso geschnittenen Konstrukt pACYC002 ligiert. pACYC005: Aus pACYC006 wurde mit BglII/MluI ein
4,6 kBp-Fragment ausgeschnitten und mit pACYC004 ligiert. pACYC007: Ligation des 4,6 kBp BglII/MluIFragmentes aus pACYC006 mit pACYC003. pACYC008: Ligation des auch zur Konstruktion von pACYC003
verwendeten SgfI/SstI-Fragmentes aus pOBH23 mit pACYC001. pACYC009: Ligation des zur Konstruktion
von pACYC004 verwendeten SgfI/PstI-Fragmentes aus pBRS2 in pACYC001. pACYC010: Das für die
Konstruktion von pACYC004 und pACYC009 verwendete SgfI/PstI-Fragment aus pBRS2 ist mit dem ebenso
geschnittenen pACYC008 ligiert worden.
3.3.3.2. Nachweis der Protein-Produktion
Die Produktion der Proteine KsuB, KsuC und KsuF wurde in den Transformanten nach
Kultivierung in Minimalmedium mit Hochsalz oder ohne getestet (siehe Abb. 3.14 a-c).
Bei der Negativ-Kontrolle S.lividans NI pOV001 kann, wie zu erwarten war, kein Signal
gegen KsuF, KsuB und KsuC gefunden werden (Abb. 3.14 a-c, Spur 1 und 2). KsuF findet
sich bei allen Stämmen, die das vollständige Gen für KsuF tragen (Abb. 3.14 c, Spuren 5-10,
13 und 14, pOV003-, pOV004- und pOV005-Transformanten). pOV006 trägt nur den 5’-Teil
von ksuF, es kann kein Signal nachgewiesen werden (die schwachen Signale werden durch
einen Überladungseffekt der Nachbarspuren hervorgerufen; Abb. 3.14 c, Spuren 11 und 12).
Die Konstrukte pOV004, pOV005 und pOV010 tragen ksuC und ksuB. Hier können auch
jeweils deutliche Signale der erwarteten Größe gefunden werden (Abb. 3.14 a und b). Das
Konstrukt pOV009 trägt vollständig ksuC, jedoch nur einen Teil von ksuB. Die Produktion
von KsuC kann nachgewiesen werden (Abb. 3.14 b, Spuren 17 und 18), KsuB ist nicht
Ergebnisse
- 65 -
nachweisbar (Abb. 3.14 a, Spuren 17 und 18). Ein vergleichbares Ergebnis konnte in
Minimalmedium mit 300 mM NaCl statt 300 mM KCl gefunden werden (Ergebnisse nicht
dargestellt). Die Produktion von KsuB, KsuC und KsuF ist bei Wachstum in Minimalmedium
mit 300 mM KCl (Abb. 3.14 a-c, gerade Nummern) oder 300 mM NaCl, (nicht dargestellt)
gegenüber der Synthese in Minimalmedium ohne Zusatz von Salz (Abb. 3.14 a-c, ungerade
Nummern), deutlich um ca. das fünf- bis zehnfache erhöht. Die Zugabe von 10,3 % (300 mM)
Sucrose statt Salz erbringt eine, der Produktion in Minimalmedium ohne zusätzlich Salz,
vergleichbares Ergebnis (nicht dargestellt).
Abb. 3.14 a-c) Test der Synthese von KsuB in a), KsuC in b) und KsuF in c). Aufgetragen wurde auf den
jeweiligen Spuren die Cytoplasmafraktionen der S.lividans NI Stämme mit folgendem Plasmid, jeweils
angezogen in MM40 (Spuren mit ungerade Nummern) und in MM40 + 300 mM KCl (Spuren mit gerade
Nummern): 1-2: pOV001, 3-4: pOV002, 5-6: pOV003, 7-8: pOV004, 9-10: pOV005, 11-12: pOV006, 13-14:
pOV007, 15-16:pOV008, 17-18:pOV009, 19-20: pOV010. Getestet wurde mit Antikörpern gegen KsuB
(Membran a), KsuC (Membran b) und KsuF (Membran c). Es sind jeweils nur die Proben aufgetragen worden,
deren Stämme auch jeweils ein Plasmid mit den entsprechenden Genen trugen (siehe Abb. 3.13). Als NegativKontrolle wurde der den Leervektor tragende S.lividans NI pOV001-Stamm verwendet.
- 66 -
Ergebnisse
3.3.4. Produktion der Proteine in einer sigH-Mutante
Der Sigma-Faktor SigH (σH) ist an der osmotischen Regulation in S.coelicolor beteiligt, vor
sigH findet sich ein Promoter (P2), der unter hohen Salz-, jedoch nicht
Sucrosekonzentrationen die erhöhte Transkription von sigH bewirkt (Kormanec, J., et al.;
2000). Von der SigH-Regulation abhängige Proteine zeigen ein zu KsuB, KsuC und KsuF
vergleichbares Produktionsverhalten, unter hohen KCl und NaCl Konzentrationen (Jan
Kormanec, pers. Mitteilung). Zum Nachweis, ob eine SigH abhängige Regulation der drei
Proteine vorliegt, wurde die sigH-Mutante S.coelicolor M145 sigH:tsr (Sevcikova, B., et al.;
2001) und zur Kontrolle S.coelicolor J1984 (M145 sigF:tsr, Kelemen, G.M.; et al.; 1998),
S.coelicolor M145 WT, S.lividans 66 WT (nicht dargestellt), S.lividans 66 pOV001 und als
„Positiv“ Kontrolle die S.lividans NI pOV005 Transformante (trägt ksuC, ksuB und ksuF auf
dem Konstrukt) in Minimalmedium ohne zusätzlich Salz (nicht dargestellt) und in
Minimalmedium mit 300 mM KCl angezogen (siehe 3.15 a-c). Das Produktionsverhalten von
KsuB, KsuC und KsuF der S.coelicolor-Stämme und des S.lividans Wildtyps war jeweils
vergleichbar. Die S.lividans 66 pOV001 Transformande, die einen „Leervektor“ ohne ein
integriertes Fragment trägt, zeigt eine deutliche, chromosomal determinierte KsuF-Produktion
(siehe Abb. 3.15 c, Spur 5), alle anderen Stämme nicht (Abb. 3.15 c, Spuren 1-4).
Eine von SigH regulierte Synthese von KsuB, KsuC und KsuF konnte nicht nachgewiesen
werden.
Abb. 3.15 a-c): Test der SigH-Abhängigkeit der KsuB, KsuC und KsuF Synthese. Alle Stämme wurden
jeweils nach Vorkultur in Jasenka-Medium mit Sucrose ü.N., in MM40 Minimalmedium mit 300 mM KCl
angezogen und die Cytoplasmafraktionen mit Antikörpern gegen KsuB in a), KsuC in b) oder gegen KsuF in c),
getestet. Aufgetragen wurden: Spur 1: S.coelicolor M145 Wildtyp, Spur 2: S.coelicolor M145 sigH:tsr, Spur 3:
S.colicolor 1984 (M145 sigF:tsr), Spur 4: S.lividans 66 pOV001 und Spur 5: S.lividans NI pOV005. 8S:
Proteinstandard. Die Anzucht der S.coelicolor-Stämme erfolgte in Medium ohne Thiostrepton, die der S.lividans
Transformanten mit 12,5 mg/l Thiostrepton. Zur besseren Erkennbarkeit des Proteinstandards und der Signale,
wurden die Abbildungen jeweils bearbeitet (Tonwertekorrektur). Das von KsuB stammende Signal der
S.coelicolor Stämme ist schwer zu erkennen, die Laufhöhe ist durch einen Pfeil markiert.
Ergebnisse
- 67 -
3.3.5. Abhängigkeit der Synthese von KsuF vom Vorhandensein des Thiostrepton
Resistenzproteins
Eine Produktion von KsuF in Wildtypstämmen (z.B. S.lividans 66 oder S.coelicolor M145)
konnte mit Hilfe von Antikörpern nach Transfer auf Membranen nicht nachgewiesen werden,
anders als bei Synthese in S.lividans WT Stämmen, die pWHM3be und pIJ702 oder Derivate
derselben, ohne ein ksuF tragendes Fragment, enthielten (z.B. siehe vorheriges Kapitel, Abb.
3.15 c, Spur 5).
Die Synthese des aus Streptomyces azureus stammenden Thiostrepton Resistenzproteins Tsr
ist durch Thiostrepton induzierbar. Geringe Konzentrationen sind ausreichend, um durch
Thiostrepton induzierbare Proteine zu induzieren (Ali, N., et al., 2002, Holmes, D.J., et al.;
1993). Es wurde 1 µg/ml Thiostrepton verwendet, da diese Konzentration keine Auswirkung
auf das Wachstum der Wildtypstämme zeigte.
In unserer Arbeitsgruppe sind keine S.lividans Stämme vorhanden, die tsr im Chromosom
integriert haben. Um auszuschließen, dass weitere, plasmiddeterminierte Proteine von pIJ702
oder pWHM3be für die Synthese von KsuF verantwortlich sind, wurden zwei S.coelicolorDisruptionsmutanten von Sigma-Faktoren verwendet, die nur tsr im Chromosom integriert
haben. Dies sind die Stämme S.coelicolor M145 sigH:tsr (Sevcikova, B., et al.; 2001) und das
M145 Derivat S.coelicolor J1984 (sigF:tsr, Keleman, G.M.; et al.; 1998).
Die Gabe von Thiostrepton hat keine Auswirkung auf die Synthese von KsuF in
Wildtypstämmen (Abb. 3.16 a, Spuren 1-3). Eine KsuF-Produktion konnte auch im Stamm
S.lividans 66 FEH11 nicht nachgewiesen werden; dieser Stamm trägt ein EGFP-Gen „in
frame“ integriert hinter ksuF (Abb. 3.16 a, Spur 6). Die tsr im Chromosom integriert
tragenden Stämme S.coelicolor M145 sigH:tsr und S.coelicolor J1984 (sigF:tsr) zeigen bei
Gabe von 1 µg/ml Thiostrepton eine hohe Synthese des chromosomal determinierten KsuF
(Abb. 3.16 a, Spuren 4 und 5); im Vergleich hierzu der S.coelicolor M145 Wildtyp-Stamm
keine (Abb. 3.16 a, Spur 3). Bei Wachstum in Medium ohne Thiostrepton zeigen beide
Deletionsmutanten keine Synthese von KsuF, bzw. eine, die unterhalb der Nachweisgrenze
liegt (siehe vorheriges Kapitel, Abb. 3.15 c, Spuren 2 und 3). Alle Stämme, die die Vektoren
pIJ702, pWHM3be oder Derivate derselben tragen, zeigen bei Wachstum in Medium mit
12,5 µg/ml Thiostrepton eine Produktion von chromosomal determiniertem KsuF, die in der
Synthesemenge vergleichbar ist mit der der beiden sigH:tsr und sigF:tsr S.coelicolor Stämme
(Abb. 3.16. a, Spur 7 und b, Spuren 1-3, 6 und 7).
Die Synthesesrate von KsuF ist somit abhängig vom Vorhandensein des ThiostreptonResistenzproteins und gleichzeitiger Gabe von Thiostrepton zur Induktion der Produktion
desselben. Sie ist nicht alleine direkt abhängig von Thiostrepton und von weiteren pIJ702
oder pWHM3be determinierten Proteinen.
Das Vorhandensein des potentiellen Promoterbereiches oder eines Teils von ksuF auf einem
Konstrukt reduziert die Synthese des chromosomal determinierten KsuF (Abb. 3.16 b, Spur
4). Dies konnte auch bei anderen, die Konstrukte pOVE31, pOVE32, pOVE34 und pOVE 43
- 68 -
Ergebnisse
tragenden S.lividans Stämmen, beobachtet werden (nicht dargestellt). Die geringere
Migrierung des von pOVE33 determinierten His-Tag KsuF ist zu erkennen (Abb. 3.16 b,
Spur 5).
Abb. 3.16 a und b): Nachweis der KsuF-Synthese in unterschiedlichen Stämmen unter Thiostrepton. Die
Stämme wurden jeweils in Minimalmedium mit Salz angezogen (MM40 Medium mit 300 mM KCl), Stämme,
die das Plasmid pWHM3be trugen oder unterschiedliche Konstrukte desselben, wurden mit 12,5 µg/ml
Thiostrepton angezogen, Stämme ohne Plasmide oder Konstrukte, mit 1 µg/ml Thiostrepton oder ohne. Der
Nachweis erfolgte nach Transfer auf Membran mit Hilfe von Antikörpern gegen KsuF.
Auf a) wurde aufgetragen: Spur 1: S.lividans 66 WT, angezogen ohne Thiostrepton und in Spur 2 angezogen mit
1 µg/ml Thiostrepton, Spur 3: S.coelicolor M145 WT, angezogen mit 1 µg/ml Thiostrepton, Spur 4: S.coelicolor
M145 sigH:tsr (1 µg/ml Thio), Spur 5: S.colicolor J1984 (M145 sigF:tsr) (1 µg/ml Thio), Spur 6: S.lividans 66
FEH11 (1 µg/ml Thio), Spur 7: S.lividans 66 pIJ702 (12,5 µg/ml Thio) und in Spur 8: S.lividans NI pOV005
(12,5 µg/ml Thio).
In b) wurde aufgetragen auf: Spur 1: S.lividans TK21 pOV001 (12,5 µg/ml Thio), Spur 2: S.lividans 66 pOV001,
Spur 3: S.lividans 66 pWHM3be (12,5 µg/ml Thio), Spur 4: S.lividans TK21 pOVE3 (12,5 µg/ml Thiostrepton),
Spur 5: S.lividans TK21 pOVE33 (12,5 µg/ml Thio, His-Tag KsuF-Produktionsstamm), Spur 6: S.lividans 66
pOV005 (12,5 µg/ml Thio), Spur 7: S.lividans pOV201 (12,5 µg/ml Thio) und 8: S.lividans NI pOV005. 8S: ist
jeweils der Proteinstandard.
Es wurden jeweils ca. 0,45 µl Cytoplasmafraktion aufgetragen, für S.lividans NI pOV005 ca. 1/10 der Menge.
Spätere Tests des Stammes S.lividans 66 pOV005 zeigten, dass das in pOV005 integrierte homologe 13 kBp
Fragment vollständig deletiert war, das Konstrukt besaß ungefähr die Größe des „Leervektors“ pOV001. Die
gefundene Produktion von KsuF ist chromosomal determiniert.
3.4. Gewinnung von His-Tag Proteinen aus S.lividans
Um verschiedene Proteine in S.lividans in größeren Mengen zu produzieren und über Ni-NTA
aufreinigen zu können, wurde der Vektor pOVE3 konstruiert, da in unserer Arbeitsgruppe
kein entsprechender Vektor vorhanden war. In den Streptomyces/E.coli-Vektor pWHM3be
wurde der den potentiellen Promotor von ksuF tragende intergenische Bereich zwischen ksuF
und kcsA, der für den His-Tag kodierende- und Polylinker-Bereich aus pQE32 und der
zwischen ksuF und ksuL liegende Terminator integriert. Der Promotor von ksuF ermöglichte
Ergebnisse
- 69 -
auf einem Konstrukt (pJO1 oder z.B. pOV005) in S.lividans eine sehr hohe Produktion von
KsuF (Abb. 3.11 a und d und Abb. 3.14 c). Das Startkodon liegt innerhalb der
Erkennungssequenz des SphI-Restriktionsenzyms (GCATGC). Zur Inaktivierung der
Schnittstelle wurde die zweite Base (G) vor dem A des ATG durch ein C ausgetauscht.
3.4.1. Konstruktion der Plasmide pOVV1, pOVV2 und pOVE3
Das bifunktionelle Produktionsplasmid pOVE3 wurde über zwei Zwischenkonstrukte
hergestellt, pOVV1 und pOVV2. In einem ersten Schritt wurde der für den 6fach His-Tag
kodierende- und der Polylinker-Bereich aus pQE32 (Qiagen) amplifiziert und nach
XbaI/HindIII-Restriktion das entstandene 80 Bp lange Fragment mit dem ebenso
geschnittenen
Vektor
pWHM3be
ligiert.
Hierbei
wurde
eine
Mph1103IRestriktionsschnittstelle in das Startkodon des His-Tag’s eingefügt. Der entstandene Vektor
erhielt den Namen pOVV1 (Abb. 3.17) Im nächsten Schritt wurde der vor ksuF liegende
potentielle Promotor-Bereich in den Vektor pOVV1 eingefügt. Nach Amplifikation mit Hilfe
von „nested-PCR“ wurde, nach Restriktion mit EcoRI/Mph1103I, das entstandene 356 Bp
lange Fragment mit dem ebenso geschnittenen Vektor pOVV1 ligiert. Das Konstrukt erhielt
den Namen pOVV2 (Abb. 3.17). Im letzten Schritt wurde der zwischen ksuF und ksuL
gelegene Terminator amplifiziert, mit HindIII und MluI geschnitten und als 158 Bp-Fragment
mit dem ebenso geschnittenen Vektor pOVV2 ligiert. Der entstandene Vektor trägt den
Namen pOVE3 (Abb. 3.17).
Abb. 3.17: Vektoren pOVV1, pOVV2 und pOVE3. Gelb markiert ist das den 6x His- kodierenden TagBereich tragende Fragment aus pQE32. In grau, der den potentiellen Promoter tragende Bereich und blau
markiert, der Terminator-Bereich mit dem Terminator selbst, in rot. Zur Amplifikation des Fragmentes (in gelb),
das die sechs Histidin-Kodons enthält, wurden die Oligos 2PrCR1XN und PrPCR1H1 verwendet. Für die
Amplifikation des vermutlichen Promoterbereiches wurden in einer ersten Amplifikation die Oligos Pr70 und
Pr71 und pJO1 als Matrize verwendet. Von dem so entstandenen 530 Bp Fragment erfolgte eine weitere
Amplifikation mit Hilfe der Oligos PRPCR2E und PRPCR2N, wobei die entsprechenden Schnitttstellen
eingefügt wurden. Der Terminatorbereich wurde mit Hilfe der Primer PRPCR3MH und PRPCR3SX vom
Konstrukt pOSP13 amplifiziert.
- 70 -
Ergebnisse
3.4.2. Konstruktion der bifunktionellen Plasmide pOVE4 und pOVE5
pOVE4 unterscheidet sich von pOVE3 durch eine SphI-Restriktionsschnittstelle im
Startkodon und besitzt keinen für die 6 Histidine determinierenden Abschnitt. Die 2. Base (G)
vor dem ATG des Startkodons wurde, anders als bei pOVE3, nicht ausgetauscht. Mit diesem
Plasmid sollte die Überproduktion von nativen Proteinen ermöglicht werden. Hierzu wurde
das für die Konstruktion von pOVV2 verwendete 530 Bp PCR-Fragment als Matrize für eine
PCR-Reaktion verwendet. Das entstandene Fragment wurde nach EcoRI- und SphIRestriktion als 336 Bp-Fragment mit dem entsprechend geschnittenen Vektor pOVE3 ligiert.
Der resultierende Vektor erhielt den Namen pOVE4 (Abb. 3.18).
Abb. 3.18: Überproduktionsvektor pOVE4. Grün makiert ist der neu eingefügte Promoterbereich. Das ATGStartkodon des ksuF-Promoters liegt in der SphI-Schnittstelle. Gelb makiert ist der Polylinker-Bereich aus
pQE32, blau der Terminatorbereich, rot der Terminator selbst. Für die Amplifikation des potentiellen
Promotorbereiches wurden die beiden Oligos PR70 und PRPCR2E verwendet.
Die Produktion der His-Tag Proteine bei den pOVE3-Derivat-Transformanten in S.lividans
fiel deutlich geringer aus, als erwartet. Es wurde vermutet, dass der aus pQE32 stammenden
Abschnitt verantwortlich sein könnte, aufgrund des Vorhandenseins von für E.coli typischen
jedoch für Streptomyceten untypischen Kodons. Dieser Abschnitt umfasst die für die ersten
11 Aminosäuren kodierenden Basentripletts, unter anderem die für das 6x His-Tag
(MHRGSHHHHHH). Einige dieser sind selten in Streptomyceten zu finden (AGA-> 0,8 von
1000; 4x CAT->1,7; GGA->7,2 und TCT ->0,6 von 1000 Basentripletts bei S.coelicolor
A3(2), NCBI-Genbank Flat File Release 144.0). Durch Austausch seltener Basentripletts im
5’ Bereich konnte die Produktionsrate bei anderen Stämmen deutlich beeinflusst werden
(Liljenstrom H. and von Heijne, G.; 1987); sechs der ersten 11 Kodons sollten gegen
Ergebnisse
- 71 -
Streptomyceten gängigere ersetzt werden. Um diesen Bereich auszutauschen, wurden zwei
komplementäre Oligos phosphoryliert und anschließend zum Doppelstrang assoziiert. Die
Oligos waren so gewählt, dass das assoziierte Fragment an einer Seite das überhängende Ende
einer Mph1103I- und auf der anderen einer BamHI-Schnittstelle besaß. Dieses wurde mit dem
Mph1103I/BamHI geschnittenen Vektor pOVE3 ligiert und in E.coli transformiert. Erhalten
wurde pOVE5 (Abb. 3.19).
Nach Sequenzierung fanden sich zwei korrekt inserierte Konstrukte, die verwendet wurden. In
den drei weiteren getesteten fanden sich Basenaustausche im integrierten Bereich,
hervorgerufen durch minderwertige Oligos.
Abb. 3.19: Überproduktionsvektor pOVE5. Grün markiert ist der ausgetauschte Bereich, gelb der aus pQE32
stammende Linkerbereich, blau der Terminatorbereich und rot der Terminator selbst. Die beiden Oligos PrPoly3I
und PrPoly3II wurden für die Konstruktion des ausgetauschten Bereiches verwendet. Von den für den Nterminalen His-Tag kodierenden ersten 11 Kodons (MHRGSHHHHHH) wurden folgende ausgetauscht: drei der
vier CAT-Kodons (die drei im His-Tag vorhandenen) gegen CAC (kodierend für Histidin), AGA zu CGC
(Arginin), GGA zu GGC (Glycin) und TCT zu TCC (Serin).
- 72 -
Ergebnisse
3.4.3. Herstellung kcsA-haltiger Konstrukte und Analyse der S.lividans-Transformanten
Zur Klonierung von kcsA in pOVE3 wurde das entsprechende Gen aus pQE837 (H. Splitt) mit
Hilfe einer SphI/HindIII-Doppelrestriktion ausgeschnitten und in die entsprechenden
Restriktionsschnittstellen von pOVE3 eingefügt (pOVE31, Abb. 3.20). Dasselbe Fragment
wurde auch mit den ebenso geschnittenen Vektoren pOVE4 und pOVE5 ligiert. Erhalten
wurden die Konstrukte pOVE41 und pOVE51 (Abb. 3.20). Nach Aufreinigung aus E.coli
erfolgte jeweils die Transformation in S.lividans TK21.
Abb. 3.20: Konstrukte pOVE31, pOVE41 und pOVE51 In dunkelgrau und grün sind die potentiellen
Promoter-Bereiche, in hellgrau das inserierte kcsA, in blau der Terminatorbereich mit dem Terminator in rot,
dargestellt. Mit den Konstrukten pOVE3, pOVE4 und pOVE5 wurde jeweils das kcsA tragende 560 Bp große
SphI/HindIII-Fragment aus pQE837 ligiert. Die pOVE31 und pOVE51 S.lividans-Transformanten sollten die
Produktion eines 174 Aminosäuren langen N-terminalen His-Tag KcsA ermöglichen, die der pOVE41
Transformanten eines mit 160 Aminosäuren in der Länge und Sequenz dem originalem KcsA entsprechenden
Proteins.
Nach Anzucht der Transformanten und Aufreinigung des His-Tag KcsA über Ni-NTA aus
den Membranfraktionen, wurde die Produktion immunologisch getestet („Western Blot“,
Abb. 3.21 a-d). Die pOVE31- und die pOVE51- Transformanten produzieren His-Tag KcsA.
Die Produktion ist bei den pOVE51-Transformanten deutlich geringer. Sowohl die tetramere
(theoretisches Molekulargewicht von 77,1 kDa), als auch monomere Form (theoretisches MW
von 19,3 kDa), haben im Vergleich zum Standard eine etwas geringere Mobilität als erwartet.
Dies wurde auch schon früher beobachtet und ist typisch für Membranproteine. Nach
Aufkochen in Probenpuffer ohne reduzierende Agenzien findet sich KcsA als Monomer.
Eine Produktion von KcsA in den pOVE41-Transformanten konnte nie nachgewiesen werden
(Abb. 3.20 a, Spuren 5 und 6). Da pOVE41 über Restriktionskontrolle und Sequenzierung
verifiziert wurde, ist keine Ursache hierfür zu erkennen.
Ergebnisse
- 73 -
Abb. 3.21 a-d): Test der Produktion von KcsA und His-Tag KcsA in S.lividans TK21 pOVE3, pOVE31-,
pOVE41- und pOVE51-Transformanten. Getestet wurden die Membranfraktionen (Membran a und b) und die
über Ni-NTA aufgereinigten Proteine (Membran c und d), jeweils mit Antikörpern gegen KcsA (Membran a und
c) und gegen den His-Tag (Membran b und d). Es wurden jeweils Fraktionen nicht gekocht (ungerade Zahlen)
und gekocht (gerade Zahlen) aufgetragen. Die Mobilität der tetramären und der monomeren Form von His-Tag
KcsA ist jeweils mit Pfeilen markiert.
a) und b): Aufgetragen wurden die Membranfraktionen von: Spuren 1 und 2 pOVE3-, Spuren 3 und 4 pOVE31-,
Spuren 5 und 6 pOVE41- und Spuren 7 und 8 pOVE51-Transformanten. Spur 9: 8S-Proteinstandard.
c) und d): Aufgetragen sind die Elutionsfraktionen von: Spuren 1 und 2 pOVE3-, Spuren 3 und 4 pOVE31- und
Spuren 5 und 6 pOVE51-Transformanten. Spur 7: 8S-Proteinstandard. Um die Erkennbarkeit des
Proteinstandards zu erhöhen, wurde der Kontrast der Spur 9 in a) und der Spur 7 in c) verstärkt. Alle Kulturen
wurden in MM40 Medium mit 300 mM KCl angezogen.
- 74 -
Ergebnisse
3.4.4. Produktion von KsuB in S.lividans-Transformanten
Aus dem für die Konstruktion des His-Tag KsuB Überproduktionsvektor pQE309
verwendeten Konstrukt pORFZ wurde ksuB mit Hilfe einer SphI/HindIII-Restriktion
ausgeschnitten und mit den ebenso geschnittenen Vektoren pOVE3, pOVE4 und pOVE5
ligiert und in E.coli transformiert. Die Konstrukte erhielten die Namen pOVE32, pOVE42
und pOVE52 (siehe Abb. 3.22). Nach Aufreinigung aus E.coli erfolgte die Transformation in
S.lividans TK21.
Abb. 3.22: Konstrukte pOVE32, pOVE42 und pOVE52 Die potentiellen Promoter-Bereiche sind in
dunkelgrau und grün dargestellt. Das inserierte ksuB tragende Fragment ist in hellgrau, in blau der
Terminatorbereich mit dem Terminator in rot, dargestellt. Mit den Konstrukten pOVE3, pOVE4 und pOVE5
wurde jeweils das ksuB tragende, 929 Bp lange SphI/HindIII-Fragment aus pORFZ ligiert. Die Produktion eines
323 Aminosäuren langen N-terminalen His-Tag KsuB sollten die pOVE32 und pOVE52 S.lividansTransformanten ermöglichen, die der pOVE42 Transformanten eines dem Original entsprechenden Proteins (310
Aminosäuren lang).
Der Nachweis der Produktion erfolgte immunologisch. Getestet wurden die
cytoplasmatischen Fraktionen und die in Folge über Ni-NTA aufgereinigten Proteine
(Abb. 3.23 a und b). Neben den in allen fünf Cytoplasma-Fraktionen gefundenen, vom
Chromosom determinierten KsuB (Abb. 3.23 a, Spuren 1-5, theoretisches MW von 34,3 kDa),
findet sich bei den pOVE32 und pOVE52 Transformanten ein weiteres Protein, das His-Tag
KsuB (theoretisches MW von 36 kDa) repräsentiert (Abb. 3.23 a und b, Spuren 3 und 5). Die
Produktion von His-Tag KsuB ist bei den pOVE32-Transformanten größer, was auch an den
über Ni-NTA aufgereinigten Fraktionen zu erkennen ist (siehe Abb. 3.23 a und b, Spuren 7
und 8). Es konnte keine erhöhte Produktion von KsuB in den pOVE42-Transformanten
gegenüber den einen „Leervektor“ tragenden pOVE3 oder pOVE4 Transformanten
identifiziert werden (Abb. 3.23 a, Spur 4 und Spuren 1 und 2).
Ergebnisse
- 75 -
Abb. 3.23 a und b): Test der Produktion von KsuB und His-Tag KsuB in S.lividans TK21 pOVE3-,
pOVE4- pOVE32-, pOVE42- und pOVE52-Transformanten. Die Anzucht der Kulturen erfolgte in MM40
Medium mit 300 mM KCl. Aufgetragen und mit Antikörpern gegen KsuB (Membran a) und gegen den His-Tag
(Membran b) getestet, wurden Cytoplasma-Fraktionen von pOVE3- (jeweils Spur 1), pOVE4- (Spur 2),
pOVE32- (Spur 3), pOVE42- (Spur 4) und von pOVE52-Transformanten (Spur 5). Auf den Spuren 6 bis 8
wurden jeweils über Ni-NTA aufgereinigte Protein-Fraktionen aufgetragen: Spur 6, von pOVE3-, Spur 7 von
pOVE32-, Spur 8 pOVE52-Transformanten. Spur 9: 8S-Proteinstandard.
3.4.5. Produktion von KsuC in S.lividans-Transformanten
Die Konstruktion von pWRS1 erfolgte unter direkter Anleitung durch Ralf Steger. Aus dem
für die Produktion von His-Tag KsuC in E.coli verwendeten Konstrukt pQE321 wurde über
eine HindIII/SphI- Restriktion ksuC ausgeschnitten und mit dem ebenso geschnittenen Vektor
pOVE3 ligiert und in E.coli transformiert. Erhalten wurde das Konstrukt pWRS1 (Abb. 3.24).
Aus pWRS1 wurde über eine HindIII/SphI-Restriktion ksuC wieder ausgeschnitten und mit
dem ebenso geschnittenen Vektor pOVE5 ligiert. Das Konstrukt erhielt nach Transformation
in E.coli den Namen pOVE54 (Abb. 3.24). Beide Konstrukte wurden in S.lividans TK21
transformiert.
Der Nachweis der Produktion von His-Tag KsuC erfolgte mit Hilfe von Antikörpern durch
Test der Cytoplasma-Fraktionen und des über Ni-NTA aufgereinigten Proteins. In den beiden
His-Tag KsuC-Überproduktionstransformanten (pWRS1 und pOVE54, Abb. 3.25 a und b,
Spuren 3, 4, 6 und 7) können gegenüber den Kontrollen (pOVE3 und pOVE5Transformanten, Membranen a und b, Spuren 1 und 2) zusätzlich Kreuzreaktionen gefunden
werden. Die Mobilitäten sind geringer, als das theoretische Molekulargewicht von 29,9 kDa
für KsuC und 31,6 kDa für His-Tag KsuC erwarten lassen würde. Die Produktion von HisTag KsuC ist bei der pOVE5-Derivat- (pOVE54; Abb. 3.25 a und b, Spuren 4 und 7) geringer
als bei der pOVE3-Derivat-Transformante (pWRS1; Abb. 3.25 a und b, Spuren 3 und 6).
- 76 -
Ergebnisse
Abb. 3.24: Konstrukte pWRS1 und pOVE54 Dargestellt sind: die potentiellen Promoter-Bereiche in
dunkelgrau, das inserierte, 897 Bp lange ksuC tragende SphI/HindIII Fragment in hellgrau, in blau der
Terminatorbereich mit dem Terminator in rot. S.lividans-Transformanten, die einen der beiden Konstrukte
trugen, sollten jeweils die Produktion eines 299 Aminosäuren langen His-Tag KsuC ermöglichen.
Abb. 3.25 a und b): Test der Produktion von KsuC und His-Tag KsuC in S.lividans TK21 pOVE3-,
pOVE5- pWRS1-, und pOVE54-Transformanten. Die Anzucht erfolgte in MM40 Medium mit 300 mM KCl.
Mit Antikörpern gegen KsuC (Membran a) und gegen den His-Tag (Membran b) wurden die CytoplasmaFraktionen von pOVE3- (jeweils Spur 1), pOVE5- (Spur 2), pWRS1- (Spur 3) und von pOVE54Transformanten (Spur 4) getestet. Über Ni-NTA aufgereinigte Protein-Fraktionen wurden jeweils auf den drei
nachfolgenden Spuren aufgetragen: Spur 5, von pOVE3-, Spur 6 von pOVE34-, Spur 7 pOVE54Transformanten. Spur 8: 8S-Proteinstandard. Der Kontrast des den Standard tragenden Abschnittes wurde
jeweils erhöht, um die Erkennbarkeit zu verbessern.
Ergebnisse
- 77 -
3.4.6. Produktion von KsuF in S.lividans-Transformanten
Aus pQE314 (His-Tag KsuF-Produktionsvektor) wurde das ksuF-tragende Fragment mit
Hilfe der Restriktionsenzyme SphI/HindIII ausgeschnitten und mit den ebenso geschnittenen
Vektoren pOVE3 und pOVE4 ligiert. Es wurden die Konstrukte pOVE33 und pOVE43
erhalten (siehe Abb. 3.26). Anschließend wurde aus pOVE33 dasselbe Fragment wieder
ausgeschnitten und mit dem Vektor pOVE5 ligiert. Nach Transformation in E.coli wurde das
Konstrukt pOVE53 erhalten (Abb. 3.26). Nach Aufreinigung erfolgte die Transformation in
S.lividans TK21.
Abb. 3.26: Konstrukte pOVE33, pOVE43 und pOVE53. Die potentiellen Promoter-Bereiche sind in
dunkelgrau und grün dargestellt. Das inserierte, ksuF tragende Fragment in hellgrau, in blau ist der
Terminatorbereich mit dem Terminator selbst in rot, dargestellt. Das in hellgrau dargestellte, aus pQE314
stammende SphI/HindIII-Fragment, besitzt jeweils eine Größe von 1399 Bp. Von den pOVE33 und pOVE53
Transformanten sollte eine Produktion eines 387 Aminosäuren langen His-Tag KsuF erfolgen, von pOVE43
eines dem Original entsprechenden 373 langen KsuF-Proteins.
Die Synthesen von His-Tag KsuF konnte sowohl in den Cytoplasma-Fraktionen der pOVE33
und pOVE53-Transformante, als auch in den über Ni-NTA aufgereinigten Fraktionen,
nachgewiesen werden (Abb. 3.27 a und b, Spuren 3, 4, 6 und 7). Die Mobilität entspricht den
erwarteten 40,8 kDa und ist deutlich höher, als das chromosomal determinierte KsuF mit
einem theoretischen MW von 39,1 kDa (Abb. 3.27 a, Spuren 1 und 2). Die His-Tag KsuFund KsuF-Lauffront ist jeweils mit einem Pfeil markiert. Auch hier ist die Produktion vom
pOVE5- deutlich geringer als vom pOVE3-Derivat. Die Produktion von KsuF der pOVE43Transformanten erwies sich als vergleichbar stark, wie die der pOVE4-Transformanten (nicht
dargestellt). Sie war geringer als die chromosomal determinierte Produktion von
Transformanten, die pWHM3be-Derivate, ohne ksuF auf einem Fragment inseriert, trugen.
- 78 -
Ergebnisse
Abb. 3.27 a und b): Test der Produktion von KsuF und His-Tag KsuF in verschiedenen S.lividans
Transformanten. Die Anzucht erfolgte in MM40 Medium mit 300 mM KCl. Aufgetragen wurden die
Cytoplasma-Fraktionen (Spuren 1 bis 4) und über Ni-NTA aufgereinigte Fraktionen (jeweils Spuren 5-7), der
Nachweis erfolgte mit Antikörpern gegen KsuF (Membran a) und den His-Tag (Membran b). Spur 1: pOVE3-,
Spur 2: pOVE5-, Spur 3: pOVE33-, Spur 4: pOVE53-, Spur 5: pOVE3-, Spur 6: pOVE33- und Spur 7: pOVE53Transformanten. Auf der Spur 8 wurde jeweils 8S-Proteinstandard aufgetragen.
In S.lividans-Transformanten, die entweder eines der pOVE3- oder der pOVE5-DerivatKonstrukte trugen, konnte die Produktion eines His-Tag-Proteins nachgewiesen werden. Die
Produktionsrate der jeweiligen His-Tag Proteine war bei den pOVE5-Derivat-S.lividans
Transformanten deutlich geringer, als bei den vergleichbaren pOVE3-Derivat-Transformanten
(ca. um das Fünf- bis Zehnfache). Beide Derivatfamilien unterscheiden sich nur durch eine
alternative Kodonverwendung im N-terminalen Bereich des His-Tag’s. Da die
Kodonverwendung in den pOVE5-Derivaten für Streptomyceten optimiert war, sollte hier
eine mit den pOVE3-Derivaten zumindest vergleichbare Produktion erfolgen.
Die Ergebnisse zeigten jedoch, dass die für E.coli optimierten Kodons für den His-Tag in den
pOVE3-Derivaten, auch in S.lividans eine höhere Produktion ermöglichen, als die für
S.lividans optimierten Kodons in den pOVE5-Derivaten. Dass die Verwendung von den in
Streptomyceten häufiger vorkommenden Kodons zu einer geringeren Synthese führte, war
unerwartet. Ob dieses Ergebnis auf eine veränderte Termination der Transkription oder auf
eine verringerte Stabilität der mRNA zurückzuführen war, wurde nicht näher analysiert.
Die Produktionsrate war bei Verwendung eines Vollmedium (Jasenka-Medium) deutlich
geringer (ca. um das Fünffache pro Gramm Nassgewicht), als bei Verwendung von
Minimalmedium mit Hochsalz (Ergebnisse nicht dargestellt).
Es konnte nicht gezeigt werden, dass von den pOVE4-Derivat Transformanten (pOVE41,
pOVE42 und pOVE43) die Produktion eines Proteins, determiniert vom Plasmid, erfolgt. Bei
den pOVE42- und pOVE43-Transformanten entspricht die Produktion von KsuB bzw. KsuF
jeweils der chromosomal determinierten. Bei einer Reihe von Tests unterschiedlicher
pOVE41-Transformanten konnte KcsA nicht nachgewiesen werden. Da alle notwendigen
Kontrollen erfolgten ist keine Ursache hierfür zu erkennen.
Ergebnisse
- 79 -
Die von den pOVE3 Konstrukten determinierte Proteinsynthese ist deutlich geringer als
erwartet. Sie ist geringer, als die chromosomal determinierte Produktion von KsuF von
S.lividans-Stämmen, die pWHM3be Derivate oder pIJ702 trugen, ohne in ihnen inseriertes
ksuF (siehe z.B. Abb. 3.16 a und b) und deutlich geringer, als z.B. in S.lividans NI-Stämmen
mit ksuF tragenden pOVE-Derivaten (siehe Abb. 3.14 c) oder dem S.lividans TK21 pJO1
Stamm (Abb. 3.11 a und d). Vergleichbare Ergebnisse zeigen auch die
Fluoreszensmikroskopie-Ergebnisse der Stämme S.lividans TK21 pOVG1 und S.lividans
TK21 pOVG13, die den für pOVE3 verwendeten und einen deutlich längeren potentielle
Promoterbereiche von ksuF trugen (siehe unten, Abb. 3.34 und Abb. 3.35, jeweils b und h).
- 80 -
Ergebnisse
3.5. Studien von S.lividans-Transformanten mit ausgewählten Konstrukten
3.5.1. Herstellen der Konstrukte
Um die Induktion und die Aktivierung von Streptomycetenpromotoren zu untersuchen und
die Produktion verschiedener Proteine zu testen, wurde der Vektor pOVG1 (Abb. 3.28) aus
dem Überproduktionsvektor pOVE3 konstruiert. Der für den His-Tag kodierende Bereich
wurde ausgeschnitten und durch ein EGFP-Gen ersetzt. Hierzu wurde das EGFP-Gen aus dem
Vektor pEGFP1 (Clontech) amplifiziert und nach Restriktion mit dem ebenso geschnittenen
Vektor pOVE3 ligiert. Nach Mph1103I/EcoRI- oder Mph1103I/BglII-Restriktion von pOVG1
kann ein DNA-Fragment, mit einem mutmaßlichen Promotor-Bereich, vor das EGFP-Gen
eingesetzt werden.
Das Konstrukt pOVG1 trägt den vermutlich nicht voll funktionellen Promoter von ksuF, der,
nach den Ergebnissen mit verschiedenen pOVE3-Konstrukten, in S.lividans nur eine geringe
Synthese von EGFP erlauben sollte.
Abb. 3.28: Bifunktioneller Produktionstestvektor pOVG1. In grün dargestellt ist das EGFP-Gen tragende
Fragment. Dieses wurde nach Amplifikation mit pEGFP1 (Clontech) als Template und den Primer pREGFPmp
und pREGFPxb (Fragmentgröße 1109 Bp, Vent-Polymerase) und Mph1103I/XbaI Restriktion als 728 Bp
Fragment mit pOVE3 ligiert. In grau dargestellt ist der jeweils zu ersetzende Bereich, in blau der TerminatorBereich, der Terminator selbst ist in rot dargestellt.
Zum Test der von den verschiedenen putativen Promotoren abhängigen Proteinproduktion,
wurde versucht, die flussauwärts liegenden Bereiche verschiedener Gene mit Hilfe von PCR
(Vent-Polymerase) zu amplifizieren und nach Mph1103I/BglII Restriktion in die
entsprechenden Schnittstellen von pOVG1 zu klonieren. Die Oligos für die Amplifikation
wurden so gewählt, dass jeweils ein Fusionsprotein produziert werden sollte, bestehend aus
den ersten ca. 10 Aminosäuren des entsprechenden Proteins und nachfolgend dem EGFP-
Ergebnisse
- 81 -
Protein. Als „Negativ“-Kontrolle wurde ein interner Sequenzbereich aus ksuF entgegen der
Leserichtung in pOVG1 eingesetzt (pOVG17).
Zur Integration des potentiellen Promoters von kcsA wurde aus dem Vektor pJO1 ein 1135 Bp
langes Fragment mit Hilfe der Oligos Pr23 und pkcsam1 amplifiziert (Vent-Polymerase) und
nach BglII/Mph1103I Restriktion das erhaltene 987 Bp Fragment mit dem ebenso
geschnittenen Vektor pOVG1 ligiert. Das erhaltene Konstrukt erhielt den Namen pOVG11.
Das Insert enthält neben dem vor kcsA liegenden Bereich die für den Anfangsbereich
kodierenden Nukleotide, nachfolgend im selben Leseraster den EGFP-Gen-Teil (Abb. 3.29).
Als Kontrollplasmid wurde der Vektor pOVG17 verwendet (Abb. 3.29). Hier wurde mit Hilfe
der Oligos pkontm1 und pkontb1 ein 991 Bp Fragment vom Konstrukt pJO1 amplifiziert und
nach Mph1103I/BglII Restriktion das entstandene 492 Bp Fragment mit dem ebenso
geschnittenen Vektor pOVG1 ligiert. Von diesem Konstrukt sollte in S.lividans keine
Synthese von EGFP erfolgen.
Abb. 3.29: Konstrukte pOVG11 und pOVG17. Das in den Vektor pOVG1 jeweils integrierte Fragment ist in
gelb dargestellt, das EGFP-Gen tragende Fragment in grün. Das den Terminator tragende Fragment ist in blau,
der Terminator selbst ist in rot dargestellt. In S.lividans sollte von pOVG17 keine Synthese erfolgen, während
von pOVG11 die Produktion eines 249 Aminosäuren langen KcsA’-EGFP-Fusionsproteins erfolgen sollte,
bestehend aus den ersten 10 Aminosäuren von KcsA und nachfolgend den 239 von EGFP.
- 82 -
Ergebnisse
Um die vom potentiellen Promoterbereich von ksuL determinierte Synthese zu testen, wurde
der entsprechende Bereich amplifiziert und nach Mph1103I/BglII-Restriktion mit dem ebenso
geschnittenen Vektor pOVG1 ligiert. Nach Aufreinigung aus E.coli wurde das Konstrukt, das
den Namen pOVG14 erhielt (Abb. 3.30), in S.lividans TK21 transformiert.
Abb. 3.30: Konstrukt pOVG14. Das potentielle Promoter- ist in gelb, das EGFP-tragende Fragment in grün
und der Terminatorbereich in blau, der Terminator selbst in rot dargestellt. Für die Amplifikation des
potentiellen Promoter-Bereiches wurden die Oligos Pksulm1 und Pksulb2, als Template das Konstrukt pOBH23,
verwendet. Das entstandene 893 Bp Fragment wurde nach BglII/Mph1103I-Restriktion als 878 Bp großes
Fragment in pOVG1 eingefügt. Das ksuL-EGFP-Gen kodiert für ein Protein von 248 Aminosäuren, bestehend
aus den ersten 9 Aminosäuren von KsuL und den nachfolgenden 239 Aminosäuren von EGFP.
Die beiden Gene ksuC und ksuB bilden vermutlich eine einzige Transkriptionseinheit; es
wurde nur ein Konstrukt entwickelt mit dem vor ksuC liegenden potentiellen PromoterBereich. Zum Test der Aktivität wurde dieser potentielle Promotorbereich amplifiziert und
nach Mph1103I/BglII-Restriktion mit dem ebenso geschnittenen Vektor pOVG1 ligiert. Das
so entstandene Konstrukt pOVG15 wurde nach Aufreinigung aus E.coli in S.lividans TK21
transformiert (Abb. 3.31).
Ergebnisse
- 83 -
Abb. 3.31: Konstrukt pOVG15. Dargestellt sind: Das den potentiellen Promoter tragende Fragment in gelb, das
EGFP tragende in grün, der Terminatorbereich in blau und der Terminator selbst in rot. Für die Amplifikation
des potentiellen gemeinsamen Promoter-Bereiches von ksuC/ksuB wurden die Oligos PorfYm1 und PorfYb2, als
Template das Konstrukt pBRS2, verwendet. Das entstandene 527 Bp Fragment wurde nach BglII/Mph1103IRestriktion als 511 Bp großes Fragment mit dem ebenso geschnittenen Vektor pOVG1 ligiert. Vom
entstandenen Konstrukt sollte die Synthese eines KsuC’-EGFP-Proteins bestehend aus den ersten 9 Aminosäuren
von KsuC und nachfolgend dem EGFP-Protein erfolgen.
Der Abstand zwischen dem Ende von orfI und dem Start von cmlR beträgt 236 Bp. Daher
wurde für den Test der Synthese von CmlR nur ein relativ kurzer Abschnitt des
intergenischen Bereiches und einem Teil von orfI amplifiziert und in pOVG1 eingesetzt. Das
erhaltene Konstrukt erhielt den Namen pOVG12 und wurde nach Aufreinigung aus E.coli in
S.lividans TK21 transformiert (Abb. 3.32).
- 84 -
Ergebnisse
Abb. 3.32: Konstrukt pOVG12. Das den potentiellen Promoter von cmlR tragende Fragment ist in gelb
dargestellt. Für die Amplifikation wurden die beiden Oligos PcmlRm1 und PcmlRb2 und als Template pWH297
gewählt. Das erhaltene Fragment, mit einer Größe von 366 Bp, wurde nach BglII/Mph1103I-Restriktion als
348 Bp langes Fragment mit pOVG1 ligiert. Das EGFP-Gen tragende Fragment ist in grün dargestellt, der
Terminatorbereich in blau und der Terminator selbst in rot. Vom Konstrukt sollte die Produktion eines CmlR’EGFP-Proteins, bestehend aus den ersten neun Aminosäuren von CmlR und dem nachfolgenden EGFP-ProteinTeil, erfolgen.
Der Vektor pOVG1 besitzt den verhältnismäßig kurzen, nur gering exprimierenden,
potentiellen Promoter von ksuF aus pOVE3. Zum Test der Expression von ksuF wurde ein
mit ca. 1 kBp deutlich größerer Abschnitt des vor ksuF liegenden Abschnittes amplifiziert und
nach BglII/Mph1103I-Restriktion mit dem ebenso geschnittenen Vektor pOVG1 ligiert. Das
Konstrukt, welches den Namen pOVG13 erhielt (Abb. 3.33), wurde aus E.coli aufgereinigt
und in S.lividans TK21 transformiert.
Abb. 3.33: Konstrukt pOVG13 Dargestellt ist in grün das EGFP-Gen tragende Fragment, in blau der den
Terminator (in rot dargestellt) tragende Abschnitt und in gelb der potentielle Promoterbereich von ksuF. Der
potentielle Promotorbereich wurde mit Hilfe der Oligos pksuFm1 und pksuFb2 vom Konstrukt pJO1
Ergebnisse
- 85 -
amplifiziert, das entstandene 1057 Bp große Fragment nach BglII/Mph1103I Restriktion als 1032 Bp großes
Fragment mit pOVG1 ligiert. Das Konstrukt sollte die Synthese eines 249 Aminosäuren langen KsuF’-EGFPProteins ermöglichen, bestehend aus den ersten 10 Aminosäuren von KsuF und nachfolgend dem EGFPProteinteil.
3.5.2. „In vivo“ Nachweis der Synthese von EGFP (enhanced green fluorescent protein)
Unter den getesteten Bedingungen (Minimal-Medium mit 300 mM KCl und Vollmedium mit
Sucrose, jeweils mit 12,5 mg/l Thiostrepton) konnte bei 4 der 7 Transformanten eine
Produktion von EGFP nachgewiesen werden (siehe Abb. 3.34 und Abb. 3.35). In
Minimalmedium mit 300 mM KCl (Abb. 3.34) zeigt S.lividans pOVG13, das den PromoterBereich von ksuF trägt, die stärkste Fluoreszens. Es folgen, mit einer vergleichbaren
Fluoreszenz, die Transformanten S.lividans pOVG14, das den Promoterbereich von ksuL und
S.lividans pOVG15, welche den gemeinsamen Promoterbereich von ksuC und ksuB trägt; die
schwächste Fluoreszens zeigt die pOVG1 Transformante. Für die S.lividans-Transformanten
pOVG11, welches den Promoterbereich von kcsA und pOVG12, das den Promoterbereich des
für das Chloramphenicol-Resistenz determinierende cmlR trägt, konnte, wie auch für die
Negativ-Kontrolle, die pOVG17-Transformante, keine Synthese von EGFP gezeigt werden.
Bei Wachstum in Vollmedium mit Sucrose (siehe Abb. 3.35) ist ebenfalls bei den pOVG13-,
pOVG14-, pOVG15- und den pOVG1-Transformanten Fluoreszens nachzuweisen. Sie ist
jedoch jeweils deutlich geringer, als bei Wachstum in Minimalmedium mit 300 mM KCl. Die
stärkste Fluoreszens zeigt die pOVG14 Transformante, gefolgt von der pOVG15- und der
pOVG13-Transformante. Auch hier ist die Fluoreszens der pOVG1 Transformante sehr
gering. Das Konstrukt pOVG1 trägt wie pOVG13, den flussaufwärts gelegenen Bereich von
ksuF, ist jedoch um ca. 660 Bp kürzer. Die pOVG11- und die pOVG17-Transformante, als
Negativ-Kontrolle, zeigen keine Fluoreszens. Bei der pOVG12-Transformante ist bei
Wachstum auf Jasenka-Medium mit Sucrose unter Umständen eine sehr schwache
Fluoreszens zu erkennen, die jedoch, wenn tatsächlich vorhanden, nur unwesentlich stärker
ist, als die der pOVG11- und pOVG17-Transformanten.
Die Produktion von EGFP kann von pOVG12 (trägt den potentiellen Promoterbereich des für
die Chloramphenicol-Resistenz determinierenden Gens cmlR) mit Hilfe von Chloramphenicol
induziert werden (Abb. 3.36 a bis l). Die EGFP Produktion ist in den hier dargestellten
Abbildungen bei Wachstum in Minimalmedium und Induktion mit Chloramphenicol (Abb.
3.36 d) höher, als bei Wachstum in Vollmedium (Abb. 3.36 j). Es finden jedoch auch
Beispiele, bei denen die Synthese jeweils vergleichbar ist (nicht dargestellt). Die pOVG11
Transformante (trägt den potentiellen Promoter von kcsA) zeigt keine nachweisbare EGFPProduktion (nicht dargestellt). Das Wachstum der pOVG12 Transformante ist nach Induktion
mit 5 mg/l Chloramphenicol gegenüber der Kontrolle und den weiteren pOVGTransformanten deutlich verlangsamt (nicht dargestellt).
- 86 -
Ergebnisse
Abb. 3.34 a-n): Fluoreszensmikroskopie der S.lividans pOVG Transformanten bei Wachstum in MM40
Medium mit 300 mM KCl. Dargestellt ist jeweils links eine Aufnahme in Hellfeld, rechts jeweils die
dazugehörige Aufnahme als Fluoreszenzbild. a) und b) pOVG1 Transformante, c) und d) pOVG11
Transformante, e) und f) pOVG12 Transformante, g) und h) pOVG13 Transformante, i) und j) pOVG14
Transformante, k) und l) pOVG15-Transformante und in m) und n) die pOVG17-Transformante als NegativKontrolle. Die Stämme wurden jeweils als Sporen in Jasenka-Medium mit Sucrose ca. 20 h inkubiert, 5 h
geschüttelt und anschließend in MM40 Medium mit 300 mM KCl aufgenommen und für 3 h geschüttelt
Belichtungszeit: 7000 ms, 40x Objektiv, Binning 1x1, der Schwarzwert wurde jeweils auf 67 gesetzt, der
Weißwert auf 600.
Ergebnisse
- 87 -
Abb. 3.35 a-n): Fluoreszensmikroskopie der S.lividans pOVG Transformanten bei Wachstum in JasenkaMedium mit Sucrose. Dargestellt ist jeweils links eine Aufnahme in Hellfeld, rechts jeweils die dazugehörige
Aufnahme als Fluoreszenzbild. a) und b) pOVG1 Transformante, c) und d) pOVG11 Transformante, e) und f)
pOVG12 Transformante, g) und h) pOVG13 Transformante, i) und j) pOVG14 Transformante, k) und l)
pOVG15-Transformante und in m) und n) die pOVG17-Transformante als Negativ-Kontrolle. Die Stämme
wurden jeweils als Sporen in Jasenka-Medium mit Sucrose ca. 20 h inkubiert und anschließend für 9 h
geschüttelt. Belichtungszeit: 7000 ms, 40x Objektiv, Binning 1x1, der Schwarzwert wurde jeweils auf 67
gesetzt, der Weißwert auf 400.
- 88 -
Ergebnisse
Abb. 3.36 a-l): EGFP Synthese der S.lividans TK21 pOVG12 Transformante unter CloramphenicolInduktion. Dargestellt ist jeweils links die Hellfeldaufnahme, rechts das dazugehörige Fluoreszensbild. Die
Stämme wurden jeweils in MM40 Medium mit 300 mM KCl (in a bis h) oder in Jasenka Medium mit 10,3 %
Sucrose angezogen. Die Induktion erfolgte jeweils mit 5 mg/l Chloramphenicol (in c, d, g, h und i bis l).
a bis d, i und j): pOVG12 Transformante, e) bis h), k) und l): pOVG17 Transformante (Negativ-Kontrolle).
Belichtungszeit: 7000 ms, 40x Objektiv, Binning 2x2, der Schwarzwert wurde jeweils auf 70 gesetzt, der
Weißwert auf 700.
3.6. Charakteristika der Proteine
3.6.1. Klassifizierung des abgeleiteten Flavo-Proteins (KsuF)
327 Basenpaare stromaufwärts von kcsA findet sich in entgegengesetzter Flussrichtung ein
offenes Leseraster, mit einer Länge von 1119 Bp. Es determiniert für ein Protein mit einer
Länge von 373 Aminosäuren (siehe Anhang A) und erhielt den Namen ksuF bzw. KsuF für
das hiefür determinierte Protein. Vor dem Startkodon findet sich eine potentielle ShineDalgarno-Sequenz. Hinter ksuF liegt ein Terminator, nachfolgend ksuL, das in
entgegengesetzter Flußrichtung von ksuF lokalisiert ist (siehe Anhang A und B).
KsuF gehört zur Familie der „Aromatic-ring hydroxylase“ (RNGMNOXGNASE, Acc.Nr.:
IPR003042, auch als „Flavoprotein Monooxygenase“-Famile bezeichnet; Harayama, S., et al.;
Ergebnisse
- 89 -
1992), mit 1896 Mitgliedern, die sich sowohl bei Bakterien (1298 identifizierte Mitglieder),
als auch bei Archaen (102 Mitglieder) und Eukaryoten (einschließlich von 136
Plastiddeterminierten: 496 Mitglieder) finden (Stand 2003, InterPro). Die Signatur dieser
Familie wurde aus 30 Proteinsequenzen gebildet und besteht aus sechs kurzen Motiven
(PR00420, Search PRINTS-S der Print Datenbank, 1999). Die meisten Mitglieder dieser
Familie besitzen jedoch nur einen Teil der Motive, die häufigste Anzahl sind 2 Motive
(PR00420, Search PRINTS-S der Print Datenbank, 1999). Bei KsuF finden sich 3 Motive
(Motiv 1, 2 und 3), die jeweils an der Bindung des FAD-Cofaktors beteiligt (Abb. 3.37 a) und
hoch konserviert sind. Die außerhalb dieser 6 Motive liegenden Bereiche sind jeweils hoch
variabel. Die größte Untergruppe (Unterfamilie) der „Aromatic-ring hydroxylase“ zeichnet
sich durch den Besitz der „Monooxygenase, FAD-binding“ Domäne („FAD_binding_3“, auch
als „mOase_FAD_bd“ bezeichnet, Acc.Nr.: IPR002938, Harayama, S., et al.; 1992) aus. In
diese ist die „Monooxygenase“ (single domain) Familie (pfam01360.11) aufgegangen.
„FAD_binding_3“ ist in KsuF vollständig enthalten und erstreckt sich, bis auf einen kurzen Cterminalen Bereich, über die komplette Länge von KsuF (siehe Abb. 3.37 b). Von den 835
Mitgliedern, bei denen diese Domäne identifiziert wurde, finden sich 550 unter den Bakterien
(davon 15 bei den Cyanobakterien), 8 bei den Archaeen und 277 bei den Eukaryoten
(einschließlich 51 plastiddeterminierten) (ebenfalls Stand 2003, InterPro). Der Archetyp
dieser Untergruppe ist die p-Hydroxybenzoat Hydroxylase (PHBH, EC 1.14.13.2), aus
Pseudomonas aeruginosa und Pseudomonas fluorescens, das im Lignin-Degradationsweg
involviert, durch Röntgenstrukturanalysen analysiert und am besten untersucht ist.
Abb. 3.37 a-c): Homologe Bereiche von KsuF zu Erkennungssequenzen einer Familie und einer Domäne.
Durch Flavin hervorgerufene Gelbfärbung des aufgereinigten Proteins. Dargestellt sind in a) die 3
gefundenen Erkennungsmotive der Familie der „Aromatic-ring hydroxylase“ (RNGMNOXGNASE) als grüne
Kästchen ( ), die für die Bindung von FAD am Protein verantwortlich und hoch konserviert sind. Die
Positionen sind: Aminosäure 4-26 für die erste konservierte Struktur, 147-162 für die zweite und 287-302 für die
dritte. In b) ist der zu der „FAD_binding_3“-Domäne (Monooxygenase, FAD binding) homologe Bereich als
blauer Kasten ( ) dargestellt, der sich von Aminosäure 2-348 von KsuF erstreckt. Das 373 Aminosäuren lange
KsuF ist jeweils als schwarzer Balken dargestellt. In c) ist über Ni-NTA aufgereinigtes His-KsuF aus E.coli
M15[pREP4] pQE314 (linkes Reaktionsgefäß) im Vergleich zum verwendeten Puffer (rechtes Reaktionsgefäß)
gezeigt. Die Gelbfärbung, durch das nicht kovalent gebundene Flavin hervorgerufen, ist deutlich zu erkennen.
- 90 -
Ergebnisse
Mitglieder der „FAD_binding_3“ Familie (im Weiteren als Flavoprotein Monooxygenasen
bezeichnet) verwenden aromatische Verbindungen als Substrat und hydroxylieren diese.
Hierbei wird NAD(P)H oxidiert, O2 reduziert, ein Sauerstoffatom wird in die Hydroxylgruppe
eingeführt, das zweite als H2O freigesetzt (siehe Abb. 3.38).
Abb. 3.38: Reaktionsschema der Flavoprotein Monooxygenasen
Typische Substrate sind z.B. 4-Hydroxybenzoat (PobA, p-Hydroxybenzoat Hydroxylase
(PHBH, EC 1.14.13.2) aus P.aeruginosa und P.fluorescens), 2-Hydroxybenzoat (Salicylat
Hydroxylase, EC 1.14.13.1, z.B. aus P.fluorescens (NahG), und Pseudomonas stutzeri AN10
(NahW)) und Phenol (Phenol Hydroxylase (PHHY, EC 1.14.13.7) aus Trichosporon
cutaneum). Sie sind auch beteiligt an der Inaktivierung von Tetracyklinen (TetX aus
Bacteroides fragilis, zeigt bei Synthese in E.coli eine Tetracycline Resistenz), an der Synthese
von Tetracyklinen (TcsC, Anhydrotetracyclin Oxygenase, z.B. aus Streptomyces
aureofaciens) oder der Synthese von Ubichinon (UbiH, 2-Octaprenyl-6-methoxyphenol
Hydroxylase aus E.coli). Bei den meisten Mitgliedern dieser Unterfamilie ist das Substrat
jedoch unbekannt.
Als Kofaktoren besitzen sie NADPH oder NADH, des Weiteren FAD, das nicht kovalent am
Protein gebunden ist. Nukleotid-Kofaktoren binden an Proteine gewöhnlich über eine
„Rossman fold“ Sekundärstruktur (Rao, S. T. and Rossman, M.G.; 1973). Sie findet sich im
N-terminalen Teil und ist vorwiegend für die Bindung des Adenosin-Teils des FADs
verantwortlich
(β1α1β2α2β3-Sekundärstruktur,
siehe
Abb.
3.39).
Flavoprotein
Monooxygenasen sind somit Mitglieder des „Clans“ „FAD/NAD(P)-binding Rossmann fold
Superfamily“. Die Bindung von NAD(P)H erfolgt bei Flavoprotein Monooxygenasen nicht
über diese Sekundärstruktur. His-Tag KsuF zeigt nach Aufreinigung aus E.coli (Abb. 3.37 c)
wie auch aus S.lividans (nicht dargestellt) eine starke Gelbfärbung, hervorgerufen durch das
nicht kovalent gebundenen FAD.
Drei Proteine der Flavoprotein Monooxygenasen wurden durch Röntgenstrukturanalysen
aufgeklärt. Die Phenol Hydroxylase (EC 1.14.13.7) aus Trichosporon Cutaneum (1foh.pdb,
Enroth, C., et al.; 1998), die Cholesterol Oxidase (EC 1.1.3.6) aus Brevibacterium sterolicum
(1coy.pdb, Li, J., et al.; 1993) und die p-Hydroxybenzoat Hydroxylase (PHBH, EC 1.14.13.2)
aus P.aeruginosa und P.fluorescens. KsuF zeigt zur Phenol Hydroxylase aus Trichosporon
Ergebnisse
- 91 -
Cutaneum zu geringe Homologien, um eine Strukturaufklärung zu betreiben. Vor allem, da
sich bei 1foh.pdb die Abschnitte zwischen den homologen Bereichen in der Größe zu stark
unterscheiden. Die Cholesterol Oxidase zeigt (mit Ausnahme eines Motivs, „Rossman fold“)
keine Ähnlichkeiten zu KsuF oder weiteren Mitgliedern der„FAD_binding_3“-Familie.
Die Kristallisation der p-Hydroxybenzoat Hydroxylase ist jeweils mit dem Cofaktor FAD und
dem Substrat p-Hydroxybenzoat (pOHB) gelungen. Der zweite Cofaktor, NADPH, konnte
nicht zusammen mit dem Enzym kristallisiert werden; die Cokristallisation von NAD(P)H
gelang auch nicht bei der Phenol Hydroxylase und Cholesterol Oxidase. Drei unterschiedliche
Konformationen von PHBH sind kristallisiert, eine „in“ Konformation, in der das FAD in der
Nähe des pOBH lokalisiert ist. Hierfür ist 1pbe.pdb (Schreuder, H.A., et al; 1989) aus
P.fluoreszens der Archetyp. Eine „out“ Konformation, in der das FAD an der Oberfläche des
Proteins und der Flavinteil des FAD gegenüber der „in“ Konformation vom Substrat entfernt,
lokalisiert ist, hierfür wird 1dob.pdb aus P.aeruginosa (Gatti, D.L., et al; 1994) als Archetyp
verwendet. Eine „open“ Konformation, in der das Substrat aufgenommen und das Produkt
freigesetzt wird, 1k0j.pdb (Wang, J. et al; 2002) aus P.aeruginosa ist hierfür der Archetyp.
In 1dob.pdb wurde Tyr 222 gegen Phe 222 (Y222F) ausgetauscht, so dass die „out“
Konformation erhalten wurde. In 1k0j.pdb wurde Arg 220 gegen Gln220 ausgetauscht, so
dass die „open“ Konformation erhalten wurde, des Weiteren unterscheidet sich PHBH aus
P.aeruginosa an 2 zusätzlichen Positionen von der aus P.fluoreszens (siehe Abb. 3.39). Trotz
relativ geringer Homologien von 30,6 % (davon 19,6 % identische Aminosäuren zu Sequenz
von 1dob und 1k0j und 20,1 % identische zu 1pbe) gelang es, für KsuF zu den pHydroxybenzoat Hydroxylasen ein Alignment zu erstellen (Abb. 3.39). Hieraus konnte
sowohl für die „in“ als auch die „out“ Konfiguration jeweils eine putative Kristallstruktur
generiert werden (Abb. 3.40 a-d). Zu der „open“ Konfiguration gelang dies nicht. Die
höchsten Homologien finden sich in den drei primär an der Bindung von FAD beteiligten
Abschnitten. Diese entsprechen den drei bei KsuF gefundenen Erkennungsmotiven für die
„Aromatic-ring hydroxylase“ Familie (Abb. 3.37 a und Abb. 3.39). Die in PHBH an der
Bindung von FAD, des Substrates und NADPH beteiligten Aminosäuren sind identifiziert und
im Alignement eingetragen (Abb. 3.39).
- 92 -
Ergebnisse
Abb. 3.39: Sequenzvergleich von KsuF mit der p-Hydroxybenzoat Hydroxylase. Dargestellt ist ein
Alignment von KsuF mit der Sequenz von 1dob.pdb („out“-Konfiguration) und 1pbe.pdb („in“-Konfiguration).
Die mit KsuF identischen Aminosäuren sind schwarz hinterlegt, die homologen grau. 1dob und 1pbe
unterscheiden sich an drei Positionen, die in 1dob mutierte Aminosäure Y222F und die Aminosäuren an den
Positionen 228 und 249. Diese sind rot umrandet. Die Sekundärstrukturen von 1dob und 1pbe und die im
Vergleich hierzu ermittelten von KsuF sind unter dem Alignment dargestellt, s steht für β-sheet, h für α-helix.
Die Lücken in den jeweiligen Sequenzen sind durch – markiert. Die Sekundärstrukturen der „out“ Konformation
sind rot dargestellt, die der „in“-Konformation in grün. In PHBH wurden die für die Bindung des Substrates
(pOBH), FAD und NADPH beteiligten Aminosäuren ermittelt. Die Positionen sind oberhalb des Alignments
markiert, mit einem * markierte Aminosäuren sind beteiligt an der Bindung von FAD, die mit einem +
markierten an der Bindung von NADPH und die mit einem ^ markierten an der Bindung des Substrates und dem
Wasserstoffbrückennetzwerk. Die für die Bindung des Adenosin-Teils des FAD beteiligten β-sheet und α-helix
Sekundärstrukturen (Rossman fold) sind eingetragen (β1 α1 β2 α2 β3).
Ergebnisse
- 93 -
Abb. 3.40 a-d): Putative Kristallstrukturen von KsuF in der „in“ und „out“ Konformation. Dargestellt sind
in a) und b) jeweils die potentiellen monomeren, in c) und d) die potentiellen dimeren Strukturen. In a) und c) ist
KsuF in der „in“ Konfiguration, berechnet aus der Kristallstruktur der p-Hydroxybenzoat Hydroxylase aus
P.fluoreszens (1pbe.pbd), in b) und d) in der „out“ Konfiguration, berechnet aus der Kristallstruktur der Y222F
Mutante aus P.aeruginosa (1dob.pdb), abgebildet. Die zwei Untereinheiten des Dimers sind in grün und gelb,
FAD ist allen vier Abbildungen in schwarz dargestellt. Die Sichtweise der in a) und b) dargestellten monomeren
Strukturen entsprechen der Aufsicht der in c) und d) in grün dargestellten Untereinheit, das Molekül ist um 180
Grad gedreht. Berechnet wurden die Kristallstrukturen jeweils im „Alignement Interface“-Modus des SwissModel Servers, mit Hilfe des in Abb. 3.39 vorgestellten Alignements. Da keine Kristalldaten des potentiellen
Dimers veröffentlicht worden sind, wurde die potentielle Dimer-Struktur jeweils von Hand modelliert.
3.6.2. Reinigung und Charakterisierung des Flavoproteins
Nativ aus E.coli M15[pREP4] pQE314 und aus S.lividans TK21 pOVE33 über Ni-NTA
aufgereinigtes His-Tag KsuF wurde über Gelfiltration zusammen mit GrößenstandardProteinen aufgetrennt (Abb. 3.41 a-d und Abb. 3.42 a-f). His-Tag KsuF kann jeweils in zwei
Fraktionen nachgewiesen werden, die im Vergleich zu den Standard-Markerproteinen in der
Größe dem Monomer und einem Multimer, mit einer Größe zwischen Dimer und Trimer, von
His-Tag KsuF entsprechen. Auf Grund von fehlenden und unpassenden GrößenstandardProteinen war eine genauere Bestimmung, auch bei Verwendung einer anderen Gelmatrix
- 94 -
Ergebnisse
(Superose 6), nicht möglich. Der His-Tag KsuF Flavin-Komplex kann für das, aus E.coli
M15[pREP4] pQE314 aufgereinigte Protein, spektrophotometrisch nur in den gelbfarbigen,
der Monomergröße entsprechenden Fraktionen, nachgewiesen werden (Abb. 3.41 d). In den
Multimerfraktionen ist FAD nicht nachweisbar (Abb. 3.41 c). Der spektrophotometrische
Nachweis des Flavins nach Aufreinigung aus S.lividans ist trotz geringer Synthese und der
Verluste bei den nachfolgenden Aufreinigungsschritten gelungen. FAD findet sich ebenfalls
nur in den Monomerfraktionen. Die für FAD typischen Absorptionsmaxima bei 375 nm und
450 nm sind, wenn auch nicht deutlich, zu erkennen (Abb. 3.42 f). In den Multimerfraktionen
von His-Tag KsuF aus S.lividans TK21 pOVE33 sind zwei Proteine, mit der erwarteten
Mobilität für His-Tag KsuF von 40,8 kDa und mit einer um ca. 2,5 kDa geringeren Mobilität,
zu finden (Abb. 3.42 b, Spuren 1-3). Die Vermutung, dass neben His-Tag KsuF das
chromosomal determinierte KsuF (theoretische Größe von 39,1 kDa) als Dimer
coaufgereinigt worden ist, bestätigte sich nicht. Antikörper gegen den His-Tag zeigen
Kreuzreaktionen gegen beide Proteine (Abb. 3.42 d, Spur 1). Das mit einer Mobilität von ca.
38-39 kDa laufende Protein ist wahrscheinlich ein C-terminales Abbauprodukt von His-Tag
KsuF. In den das Multimer enthaltenen Fraktionen findet sich eine gleichmäßig exponentiell
abfallende Absorption in Richtung der längerwelligen Bereiche. Dies ist ein Zeichen für
Streuung, hervorgerufen durch unlösliches, ausgefallenes Protein (Abb. 3.41 c und Abb. 3.42
f). Durch Zentrifugation der Probe vor der Gelfiltration findet sich ein durch His-Tag KsuF
gebildetes Proteinpellet, welches keine durch FAD hervorgerufene Gelbfärbung zeigt. Der
Anteil des Multimers ist bei einer nachfolgenden Gelfiltration deutlich reduziert (nicht
dargestellt). Bei Gelfiltration von His-Tag KsuF sind im Lauf-Bereich des monomeren
Proteins zwei sich überlagernde Elutionsspitzen zu erkennen. In den Fraktionen derjenigen,
die früher eluiert wird, kann Streuung nachgewiesen werden. Das FAD/His-Tag KsuF
Verhältnis ist deutlich in Richtung der Proteinkonzentration verschoben (nicht dargestellt).
Die nachgewiesene FAD-Konzentration stammt vermutlich von dem bei der Gelfiltration
überlagernd laufenden monomeren FAD-tragendem His-Tag KsuF. Nach Zentrifugation der
Streuung hervorrufenden Fraktionen des Multimers findet sich wieder ein von His-Tag KsuF
gebildeter nicht gelber Proteinniederschlag. In den monomeren FAD-enthaltenden Fraktionen
ist keine Streuung zu erkennen. Es findet sich nach Zentrifugation kein Niederschlag, His-Tag
KsuF ist nur in der monomeren FAD-tragenden Form löslich.
Ergebnisse
- 95 -
Abb. 3.41 a-d): Nachweis des Multimerisierungsgrades von His-Tag KsuF aus E.coli M15[pREP4]
pQE314 und spektrophotometrischer Nachweis von FAD. His-Tag KsuF wurde zusammen mit
Markerproteinen über Gelfiltration (Superdex75) aufgetrennt. In a) ist der Plot des Laufes dargestellt, in b) das
mit Coomassie gefärbte Gel, auf dem Proben von 5 Fraktionen (sind entsprechend in a) mit der entsprechenden
Zahl und mit
für den entsprechenden Fraktionsbereich markiert) aufgetragen worden sind. Auf der rechten
Seite der Abbildung sind die jeweiligen Proteine markiert (BSA, Albumin Bovine Serum, apparentes
Molekulargewicht von 66 kDa; His-Tag KsuF mit einem theoretischen Molekulargewicht von 40,8 kDa; CA,
Carbonic-Anhydrase, apparentes Molekulargewicht von 29 kDa; CyC, CytochromC mit apparentem
Molekulargewicht von 12,4 kDa). In c) und d) ist das Spektrum von 2 Fraktionsbereichen dargestellt, die der
Fraktion 1 (dargestellt in c) und 3 (dargestellt in d) aus Abb. a) entsprechen, allerdings aus einer Aufreinigung
stammen, in der ca. die 30fache Menge eingesetzt wurde. Auf der X-Achse ist die Wellenlänge in nm
aufgetragen, auf der Y-Achse die Absorption. c) Dargestellt ist in rot das Spektrum der potentiellen MultimerFraktion, in gelb FAD als Kontrolle. d) Dargestellt ist in rot das Spektrum der FAD tragenden Monomerfraktion,
in blau das des errechneten FAD-Anteils (FAD tragende Monomeranteil minus Spektrum von BSA) und in gelb
die FAD-Kontrolle.
- 96 -
Ergebnisse
Abb. 3.42 a-f): Nachweis des Multimerisierungsgrades von His-Tag KsuF aus S.lividans TK21 pOVE33
und spektrophotometrischer Nachweis von FAD. His-Tag KsuF wurde zusammen mit Markerproteinen über
Gelfiltration (Superdex75) aufgetrennt, in a) ist der Plot des Laufes, in b) und c) sind die über SDS-Page
aufgetrennten Fraktionen dargestellt (Coomassie gefärbt). Die Laufhöhen von BSA (Albumin Bovine Serum,
apparentes Molekulargewicht von 66 kDa), His-Tag KsuF (theoretisches Molekulargewicht von 40,8 kDa) und
von CA (Carbonic Anhydrase, apparentes Molekulargewicht von 29 kDa) sind markiert. Die in den „Multimer“Fraktionen zu erkennenden 2 KsuF-Derivate sind mit ( ) markiert. Die Nummerierung der Spuren entspricht
den mit ( ) markierten Fraktionsbereichen in a). Die im Plot a) gezeigte rechte Absorptionspitze wird von
CytochromC (apparentes Molekulargewicht von 12,4 kDa) gebildet, wurde jedoch nicht in b) und c) aufgetragen.
In d) und e) erfolgte der Nachweis von His-Tag KsuF nach Transfer auf Membranen mit Hilfe von Antikörpern
gegen den His-Tag (jeweils Spur 1) und gegen KsuF (jeweils Spur 2). In d) wurde die Fraktion 2 aufgetragen, in
e) die Fraktion 5. 8S ist jeweils der Protein-Größenstandard. Das Absorptionsspektrum der „Multimer“- (in rot)
und der „Monomer“- (in blau) Fraktion ist in f) dargestellt, stammen allerdings aus einer Aufreinigung über
Gelfiltration, in der eine größere Menge an His-Tag KsuF eingesetzt wurde. Die „Multimer“-Fraktion entspricht
den Fraktionen 1-3, die „Monomer“-Fraktion der Fraktion 5. Auf der X-Achse ist die Wellenlänge in nm
dargestellt, auf der Y-Achse die Absorption.
Ergebnisse
- 97 -
Mitglieder der Flavoprotein Monooxygenasen weisen pro Untereinheit jeweils ein
Flavin/FAD auf. Zur Untersuchung des FAD/KsuF-Verhältnisses des monomeren FADtragenden KsuF wurde die FAD-Konzentration spektrophotometrisch bei 450 nm bestimmt,
die Proteinkonzentration mit Hilfe eines Proteintests (Abb. 3.43). Errechnet wurde ein
Verhältnis von 0,9744 FAD pro KsuF-Untereinheit mit einer Standardabweichung σx von
0,0741. Die für die Berechnung verwendeten Werte sind im Anhang D dargestellt.
Abb. 3.43: Darstellung des FAD/KsuF-Verhältnisses. Aus drei unterschiedlichen Anzuchten und
Aufreinigungen von His-Tag KsuF aus von E.coli M15[pREP4] pQE314, wurde das FAD/KsuF-Verhältnis
jeweils der zusammen 14 monomeren FAD tragenden Fraktionen bestimmt. In A, B und C ist jeweils das
FAD/Proteinverhältnis der drei unterschiedlichen Aufreinigungen mit je 4, 5 und 5 gemessenen Fraktionen
dargestellt, in D der Mittelwert der 14 Proben, jeweils als Balkengrafik (genaue Werte siehe Anhang D). Der
maximale Streuungsbereich der Werte ist jeweils durch ein schwarzes (I) dargestellt, in D zusätzlich die
Standardabweichung σx durch ein rotes (I). Die Proteinkonzentration wurde jeweils mit Hilfe des BCAProteintests bestimmt, die FAD-Konzentration durch Messung der Absorptionsspitze bei 450 nm im Vergleich
zu FAD (zur Bestimmung der FAD-Konzentration wurde der erhaltene Wert mit dem Korrekturfaktor 1,097
(Palfey, B.A., et al, 2003) multipliziert, siehe auch: Materialen und Methoden, 2.6.7.).
- 98 -
Ergebnisse
Zur Bestimmung des Kofaktors in KsuF wurde aufgereinigtes His-Tag KsuF Protein aus
S.lividans pOVE33 und käuflich erworbenes FAD über HPLC aufgetrennt und anschließend
massenspektrometrisch untersucht. Nach ca. 12,3 Minuten Elutionsdauer erschien jeweils in
der Absorptionsmessung (nicht dargestellt) der HPLC eine Spitze, die in der
massenspektrometrischen Analyse von einem Molekül mit einer Größe von 786,3 m/z bzw.
786,2 m/z gebildet wird (Abb. 3.44 a und e). Dies entspricht der erwarteten Größe von FAD
mit einem Molekulargewicht von 785 MW + 1 Proton. Das FAD ist jeweils einfach positiv
geladen. Dieses Molekül wurde jeweils massenspektrometrisch in einem MS2-Spektrum
untersucht. Es wurden präferentiell zwei einfach geladene Moleküle mit 348 m/z (347 MW +
1 Proton) und 439 m/z bzw. 439,1 m/z (438 MW + 1 Proton) erhalten (Abb. 3.44 b und f).
Zusammen ergeben die Molekulargewichte jeweils eine Größe von 787 m/z (785 MW + 2
Protonen), was der von FAD entspricht. Das 347 MW + 1 Proton Fragment von FAD besteht
aus dem Adenosin Teil und einer Phosphatgruppe (AMP), das 437 MW + 1 Proton aus dem
Flavin- und dem Ribitol-Teil und PO3H. Von beiden Molekülen wurde ein MS3 Spektrum
erstellt. Die Analyse des Moleküls mit einer Größe von 348 m/z ergab ein Molekül mit
136 m/z (135 MW + 1 Proton, siehe Abb. 3.44 c und g), das dem einfach positiv geladenen
Adenin entspricht. Die Analyse des 439 m/z Flavin-Ribitol-PO3H Teils des FAD ergab
jeweils 5 identische Molkül-Bruchstücke, mit 297 m/z, 341,1 m/z, 359/359,1 m/z,
396/395,9 m/z und 421,1 m/z. Bei dem aus dem gekauften FAD fand sich zusätzlich noch ein
Fragment von 295 m/z, bei dem aus dem gereinigten His-Tag KsuF aus S.lividans pOVE33
fanden sich drei weitere mit 242,9 m/z, 323.1 m/z und 403 m/z (Abb. 3.44 d und h). Das
242,9 m/z Fragment wird vermutlich vom Flavinteil gebildet, das 395 m/z Fragment vom
Flavin-Ribitolteil.
In dem aus E.coli M15[pREP4] pQE314 aufgereinigtem His-Tag KsuF konnte FAD, mit
Hilfe von HPLC, durch ein identisches Laufverhalten mit der Kontrolle (käuflich erworbenen
FAD), nachgewiesen werden (nicht dargestellt).
Ergebnisse
- 99 -
Abb. 3.44 a-h): Massenspektrometrische Analyse von FAD. Dargestellt sind die MS- in a) und e), MS2- in b)
und f) und je zwei MS3-Spektren in c), d), g) und h) von käuflich erworbenen FAD in a-d) und von FAD aus
S.lividans aufgereinigtem His-Tag KsuF in e-h). Auf der Y-Achse ist jeweils die Intensität der Signale, auf der
X-Achse der m/z-Wert (Molekulargewicht + Anzahl positiver Ladungen/Anzahl positiver Ladungen) dargestellt.
Mit einem roten
Quadrat sind die Moleküle jeweils markiert, die in den nachfolgenden MS-Spektren
untersucht wurden. Mit einem grünen
Quadrat ist in den MS2 und MS3 Spektren auf der X-Achse jeweils die
Ursprungsgröße des untersuchten Moleküls abgebildet. In den beiden MS2-Spektren in b) und f) wurde jeweils
das im MS-Spektrum gefundene Molekül mit einer m/z von 786 untersucht, das 348 m/z große Molekül wurde
in den MS3-Spektren c) und g), das Molekül mit einer m/z von 439 in den MS3-Spektren in d) und h). Die
Proben wurden vor den MS-Messungen über HPLC aufgetrennt (ThermoQuest 250 x 4,6 mm, 5 µm HyPURITY
Elite C18).
- 100 -
Ergebnisse
Für die Kristallisation von KsuF wurde der Stamm E.coli M15[pREP4] pQE314, wie im
Methodenteil beschrieben, angezogen und His-Tag KsuF zweimal unter „nativen“
Bedingungen über Ni-NTA aufgereinigt. Nach Umpufferung erfolgte die Aufreinigung über
FPLC (Superose 6 Gelfiltration). Nach Ankonzentration und Umpufferung der gelb gefärbten,
Flavin tragenden monomeren Fraktion von His-Tag KsuF auf 25 mM Hepespuffer pH 7,5
wurde je 1 µl mit einer Proteinkonzentration von 15 µg/µl als Kristallisations-Ansatz für die
240 unterschiedlichen Puffer eines Kristallisations Screening Kits verwendet. Die erste
Kontrolle nach 48-72 h zeigte, dass es in 238 zur Ausbildung eines Präzipitats gekommen
war, zwei waren auf Grund von Pipettierfehlern misslungen. Auch bei weiteren Kontrollen
nach ca. 3 und 9 Monaten konnte keine Kristallbildung festgestellt werden. Es gilt die
Grundregel, dass, wenn in keinem oder in allen Testpuffern eines Kristallisationsansatzes das
Protein präzipitiert, es aussichtslos sein wird, das Protein zu kristallisieren (A.Saito,
persöhnliche Mitteilung). Auf weitere Versuche wurden verzichtet.
3.6.3. Analyse des extrazellulären Proteins KsuL
776 Bp hinter ksuB findet sich in identischer Leserichtung ein offenes Leseraster mit einer
Länge von 1755 Bp, das für ein Protein mit einer Länge von 585 Aminosäuren determiniert,
eine potentielle Shine-Dalgarno Sequenz ist zu identifizieren (siehe Anhang A). In der
Zwischenzeit wurde dieses offene Leseraster in molS und MolS für das hierfür determinierte
Protein umbenannt. In dieser Arbeit wird weiterhin der vorherige Name ksuL für das Gen und
KsuL für das hierfür determinierende Protein verwendet. Hinter ksuL folgt in 133 Bp Abstand
in entgegengesetzter Leserichtung ksuF. In dem intergenischen Bereich zwischen ksuL und
KsuF findet sich ein Terminator (siehe Anhang A und B). KsuL besitzt im N-terminalen
Bereich eine Signalsequenz von 39 Aminosäuren Länge. Dies konnte sowohl theoretisch
durch Berechnung (SignalP 3.0 Server) mit Hilfe des „Neural Networks-“ (Bendtsen, J.D., et
al; 2004; Nielsen, H., et al; 1997) und des „Hidden Markov-Modells“ (Nielsen, H. and Krogh,
A.; 1998) gezeigt, als auch experimentell durch Ansequenzierung des aufgereinigten Proteins,
nachgewiesen werden (pers. Mitteilung H.Schrempf).
KsuL zeigt im C-terminalen Bereich Ähnlichkeiten zu der C-terminalen katalytisch aktiven
Domäne von Mitgliedern der Lysyl-Oxidasen, auch als Protein Lysin 6-Oxidasen bezeichnet
und zur katalytisch aktiven Domäne der Lysyl-Oxidase ähnlichen Proteinen (siehe Abb. 3.45).
Diese gehören zur Amine Oxidase (AO) Familie, die sich in die FAD enthaltenden Amine
Oxidase und in die Kupfer enthaltenden Semicarbizide sensitiven Amin Oxidasen (SSAO)
aufteilen (Jalkanen, S. and Salmi, M.; 2001). Die Lysyl Oxidasen (EC 1.4.3.6) sind Mitglieder
der SSAO-Familie und sind extrazellulär. SSAO’s besitzen gewöhnlich Topa-Quinone (TPQ)
als Kofaktor (Klinman, J.P. and Mu,D.; 1994; Klinman, J.P.; 1996; Lyles, G.A.; 1996), Lysyl
Oxidasen allerdings eher Lysin-Tyrosylquinon (Wang S.X., et al.; 1997). Die beiden hierfür
benötigten Aminosäuren (Tyrosin und Lysin) sind auch in KsuL zu finden (siehe Abb. 3.45).
Ergebnisse
- 101 -
SSAO’s sind dimere Glycoproteine mit einer durchschnittlichen Größe von 140-160 kDa
(Klinman, J.P. and Mu, D.; 1994; Lyles, G.A.; 1996), die zwei Kupferatome pro Dimer
enthalten; diese sind über Histidine an die SSAO’s gebunden (siehe Abb. 3.45). Lysyl
Oxidasen sind an der Verknüpfung von Collagen- oder Elastin-Ketten untereinander
involviert und führen folgende Reaktion durch:
Peptidyl-L-Lysyl-Peptide + O2 + H2O = Peptidyl-Allysyl-Peptide + NH3 + H2O2
Im Folgenden kommt es zur Autokondensation der Peptidyl-Allysyl-Peptide, mit Ausbildung
einer Matrix. In den letzten Jahren wurden weitere Funktionen der Lysyl Oxidasen und der
Lysyl Oxidase ähnlichen Proteine vermutet.
KsuL zeigt nur zu zwei Proteinen über die volle Länge Homologien, diese sind das
vermutliche Pedant in S.avermitilis (BAC72171), mit einer Länge von 563 Aminosäuren und
aus Nocardia sp. JS614 (ZP_00656873), mit einer Länge von 527 Aminosäuren, beide sind
nicht weiter untersucht. Des Weiteren findet sich in der kürzlich veröffentlichten S.scabiesSequenz ein KsuL-Homolog mit einer vermutlichen Länge von 586 Aminosäuren (Basen:
4945557-4943764, http://www.sanger.ac.uk/Projects/S_scabies/). Ein Sequenzvergleich
dieser drei Proteine mit KsuL ist im Anhang E dargestellt.
Abb. 3.45: Sequenzvergleich des C-terminalen Teils von KsuL mit den entsprechenden Bereichen von 3
Lysyl Oxidasen und einem Lysyl Oxidase ähnlichen Protein. Dargestellt ist ein Mitglied der Lysyl Oxidase
ähnlichen Proteine (Plo1 aus Perca flavescens, AAC79085, 819 Aminosäuren) und 3 Lysyl Oxidasen
(LYOX_CHICK aus Gallus gallus, Q05063, 420 Aminosäuren; LYOX_MOUSE aus Mus musculus,
NP_034858, 411 Aminosäuren und LYOX_HUMAN aus Homo sapiens, P283000, 417 Aminosäuren) im
Vergleich zu KsuL (rot markiert). Die jeweils identischen Aminosäuren sind schwarz hinterlegt, die homologen
mit grau. Die an der Ausbildung des Lysin-Tyrosylquinon beteiligten Lysin (K467) und Tyrosin (Y518) sind
jeweils durch einen
markiert, die drei an der Koordination des Cu-Ions beteiligten Histidine durch
.
- 102 -
Ergebnisse
KsuL kann in den Überständen der Medien in drei Formen nachgewiesen werden: Als Protein
mit einer Laufhöhe von ca. 60 kDa (Abb. 3.46 Spur 5) und/oder in 2 Fragmenten von ca. 31
und 26 kDa (siehe Abb. 3.46 Spuren 2 und 3). In Stämmen, die nicht KsuL tragen, wie
S.lividans NI pOV001 (Abb. 3.46 Spur 1) oder der KsuL Deletionsmutante S.lividans ∆L17
(Abb. 3.46 Spur 4), ist KsuL nicht nachweisbar.
Das Protein mit der Laufhöhe von ca. 60 kDa entspricht in der Größe dem „reifen“ KsuL
ohne Signalsequenz von 57,8 kDa, die beiden kleineren Signale dem N-terminalen- (ohne
Signalsequenz) und C-terminalen-Fragment von 32,1 kDa und 25,7 kDa. Der Nachweis
erfolgte durch Aufreinigung und Ansequenzierung der jeweiligen Fragmente in unserer
Arbeitsgruppe (pers. Mitteilung H.Schrempf). Bei Synthese in S.lividans NI, die ksuL
tragende Konstrukte besitzen, finden sich nur die N-terminalen oder C-terminalen Fragmente.
In S.lividans WT kann nur das vollständige Protein (ohne Signalsequenz) nachgewiesen
werden (wie hier dargestellt), es finden sich aber auch Synthesen, in denen sich das „reife“
Protein und die N- und C-terminalen Fragmente, nur die N- und C-terminalen Fragmente oder
nur das N-terminale Fragment (siehe Abb. 3.64 Spuren 1-7) nachweisen lassen. Eigene
Versuche zeigten, dass vor allem das C-terminale Fragment von KsuL sehr schnell abgebaut
wurde.
Abb. 3.46: Synthese von KsuL. Aufgetragen wurden jeweils mit Amoniumsulfat gefällte Überstände nach
Kultivierung in MM40 Medium mit 300 mM KCl. Spur 1: S.lividans NI pOV001, Spur 2: S.lividans NI
pOV004, Spur 3: S.lividans NI pOV005, Spur 4: KsuL Deletionsmutante S.lividans ∆ksuL20 und Spur 5:
S.lividans WT. 8S: Proteinstandard. Die drei Pfeile markieren jeweils die Laufhöhen der Proteine. Diese liegen
bei ungefähr 60 kDa für den Wildtyp und bei 30 kDa und 26 kDa für die beiden S.lividans NI-Stämme mit den
Konstrukten pOV004 und pOV005. Die aufgetragenen Mengen entsprechen jeweils ca. 20 ml mit 90 %
Ammoniumsulfat gefälltem Kulturüberstand. Das mit einer Laufhöhe von ca. 23 kDa zu erkennende Signal ist
unspezifisch. Die Herstellung der ksuL-Deletionsmutante wird weiter unten besprochen.
Ergebnisse
- 103 -
3.6.4. Analyse der Aldo-Keto Reduktasen KsuC und KsuB
Nach einem 1082 Bp langen intergenischen Bereich finden sich 2 offenen Leseraster mit einer
Länge von 855 Bp und 930 Bp, getrennt durch einen intergenischen Bereich von 55 Bp. Diese
erhielten die Namen ksuC und ksuB bzw. KsuC und KsuB für die hierfür determinierenden
285 und 310 Aminosäuren lange Proteine. Hinter ksuB folgt in derselben Leserichtung, in
einem Abstand von 744 Bp, ksuL. Sowohl vor ksuC, als auch ksuB, kann jeweils eine
potentielle Shine-Dalgarno Sequenz identifiziert werden (siehe Anhang A). In
Sequenzvergleichen zeigt sich, dass sowohl KsuC, als auch KsuB Mitglieder der Aldo-Keto
Reduktase Familie sind (IPR001395, Aldo/ket_red). Zu dieser werden mehr als 1900
Mitglieder gezählt (Stand 2003, InterPro, EMBL-EBI). Sie werden jeweils von verschiedenen
Servern und Datenbanken hierin eingeteilt (Abb. 3.47 a und b).
Abb. 3.47 a und b): Homologien von KsuB und KsuC zur Familie der Aldo-Keto Reduktasen. In a) sind
jeweils die homologen Bereiche von KsuB, in b) von KsuC, zur Familie der Aldo Keto Reduktase Superfamilie,
identifiziert jeweils mit unterschiedlichen Programmen verschiedener Server, dargestellt. In rot sind die
identifizierten Bereiche mit Hilfe des Prodom-Servers (Aldo/Keto_red, PD000288), in grün die kurzen
Signalabschnitte mit Hilfe der Print S Datenbank (ALDKETRDTASE, PR00069) und in gelb die Bereiche mit
Hilfe der Pfam-Datenbank (aldo_ket_red, PF00248), zu erkennen. Das 310 Aminosäuren lange KsuB in a) und
das 285 Aminosäuren lange KsuC in c) ist jeweils als schwarzer Strich in der entsprechenden Länge dargestellt.
Eine Unterfamilie der Aldo-Keto Reduktasen sind die tetrameren β-Untereinheiten der
Kaliumkanäle, die im N-terminalen Teil eine Tetramerisierungsdomäne (T1) besitzen. Diese
wird jedoch weder bei KsuC noch bei KsuB gefunden. Die Mitglieder der Aldo-Keto
Reduktase Familie sind vorwiegend monomere Proteine (Jez, J.M. and Penning, T.M.; 2001),
die überwiegend NADP weniger NAD als Cofaktor verwenden, dieser bindet an eine
Rossman-Fold Struktur. Es finden sich aber auch dimere Mitglieder der Familie, wie die
- 104 -
Ergebnisse
Ratten Leber Aflatoxin Dialdehyde Reductase (AKR7A1, Pdb: 1Gve Chain a und b). AldoKeto Reduktasen sind Oxidoreductasen. Zu diesen gehören z.B. Aldehyd Reduktasen, Aldose
Reduktasen, Prostaglandin F Synthasen, Xylose Reduktasen und Rho Crystallin. Sie besitzen
eine Länge von ca. 320 Aminosäuren und ein durchschnittliches Molekulargewicht von ca.
36 kDa (El-Kabbani, O., et al, 1998), KsuB besitzt ein theoretisches MW von 34,3 kDa, KsuC
von 30 kDa.
Mitglieder der Aldo-Keto Reduktase Familie zeichnen sich durch den Besitz eines parallelen
β-8/α-8-Fasses (TIM Barrel; Farber, G.K. and Petsko, G.A.; 1990) als Tertiärstruktur aus
(Abb. 3.48 und 3.49). Die Strukturen verschiedener Mitglieder der Familie konnten durch
Röntgen-Strukturanalysen aufgeklärt werden. Zu Mitgliedern mit bekannter Struktur dieser
Familie, zeigen sowohl KsuB als auch KsuC die höchsten Ähnlichkeiten zu einer potentiellen
Aldo-Keto Reduktase aus E.coli (YDHF, Pdb:1og6 Chain a-c und 1ur3 Chain M,
unterscheidet sich von 1og6 durch den Besitz eines N-Terminalen His-Tag, keine
Cokristallisation von NADP). 1og6 wurde als Trimer kristallisiert. Mit Hilfe eines
Sequenzvergleiches (Abb. 3.48) gelang es, sowohl für KsuB, als auch für KsuC, eine
potentielle Tertiär- und Quartärstruktur gegen YDHF (Pdb:1og6 Chain a-c) über die
komplette Proteinlänge zu errechnen (Abb.3.49 a-d). Die Kristallisation von 1og6 Chain a-c
erfolgte mit dem Cofaktor NADP (siehe Abb. 3.49 a-d). Die an der Bindung von NADPH
beteiligten Aminosäuren sind unter den Mitgliedern der Aldo-Keto Reduktase Familie
konserviert. In Sequenzvergleichen mit der Aldehyd Reductase ALR1 (Pdb: 1ae4), Aldose
Reduktase ALR2 (Pdb: 1mar) und einem durch einen Fibroblast Wachstums Faktor
induzierten Protein FR-1 (Pdb:1frb), konnten die entsprechenden Aminosäuren identifiziert
werden (Abb. 3.48).
KsuB zeigt mit 50 % ähnlichen und identischen Aminosäuren, davon 36 % identischen, eine
relativ hohe Ähnlichkeit zu YDHF; KsuC zeigt eine geringere Ähnlichkeit zu YDHF mit
33 %, davon 23 % identischen. Vergleichbar hoch ist die Ähnlichkeit von KsuB zu KsuC mit
33 %, davon 21 % identischen Aminosäuren (Abb. 3.48). KsuB unterscheidet sich von KsuC
und YDHF durch das Vorhandensein einer postulierten zusätzlichen antiparallelen β/βFaltblattstruktur (Aminosäuren 186-202 von KsuB). Diese liegt zwischen der sechsten
Faltblatt- und Helixstruktur des Tim-Barrels (Abb. 3.48 und Abb. 3.49 a und c).
Ergebnisse
- 105 -
Abb. 3.48: Sequenzvergleicht von YDHF gegen KsuB und KsuC und Sekundärstrukturen der Proteine.
Das Alignment wurde mit Hilfe des Programmes „Multalin“ (Corpet, F.; 1988) erstellt und anschließend von
Hand optimiert. Verglichen wurde YDHF (putative Aldo-Keto Reductase aus E.coli, Pdb: 1og6 Chain a) mit
KsuB und KsuC aus S.lividans. Identische Aminosäuren sind schwarz hinterlegt, homologe in grau. Unterhalb
des Sequenzvergleiches ist die bekannte Sekundärstruktur für YDHF (Pdb: 1og6 Chain a) in rot, die aus dem
Sequenzvergleich berechnete für KsuB in grün und für KsuC in blau, dargestellt. α-helicale Sekundärstrukturen
sind als h dargestellt, β-Faltblattstrukturen als s, Lückenbereiche jeweils durch einen Bindestrich -. Die an der
Bindung von NADPH beteiligten Aminosäuren sind unter den Mitgliedern der Aldo-Keto Reduktase Familie
konserviert. Oberhalb des Sequenzvergleiches sind in gelb die an der Bindung von NADPH beteiligten und
identifizierten Aminosäuren aus ALR1, ALR2 und FR-1 eingetragen. ALR1 unterscheidet sich von ALR2 und
FR-1 an Position 272 (bei YDHF, als Z für Glx dargestellt). Bei ALR1 findet sich Glutamin, bei ALR2 und FR-1
ein Glutamat an der entsprechenden Position.
- 106 -
Ergebnisse
Abb. 3.49 a-d): Putative Kristallstrukturen von KsuB und KsuC. Die Berechnung der putativen
Kristallstrukturen erfolgte jeweils gegen YDHF, eine putative Aldo-Keto Reduktase aus E.coli (PDB: 1og6).
Verwendet wurde das in Abb. 3.9 dargestellte Alignement von KsuB, KsuC und YDHF. Die Berechnung
erfolgte mit Hilfe des Swiss Model Server des SIB Biozentrums Basel im „Alignment Interface“ (Schwede, T.,
et al; 2003). Gezeigt sind jeweils die Tertiärstrukturen in der „Backbone“ Konfiguration. a) Dreidimensionale
Struktur von KsuB, in b) von KsuC, jeweils errechnet gegen 1og6 „Chain a“. c) und d) Putative Quartärstruktur
von KsuB in c) und KsuC in d). Die aus 1og6 „Chain a“ errechnete Struktur ist in gelb dargestellt, die von
„Chain b“ in grün und von „Chain c“ in blau. Strukturen, die nicht mit 1og6 homolog waren und errechnet
wurden, sind rot markiert. NADPH ist jeweils in braun dargestellt.
Ergebnisse
- 107 -
3.6.5. Analyse des abgeleiteten ORFI-Proteins
Hinter kcsA folgt in einem 86 Bp Abstand ein offenes Leseraster, mit einer Länge von
603 Bp. Es erhielt den Namen orfI und ORFI, für das hierfür determinierte Protein, mit einer
Länge von 201 Aminosäuren. Hinter orfI folgt in gleicher Leserichtung das für die
Cloramphenicol Resistenz CmlR determinierende cmlR (Dittrich, W., et al; 1991), in einem
Abstand von 238 Bp. Vor orfI ist eine potentielle Shine-Dalgarno Region gelegen (siehe
Anhang A). OrfI zeigt Homologien zu bakteriellen Deaminasen/Reduktasen, die am zweiten
und dritten Schritt der Riboflavinsynthese aus GTP beteiligt sind (Richter, G., et al.; 1997).
Beispiele für Mitglieder dieser Familie sind RibD aus E.coli und RibG aus B.subtilis, die in
einem ersten Schritt den Pyrimidinring von 2,5-Deamino-6-ribosylamino-4(3H)-pyrimidone
5’-Phosphat (Substrat II) zu 5-Amino-6-ribosylamino-2,4(1H,3H)-pyriminedione 5’-Phosphat
(Substrat III) deaminieren und anschließend in einer Reductase-Reaktion an der RibosylSeitenkette Substrat III zu 5-Amino-6-ribitylamino-2,4(1H,3H)-pyriminedione 5’-Phosphat
(Substrat V) reduzieren. Bakterielle Deaminasen/Reduktasen bestehen aus 2 Domänen, einer
N-terminalen Deaminase-Domäne (CMP_dCMP_Zn_bd, IPR002125), die eine ZincBindedomäne besitzen und einer C-terminalen Reductase-Domäne (RibDG_C, IPR002734),
die NAD(P)H als Cofaktor verwenden. OrfI besteht nur aus der C-terminalen ReductaseDomäne (Abb. 3.50 a), die N-terminale Deaminase-Domäne ist nicht vorhanden. Nur eine
RibDG_C-Domäne findet sich z.B. auch bei Hefen. Hier führt RIB7 in einem ersten Schritt
eine Reductase-Reaktion des Substrates II zu 2,5-Diamino-6-ribitylamino-4(3H)-pyrimidone
5’Phosphat (Substrat IV) durch, anschließend RIB2 die Deaminierung zu Substrat V. Des
Weiteren zeigt OrfI über fast die komplette Länge (siehe Abb. 3.50 b) Ähnlichkeiten zur
Dihydrofolat Reductase Superfamilie (DHFR, SSF53597). Dihydrofolat Reductasen
katalysieren die Reduktion des Kofaktors Dihydrofolat zu Tetrahydrofolat, das an der de novo
Synthese von Glycin, Purinen und Deoxythymidin Phosphat beteiligt ist. Die Ähnlichkeiten
zu Proteinen, mit nachgewiesener Funktion der bakteriellen Deaminasen/Reduktasen und
Dihydrofolat Reductasen, sind relativ gering.
Abb. 3.50 a und b): Homologien von OrfI zu Erkennungssequenzen einer Domäne und einer Superfamilie.
Das 201 Aminosäuren lange Protein OrfI ist jeweils als schwarzer Strich dargestellt.
- 108 -
Ergebnisse
3.7. Disruption verschiedener Gene in S.lividans
3.7.1. Auswahl der Strategien zur Disruption von Genen
Zur Etablierung der Disruption (Unterbrechung) von Genen in S.lividans sollte ein System
neu in unserer Arbeitsgruppe eingeführt werden, um eine Reihe von Genen (kcsA, ksuF, orfI,
ksuL, ksuB und ksuC), in der Nähe von kcsA gelegen, jeweils durch eine AntibiotikaResistenzkassette (bis auf einem kurzen 5’ und 3’ Bereich zu ersetzen). Die Inaktivierung der
Gene sollte über eine „Doppel-Rekombination“ erfolgen. Hierbei musste die
Antibiotikakassette, flankiert von den kurzen 5’ und 3’ Bereichen der entsprechenden Gene,
über homologe Rekombination integriert werden; die homologen Bereiche besaßen jeweils
eine Länge zwischen 700 Bp und 1 kBp.
Vier grundsätzliche Methoden, das für die Rekombination benötigte Fragment zuzuführen,
werden bei Arbeiten mit Streptomyceten-Stämmen angewendet. Dies sind die Verwendung
von nicht replikativen Plasmiden oder Fragmenten, Plasmide mit dem von Natur aus
Temperatur sensitiven Replikon von pSG5 aus Streptomyces ghanaensis (Muth, G., et al.;
1995), Derivate des Phagen-Vektors ΦC31 (Malpartida, F. and Hopwood D.A.; 1986) oder
von Vektoren mit instabilen Replikons.
In einer ersten Versuchsreihe wurde versucht, mit Hilfe von nicht replikativen Plasmiden und
Fragmenten, die Disruptionen zu erreichen. Verschiedene, jeweils die Antibiotika Resistenz
mit den flankierenden homologen Bereichen tragende Konstrukte wurden verwendet. Sie
wurden über Transformation oder Konjugation in S.lividans transferiert. Unter
Selektionsdruck sollten nur die Transformanten überleben, die das Gen für die
Antibiotikaresistenz ins Chromosom integriert hatten.
So wurde ein konjugative E.coli/Streptomyceten Vektorsystem verwendet. Die vollständigen
Kassetten wurden auch als pUC-, pBR322- und M13-Derivate in S.lividans 66 WT oder den
Plasmid-reduzierten Mutanten TK21 oder TK24 transformiert, sowohl als doppelsträngige
Derivate, als auch in einzelsträngiger Form (nach Denaturierung oder bei M13-Derivaten
nach Aufreinigung), da einzelsträngige DNA eine 10 bis 100fach höhere
Transformationseffizens in Streptomyceten bieten soll (Hillemann D., et al.; 1993). Da einige
Streptomyceten-Stämme methylierungsspezifische Restriktionsenzyme besitzen, hierzu zählt
z.B. auch Streptomyces coelicolor ATCC 10147 (Mueller) und Streptomyces avermitilis, kann
die Transformationshäufigkeit der Konstrukte durch vorherige Passage über einen
methylierungsdefizienten E.coli-Stamm deutlich erhöht werden (MacNeil, D.J.; 1988). Ein
relativ schwaches methylierungsspezifisches Restriktionssystem besitzt S.lividans TK21.
Dieser unterscheidet sich von S.lividans 66 durch das Fehlen der beiden Plasmide SLP2 und
SLP3. Die Transformationshäufigkeit kann hier nur geringfügig erhöht werden (MacNeil,
D.J.; 1988). Zur Aufreinigung von nicht methylierter Plasmid-DNA wurde der Dam- und
Dcm- Stamm E.coli JM110 verwendet.
Ergebnisse
- 109 -
Des Weiteren wurde versucht, die Resistenzkassetten mit den flankierenden homologen
Bereichen sowohl als doppelsträngiges als auch als einzelsträngiges Fragment zu
transformieren, sowohl als PCR-Fragment, als auch nach Restriktion und Aufreinigung.
Bei den verschiedenen Versuchen wurden viele potentielle Disruptionsmutanten erhalten, die
sich als resistent gegen Thiostrepton oder Kanamycin erwiesen. Von mehr als 350 wurde die
chromosomale DNA aufgereinigt und mit Hilfe von Hybridisierungen auf mögliche
Integration der Resistenzgene ins Chromosom untersucht, was jedoch in keinem Fall gelang.
Es lag jeweils eine spontan entstandene Resistenz vor. Sowohl die Methoden als auch die
gewählten Resistenzen erwiesen sich als ungeeignet.
3.7.2. Disruption der Gene in mit Hilfe des Vektors pGM160
Da alle Versuche, mit Hilfe von in Streptomyceten nicht replizierenden Plasmiden („suicide“Vektoren) und isolierten Fragmenten Disruptionen einzuführen, erfolglos blieben, wurde
versucht, diese mit Hilfe von Konstrukten, die Temperatur-sensitive Replikons besitzen, zu
generieren.
Verwendet wurde der 7,78 kBp große Streptomyces/E.coli bifunktionelle („shuttle“) Vektor
pGM160, der einen Temperatur-sensitiven Streptomyceten pSG5-Replicon und einen E.coli
pUC Plasmid-Teil besitzt. Als Selektionsgene in Streptomyceten trägt er Thiostrepton- (tsr)
und Gentamicin- (aacC1) Resistenzgene, für E.coli eine Ampicillin- (bla)-Resistenz. Um die
entsprechenden chromosomalen Gene durch ein Hygromycin- (hygR) Resistenzgen zu
ersetzen, wurde aus pGM160 das aacC1-Gen ausgeschnitten und hygR, beidseitig flankiert
von einem ca. 700 Bp großen DNA-Abschnitt aus dem jeweiligen Anfangs- und Endbereich
der zu ersetzenden Gene, eingesetzt. Nach Transformation in S.lividans und Wachstum auf
37°C sollten nur die Kolonien wachsen können, die die Hygromycin-Resistenz chromosomal
integriert hatten (siehe Abb. 3.51).
- 110 -
Ergebnisse
Abb. 3.51: . Rekombinationsschema. Die jeweils homologen Bereiche des Plasmides und des Chromosoms
sind in grau dargestellt, das Ω-hyg-Fragment ist in weiß dargestellt. Die Leserichtung des Resistenzgens ist
immer identisch mit dem des zu unterbrechenden Gens. Ebenfalls in weiß dargestellt ist das ThiostreptonResistenzgen, welches auf dem Vektorteil liegt. Die Ω-hyg-Kassette wurde so zwischen den homologen
Bereichen eingesetzt, dass nach Rekombination ins Chromosom das zu unterbrechende Gen bis auf einen kurzen
5’- und 3’-Rest vollständig ersetzt wurde. Die Integration ins Chromosom kann in einem einzigen „doublecrossing-over“-Fall eintreten oder über 2 „single-crossing-over“-Fälle. Dargestellt ist nur das „Double-crossover“ Endprodukt. Der jeweilige Phänotyp ist auf der linken Seite dargestellt.
3.7.3. Disruption von kcsA
Mit Hilfe der PCR wurden vom flußaufwärts und flussabwärts gelegenen Bereich von kcsA
ca. 700 Bp lange Fragmente synthetisiert. Nach HindIII/SnaBI-Restriktion des N-terminal
gelegenen und SnaBI/KpnI Restriktion des C-terminal gelegenen Fragmentes, wurden beide
zugleich mit einem HindIII/KpnI geschnittenen Vektor pUC18 ligiert (pTSK, Abb. 3.52). In
diesen wurde nach SnaBI-Restriktion („blunt“) die DraI („blunt“) geschnittene HygromycinResistenzkassette aus pHP45Ωhyg eingefügt. Von den beiden möglichen Endkonstrukten
wurde nur das weiterverwendet, das hygR in Flussrichtung von kcsA integriert hatte
(pUTSK1H, Abb. 3.52). Die komplette Kassette mit den N- und C-terminalen Fragmenten
und der dazwischen liegenden Resistenzkassete wurde mit HindIII/NcoI ausgeschnitten und in
den ebenso geschnittenen Vektor pGM160 eingefügt. Das Plasmid erhielt den Namen pGMK
(Abb. 3.52). Dieses wurde in S.lividans 66 WT transformiert und anschließend die
Transformanten auf potentielle Disruptionsmutanten selektiert.
Ergebnisse
- 111 -
Abb. 3.52: pTSK, pUTSK1H und pGMK. Der flußaufwärts gelegene Bereich ist in rot dargestellt (verwendete
Oligos: PrkcsAIHin und PrkcsAISna, Fragmentlänge: 745 Bp, nach Restriktion mit HindIII und SnaBI 725 Bp),
der flussabwärts gelegene Bereich in gelb (PrkcsAIISna und PrkcsAIIKpNc, Fragmentgröße 716 Bp, nach
KpnI/SnaBI- Restriktion 696 Bp), das hygR tragende Ω-hyg-Fragment in grün. Für die Amplifikationen wurde
pOV005 als Template und die Pfu-Polymerase verwendet.
Die chromosomalen DNA’s der potentiellen Mutanten wurden mit Hilfe von Hybridisierung
getestet (Abb. 3.54 a und b).
3.7.4. Disruption von ksuF
Die Disruption von ksuF wurde, wie im Abschnitt 3.7.3 für die Disruption von kcsA
beschrieben, durchgeführt. Die flussaufwärts und flussabwärts liegenden Bereich von ksuF
wurden gleichzeitig mit dem Vektor pUC18 ligiert und in E.coli transformiert. In dieses pTSF
benannte Konstrukt (Abb. 3.53) wurde das Ω-hyg-Fragment eingefügt und in E.coli
transformiert. Weiter Verwendung fand nur das der beiden möglichen Konstrukte, bei dem
das Ω-hyg-Fragment in Flussrichtung von ksuF integriert war (pUTS1H, Abb. 3.53). Das
komplette Insert wurde nach Restriktion mit dem Vektor pGM160 ligiert und erhielt den
Namen pGMF (Abb. 3.53). Nach Aufreinigung aus E.coli und Transformation in
S.lividans 66 WT erfolgte die Selektion auf mögliche Disruptionsmutanten.
- 112 -
Ergebnisse
Abb. 3.53 a-c): Konstrukte pTSF, pUTSF1H und pGMF. In rot dargestellt ist der amplifizierte flussaufwärts
gelegene Bereich von ksuF (Oligos: PrksuFIHin und PrksuFISna, Fragmentgröße: 778 Bp, nach Restriktion
758 Bp), in gelb jeweils der flussabwärts gelegene Bereich (Oligos PrksuFIISna und PrksuFKpNc,
Fragmentgröße 792 Bp, nach Restriktion 772 Bp). Das Ω-hyg-tragende Fragment ist in grün dargestellt.
Die korrekte Integration des Hygromycin-Resistenzgens in die chromosomale DNA wurde
durch Hybridisierungen untersucht (Abb. 3.54 a und b).
Abb. 3.54 a und b): Nachweis der Disruption von ksuF und kcsA. Die Tests erfolgten mit Sonden gegen das
ksuF und kcsA tragende Fragment (Membran a) und gegen das Hygromycin-Resistenzgen (Membran b). Alle
DNA’s wurden mit NcoI/PvuI geschnitten. Die Membran aus a) wurde nach Abwaschen der Sonden
(„Dehybridisierung“) für die zweite Hybridisierung in b) wieder verwendet. Aufgetragen wurden auf den ersten
4 Spuren potentielle ksuF-Mutanten (Spur 1: ∆ksuF2, Spur 2: ∆ksuF5, Spur 3: ∆ksuF6 und Spur 4: ∆ksuF7), auf
den weiteren 5 potentielle kcsA-Mutanten (Spur 5: ∆kcsA9, Spur 6: ∆kcsA10, Spur 7: ∆kcsA11, Spur 8: ∆kcsA13
und Spur 9: ∆kcsA14). Auf Spur 10 wurde S.lividans WT-DNA, auf Spur 11 Dig-markierter MolekularGewichts-Marker III, Plasmid pHP45Ωhyg auf Spur 12 und auf Spur 13 unmarkierter λ-PstI-Marker
aufgetragen.
Ergebnisse
- 113 -
Bei drei der potentiellen ksuF- (∆ksuF2, ∆ksuF6 und ∆ksuF7) und drei der kcsA-Mutanten
(∆kcsA9, ∆kcsA13 und ∆kcsA14) wurden Hybridisierungen der erwarteten Mobilität (Größe
von 4354 Bp für die ksuF- und 5187 Bp für die kcsA-Mutanten) gefunden, mit einer deutlich
geringeren, gegenüber der Hybridisierung für den Wildtyp (Größe von 3357 Bp, Abb. 3.54,
Membran a, Spur 10). Diese wurden weiterverwendet.
3.7.5. Disruption von ksuL
Auch die Disruption von ksuL wurde, wie für die Disruption von kcsA (Abschnitt 3.7.3)
beschrieben, durchgeführt. Das pUC18-Derivat, in das die flussabwärts und flussaufwärts
gelegenen Bereiche von ksuL integriert wurde, erhielt den Namen pTSL (Abb. 3.55). Das
nachfolgende Derivat, mit der in Flussrichtung integrierten Ω-hyg-Kassette, erhielt den
Namen pUTSL1H (Abb. 3.55) und das pGM160 Konstrukt, in welches anschließend das
vollständige Insert eingefügt wurde, den Namen pGML (Abb. 3.55). Die Selektion auf
potentielle Disruptionsmutanten erfolgte nach Transformation von pGML in S.lividans WT,
die Kontrolle der korrekten Integration durch Hybridisierung (Abb. 3.56 a und b).
Abb. 3.55: Konstrukte pTSL, pUTSL1H und pGML Der flußaufwärts gelegene amplifizierte Bereich von
ksuL (verwendete Oligos: PrksuLIHin und PrksuLISna, Fragmentgröße 762 Bp nach HindIII/SnaBI-Restriktion
746 Bp) ist in rot dargestellt, in gelb, der flussabwärts gelegene Bereich (Oligos PrksuLIISna und
PrksuLIIKpNc, 739 Bp, 723 Bp nach SnaBI/KpnI-Restriktion) und in grün das Ω-hyg-Fragment.
Die Hybridisierungen gegen die gespaltenen DNAs der 5 ∆ksuL-Mutanten erschienen in
Mobilität der erwarteten Größe von 4145 Bp (Abb. 3.56 a, Spur 1-5), mit einer deutlich
geringeren Mobilität als die WT-DNA mit einer erwarteten Größe von 3315 Bp (Spur 6). Die
Hybridisierung von ∆ksuL23 scheint bei einer geringfügig geringeren Größe zu laufen als die
vier anderen Mutanten. Diese wurde nicht weiterverwendet.
- 114 -
Ergebnisse
Abb. 3.56 a und b): Nachweis der Disruption von ksuL. Getestet wurde mit Sonden gegen a): das ksuL
tragende DNA-Fragment und b): das Hygromycin-Resistenzgen.
Die DNA’s wurden mit BglII/SgfI geschnitten. Die in a) verwendete Membran wurde „dehybridisiert“ und für
die Hybridisierung gegen das Hygromycinresistenzgen in b) verwendet. Aufgetragen wurden 5 verschiedene
potentielle ∆ksuL-Mutanten: Spur 1: ∆ksuL17, 2: ∆ksuL20, 3: ∆ksuL21, 4: ∆ksuL23 und 5: ∆ksuL24, S.lividans
WT-DNA (Spur: 6), Dig-markierter Molekular-Gewichts-Marker III (Spur 7) und Plasmid pHP45Ωhyg (Spur 8).
Auf Spur 9 ist unmarkierter λ-PstI Marker aufgetragen.
3.7.6. Disruption von orfI
Die Disruption von orfI erfolgte wie für kcsA (siehe Abschnitt 3.7.3) beschrieben; das
pUC18-Konstrukt, das die beiden flußaufwärts und flussabwärts gelegenen Bereich von orfI
trägt, erhielt den Namen pTSO (Abb. 3.57). In dieses wurde anschließend die Ω-hyg-Kassette
eingefügt. Aus dem Konstrukt, das das Resistenzgen in Leserichtung integriert hatte
(pUTSO1H, Abb. 3.57), wurde das komplette Insert ausgeschnitten, in pGM160 eingefügt
und in E.coli transformiert.
Ergebnisse
- 115 -
Abb. 3.57: Konstrukte pTSO, pUTSO1H und pGMO Der amplifizierte flussaufwärts liegende Bereich ist in
rot dargestellt (Oligos: ProrfIHin und ProrfIISna, Fragment-Größe 748 Bp, nach HindIII/SnaBI-Restriktion
731 Bp), der flussabwärts liegende amplifizierte Bereich in gelb (Oligos: ProrfIISna und ProrfIIKpNc; Größe des
Fragmentes 609 Bp, nach Restriktion 593 Bp) und der des Ω-hyg-Fragmentes in grün.
Dieses pGMO benannte Konstrukt (Abb. 3.57) wurde in S.lividans WT transformiert und
nachfolgend auf Mutanten selektiert. Der Nachweis der Integration erfolgte durch
Hybridisierungen gegen die chromosomalen DNA’s (Abb. 3.58 a-c).
Abb. 3.58 a-c): Hybridisierungen, Nachweis der Disruption von orfI. Getestet wurde mit Sonden gegen das
Hygromycin-Resistenzgen in a), das orfI tragende DNA-Fragment in b) und gegen das ThiostreptonResistenzgen in c).
Die DNA’s wurden jeweils mit BamHI/BglII restringiert. Es wurde immer dieselbe Membran verwendet, die
jeweils „dehybridisiert“ und neu hybridiesiert wurde. Aufgetragen wurden 6 verschiedene potentielle ∆orfIMutanten: Spur 1: ∆orfI33, 2: ∆orfI34, 3: ∆orfI35, 4: ∆orfI36, 5: ∆orfI37 und 6: ∆orfI39. Des Weiteren wurde
S.lividans WT-DNA (Spur: 7), Plasmid pOV005 (Spur 8), Plasmid pGMO (Spur 9), ein unmarkierter λPstIMarker (Spur 10) und Dig-markierter Molekular-Gewichts-Marker III aufgetragen (Spur 11).
- 116 -
Ergebnisse
Bei den Disruptionsmutanten ∆orfI35, ∆orfI36, ∆orfI37 und ∆orfI39 (Abb. 3.58 a und b,
Spuren 3-6) finden sich die Hybridisierungen in Höhe der erwarteten Mobilität (Größe von
6981 Bp). Die Hybridisierung gegen WT-DNA zeigt die erwartet größere Mobilität (Größe
von 4995 Bp, Abb. 3.58 b, Spur 7). Die beiden potentiellen Mutanten ∆orfI33 und ∆orfI34
sind nicht korrekt. Bei ∆orfI34 ist es zu keiner Rekombination des Plasmids pGMO mit dem
Chromosom gekommen, es findet sich sowohl eine Hybridisierung in Mobilität des Plasmides
(Abb. 3.58 a und c, Spur 2) als auch auf der Mobilität der chromosomalen WT-DNA (Abb.
3.58 b, Spur 2). Weiter verwendet wurden die 4 korrekten Mutanten.
3.7.7. Disruption von ksuB
Das ksuB Gen wurde wie für kcsA beschrieben, unterbrochen (Abschnitt 3.7.3). Die
amplifizierten flussaufwärts und flussabwärts gelegenen Fragmente wurden nach Restriktion
mit pUC18 ligiert und in E.coli transformiert. In dieses pTSB benannte Konstrukt wurde die
Ω-hyg-Kassette eingefügt und in E.coli transformiert (Abb. 3.59). Aus dem, das Hygromycin
Resistenz-Gen in Flussrichtung tragende Konstrukt pUTSB1H (Abb.3.59), wurde das Insert
ausgeschnitten und mit pGM160 ligiert. Nach Transformation und Aufreinigung aus E.coli
erfolgte die Transformation des Konstruktes pGMB (Abb. 3.59) in S.lividans WT,
nachfolgend die Selektion auf mögliche Disruptanten.
Abb. 3.59: Konstrukte pTSB, pUTSB1H und pGMB In rot dargestellt ist der flußaufwärts gelegene
amplifizierte Bereich von ksuB (verwendete Oligos: PrksuBIHin und PrksuBISna, Fragmentgröße 755 Bp nach
HindIII/SnaBI-Restriktion), in gelb der flussabwärts gelegene (Oligos PrksuBIISna und PrksuBIIKpNc, 742 BP
nach SnaBI/KpnI-Restriktion) und in grün das Ω-hyg-Fragment.
Der Nachweis der korrekten Integration ins Chromosom erfolgte durch Hybridisierungen
(Abb. 3.60 a-c).
Ergebnisse
- 117 -
Abb. 3.60 a-c): Hybridisierungen, Nachweis der Disruption von ksuB. Getestet wurde mit Sonden gegen das
Hygromycin-Resistenzgen a), das ksuB tragende DNA-Fragment b) und gegen das Thiostrepton-Resistenzgen c).
Die DNA’s wurden jeweils mit BglII/KpnI restringiert. Jeweils dieselbe Membran wurde verwendet, die
„dehybridisiert“ und neu hybridisiert wurde. Es wurden 12 verschiedene potentielle ∆ksuB-Mutanten getestet:
Spur 1: ∆ksuB21, Spur 2: ∆ksuB22, Spur 3: ∆ksuB23, Spur 4 ∆ksuB24, Spur 5: ∆ksuB25, Spur 6: ∆ksuB26, Spur
7: ∆ksuB27, Spur 8: ∆ksuB28, Spur 9: ∆ksuB29, Spur 10: ∆ksuB30, Spur 11: ∆ksuB31 und ∆ksuB32 auf Spur 12.
Zur Kontrolle wurden auf Spur 13 S.lividans WT-DNA, Plasmid pGMB auf Spur 14, ksuL-Disruptionsmutante
∆ksuL21 auf Spur 15 und auf Spur 16 Dig-markierter Molekular-Gewichts-Marker III aufgetragen.
Bei neun der zwölf potentiellen Disruptionsmutanten finden sich Hybridisierungen in
Mobilität der erwarteten Größe von 6383 Bp, bei einer deutlich geringeren Mobilität als die
Hybridisierung für den Wildtyp bei einer erwarteten Größe von 5393 Bp zeigt (Abb. 3.60 b,
Spur 13) und geringfügig geringer als die Hybridisierung der ksuL-Disruptionsmutante
(6222 Bp, Abb. 3.60 a und b, Spur 15). Drei Mutanten sind nicht korrekt, ∆ksuB23 (Spur 3),
∆ksuB27 (Spur 7) und ∆ksuB30 (Spur 10). Bei ∆ksuB30 wurde die Hygromycin-Kassette
vermutlich korrekt ins Chromosom integriert, jedoch eine weitere Hybridisierung in Mobilität
des Plasmides lässt auf eine heterogene Population schließen (Abb. 3.60 a und c, Spur 10).
Diese drei Mutanten wurden nicht weiterverwendet.
- 118 -
Ergebnisse
3.7.8. Disruption von ksuC
Die Disruption von ksuC erfolgte, wie in Abschnitt 3.7.3 für kcsA beschrieben. Das pUC18Derivat, in das die flussabwärts und flussaufwärts gelegenen Bereiche von ksuB integriert
wurden, erhielt den Namen pTSC, das nachfolgende Derivat mit der in Flussrichtung
integrierten Ω-hyg-Kassette den Namen pUTSC1H, das pGM160 Konstrukt, in das das
vollständige Insert eingefügt wurde, den Namen pGMC (Abb. 3.61). Nach Transformation
von pGMC in S.lividans WT erfolgte die Selektion auf potentielle Disruptionsmutanten.
Zwanzig potentielle Mutanten wurden anschließend mit Hilfe von Hybridisierungen getestet
(Abb. 3.62 a-f).
Abb. 3.61 a-c): Konstrukte pTSC, pUTSC1H und pGMC Der amplifizierte flussaufwärts liegende Bereich ist
in rot dargestellt (Oligos: PrksucIHin und PrksuCISna, Fragment Größe 748 Bp, nach HindIII/SnaBI-Restriktion
731 Bp), der flussabwärts liegende amplifizierte Bereich in gelb (Oligos: PrksuCIISna und PrksuCIIKpNc,
Größe des Fragmentes 609 Bp, nach SnaBI/KpnI-Restriktion 593 Bp) und der des Ω-hyg-Fragmentes in grün.
Zwölf der zwanzig potentiellen Mutanten scheinen das Hygromycin-Resistenzgen korrekt
integriert zu haben (∆ksuC1, ∆ksuC3, ∆ksuC4, ∆ksuC5, ∆ksuC6, ∆ksuC7, ∆ksuC8, ∆ksuC11,
∆ksuC12, ∆ksuC15, ∆ksuC19 und ∆ksuC20, Abb. 3.62 a bis f) Hier finden sich
Hybridisierungen im Mobilitätsbereich der erwarteten 8746 Bp Größe, bei einer deutlich
geringeren Mobilität als bei der Hybridisierung gegen die Wildtyp-DNA (5393 Bp, Abb. 3.62
b und e, Spur 11).
Ergebnisse
- 119 -
Abb. 3.62 a-f): Nachweis der Disruption von ksuC: Getestet wurde mit Sonden gegen das HygromycinResistenzgen (Membranen a und d), gegen das ksuC tragende Fragment (Membranen b und e) und gegen das
Thiostrepton Resistenzgen (Membranen c und f). Insgesamt 20 verschiedene potentielle Mutanten wurden
gestestet. Alle chromosomalen DNA’s wurden mit BglII/KpnI restringiert. Für die Hybridisierungen in a-c) und
in d-f) wurde jeweils eine Membran verwendet, die „dehybridisiert“ und neu hybridisiert wurde. Aufgetragen
wurde auf den Membranen a-c): 10 potentielle ksuC-Mutanten, Spur 1: ∆ksuC1, Spur 2: ∆ksuC2, Spur 3:
∆ksuC3, Spur 4: ∆ksuC4, Spur 5: ∆ksuC5, Spur 6: ∆ksuC6, Spur 7: ∆ksuC7, Spur 8: ∆ksuC8, Spur 9: ∆ksuC9
und Spur 10: ∆ksuC10. Auf Spur 11 wurde S.lividans WT-DNA aufgetragen, auf 12 die ksuLDisruptionsmutante ∆ksuL21, auf 13 das Plasmid pGMB und auf 14 Dig-markierter Molekular-Gewichts-Marker
III. Auch auf den Membranen d-f) wurden auf den 10 ersten Spuren potentielle ksuC-Disruptionsmutanten
aufgetragen: Spur 1: ∆ksuC11, Spur 2: ∆ksuC12, Spur 3: ∆ksuC13, Spur 4: ∆ksuC14, Spur 5: ∆ksuC15, Spur 6:
∆ksuC16, Spur 7: ∆ksuC17, Spur 8: ∆ksuC18, Spur 9: ∆ksuC19 und Spur 10: ∆ksuC20. Auf Spur 11 wurde
S.lividans WT-DNA, auf Spur 12 Plasmid pGMC, auf 13 die ksuL-Disruptionsmutante ∆ksuL21 und auf 14 Digmarkierter Molekular-Gewichts-Marker III aufgetragen.
Versuche, die Mutanten und den S.lividans WT, mit Hilfe entsprechender Konstrukte
(pOV004, pOV005, pOV006 und pOV010) zu komplementieren, waren nicht erfolgreich. Die
inserierten Fragmente rekombinierten jeweils mit den homologen Bereichen des Chromosoms
(nicht dargestellt). Nach mehrmaligem Ausstreichen konnten jeweils nur Konstrukte der
Größe des „Leervektors“ pOV001 nachgewiesen werden. Ein Transformationsversuch mit
dem Konstrukt pOV008 zur Komplementierung der ∆ksuL Mutante ist anscheinend vor
kurzem gelungen (pers. Mitteilung H.Schrempf); pOV008 trägt nach pOV002 das zweitkürzeste Fragment (3,2 kBp) aller pOV Konstrukte.
- 120 -
Ergebnisse
3.8. Charakteristika der Mutanten
3.8.1. Wachstumseigenschaften
Auf Sporulationsmedium (RSM-Agarose Platten) zeigen die Disruptionsmutanten keinen
Unterschied im Wachstum und der Differenzierung zum Wildtyp (nicht dargestellt).
Auxotrophien konnten nicht gefunden werden (nicht dargestellt). Hierzu wurden jeweils die
Deletionsmutanten von ksuB, ksuC, ksuL, ksuF, kcsA und orfI auf Minimalmedium (MM40)
ausgestrichen und im Wachstum mit dem Wildtyp (S.lividans 66) verglichen.
3.8.2. Immunologischer Nachweis der relevanten Proteine
Zum Test, ob die Deletion einzelner Gene Auswirkungen auf die Protein-Synthese,
determiniert von benachbarten Genen, zeigt (KsuB, KsuC, KsuF und KcsA), wurden die
Disruptionsstämme, S.lividans 66 WT und der auf dem Konstrukt pOV005 ein 13 kBp
Fragment mit den zu untersuchenden Genen tragende Stamm S.lividans NI, in
Minimalmedium und in Minimalmedium mit 400 mM KCl angezogen. Die Produktion der
Proteine wurde mit Hilfe von Antikörpern, nach Transfer auf Membranen, nachgewiesen.
KsuB kann in allen Stämmen, außer in den Deletionsstämmen S.lividans ∆ksuB und ∆ksuC
(Abb. 3.63 a, Spuren 1-4) nachgewiesen werden. Das durch einen grünen Pfeil markierte
Doppel-Signal mit einer Migration bei ca. 50 kDa ist unspezifisch und kann auch bei
S.lividans ∆ksuB identifiziert werden. Es ist jedoch zu schwach um hier erkennbar zu sein
(Abb. 3.63 a, Spur 1 und 2). Die Synthese von KsuC erfolgt in allen Stämmen außer der ksuC
Deletionsmutante (siehe Abb. 3.63 c und d). Die Deletion von ksuC zeigt einen polaren Effekt
auf die Produktion von KsuB. Dieses erklärt sich dadurch, dass eine Co-Transkription beider
Gene abgeleitet werden kann. Die Synthese von KsuF kann außer beim Stamm S.lividans NI,
der das Konstrukt pOV005 trägt, nicht nachgewiesen werden (siehe Abb. 3.63 e und f). KcsA
konnte weder in den Membranfraktionen der Disruptionsstämme noch bei S.lividans NI
pOV005 nachgewiesen werden (nicht dargestellt).
Ergebnisse
- 121 -
Abb. 3.63 a-f): Nachweis von polaren Effekten der Disruptionsmutanten. Getestet wurden jeweils die
Cytoplasma-Fraktionen von sechs verschiedenen Disruptionsmutanten, von S.lividans WT und von S.lividans NI
pOV005, jeweils nach Anzucht in MM40 Medium ohne zusätzlich Salz (ungrade Nummern) und MM40
Medium mit 400 mM KCl (grade Nummern). Getestet wurde jeweils mit Antikörpern gegen KsuB (a und b),
KsuC (c und d) und gegen KsuF (e und f). Aufgetragen wurden jeweils die Cytoplasma-Fraktionen auf den
Membranen a), c) und e) von: Spuren 1 und 2: S.lividans ∆ksuB, Spuren 3 und 4: S.lividans ∆ksuC, Spuren 5 und
6: S.lividans ∆ksuF, Spuren 7 und 8: S.lividans WT. Auf den Membranen b), d) und f) wurden jeweils die
Cytoplasmafraktionen von: Spuren 1 und 2: S.lividans ∆kcsA, Spuren 3 und 4: S.lividans ∆ksuL, Spuren 5 und 6:
S.lividans ∆orfI und Spuren 7 und 8: S.lividans NI pOV005 aufgetragen. 8S ist ein Proteinstandard. Die
Laufhöhe von KsuB, KsuC und KsuF ist jeweils auf der rechten Seite durch einen schwarzen Pfeil markiert.
- 122 -
Ergebnisse
Der Test der KsuL Produktion erfolgte nach Ammoniumsulfatfällung der Zellkultur nach
Wachstum in Minimalmedium mit 300 mM KCl (siehe Abb. 3.64). Die Synthese von KsuL
kann in allen Disruptionsmutanten und dem Wildtyp nachgewiesen werden, außer der ksuL
Deletionsmutante (Abb. 3.64 Spur 3). Die KsuL-Produktion ist in den ∆ksuC und ∆ksuB
Deletionsmutante (Abb. 3.64 Spuren 1 und 2) gegenüber der ∆ksuF, ∆kcsA und ∆orfI
Deletionsmutante und dem Wildtyp (Spuren 4-7), reduziert. ksuL liegt, durch einen 776 Bp
langen intergenischen Bereich getrennt, hinter ksuB und ksuC in gleicher Leserichtung,
vermutlich auf einem gemeinsamen Operon. Vor ksuL findet sich ein weiterer
Transkriptionsstart.
Abb. 3.64: Nachweis polarer Effekte auf die Synthese von KsuL. Aufgetragen wurden die mit
Ammoniumsulfat gefällten Kulturüberstände der 6 Deletionsmutanten, vom Wildtyp und von S.lividans NI
pOV005, nach Wachstum in M40 Medium mit 300 mM KCl. Nach Transfer auf eine Membran erfolgte der
Nachweis mit Hilfe von Antikörpern gegen KsuL. Spur 1: ksuB-, Spur 2: ksuC-, Spur 3: ksuL-, Spur 4: ksuF-,
Spur 5: kcsA- und Spur 6: orfI-Deletionsmutante. Auf Spur 7 wurde S.lividans WT aufgetragen und auf Spur 8:
S.lividans NI pOV005. 8S: Proteinstandard. Der Kontrast des Proteinstandards wurde zur besseren
Erkennbarkeit erhöht. Die auf Spur 8 aufgetragene Probe ist dieselbe Probe, die auch für Abb. 3.46, Spur 3
verwendet wurde. Auf den Spuren 1, 2, 4-7 ist jeweils nur das mit einem Pfeil markierte 32,1 kDa große Nterminale Fragment zu identifizieren, das C-terminale Fragment ist vermutlich abgebaut (ich bitte die schlechte
Bildqualität zu entschuldigen).
Polare Auswirkungen der Disruptionsmutanten (im Vergleich zum Wildtyp) auf die Synthese
der durch cmlR determinierten Cloramphenicol-Resistenz wurde durch Wachstum bei drei
verschiedenen Chloramphenicol-Konzentrationen (ohne, 5 und 10 µg/ml) durch Bestimmung
des Nassgewichtes untersucht. Es konnten jeweils keine Unterschiede im Wachstum
festgestellt werden (nicht dargestellt).
Ergebnisse
- 123 -
3.8.3. Analyse der Pigment-Produktion
Undecylprodigiosin ist ein Mycel assoziiertes rotfarbiges Antibiotikum (siehe Einleitung), das
von S.lividans WT unter bestimmten Bedingungen produziert wird. Getestet wurden die 6
Disruptionsmutanten S.lividans ∆kcsA, ∆ksuB, ∆ksuC, ∆orfI, ∆ksuL und ∆ksuF im Vergleich
zu S.lividans WT bei Wachstum auf einer Minimalmedium-Agaroseplatte (siehe Abb. 3.65).
Die Disruptionsmutanten S.lividans ∆ksuB und ∆ksuC zeigen im Vergleich zu den restlichen
Mutanten und dem Wildtyp eine verstärkte Produktion an Undecylprodigiosin, erkennbar an
der Rotfärbung. Undecylprodigiosin-Produktion findet sich bei allen anderen Stämmen,
anders als bei den beiden überproduzierenden Mutanten, vor allem im Randbereich der
Austriche, zu einem späteren Zeitpunkt auch auf der gesamten Ausstrichsfläche, jedoch mit
einer deutlich geringeren Konzentration. Auch bei Wachstum in MM40 Flüssig-Medium ist
eine verstärkte RED-Produktion der ∆ksuB und ∆ksuC Mutanten im Vergleich zum Wildtyp
und den weiteren Mutanten zu beobachten. Die Synthese der ∆ksuB Mutante ist deutlich
höher als die der ∆ksuC Mutante (nicht dargestellt).
Abb. 3.65: Undecylprodigiosin-Produktion der Disruptionsstämme und S.lividans 66. Die Stämme wurden
auf einer Minimalmedium-Platte (MM40) ausgestrichen und nach ca. 4,5 Tagen fotografisch protokolliert. Zur
Verdeutlichung der Unterschiede ist der Kontrast erhöht worden. 1: S.lividans Wildttyp, 2: S.lividans ∆kcsA, 3:
S.lividans ∆ksuB, 4: S.lividans ∆ksuC, 5: S.lividans ∆orfI, 6: S.lividans ∆ksuL und 7: S.lividans ∆ksuF.
Abgebildet ist die Rückseite der Platte.
Streptomyceten produzieren, „A-factor“ genannte, extrazelluläre γ-Butyrollactone als
Signalstoffe, die, wie zuerst für S.griseus nachgewiesen (Khokhlov, A.S., et al.; 1967, Mori,
K.; 1983), Einfluss auf die Antibiotika-Produktion und teilweise auf die Differenzierung der
Zellen besitzen. S.coelicolor A3(2) produziert mehrere γ-Butyrolactone wovon SCB1 genauer
- 124 -
Ergebnisse
charakterisiert ist (Kawabuchi, M., et al.; 1997), SCB1 hat eine negative regulatorische
Funktion auf die Antibiotika-Produktion. Zum Test, ob SCB1, weitere diffundierende
Signalmoleküle oder ausgeschiedenen Zwischenprodukte einen Einfluss auf die verstärkte
Undecylprodigiosin-Produktion der ∆ksuC und ∆ksuB Mutanten besitzen, wurden diese
zusammen mit dem S.lividans Wildtyp ausgestrichen (siehe Abb. 3.66). Es konnte kein
Einfluss nachgewiesen werden.
Abb. 3.66: Einfluss möglicher Signalmoleküle auf die Undecylprodigiosin Produktion. Ausgestrichen auf
MM40 Minimalmedium wurden die beiden S.lividans ∆ksuC- (oben links) und ∆ksuB-Mutanten (unten links)
und auf der rechten Seite zweimal der Wildtyp S.lividans 66. Dargestellt ist die Rückseite der Platte.
Die beiden Gene ksuC und ksuB werden vermutlich von einer polycistronischen mRNA
transkribiert, ksuC ist hierbei vor ksuB lokalisiert. Die Disruption von ksuC verhindert auch
die Produktion von KsuB (siehe Abb. 3.63 a, Spuren 3 und 4), während die Disruption von
ksuB keinen Effekt auf die Synthese von KsuC zeigt (siehe Abb. 3.63 c, Spuren 1 und 2). Die
Disruption der Gene erfolgte jeweils durch die Insertion von hygR einschließlich eines
Terminators in derselben Leserichtung wie ksuC und ksuB. Die Transkription von hygR ist
durch die Gabe von Hygromycin induzierbar. Um zu identifizieren, ob nur das Fehlen von
KsuB oder KsuC/KsuB zusammen für die erhöhte Undecylprodigiosin-Produktion
verantwortlich ist, wurden die beiden Disruptionsmutanten, zusammen mit den ∆orfI und
∆ksuF Disruptionsmutanten, die keinen Unterschied zum Wildtyp zeigen, auf
Minimalmedium mit Hygromycin ausgestrichen, in der Hoffnung, dass hinter hygR liegende
Terminator der ∆ksuC Mutante teilweise überlesen und die Produktion von KsuB
ermöglichen würde (siehe Abb. 3.67). Die ∆ksuC Mutante zeigt eine, gegenüber der ∆orfI und
∆ksuF Mutante, leicht erhöhte Undecylprodigiosin (RED)-Produktion. Die RED-Produktion
der ∆ksuB-Mutante ist gegenüber der Produktion der ∆ksuC Mutante jedoch deutlich erhöht,
Ergebnisse
- 125 -
auch ist die RED-Produktion deutlich früher nachweisbar (ca. 4-6 h). Dies deutet auf das
erhoffte teilweise „durchlesen“ des Terminators der ∆ksuC Mutante hin. Somit kann
angenommen werden, dass der beobachtete Phänotyp der Mutanten nur durch die nichtProduktion von KsuB verursacht wird und unabhängig von KsuC ist.
Abb. 3.67: Undecylprodigiosin-Produktion der ∆ksuC und ∆ksuB Mutanten auf Minimalmedium mit
Hygromycin. Ausgestrichen wurden die ∆ksuB (oben links), ∆ksuC (unten links), ∆orfI (oben rechts) und ∆ksuF
(unten rechts) Mutanten auf Minimalmedium (MM40) mit 10 mg/l Hygromycin. Abgebildet ist der Zustand nach
ca. 44 h Wachstum bei 30°C, dargestellt ist die Rückseite Platte.
Verschiedene Supplemente beeinflussen die Undecylprodigiosinproduktion. So ist bekannt,
dass Prolin, das ein Grundbaustein der Synthese ist, die Phosphat-Konzentration und hohe
NaCl-Konzentrationen Auswirkungen auf die Synthese zeigen. Des Weiteren wurden die für
die Synthese, neben dem Grundbaustein Prolin, benötigten Substrate Serin und Glycin und die
Auswirkung hoher KCl- und Sucrose-Konzentrationen getestet, ebenso das Wachstum auf
Mannitol und Casaaminosäuren. Die Ergebnisse sind in Abb. 3.68 a bis l dargestellt und in
der Tabelle 3.1 zusammengefasst.
Die Produktion von Undecylprodigiosin (RED) ist abhängig von der Wachstumsphase. Unter
Bedingungen, unter denen keine Ausbildung von Luftmycel erfolgt (z.B. Minimalmedium mit
20 % Sucrose oder mit 0,1 g/l KH2PO4, nicht bildlich dargestellt und Minimalmedium mit
Casaaminosäuren und Casaaminosäuren + Mannitol, siehe Abb. 3.68 i und j), ist keine
Antibiotikaproduktion erkennbar.
Die Ausbildung des Luftmycels begann jeweils nach ca. 40 h. Bei Zugabe von 300 mM NaCl
oder 10 % Sucrose ist die Antibiotikaproduktion anscheinend schon während der transienten
- 126 -
Ergebnisse
Phase, zwischen der vegetativen und der Vermehrungsphase, nachweisbar (Abb. 3.68 e und
g). Ansonsten ist sie frühestens mit Beginn der Luftmycelbildung erkennbar. Bei Wachstum
auf Minimalmedium mit 10 g/l KH2PO4 statt 1 g/l erscheint nach ca. 48-51 h das deutlich
erkennbare, diffundierende, violette Antibiotika Actinorhodin (Abb. 3.68 l). Die Actinorhodin
Produktion ist zu einem späteren Zeitpunkt (nach ca. 6 Tagen) auch bei Wachstum auf
Minimalmedium, Minimalmedium mit nur 0,2 g/l KH2PO4 und auf Minimalmedium mit
Mannitol oder Prolin nachweisbar. Es ist jeweils kein Unterschied der Actinorhodin
Produktion der Mutanten zum Wildtyp feststellbar.
Abb. 3.68 a-l): Undecylprodigiosinproduktion der ∆ksuB und ∆ksuC Mutanten im Vergleich zum
Wildtyp. Getestet wurde jeweils die ∆ksuB- (jeweils links oben) und die ∆ksuC-Mutante (jeweils links unten),
des Weiteren zweimal S.lividans 66 Wildtyp (jeweils rechte Seite). Gezeigt ist der Zustand nach ca. 65 h
Wachstum bei 30°C. Ausgestrichen wurde jeweils auf MM40 Minimalmedium in a), mit zusätzlich 1 g/l Prolin
(8,69 mM) in b), mit zusätzlich 1 g/l Glycin (13,3 mM) in c), zusätzlich 1 g/l Serin (9,5 mM) in d), mit
zusätzlich 300 mM NaCl in e), mit zusätzlich 300 mM KCl in f), zusätzlich 10 % Sucrose (300 mM) in g), mit
10 g/l Mannitol in h), mit zusätzlich 2 g/l Casaaminosäuren in i), mit 2 g/l Casaaminosäuren und 10 g/l Mannitol
in j), mit nur 0,2 g/l KH2PO4 (1,47 mM) statt 1 g/l (7,3 mM), wie in MM40 Medium, in k) und mit 10 g/l
KH2PO4 (73,5 mM) in l). Die deutlich erkennbare starke Violettfärbung in l) wird durch Actinorhodin
hervorgerufen.
Ergebnisse
- 127 -
Medium
Stamm
Beginn
REDProduktion
RED-Produktion
nach 52 h
Erscheinungsbild nach
72 h/RED Produkt
Act Produktion nach 6
Tagen
MM40
WT
Nach ca. 48-50 h
+
∆ksuB/ksuC
Nach ca. 41-42 h
++
WT
Nach ca. 48-50 h
+
∆ksuB/ksuC
Nach ca. 41-43 h
++
+1 g/l Glycin
WT
Keine Produktion
+1 g/l Serin
∆ksuB/ksuC
WT
Nicht genau
bestimmbar
Nach ca. 48-50 h
Nach ca.48-50 h
+
+ Actinorhodinbildung (Act, wie
Mutanten)
++
+ Act (wie WT)
+
+ Act (wie Mutanten)
++
+ Act (wie WT)
+
geringer als Mutanten
+
+
WT
∆ksuB/ksuC
WT
∆ksuB/ksuC
WT
Nach ca. 46-48 h
Nach ca. 38 h
Nach ca. 38 h
Nicht genau
bestimmbar
Nicht genau
bestimmbar
Nach ca. 36 h
Nach ca. 36 h
Keine Produktion
Keine Produktion
Nach ca. 41 h
+
+++
+++
Randbereich?
+/Randbereich?
+/++++
++++
Kein Luftmycel
Kein Luftmycel
++
∆ksuB/ksuC
Nach ca. 41 h
+++
WT
∆ksuB/ksuC
WT
Keine Produktion
Keine Produktion
Keine Produktion
Kein Luftmycel
Kein Luftmycel
Kein Luftmycel
∆ksuB/ksuC
WT
Keine Produktion
Keine Produktion
Kein Luftmycel
Kein Luftmycel
∆ksuB/ksuC
KeineProduktion
Kein Luftmycel
WT
Nach ca. 42-43 h
++
∆ksuB/ksuC
Nach ca. 39 h
+++
WT
Nach ca. 44 h
+
∆ksuB/ksuC
Nach ca. 40 h
+
+1 g/l Prolin
300 mM NaCl
300 mM KCl
∆ksuB/ksuC
WT
∆ksuB/ksuC
WT
∆ksuB/ksuC
10 % Sucrose
20 % Sucrose
10 g/l
Mannitol
2 g/l Casa.
2 g/l Casa
+Mannitol
0,1 g/l KH2PO4
0,2 g/l KH2PO4
10 g/l KH2PO4
+/+
+
++++ (wie Mutanten)
++++ (wie WT)
sehr gering
sehr gering
gering stärker als WT
+++ (wie Mutanten)
+++ (wie WT)
Keine Luftmycelbildung (n.a.)
Keine Luftmycelbildung (n.a.)
++
+ Act (wie Mutanten)
+++
+ Act (wie WT)
Keine Luftmycelbildung
Keine Luftmycelbildung
Keine Luftmycelbildung
Keine Luftmycelbildung
Zu wenig Phosphat
Wachstum eingestellt (n.a.)
Zu wenig Phosphat
Wachstum eingestellt (n.a.)
+++ (wie Mutanten)
++ Act (wie Mutante)
+++ (wie WT)
++ Act (wie WT)
++++ (wie Mutanten)
+++ Act (wie Mutante)
++++ (wie WT)
+++ Act (wie WT)
Tabelle 3.1: Antibiotikaproduktion unter verschiedenen Mediumbedingungen. Die Anzucht erfolgte jeweils
auf MM40 Minimalmedium mit unterschiedlichen Supplementen. Das verwendete Medium ist jeweils in der
ersten Spalte dargestellt, in der zweiten der jeweils verwendete Stamm. WT steht für den S.lividans 66
Wildtypstamm, die beiden S.lividans ∆ksuB und ∆ksuC Deletionsmutanten sind gemeinsam dargestellt, da beide
Mutanten jeweils einen identischen Phänotyp zeigen. In der dritten Spalte ist der Zeitpunkt des Beginns der
Undecylprodigiosin (RED) Produktion aufgeführt. In den Spalten 4 und 5 ist jeweils die Stärke der
Undecylprodigiosin-Produktion dargestellt, +/- steht für eine kaum identifizierbare Antibiotika Produktion, + für
eine schwache, ++ für eine stärkere, +++ für eine starke und ++++ für eine sehr starke Produktion, zum
jeweiligen Zeitpunkt, wobei die Antibiotikaproduktion der Deletionsmutanten bei Wachstum auf
Minimalmedium ohne Supplemente bei RED mit zwei ++ und bei Act mit + als Standard verwendet wurde.
(n.a.) steht für: nicht in Abb. 3.68 a-l) dargestellt.
- 128 -
Ergebnisse
3.9. Konstruktion von chromosomalen Fusionsgenen in S.lividans
3.9.1. Herstellung von Konstrukten und Analyse der Transformanten
Um mit Hilfe der Fluoreszenz-Mikroskopie die Synthese von KcsA nachweisen zu können,
wurde in einem ersten Experiment versucht, das Gen für das „enhanced green fluorescent
protein“ EGFP „in Frame“ am 3’ Ende von kcsA ins Chromosom von S.lividans 66 zu
integrieren, so dass ein KcsA-EGFP-Fusionsprotein produziert werden sollte. Um polare
Effekte möglichst auszuschließen oder so weit wie möglich zu reduzieren, sollten hierbei
keine weiteren Selektionsgene mit integriert werden (Rekombinationsschema in Abb. 3.69).
Für die Integration wurde ein Temperatur-sensitives Vektor-Derivat von pGM160 verwendet,
in dem über die HindIII/NcoI-Schnittstellen ein 6,2 kBp Insert eingefügt wurde, aacC wurde
hierbei ersetzt. Dieses sollte in S.lividans 66 transformiert werden. Nach Temperaturerhöhung
(37°C) erfolgte eine Selektion auf „single crossing over“ (Selektion auf Phänotyp: ThioR,
HygR und Mel+), anschließend auf „double crossing over“ (ThioS, HygS und Mel-).
Abb. 3.69: Rekombinationsschema. Die jeweils homologen Bereiche auf dem Plasmid und Chromosom sind in
grauen Boxen dargestellt; die in der Darstellung linke Box trägt das vollständige kcsA, ohne Stoppcodon. Das
EGFP-Gen tragende Fragment ist in grün dargestellt, das Gen liegt im gleichen Leseraster direkt hinter kcsA.
Das Ω-hyg-Fragment ist in weiß dargestellt, die Leserichtung des Hygromycin-Resistenzgens ist ebenso, wie von
melC1 und melC2, die für die Melanin-Synthese verantwortlich sind (in hellgrau dargestellt), entgegen der
Leserichtung des kcsA-EGFP-Fusionsgens.
Dargestellt sind, der das Plasmid tragende Transformant (in A), die beiden möglichen „Single-crossing over“
Zwischenstufen (B1 und B2) und die „Double-Crossing over“ Endform (in C), bei der das Gen für EGFP „in
Frame“ hinter kcsA integriert ist. Da das kcsA tragende homologe Fragment mit ca. 700 Bp um ca. 200 Bp größer
ist, als das zweite, dem kcsA nachfolgende homologe Fragment, sollte die „Single-Crossing-over“Rekombination über das größere Fragment bevorzugt werden (durch die 1 im Kreis dargestellt). Der jeweilige
Phänotyp ist rechts dargestellt.
Ergebnisse
- 129 -
Es wurden zwei Vorkonstrukte geschaffen. Die für die Melanin-Synthese verantwortlichen
Gene melC1 und melC2 wurden mit PvuII/PstI aus pIJ702, das Ω-hyg-Frg aus dem Vektor
pHP45Ωhyg mit DraI ausgeschnitten. Beide Fragmente wurden gleichzeitig mit dem
SmaI/PstI-geschnittenen Vektor pBSK(+) ligiert. Es wurden 2 verschiedene Konstrukte
erhalten. Weiter verwendet wurde das Konstrukt, bei dem die Leserichtung von hygR der, der
Melanin-Synthese Gene, entsprach. Der Vektor erhielt den Namen pBSK2 (Abb. 3.70). Vom
Konstrukt pOV006 wurde ein ca. 700 Bp-Fragment amplifiziert, welches den flussaufwärts
liegenden Bereich von kcsA und kcsA bis auf das Stopcodon enthielt. Dieses Fragment wurde
mit SstI/KpnI restringiert. Der flussabwärts liegende Bereich von kcsA (einschließlich des
Stopkodons) wurden von demselben Konstrukt amplifiziert, das erhaltene ca. 500 BpFragment mit NotI/XbaI restringiert. Aus pEGFP1 wurde mit Hilfe von KpnI/NotI das EGFPGen ausgeschnitten. Alle drei restringierten Fragmente wurden gleichzeitig in einer einzigen
Ligationsreaktion mit dem SstI/XbaI geschnittenen Vektor pBSK(+) ligiert. Das Konstrukt
erhielt den Namen pBSK3 (Abb. 3.70).
Nach NcoI/XbaI-Restriktion von pBSK3 (partieller Verdau, da eine weitere NcoI-Schnittstelle
im EGFP-Teil zu finden ist), XbaI/HindIII-Restriktion von pBSK2, wurden die beiden
erhaltenen Fragmente zugleich mit dem NcoI/HindIII-geschnittenen Vektor pGM160 ligiert.
Das Konstrukt erhielt den Namen pGM4 (Abb. 3.70).
Abb. 3.70: Konstrukte pBSK2, pBSK3 und pGM4. Mit grün markiert ist der, das EGFP-Gen tragende
Abschnitt, mit braun markiert, der die für die Melanin-Synthese zuständigen Gene tragende Abschnitt und in
gelb das Ω-hyg-Fragment. Mit blau markiert sind die die amplifizierten Bereiche von kcsA mit dem
flussaufwärts liegenden Bereich (verwendete Oligos PrIEK und PrIIEK, Fragmentgröße 758 Bp, nach
Restriktion 740 Bp) und dem flussabwärts liegenden Bereich von kcsA (Oligos PrIIIEK und PrIVEK,
Fragmentgröße 547 Bp, nach Restriktion 528 Bp).
pGM4 wurde in S.lividans 66 transformiert. Nach 37°C Temperaturerhöhung erfolgte die
Selektion auf „single crossing over“ (ThioR, HygR, Mel+), anschließend auf „double crossing
over“ (ThioS, HygS, Mel-) durch mehrmaliges Ausstreichen auf unselektivem Medium. Es
konnten eine Reihe potentieller Mutanten erhalten werden. Nach Restriktion und Transfer der
- 130 -
Ergebnisse
chromosomalen DNA zeigte sich, dass keine Hybridisierung mit Sonden, spezifisch gegen
hygR und tsr, erhalten werden konnten, jedoch auch nicht gegen das DNA-Fragment der
erwarteten Größe oder ein anderes. Die Kontrollen waren positiv. (Ergebnisse nicht
dargestellt). Anscheinend waren kcsA und die umliegenden Bereiche deletiert.
3.9.2. Herstellen von Hygromycin-resistenten Mutanten mit chromosomalen Fusionsgen
Da der erste Ansatz, das EGFP-Gen ins Chromosom zu integrieren, nicht gelang, wurde ein
neuer Ansatz gewählt. Anders als bei ersten Versuch wurde kein „single-cross over“Zwischenschritt benötigt, die Selektion erfolgte auf das „Double cross over“-Endprodukt. Zur
positiven Selektion wurde flussabwärts des EGFP-Gens das Hygromycin-Resistenzgen hygR,
entgegen der Flussrichtung von EGFP, eingesetzt; um polare Effekte so weit wie möglich zu
reduzieren, wurde der Terminator von hygR deletiert. Nach Ligation der Inserts mit dem
Temperatur-sensitiven Plasmid pGM160, Transformation in S.lividans 66 WT und Selektion
auf Thiostrepton und Hygromycin, wurden die Transformanten auf Selektionsmedien mit
Hygromycin transferiert und bei 37°C angezogen. Unter diesen Bedingungen sollte pGM160
nicht replizieren, so dass nur die Zellen, die die Hygromycin-Resistenz- (und somit auch das
EGFP-Gen) integriert haben, wachsen (Rekombinationsschema siehe Abb. 3.71).
Abb. 3.71: Rekombinationsschema. In grau markiert sind die jeweils homologen Bereiche des Plasmides und
des Chromosoms. Das EGFP-Gen ist so integriert, dass jeweils ein KcsA- oder KsuF-EGFP-Fusionsprotein
synthetisiert werden kann; das EGFP-Gen tragende Fragment ist in grün dargestellt. In der zum Fusionsgen
umgekehrten Leserichtung ist das Ω-hyg-Fragment für die positive Selektion inseriert (in weiß); das Fragment ist
um den hinter dem Resistenzgen liegenden Terminator verkürzt. Ebenfalls in weiß dargestellt ist das
Thiostrepton-Resistenzgen, welches auf dem Vektorteil liegt. Bei der Kontrolle wurde das Gen für EGFP durch
eine Leserasterverschiebung so integriert, dass statt eines KsuF-EGFP-Fusionsproteins nur ein geringfügig
verlängertes KsuF-Protein synthetisiert werden kann. Die Rekombination ins Chromosom kann direkt in einem
Schritt über eine Doppel-Rekombination oder über den Zwischenschritt einer Einzelrekombination erfolgen.
Dargestellt ist nur das Endergebnis (Doppel-Rekombination). Der jeweilige Phänotyp ist links dargestellt.
Ergebnisse
- 131 -
Vom Konstrukt pACYC007 wurde kcsA bis auf das Stopkodon und der flussaufwärts liegende
Bereich amplifiziert und das erhaltene ca. 750 Bp Fragment anschließend mit BamHI/XbaI
geschnitten. Vom selben Konstrukt wurde der flussabwärts liegende Bereich einschließlich
des Stopkodons von kcsA amplifiziert und das ca. 750 Bp Fragment mit BamHI/HindIII
restringiert. Beide Fragmente wurden zugleich mit dem XbaI/HindIII geschnittenen Vektor
pUC18 ligiert. Es entstand pUCK1K2 (Abb. 3.72). Das Hygromycin-Resistenz-Gen
enthaltene SanDI/NotI Fragment aus pHP45Ωhyg und das KpnI/NotI EGFP-Fragment aus
pEGFP1 wurden gleichzeitig mit dem SanDI/partiell KpnI geschnittenen Konstrukt
pUCK1K2 ligiert. Das erhaltene Konstrukt bekam den Namen pUCKEH (Abb. 3.72). Aus
diesem wurde das Insert als HindIII/XbaI Fragment mit dem ebenso geschnittenen Vektor
pGM160 ligiert. Es entstand pGMKEH (Abb. 3.72).
Abb. 3.72: Konstrukte pUCK1K2, pUCKEH und pGMKEH. Die beiden homologen Bereiche sind in blau
dargestellt, das EGFP-Gen tragende Fragment in grün und das Ω-hyg-Fragment in gelb. Für die Amplifikation
von kcsA und dem flussaufwärts gelegenen Bereiches wurden die Oligos PrkcsAK und PrkcsAX (781 Bp,
763 Bp nach Restriktion) verwendet, für den flussabwärts gelegenen PrkcsAS und PrkcsAH (739 Bp, 721 Bp
nach Restriktion).
Nach Transformation in S.lividans 66 und Selektion auf Rekombinanten, wurden von den
Stämmen, die HygR und ThioS sensitiv waren, die chromosomalen DNA’s aufgereinigt. Die
Analyse der Rekombinanten erfolgte mittels DNA-Hybridisierung (Sonden gegen das EGFPGen, Ωhyg, tsr und das AhdI-Frg; Abb. 3.73). Die Signale finden sich jeweils bei der
erwarteten Größe von 9399 Bp für die drei Mutanten (Membranen a-c, Spur 1-3) und den
7074 Bp beim Wildtyp (Membran b, Spur 4). Zusätzlich wurden zur Kontrolle der korrekten
Insertion jeweils der homologe 5’-Bereich der drei Mutante vom Chromosom mit Hilfe von
PCR amplifiziert und durch doppelsträngige Sequenzierung verifiziert. Alle drei getesteten
Mutanten scheinen in Ordnung zu sein (siehe auch Tabelle 3.2).
Ergebnisse
- 132 -
a)
c)
b)
d)
Abb. 3.73 a-d): Hybridisierung, Nachweis der Integration in kcsA. Hybridisierung mit Sonden gegen a) Ωhyg, b) AhdI-Frg c) EGFP-Gen d) tsrR. Die chromosomalen DNA’s der Rekombinanten und S.lividans TK21
wurden mit AhdI geschnitten. Jeweils in den Spuren 1-3: EGFP-Insertionsmutanten K, L und M. Spur 4:
S.lividans TK21 WT. Spur 5: Dig-markierter Molekular-Gewichts-Marker II.
BuchstabenCode
K
L
M
Stamm
66
66
66
CodeInsertion
KEH56
KEH56
KEH56
kcsA-EGFP-Insertionsmutanten,
Nr.
ThioR
Morphologie
11
16
18
OK
OK
OK
OK
OK
OK
Sequenzierung
OK
OK
OK
Besonderheiten
-
Tabelle 3.2: Auswertung der 3 kcsA-EGFP-Insertionsmutanten (KEH). Die Oligos PrKcsAvor und
PrEGFPback wurden für die Amplifikation verwendet, die Oligos PrEGFPseq und PrKcsAseq für die
doppelsträngige Kontrollsequenzierung des entstandenen 1029Bp-Fragmentes.
Ergebnisse
- 133 -
Wie schon für die Integration des EGFP-Gens „in frame“ hinter kcsA beschrieben, wurde
auch für die Integration hinter ksuF der „hintere“ Teil von ksuF bis auf das Stopkodon und
vom selben Konstrukt, der flussabwärts gelegene Abschnitt einschließlich des Stopkodons
amplifiziert und nach Restriktion mit pUC18 ligiert. Nach Transformation in E.coli erhielt das
Konstrukt den Namen pUCF1F2 (Abb. 3.74). Nach Integration der beiden hygR und EGFPGen tragenden Fragmente in pUCF1F2 und Transformation, erhielt das Konstrukt den Namen
pUCFEH (Abb. 3.74). Aus diesem wurde das Insert als HindIII/XbaI-Fragment mit dem
ebenso geschnittenen Vektor pGM160 ligiert, in E.coli transformiert und erhielt nach
Kontrolle den Namen pGMFEH (Abb. 3.74).
Abb. 3.74: Konstrukte pUCF1F2, pUCFEH und pGMFEH. Die beiden homologen Bereiche sind in blau
dargestellt, das EGFP-Gen tragende Fragment in grün und das Ω-hyg-Fragment in gelb. Für die Amplifikation
des ksuF-Teils wurden die Oligos PrksuFK und PrksuFX (724 Bp, 706 Bp nach Restriktion), für den
flussabwärts gelegenen Bereich PrksuFS und PrksuFH verwendet (594 Bp, 576 Bp nach Restriktion). Als
„Template“ fand das Konstrukt pACYC007 Verwendung.
Nach Transformation in S.lividans 66 WT und Selektion auf Rekombinanten, wurden von 12
Stämmen, die HygR und ThioS sensitiv waren, die chromosomalen DNA’s aufgereinigt und
mittels DNA-Hybridisierung auf korrekte Rekombination getestet (Sonden gegen das EGFPGen, Ωhyg, tsr und das AhdI-Frg; Abb. 3.75). Bei allen fand sich ein Signal in Höhe der
erwarteten Größe von 9403 Bp (Membranen a-c, Spuren 1-12), deutlich höher, als das Signal
beim Wildtyp (Membran c, Spur 13, erwartete Größe von 7074 Bp).
- 134 -
Ergebnisse
Abb. 3.75 a-d): Hybridisierung, Nachweis der Integration vom EGFP-Gen hinter ksuF. Hybridisierung mit
Sonden gegen a) Ω-hyg, b) EGFP-Gen, c) AhdI-Frg d) tsrR. Die chromosomalen DNA’s der potentiellen
Insertionsmutanten und S.lividans TK21 wurden mit AhdI geschnitten. Jeweils aufgetragen wurden auf den
ersten 12 Spuren die potentiellen Mutanten: Spur 1: Mutante A, Spur 2: B, Spur 3: C, Spur 4: D, Spur 5: E, Spur
6: F, Spur 7: G, Spur 8: H, Spur 9: I, Spur 10: J, Spur 11: N, und Spur 12: O. Auf Spur 13 wurde zur Kontrolle
S.lividans TK21 WT-DNA aufgetragen, auf Spur 14: Dig-markierter Molekular-Gewichts-Marker II.
Zusätzlich wurde, zur Kontrolle der korrekten Insertion, jeweils der homologe 5’-Bereich der
12 Mutante vom Chromosom mit Hilfe von PCR amplifiziert und durch doppelsträngige
Sequenzierung verifiziert. Nur bei der Mutante mit dem Buchstabenkode O findet sich, ca.
50 Bp vor Ende des ksuF-Teils des Fusionsgens, ein Basenaustauch (siehe auch Tabelle 3.3).
Ergebnisse
- 135 -
BuchstabenCode
A
B
C
D
E
F
G
Stamm
66
66
66
66
66
66
66
CodeInsertion
FEH111
FEH111
FEH111
FEH111
FEH111
FEH111
FEH111
H
I
J
66
66
66
N
O
66
66
KsuF-EGFP-Insertionsmutanten
Nr.
ThioR Morphologie
1
2
3
4
6
8
9
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
Sequenzierung
OK
OK
OK
OK
OK
OK
OK
FEH112
FEH112
FEH112
15
16
24
OK
OK
OK
OK
OK
OK
OK
OK
OK
FEH1111
FEH1111
27
39
OK
OK
OK
OK
OK
Basenaustausch
Besonderheiten
Kolonien
unterschiedlicher
Größe
Tabelle 3.3: Auswertung der 12 ksuF-EGFP-Insertionsmutanten (FEH). Mutante J zeigt leichte
Auffälligkeiten in der Morphologie. Für die Amplifikation wurden die Oligos PrksuFvor und PrEGFPback, für
die doppelsträngige Sequenzierung die Oligos PrksuFseq und PrEGFPseq, verwendet. Bei Mutante O ist die
Base 1070 des KsuF-EGFP-Fusionsgens von G zu C ausgetauscht. Dies hat keine Auswirkungen auf die
Sequenz des Proteins.
Um auszuschließen, dass die Integration eines EGFP- und des Hygromycin-Resistenz-Gens
ins Chromosom Auswirkungen auf die Expression des zu testenden Gens hat, sollte eine
Leserasterverschiebung so eingefügt werden, dass statt eines KsuF-EGFP-Fusionsprotein ein
gegenüber KsuF um 11 Aminosäuren verlängertes Protein produziert würde.
Das für die ksuF-EGFP-Fusionsmutante benötigte Zwischenkonstrukt pUCFEH (Abb. 3.74)
wurde mit ApaI geschnitten, die 3’ überhängenden Basen mit Hilfe der T4-Polymerase
„abverdaut“, wieder aufgefüllt und nach Religation transformiert. Bei Kontrollsequenzierung
verschiedener Klone des nun pUCFEH2 genannten Konstruktes zeigte sich, dass jeweils statt
der erwarteten Verkürzung um 4 Nukleotide eine von 5 Nukleotiden vorlag. Das Konstrukt
pUCFEH2 wurde mit NcoI geschnitten, nach „auffüllen“ (Klenow) des 5’ Überhanges
religiert und in E.coli transformiert. Aus diesem (pUCFEH4 benannt) wurde nach
Kontrollsequenzierung das Insert als HindIII/XbaI-Fragment mit dem ebenso geschnittenen
Vektor pGM160 ligiert, in E.coli transformiert und erhielt nach der Kontrolle den Namen
pGMFEH4 (Abb. 3.76).
- 136 -
Ergebnisse
Abb. 3.76: Konstrukt pGMFEH4. Die mit dem Chromosom homologen Bereiche sind in blau dargestellt, das
EGFP-Gen tragende Fragment in grün und das Ω-hyg-Fragment in gelb.
Nach Transformation in S.lividans 66 WT und Selektion auf Rekombinanten, wurden die
chromosomalen DNA’s von 11 potentiellen Insertionsmutanten aufgereinigt und nach
Restriktion gegen verschiedene Sonden hybridisiert (Abb. 3.77 a-c).
Abb. 3.77 a-c): Hybridisierung, Nachweis der Integration vom EGFP-Gen hinter ksuF außerhalb des
Leserasters. Hybridisierung mit Sonden gegen a) Ω-hyg, b) AhdI-Frg und c) tsrR. Die chromosomalen DNA’s
der potentiellen Insertionsmutanten und S.lividans TK21 wurden mit AhdI geschnitten. Jeweils aufgetragen
wurden auf den ersten 12 Spuren die potentiellen Mutanten: Spur 1: Mutante P, Spur 2: Q, Spur 3: R, Spur 4: S,
Spur 5: T, Spur 6: U, Spur 7: V, Spur 8: W, Spur 9: X, Spur 10: Y und Spur 11: Z. Auf Spur 12 wurde zur
Kontrolle S.lividans TK21 WT-DNA aufgetragen, auf Spur 13 (mit M markiert): Dig-markierter MolekularGewichts-Marker II.
Ergebnisse
- 137 -
Zehn der elf getesteten potentiellen Mutanten scheinen das EGFP-Gen korrekt ins
Chromosom integriert zu haben, Mutante Nr.9 (Mutante X) ist nicht korrekt inseriert. Von
diesen Mutanten sollte die Synthese eines C-terminal um 12 Aminosäuren verlängerten KsuFProteins erfolgen.
BuchstabenCode
P
Q
R
S
T
U
V
W
X
Y
Z
Stamm
66
66
66
66
66
66
66
66
66
66
66
CodeInsertion
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
FEH4
Nr.
ThioR
Morphologie
1
2
3
4
5
6
7
8
9
10
11
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
OK
Besonderheiten
fehlerhaft inseriert
Tabelle 3.4: Auswertung der 11 ksuF/EGFP-Insertionsmutanten (FEH4) die zur Kontrolle dienen. Zehn
der 11 Mutanten sind korrekt inseriert und wurden weiter verwendet.
Eine Synthese des chromosomal determinierten KcsA-EGFP (S.lividans 66 KEH5) und KsuFEGFP (S.lividans 66 FEH11), im Vergleich zum leicht verlängerten KsuF der NegativKontrolle (S.lividans 66 FEH4), konnte weder durch Fluoreszensmikroskopie (nicht
dargestellt), noch mit Hilfe von Antikörpern nach Transfer auf Membranen, nachgewiesen
werden (siehe Abb. 3.16 a, Spur 6 für S.lividans 66 FEH11). Eine Produktion der Proteine
war auch auf Grund der vorher dargestellten Ergebnisse nicht zu erwarten (siehe 3.3.5.). Eine
Synthese des KsuF-EGFP Fusionsproteins und des leicht verlängerten KsuF der NegativKontrolle sollte nach Transformation eines für die Thiostrepton Resistenz determinierenden
tsr tragenden Plasmides, wie z.B. pWHM3be oder pIJ702 erfolgen, aufgrund von Zeitmangel
konnte dies nicht mehr durchgeführt werden.
Diskussion
- 139 -
4. DISKUSSION
4.1. Sequenzanalyse und Charakteristika der abgeleiteten Proteine
Wie vergleichende Sequenzanalysen des S.coelicolor A3(2) (Bentley, S.D., et al.; 2002) und
S.avermitils Genoms (Ikeda, H., et al.; 2003) gezeigt haben, ist die Anordnung und
Zusammensetzung der Gene in den äußeren Armbereichen deutlich geringer konserviert und
nimmt zu den Telomeren hin ab (Ikeda, H., et al.; 2003, siehe auch Einleitung). Der im
Rahmen dieser Arbeit untersuchte Abschnitt findet sich im äußersten Bereich des rechten
Arms des S.coelicolor Genoms, nur 163 kBp-177 kBp entfernt vom telomeren Ende. Die
äußersten 20 kBp werden hierbei von den „Terminal inverted repeats“ (TIR’s) gebildet. Somit
verwundert es nicht, dass eine vergleichbare Zusammensetzung der Gene dieses Abschnittes
mit einer Ausnahme, weder bei S.avermitilis noch bei einem anderen Bakterienstamm, außer
bei den Mitgliedern der S.violacoeruber Familie, S.violaceoruber (Puls-Feld Gelexperimente
im Rahmen der Diplomarbeit), S.lividans 66 und S.coelicolor A3(2) zu finden ist.
Kineococcus radiotolerans ist ein aus einem radioaktiven Absetzteich isolierter, aerober,
kockoider, Gram-positiver Actinomycetenstamm mit hohem G+C-Gehalt, der in symetrischen
Multizell Gruppen wächst und sich durch eine, wie der Name schon sagt, sehr hohe Toleranz
gegenüber radioaktiver Strahlung auszeichnet (Phillips, R.W., et al.; 2002). Auf dem
Kineococcus radiotoleranz-Genom findet sich ein vermutliches Operon, bestehend aus drei
Genen (EAM73830, EAM73831 und EAM73832), die jeweils für Proteine der Aldo-Keto
Reduktase-Familie kodieren. EAM73830 zeigt hierbei mit 73 % identischen und 85 %
homologen Aminosäuren eine sehr große Ähnlichkeit zu KsuC, EAM73831 mit 77 %
identischen und 85 % homologen eine sehr große zu KsuB, die entsprechenden DNA
Sequenzen sind jeweils 81 % identisch zu den für KsuC und KsuB determinierenden. Des
Weiteren findet sich, beginnend 80 Bp flussaufwärts vor EAM73830 und 130 Bp vor ksuC,
ein jeweils 70 Bp langer AT reicher homologer Abschnitt (siehe Anhang A, rot markiert). Es
ist zu vermuten, dass dieser Abschnitt jeweils mögliche Operator-Binderegionen, die -35 und
-10 Region und den Transkriptionsstart enthält. In S.lividans sind ksuC und ksuB durch einen
35 Bp langen intergenischen Abschnitt getrennt, EAM73830 und EAM73831 sind um 4
Nukleotide überlappend. Hier unterscheiden sich die beiden Stämme. Eine Funktion für
dieses, für drei Aldo-Keto Reduktasen determinierenden putativen Operon aus
K.radiotolerans, ist weder bekannt noch postuliert.
- 140 -
Diskussion
Das aus der Sequenz abgeleitete Protein KsuF ist ein Mitglied der FlavoproteinMonooxygenasen. Diese führen in aromatischen Substrate eine neue Hydroxylgruppe an der
ortho Position der vorhandenen Hydroxylgruppe ein (Harayama, S., et al.; 1992). Es sind
jedoch auch Enzyme, wie die 3-Hydroxybenzoat-6-Hydroxylase aus Pseudomonas cepacia
und Klebsiella pneumoniae M5a1, bekannt, die eine para-Hydroxylierung durchführen
(Harayama, S.M., et al.; 1992; Wang, L.-H., et al.; 1987; Liu, D.Q., et al.; 2005). Wie am
Beispiel der p-Hydroxybenzoat-Hydroxylase (PHBH), die p-Hydroxybenzoat (4Hydroxybenzoat) zu 3,4-Hydroxybenzoat hydroxyliert, explizit gezeigt wurde, führen
Flavoprotein-Monooyxygenasen die enzymatische Reaktion in zwei Schritten durch: (1)
Reduktion des FAD durch NAD(P)H als Antwort auf die Bindung des Substrates am Enzym
und (2) Oxidation des reduzierten FAD mit O2 in einer wasserfreien Umgebung mit Bildung
eines Hyperoxids, welches anschließend das Substrat zum Endprodukt oxygeniert (Cole, L.J.,
et al.; 2005; Entsch, B., et al.; 2005, Entsch, B. and van Berkel, W.J., et al.; 1995).
In Gelfiltrationsexperimenten wurde His-KsuF als Monomer und in der Größe eines
Dimers/Trimers aufgereinigt (siehe Abb. 3.41 a-d und Abb. 3.42 a-f). Anders als das
Monomer, ist das Dimer/Trimer „FAD frei“ und neigt zur Aggregation. Es ist anzunehmen,
dass die Dimer/Trimer Form artifiziell ist. Aus den S.lividans TK21 pOVE33 oder pOVE53
Transformanten konnte das chromosomal determinierte KsuF nicht als Multimer mit dem
Plasmid-kodierten His-KsuF über Ni-NTA co-aufgereinigt werden, was ebenfalls dafür
spricht, dass KsuF als Monomer vorliegt. Alle Untersuchungen wurden unter hohen
Salzkonzentrationen durchgeführt (200 mM oder 300 mM NaCl), so dass nicht
auszuschließen ist, das KsuF unter anderen Bedingungen als Multimer vorliegt.
Die Mitglieder der Flavoprotein-Monooxygenasen werden als monomere oder homodimere
Proteine beschrieben (Harayama, S., et al.; 1992), jedoch finden sich auch Beispiele als
Homotetramer. So liegen z.B. die Salicylat-5-Hydroxylase (SAL5H), m-Hydroxybenzoat-6Hydroxylase (MHB6H) und die p-Hydroxybenzoat-3-Hydroxylase (PHB3H) aus
Rhodococcus erythopolis als Homotetramer vor (Suemori, A., et al.; 1995). Die PhenolHydroxylase aus Trichosporon cutaneum wurde als Homodimer charakterisiert (Sejlitz, T.
and Neujahr, H.Y.; 1987), jedoch als Tetramer aus 2 Homodimeren kristallisiert (1Foh, Chain
A-D; Enroth, C., et al.; 1998). Die 3-Hydroxybenzoat-6-Hydroxylase aus P.cepacia ist ein
Monomer von 44 kDa (Wang, L.-H., et al.; 1987), während sie aus Micrococcus spec. als
Dimer identifiziert wurde (Rajasekharan, S., et al.; 1990).
KsuF wie auch TetX bzw. TetX2 aus Bacteroides Stämmen (Whittle, G., et al.; 2001; Park,
B.H. and Levy, S.B.; 1988; Speer, B.S. and Salyers, A.A.; 1988) und eine Reihe weiterer
nicht genauer charakterisierte Flavoprotein-Monooxygenasen zeichnen sich durch den Besitz
eines relativ kurzen C-terminalen Endes aus. TetX und TetX2 zeigen nach Produktion in
E.coli eine kryptische, sauerstoffabhängige, durch Monohydroxylierung an Position 11a
hervorgerufenen Resistenz gegen Tetrazykline. Wie an TetX2 gezeigt, liegen sie jeweils als
Monomer vor (Yang, W., et al.; 2004). KsuF zeigt unter den Flavoprotein-Monooxygenasen
mit bekannter Funktion die höchsten Ähnlichkeiten zu TetX und TetX2 einschließlich des C-
Diskussion
- 141 -
terminalen Endbereiches, mit jeweils 46 % homologen, hiervon 30 % identischen
Aminosäuren.
Die p-Hydroxybenzoat-Hydroxylase (PHBH) aus Pseudomonas fluoreszens und
Pseudomonas aeruginosa, wie auch weiteren Pseudomonaden, ist ein Homodimer (Seibold,
B., et al.; et al.; 1996; Müller, F., et al.; 1979). Wie aus den 3D Strukturdaten ersichtlich, ist
das C-terminale Ende der PHBH primär an der Dimerisierung beteiligt (Abb. 4.1 b und d).
Die hier dargestellten dimeren Strukturen sind aus Kristalldaten des Monomers postuliert. Vor
kurzem gelang zum ersten Mal die Kristallisation als Dimer. Die Daten zeigen ebenfalls die
Bedeutung des C-terminalen Endes für die Dimerisierung (Entsch, B., et al.; 2005).
Abb. 4.1: Postulierte Kristallstruktur des C-terminalen Endes von KsuF und der PHBH („in“
Konformation). Dargestellt sind in a) und c) die putative Kristallstrukturen der C-terminalen 26 Aminosäuren
von KsuF und in b) und d) die Kristallstruktur der um 3 Aminosäuren gekürzten C-terminalen 52 Aminosäuren
der PHBH (1pbe.pdb), jeweils in dimerer Form. Die 2 Untereinheiten sind jeweils in grün und gelb dargestellt.
Die Ansicht in a) und b) entspricht der Seitenansicht in Abb. 3.40 c, in c) und d) wurden die Peptide um die
Hochachse um 90° in „Uhrlauf“-Richtung rotiert.
Wie aus dem „Alignment“ ersichtlich, ist das C-terminale Ende von KsuF um 29
Aminosäuren gegenüber der PHBH verkürzt. Nach Ser356 von KsuF (PHBH: Ser348) sind
keine korrespondierenden Aminosäuren zu finden (Abb. 3.39). Ob die im Vergleich zu den
Kristallstrukturen der PHBH postulierte C-terminale α-helicale Struktur (Leu367 bis Gly373
von KsuF) vorhanden ist, ist zu bezweifeln (siehe Abb. 4.1 a und c). KsuF liegt vermutlich als
Monomer vor.
Flavoprotein-Monooxygenasen besitzen FAD als Cofaktor, das, wie z.B. bei der pHydroxybenzoat-Hydroxylase (PHBH), nicht kovalent gebunden ist (Eppink, M.H.M, et al.;
- 142 -
Diskussion
1998b). Jeweils ein FAD-Molekül ist pro Untereinheit gebunden (Entsch, B., et al.; 2005;
Yang, W., et al.; 2004; You, I.S., et al.; 1990; Tu, S.C., et al.; 1981).
KsuF kann sowohl nach Überproduktion aus E.coli als auch nach Aufreinigung aus
Streptomyceten (nicht dargestellt) als gelb gefärbtes Protein aufgereinigt werden (siehe
Abb. 3.37 c). In Streptomyceten finden sich neben FMN und FAD auch FO (7,8-Dedimetyl8-hydroxy-5-deazariboflavin), z.B. bei der Tetrazyclin-Dehydrogenase aus Streptomyces
aureofaciens (Nakano, T. et al.; 2004) als Flavin-Cofaktoren. Weitere FAD-Derivate sind
bekannt, wie z.B. Arabino-FAD, gefunden in der Alkohol-Oxidase methylothropher Hefen
(Bystrykh, L.V., et al.; 1991). In massenspektrometrischen Untersuchungen wurde FAD als
Cofaktor nachgewiesen (siehe Ergebnis 3.6.2., Abb. 3.44 a-h). Die Ergebnisse zeigten, dass
jeweils ein FAD pro Monomer vorhanden ist (siehe Anhang D und Abb. 3.43).
FAD ist an KsuF nicht kovalent gebunden. Eine geringfügige Dissoziation des FAD vom
KsuF konnte immer während dessen Aufreinigung und Konzentrierung beobachtet werden.
Die Ablösung von FAD führt zur Bildung von oligomeren Formen (Dimeren/Trimeren, siehe
Abb. 3.41 a-d und 3.42 a-f), die leicht präzipitieren (ab ca. 14000 g). Anders als für andere
Flavoprotein-Monooxygenasen ist die Ablösung von FAD anscheinend irreversibel. Es war
nicht möglich, wie z.B. bei der PHBH und Salicylat-Hydroxylase gezeigt (Bhushan, B., et al.;
2004; Palfey, B.A., et al.; 2003), unter vergleichbaren Bedingungen (Red-A Methode, Gatti,
D.L., et al.; 1994) den KsuF-FAD-Komplex zu regenerieren. Die Stabilität des KsuF-FADKomplexes ist unabhängig vom verwendeten Puffer. Die Untersuchungen wurden mit 15
verschiedenen anorganischen oder organischen Puffern bei pH 7,5 durchgeführt (nicht
dargestellt). Auch haben (getestete) Salzkonzentrationen von 0-300 mM NaCl oder KCl auf
die Stabilität des FAD-KsuF Komplexes keinen Einfluß. Anders als z.B. bei der PHBH
(Palfey, B.A., et al.; 2003) besitzt KsuF nur einen sehr geringen pH-Bereich in dem es stabil
ist; pH-Werte unter pH 7-6,5 oder über pH 8-8,5 führen zur sofortigen, vollständigen,
irreversiblen und sehr starken Aggregation und Präzipitation von KsuF, mit Ablösung von
FAD. KsuF fällt hierbei als braun gefärbter „Klumpen“ aus, die unter diesen Bedingungen
beobachtete Aggregation unterscheidet sich hierin von der oben beschriebenen.
Überraschender Weise ist KsuF empfindlich gegenüber Metall, so führt z.B. auch das
„Aufziehen“ der Proteinlösung von KsuF-FAD durch eine Metallnadel zur sofortigen und
vollständigen Verklumpung des Proteins unter Freisetzung des FAD, vergleichbar der
beobachteten bei niedrigen oder hohen pH-Werten.
Wie an der PHBH gezeigt wurde, sind vier Bereiche der Flavoprotein-Monooxygenasen für
die Bindung von FAD bedeutsam (zusammenfassend dargestellt in: Wang. J,. et al.; 2002).
Die an der Bindung von FAD beteiligten Aminosäuren sind in der Abb. 3.39 markiert und
auch in KsuF zu einem großen Teil konserviert, bzw. liegen in Bereichen, die „hoch“
konserviert sind. Flavoprotein-Monooxygenasen sind Mitglieder der „FAD/NAD(P)-binding
Rossmann fold Superfamily“. Im N-terminalen Teil (Aminosäuren 1-48) von KsuF findet sich
die typische „Rossman fold“ Struktur (Rao, S.T. and Rossman, M.G.; 1973), bestehend aus
alternierenden β-Faltblatt und α-helikalen Sekundärstrukturen (β1α1β2α2β3, siehe Abb. 3.39).
Diskussion
- 143 -
Der Bereich der Aminosäuren 9-14 von KsuF bindet hierbei am Adenosin des FAD, vor allem
an der Ribosegruppe, die Aminosäuren 31-47 am Ribityl und dem Isoalloxazin von FAD. Der
Bereich der Aminosäuren 154-162 von KsuF ist an der Bindung der Pyrophosphate involviert,
293-310 von KsuF an der Bindung der Pyrophosphate, der Ribosyl- und der
Isoalloxazingruppe.
Als zweiten Cofaktor neben FAD besitzen Flavoprotein-Monooxygenasen NAD(P)H. TetX
bzw. TetX2 verschiedener Bacteroides-Stämme (Yang, W., et al.; 2004) und die PHBH aus
P.fluorescens und aeruginosa sind NADPH abhängig. Die Salicylat-1-Monooxygenase des
Pseudomonas spec. Stammes ATCC 29352 bevorzugt NADH gegenüber NADPH (Bhushan,
B., et al.; 2004) und die Salicylat-Hydroxylase aus Pseudomonas stutzeri AN10 benötigt
NADH (Bosch, R.; et al.; 1999). Eine Bindung von NADH oder NADPH an gereinigtem HisTag KsuF oder an KsuF-haltigen Zellextrakten (aus S.lividans 66 pJO1 bzw. S.lividans NI
pOV005 Transformanten) konnte nicht nachgewiesen werden (nicht dargestellt). Ursächlich
verantwortlich ist vermutlich, dass es nicht gelungen ist, ein Substrat für KsuF zu finden
(siehe unten). Wie für die die Phenol-Hydroxylase aus Trichosporon cutaneum und die PHBH
gezeigt wurde, erfolgt die Bindung des NAD(P)H Cofaktors erst nach der Bindung des
Substrates (Entsch, B., et al.; 2005; Sejlitz, T. and Neujahr, H.Y.; 1987).
Die Cokristallisation der PHBH mit NADPH ist bisher nicht gelungen, auch wenn NADPH in
der Zwischenzeit sekundär in die Kristallstruktur modelliert wurde (Entsch, B., et al.; 2005;
Wang, J, et al.; 2002). Wie für die PHBH gezeigt, ist an der Bindung des Nukleotid-Cofaktors
NADPH keine „Rossman“-fold Struktur beteiligt. Dies unterscheidet die FlavoproteinMonooxygenasen von allen anderen Proteinen (Entsch, B. and van Berkel, W.J.H., 1995).
Durch Aminosäureaustausche konnte die Beteiligung einer Reihe von Aminosäuren an der
Bindung von NADPH nachgewiesen werden (Eppink, M.H.M., et al.; 1999; Eppink, M.H.M.,
et al.; 1998a; Eppink, M.H.M., et al.; 1998b; Eppink, M.H.M., et al.; 1997; Eppink, M.H., et
al.; 1995). Für einen Großteil wird eine duale Rolle in der Bindung sowohl von FAD als auch
von NADPH angenommen, hierunter Arg166 (Eppink, M.H.M., et al.; 1997). Für His162 und
Arg269 wird postuliert, dass sie mit dem Pyrophophatteil von NADPH interagieren (Eppink,
M.H.M., et al.; 1998a). Nur Arg166, für das eine duale Rolle in der Bindung sowohl von FAD
als auch von NADPH angenommen wird (Eppink, M.H.M., et al.; 1997), ist in KsuF
konserviert (KsuF: Arg162). Arg269 ist durch ein konservatives Histidin ersetzt (KsuF:
His276); für Arg269 wird postuliert, dass es mit dem Pyrophophatteil von NADPH interagiert
(Eppink, M.H.M., et al.; 1998a). Wie verschiedene eigene Sequenzvergleiche zeigten, sind
die in der PHBH an der NADPH Bindung beteiligten Aminosäuren auch in anderen
Flavoprotein-Monooxygenasen kaum konserviert. Eine Ausnahme bildet das
hochkonservierte Arg166 (KsuF: Arg162) (Eppink, M.H.M., et al.; 1997).
Die typischen Substrate der Flavoprotein-Monooxygenasen, p-Hydroxybenzoat, Salicylat,
Phenol, 2,4-Dichlorophenol, Tetrazyclin und Anhydrotetrazyclin, des Weiteren auch
Chloramphenicol werden von KsuF nicht umgesetzt (nicht dargestellt).
- 144 -
Diskussion
Flavoprotein-Monooxygenasen zeichnen sich durch eine sehr hohe Substratspezifität aus
(Seibold, B., et al.; 1996), dies ist vermutlich der Grund, dass es nicht gelang, ein Substrat für
KsuF oder die Bindung eines Substrates an KsuF nachzuweisen. So ist für die PHBH nur
bekannt, dass sie, außer 4-Hydroxybenzoat, nur 2-Fluoro-4-hydroxybenzoat, 2-Chloro-4hydroxybenzoat und 2,4-Hydroxybenzoat als Substrat umsetzt (Seibold, B., et al.; 1996).
Ursächlich verantwortlich ist die „Passwort“ Erkennung des Substrates, die gegenüber dem
„Lock and Key“ Modell (Fischer, E.; 1894) und dem „Induced Fit“ Modell (Koshland, D.E.;
1958), bei denen die Substraterkennung nur durch die Bindung des Substrates an der
strukturell passenden Substratbindestelle erfolgt, einen weiteren Schritt der
Substraterkennung besitzt. Nach Bindung des Substrates und des NADPH Cofaktors in der
„open“ erfolgt der Wechsel in die „out“ Konformation. Hier ist die „Ionisierbarkeit“
(Deprotonierung, siehe unten) des Substrates notwendig. Erst anschließend erfolgt die
Reduzierung des FAD durch NADPH und der Wechsel in die „in“ Konformation mit
Oxidation des Substrates (Palfey, B.A., et al.; 1999).
Tyr201, Ser212, Arg214, Tyr222 und Pro293 sind direkt in der p-HydroxybenzoatHydroxylase (PHBH) über Wasserstoffbrücken an der Bindung des Subtrates pHydroxybenzoat (4-Hydroxybenzoat) beteiligt (Ortiz-Maldonado, M., et al.; 2003). Ser212,
Arg214 und Tyr222 binden an der −COO− Gruppe des Substrates; sie sind nicht an der
katalytischen Reaktion beteiligt. Ihre Aufgabe ist die Erkennung und die Stabilisierung des
Substrates. In KsuF ist nur Tyr223 (PHBH: Tyr222) konserviert. An den Positionen Ser212
und Arg214 finden sich His213 und Glu215, was auf eine unterschiedliche Substratspezifität
hinweist. Aus der errechneten 3D Struktur von KsuF kann vermutet werden, dass auf Grund
der räumlichen Position, His213, His221 und Tyr223 eine entsprechende Aufgabe
übernehmen könnten. Tyr201 und Pro293 binden über Wasserstoffbrücken an der 4-OH
Gruppe des p-Hydroxybenzoat. Im Gegensatz zu Tyr201 findet sich in KsuF ein entsprechend
positionierter Prolin-Rest (Pro302, siehe Abb. 3.39). Pro293 ist in FlavoproteinMonooxygenasen hoch konserviert (Eppink, M.H.M., et al.; 1997). Während der Reaktion
wird ein Proton über ein Wasserstoffbrücken-Netzwerk von 4-OH-Tyr201-Pro293 über
Tyr201, Tyr385 und zwei Wassermolekülen auf His72 auf der Außenseite des Proteins
übertragen (Ortiz-Maldonado, M., et al.; 2004; Palfey, B.A., et al.; 1999; Gatti, D.L., et al.;
1996). An Position 72 ist in KsuF Glu72, Tyr385 befindet sich im C-terminalen Ende der
PHBH, der in KsuF nicht vorhanden ist. Die Deprotonierung der 4-OH Gruppe mit Bildung
einer „Phenolat“ Form führt zur Abstoßung von Pro293. Dies bewirkt die
Konformationsänderung des Proteins und ist der Schlüsselschritt von der „out“ zur „in“
Konformation (Palfey, B.A., et al.; 2002). KsuF führt vermutlich eine ortho- Hydroxylierung
durch. Eigene Sequenzvergleiche zeigen, dass Flavoprotein-Monooxygenasen, die eine paraHydroxylierung durchführen, keinen dem Pro293 entsprechenden Prolin-Rest tragen.
Die Produktion von KsuF ist in S.lividans wie auch in S.coelicolor abhängig von der Synthese
des Thiostreptonresistenzproteins. Dies wird in einem der folgenden Kapitel besprochen (4.2.
Synthese von drei Proteinen unter verschiedenen physiologischen Bedingungen). Des
Diskussion
- 145 -
Weiteren ist sie abhängig von der Salzkonzentration im Medium, vergleichbar der Produktion
von KsuC und KsuB. Hohe Salzkonzentrationen an NaCl und KCl erhöhen die Synthese bei
Vorhandensein des Thiostreptonresistenzproteins deutlich; dies wird ebenfalls in diesem
folgenden Kapitel besprochen.
Die Startkodons von ksuF und kcsA sind durch einen 325 Bp langen intergenischen Abschnitt
getrennt, kcsA liegt in entgegengesetzter Leserichtung von ksuF. Im 132 Bp langen
intergenischen Abschnitt, jeweils flussabwärts von ksuF und ksuL, findet sich ein Terminator
(cgtggagccgacggccaccacctcgcggtggccgtcggctccacg), mit 19 Bp langen perfekten „inverted
repeats“ und einem 7 Bp umspannenden „Loop“- Bereich (siehe Anhang A und B).
In Transformanten, die ksuF zusammen mit tsr auf einem Konstrukt trugen, konnte in
Transkriptionsstudien gezeigt werden, dass ksuF von einer monocistronischen mRNA
determiniert wird (J.Ritz, pers. Mitteilung). Der Terminator erwies sich hierbei als besonders
effizient. Es gelang nicht, ein mRNA-Transkript in S.lividans WT nachzuweisen. Weder mit
Hilfe entsprechender Programme, noch beim Durchsuchen „von Hand“, konnte vor ksuF oder
einem der in dieser Arbeit untersuchten Gene, eine σ70 RNA-Polymerasen typische -35 -10
Erkennungssequenz gefunden werden (Strohl, W.R.; 1992). Dies lässt schließen, dass die
Transkription jeweils von einem der 41 im Rahmen des S.coelicolor A3(2) Genomprojektes
gefundenen ECF-Sigma Faktoren abhängig ist; auf Grund von variablen und untypischen
Erkennungs-Sequenzen sind diese schwer zu identifizieren (Bentley, S.D., et al.; 2002; Bourn,
W.R. and Babb, B.; 1995; Strohl, W.R.; 1992). Es ist durch Abgleich mit dem 3’ Ende der
16S rRNA von S.lividans gelungen, sowohl vor ksuF als auch vor allen anderen im Rahmen
dieser Arbeit untersuchten Genen jeweils eine putative Shine-Dalgarno Sequenz zu
identifizieren (siehe Anhang A, Strohl, W.R.; 1992; Bibb, M.J., et al.; 1985; Bibb, M.J. and
Cohen, S.N.; 1982).
Im 325 Bp langen intergenischen Abschnitt finden sich eine überraschend hohe Zahl von
palindromischen Sequenzen, „direct“ und „inverted repeats“; hierbei sind besonders die vier
identifizierten „direct repeats“ auf Grund ihrer jeweils geringen und regelmäßigen Abstände
auffällig (siehe Abb. 3.2). Repetitive Sequenzen in intergenischen Bereichen besitzen häufig
eine Funktion als Bindestelle von regulatorischen Proteinen. Experimentell bekannte oder
durch Sequenzanalysen identifizierte Operator-Sequenzen zeigen keine Sequenzidentitäten zu
den repetitiven Sequenzen. Die Anordnung des dreimal gefundenen Hexamers „direct repeats
3“, mit einem Abstand von sechs und 22 Nukleotiden, erinnert an die Operatorsequenzen der
SARP Regulator-Familie (Streptomyces antibiotic regulatory proteins, Wietzorrek, A., Bibb,
M.; 1997). Wie für neun von ActII-ORF4 und DnrI kontrollierten Promoterregionen gezeigt,
binden diese an „direct repeats“ als Operatorsequenzen (Sheldon, P.J., et al.; 2002). Die
Promoter-Bereiche von actI-ORF1, actIII, dnrC und dnrD tragen jeweils drei Heptamere
„direct-repeats“, die durch vier und 15 Nukleotide getrennt sind. Die hohe Anzahl der
repetitiven Sequenzen mit einer vermutlich regulatorischen Funktion deutet auf eine sehr
komplexe Regulation von ksuF und kcsA hin.
- 146 -
Diskussion
Die Überproduktionskonstrukte (pOVE3-Serie) und das EGFP-Translations-Test Konstrukt
pOVG1 tragen nur den 325 Bp langen intergenischen Abschnitt zwischen ksuF und kcsA als
Promoterbereich, das KsuF-EGFP-Translations-Test Konstrukt (pOVG13) besitzt einen
deutlich längeren (1057 Bp), flussaufwärts von ksuF liegenden Abschnitt. Die EGFP
Produktion in der pOVG1-Transformante entspricht derjenigen von Transformanten mit
einem pOVE3-Derivat, deutlich geringer als erwartet (siehe Abb. 3.34 und 3.35, a und b;
Abb. 3.23 a, Spur 3). Die pOVG13 Transformante zeigt die erwartete hohe Produktion, wie
sie auch in Transformanten, die ksuF auf einem Konstrukt trugen, gefunden wurde (siehe z.B.
Abb. 3.34 und 3.35, g und h; Abb. 3.11 d). In Bakterien findet sich nahezu immer der
Transkriptionsstart weniger als 300 Bp vor dem Translationsstart-Kodon (Studholme, D.J., et
al.; 2004), bei Streptomyceten zumeist innerhalb von 100 Bp (Strohl, W.R.; 1992). Unter 139
Streptomyceten Promotoren haben 3 (nicht genauer benannt) einen weiten Abstand von 298,
335 und 345 Nukleotiden zum jeweiligen Translations Startkodon (Strohl, W.R.; 1992). In der
5’ untranslatierten Sequenz dieser drei finden sich repetitive Sequenzen und
Sekundärstruktur-bildende Abschnitte, vergleichbar denen im intergenischen Bereich
zwischen ksuF und kcsA (Strohl, W.R.; 1992). Somit erscheinen zwei mögliche
Transkriptionsstartpunkte bzw. Operator/Promoter-Bereiche vor ksuF wahrscheinlich zu sein,
einer im intergenischen 325 Bp Bereich gelegen und ein weiterer zumindest zum Teil
außerhalb dieses Bereiches im für kcsA determinierenden Abschnitt.
Die C-terminale Hälfte von KsuL zeigt in mehreren kurzen Motiven Ähnlichkeiten zur Cterminalen katalytischen Domäne eukaryotischer extrazellulärer Protein-Lysin-6-Oxidasen
(bezeichnet als Lysyl-Oxidasen: LO; EC1.4.3.13) sowie zur katalytischen Domäne von
„lysyl-oxidase-like“ Proteinen (LOXL, Csiszar, K.; 2001; Kagan, H.M. and Wande, L.;
2003). Diese gehören zur Familie der Amine-Oxidasen (AOs) und deren Unterfamilie der
Kupfer enthaltenden „semicarbazide-sensitive amine oxidases“ (SSAOs; Jalkanen, S. and
Salmi, M; 2001). Bestimmte Prototypen der Lysyl-Oxidasen sind an der Quervernetzung von
Collagen bzw. Elastin beteiligt. Die dabei durchgeführte Reaktion erfolgt in zwei
Teilschritten. Im ersten Schritt wird Lysyl, bzw. Hydroxylysyl zum Aldehyd oxidiert, die
Aminogruppe bleibt hierbei am Lysyl-Tyrosyl Quinon Cofaktor gebunden. Im zweiten Schritt
wird die Aminogruppe unter Wasser- und O2-Verbrauch zum Ammonium reduziert und
freigesetzt, zusätzlich entsteht H2O2 (Kagan, H.M. and Wande, L.; 2003; Williamson, M.A.
and Kagan, H.M.; 1985; Williamson; P.R. and Kagan, H.M.; 1986). Die Teilreaktionen
können wie folgt dargestellt werden:
(1) LOox + RCH2NH2 → LOred(-NH2) + RHC=O
(2) LOred(-NH2) + O2 +H2O → LOox + H2O2 + NH3
Die Aldehydgruppe kann im Folgenden spontan mit benachbarten Aldehyden (Aldol
Kondensation) oder mit anderen Lysyl-Gruppen (über eine „Schiffsche“-Base) kondensieren
unter Bildung von „intra“- und „inter“-molekularen Quervernetzungen der Collagen- und
Elastinketten (Rucker, R.B., et al.; 1998; Reiser, K., et al.; 1992).
Diskussion
- 147 -
KsuL kann immunologisch als extrazelluläres Protein nachgewiesen werden (siehe Abb. 3.46,
Spur 5). Ein 39 Aminosäuren langes Signalpeptid lässt sich vorhersagen und wurde in
weiterführenden Arbeiten durch Ansequenzieren des „reifen“ extrazellulären Proteins
nachgewiesen (pers. Mitteilung I.Koebsch und M.Kotasińska). In Ergänzung werden zwei
prozessierte Subformen gefunden (Abb. 3.46 Spuren 2 und 3). Wie durch Ansequenzierung
gezeigt wurde, besteht die größere Subform (ca. 30 kDa) aus den N-terminalen 312
Aminosäuren (ohne Signalsequenz), die kleinere (ca. 26 kDa) aus den C-terminalen 234
Aminosäuren (pers. Mitteilung I.Koebsch und M.Kotasińska).
Vergleichbares findet sich bei eukaryotischen Lysyl-Oxidasen. Sie werden als katalytisch
inaktive Proteine nach Abspalten des Signalpeptids ausgeschleust (Trackman, P.C., et al.;
1992). Die C-terminale (ca. 28-32 kDa) Domäne des Proteins wird anschließend durch die
Metalloendoproteinase Procollagen C-Proteinase proteolytisch abgetrennt (Uzell, M.I., et al.;
2001) und ist dann katalytisch aktiv. Für die N-terminale Domäne wird eine Schutzfunktion
durch Blockierung angenommen, zum Schutz vor unerwünschter Aktivität innerhalb der
Zelle. Ob die N-terminale Domäne von KsuL eine vergleichbare Blockierungsfunktion
besitzt, wird zu untersuchen sein. Eine mögliche Funktion als Bindedomäne und/oder eine
Chaperon-Funktion für die C-terminale Domäne wird vermutet. Ob die proteolytische
Trennung der N-terminalen und C-terminalen Domäne durch eine Metalloendoprotease
erfolgt, wird durch die Verwendung „nicht toxischer“ Proteaseinhibitoren im Medium zu
untersuchen sein. Bei verschiedenen extrazellulären Enzymen von Streptomyceten (z.B.
Cellulasen, Xylanasen und Chitinasen) wurden jeweils spezifische Proteasen identifiziert
(Fernández-Abalos, J.M., et al.; 2003; Schrempf, H. and Walter, S.; 1995; Blaak, H. and
Schrempf, H.; 1995).
KsuL ist ein Orphan-Protein, das sich nur in den bisher sequenzierten
Streptomycetenstämmen und einem Nocardia-Stamm findet; in allen weiteren
Actinomycetenstämmen ist kein KsuL-Homolog zu entdecken. Die im Rahmen von
Sequenzierungsprojekten identifizierten KsuL-Homologen aus S.avermitilis (BAC72171) und
Nocardia spec. JS614 (ZP_00656873) sind bisher nicht weiter untersucht worden (siehe
Anhang E). Vor kurzem wurden die Sequenzdaten von S.scabies veröffentlicht
(http://www.sanger.ac.uk/Projects/S_scabies/). Auch hier findet sich ein KsuL-Homolog mit
einer vermutlichen Länge von 586 Aminosäuren (Basen: 4945557-4943764). Diese drei und
KsuL zeigen untereinander besonders in der C-terminalen Hälfte sehr hohe
Aminosäureidentitäten, die der N-terminalen Hälfte sind geringer, im Bereich des
Signalpeptids sind kaum Ähnlichkeiten zu finden (siehe Anhang E). Der Translationsstart des
Homologs aus S.avermitilis ist falsch postuliert, der vermutlich richtige Translationsstart
beginnt am Methionin an der Position 9. Die genannten abgeleiteten Proteine unterscheiden
sich untereinander und zu KsuL vor allem durch Verkürzungen und eine hohe Divergenz im
Bereich vor der experimentell nachgewiesenen proteolytischen Schnittstelle von KsuL (KsuL:
ca. 245-334, siehe Anhang E). Ob dieser Abschnitt als Verbindungs-Domäne dient, die die
Beweglichkeit der N-terminalen zur C-terminalen Domäne bedingt, wird zu untersuchen sein.
- 148 -
Diskussion
Die im Bereich der proteolytischen Schnittstelle zwischen der N- und C-terminalen Domäne
liegenden
Aminosäuren
sind
konserviert,
die
Konsensussequenz
lautet
Pro−X−Gly−Lys/Arg−Ala−║−X−Val/Glu.
In „reifen“ eukaryotischen Lysyl-Oxidasen sind zehn Cysteine zu finden, die fünf DisulfidBrücken bilden und für die Stabilität der Konformation bedeutend sind (Williams, M.A. and
Kagan, H.M.; 1985). In KsuL finden sich vier Cysteine, jeweils zwei in der N-terminalen
(Cys 145 und Cys167), wie auch in der C-terminalen Domäne (Cys471 und Cys498). Diese
sind auch in den oben genannten KsuL-Homologen konserviert (siehe Anhang E). Durch
Verwendung reduzierender Agenzien konnte sowohl für die N- als auch für die C-terminale
Domäne jeweils eine Disulfid-Brücke nachgewiesen werden (eigene Ergebnisse, nicht
dargestellt, pers. Mitteilung H.Schrempf). Anders als bei den eukaryotischen Lysyl-Oxidasen
ist der Anteil der Lysin-Reste in KsuL sehr hoch. In KsuL sind 40 Lysine zu finden, im
Vergleich zu nur fünf bis sechs bei eukaryotischen Lysyl-Oxidasen (Kagan, M.H. and Li, W.;
2003).
Die Kupfer enthaltenden „semicarbazide-sensitive amine oxidases“ (SSAOs) besitzen
Topaquinon (2,4,5-Trihydroxyphenylalanin Quinon; TPQ) als Cofaktor (Janes, S.M., et al.;
1990); als Ausnahme konnte experimentell für die Lysyl-Oxidase aus der Ratte LysylTyrosyl-Quinon (LTQ) als Cofaktor identifiziert werden (Wang, S.C., et al.; 1996). Auf
Grund von Sequenzvergleichen wird auf das Vorhandensein von LTQ auch in allen weiteren
eukaryotischen Lysyl-Oxidasen und LOXL Proteinen geschlossen. Die an der Lysyl
Tyrosylquinon Cofaktorbildung beteiligten Tyrosin und Lysin sind an den Positionen Tyr518
und Lys468 in KsuL konserviert (siehe Abb. 3.45), ebenso an den entsprechenden Positionen
in den oben genannten KsuL-Homologen. Somit ist anzunehmen, dass KsuL wie die
eukaryotischen Lysyl-Oxidasen ein Lysyl-Tyrosyl-Quinon als Cofaktor trägt. In unserer
Arbeitsgruppe erfolgen zurzeit Untersuchungen zum Nachweis desselben (M.Kotasińska,
pers. Mitteilung).
Lysyl-Oxidasen gehören zur Gruppe der Kupfer enthaltenden Semicarbazid-sensitiven Amin
Oxidasen (SSAO, Jalkanen, S. and Salmi, M.; 2001). Pro Lysyl-Oxidase Molekül ist ein
Cu(II) Atom als Cofaktor relativ fest gebunden (Gacheru, S.N., et al.; 1990). Es wird
vermutet, dass die Bindung an je drei Histidine erfolgt. Das His-X-His-X-His Motiv ist in
KsuL wie auch den oben genannten Homologen konserviert und findet sich in KsuL an der
Position 441-445 (siehe Abb. 3.45). Cu(II) ist am Elektronentransfer vom und zum Sauerstoff
beteiligt, zur oxidativen Deaminierung der Peptidyl-Lysyl Gruppe und an der Quinon
Cofaktor Bildung (Rucker, R.B., et al.; 1998). Zurzeit laufen weiterführende Versuche zum
Nachweis des Cu(II) Cofaktors in unserer Arbeitsgruppe (I.Koebsch, pers. Mitteilung).
Weiterführende Studien zeigten auf, dass aus S.lividans isoliertes KsuL mit der Zeit zur
Aggregation neigt und als Niederschlag ausfällt; es bilden sich hierbei kovalent verknüpfte
Multimere, vermutlich zurückzuführen auf autokatalytische Quervernetzung der Monomere.
Vergleichbares wurde auch bei eukaryotischen Lysyl-Oxidasen gefunden (Romero-Chapman,
N, et al.; 1997; Bedell-Hogan, D., et al.; 1993; Kagan, H.M., et al.; 1979).
Diskussion
- 149 -
Wie eigene Versuche z.B. mit Hilfe des EGFP Expressionstestkonstruktes (S.lividans TK21
pOVG14) gezeigt haben (siehe Abb. 3.34 und Abb. 3.35, jeweils i und j) und in
weiterführenden Arbeiten in unserer Arbeitsgruppe bestätigt wurde (pers. Mitteilung
H.Schrempf), wird KsuL unabhängig von der Wachstumsphase und des verwendeten
Mediums produziert. Flussaufwärts von ksuL, getrennt durch einen 776 Bp langen
intergenischen Bereich, finden sich in derselben Leserichtung die Gene ksuC und ksuB. Im
intergenischen Bereich sind keine für einen Terminator typischen „inverted repeats“ zu
finden, wie flussabwärts von ksuL (siehe Anhang A und B). Die KsuL Synthese ist in den
∆ksuC und ∆ksuB Disruptionsmutanten im Vergleich zum Wildtyp und weiteren
Disruptionsmutanten reduziert (siehe Abb. 3.64). Somit ist zu vermuten, dass ksuL von einer
polycistronischen mRNA, beginnend vor ksuC, wie auch von einer monocistronischen
mRNA, mit einem Startpunkt im intergenischen Bereich zwischen ksuB und ksuL,
transkribiert wird. Die Medium- und Wachstumsphasen- unabhängige Produktion von KsuL
wird hierbei wahrscheinlich von der monocistronischen mRNA determiniert. Die Produktion
von KsuC und KsuB ist unter hohen Salzkonzentrationen deutlich erhöht, eine erhöhte
Transkription von KsuL unter Hochsalzbedingungen ist anzunehmen. Dies wurde in
Vorversuchen beobachtet (nicht dargestellt). In Bakterien stehen häufig die von einem Operon
determinierten Proteine in einem funktionellen Zusammenhang. Dieser ist jedoch für die zwei
cytoplasmatischen Aldo-Keto Reduktasen und der extrazellulären Lysyl-Oxidase KsuL nicht
zu erkennen.
Das von einem flussabwärts von kcsA gelegene offenen Leseraster orfI determinierte OrfI
wurde im Rahmen dieser Arbeit nur am Rande untersucht. Es sind weder Antikörper gegen
OrfI vorhanden, noch konnte eine Synthese des Proteins gezeigt werden. Die im Rahmen
dieser Arbeit hergestellte Diruptionsmutante ∆orfI zeigt keine Unterschiede im Phänotyp zum
Wildtyp. Eine Auswirkung auf die Resistenz gegen Chloramphenicol, determiniert vom
flussabwärts von orfI in gleicher Leserichtung gelegenen cmlR, ist nicht zu erkennen. Es ist zu
vermuten, dass kcsA und orfI auf einem Operon liegen und von einer polycistronischen
mRNA mit einem Transkriptionsstart vor kcsA determiniert werden. Jürgen Ritz konnte in
Transkriptionsstudien weder für kcsA noch für orfI ein Transkriptionsprodukt nachweisen
(J.Ritz, pers. Mitteilung). Im S.coelicolor A3(2) Genomprojekt wurde ein um 11
Aminosäuren früherer Translationsstart postuliert (SCO7661), als der vermutlich richtige
(siehe Anhang A). Analysen des GC Gehaltes lassen diesen jedoch sehr unwahrscheinlich
erscheinen, auch ist flussaufwärts von diesem keine potentielle Shine Delgarno Region zu
finden. OrfI ist ein vermutlich cytoplasmatisches Protein, das über die vollständige Länge in
kurzen Motiven Ähnlichkeiten zur Dihydrofolat-Reduktase Superfamilie (DHFR, SSF53597)
zeigt. Dihydrofolat-Reduktasen katalysieren die Reduktion von Dihydrofolat zu
Tetrahydrofolat, das als Cofaktor z.B. an der de novo Synthese von Glycin, Purinen und
Deoxythymidin-Phosphat beteiligt ist. OrfI enthält einige Motive der C-terminalen Domäne
bakterieller bifunktionaler Deaminasen-Reduktasen, die am zweiten Schritt der
- 150 -
Diskussion
Riboflavinsynthese aus GTP beteiligt sind (Richter, G., et al.; 1997), der Vorstufe von FAD.
Es ist deshalb vermutet worden, dass OrfI eine Modifikation des Flavin Cofaktors von KsuF
durchführen könnte. Da nur FAD als Cofaktor gefunden wurde, ist dies auszuschließen. Die
Funktion von OrfI bleibt unter den getesteten Bedingungen obskur, auch ist kein funktioneller
Zusammenhang mit KcsA oder einem weiteren der in dieser Arbeit untersuchten Proteine zu
erkennen.
Im Rahmen dieser Arbeit wurde ksuB und der für die C-terminale Hälfte determinierende
Abschnitt von ksuC sequenziert. KsuB wurde in E.coli als His-Tag Protein überproduziert,
aufgereinigt und zur Herstellung von Antikörpern verwendet. In Zusammenarbeit wurde von
Ralf Steger ksuC mit Hilfe einer S.lividans Charon 35 Genom-Phagenbank vervollständigt,
KsuC als His-Tag Protein aus E.coli aufgereinigt und zur Herstellung von Antikörpern
verwendet. Sowohl KsuC als auch KsuB sind Mitglieder der Aldo-Keto Reduktase (AKR)
Superfamilie, deren Mitglieder reduzieren als Oxidoreduktasen Aldehyd- oder Ketogruppen
zu primären oder sekundären Alkoholgruppen. Als Cofaktoren verwenden sie NADPH,
seltener NADH, wie z.B. AKR1C19 aus der Maus, das „in vitro“ sowohl NADPH als auch
NADH gleichwertig als Cofaktor verwenden kann aber „in vivo“ vermutlich ausschließlich
NADH verwendet (Ishikura, S., et al.; 2005).
Im Rahmen dieser Arbeit erfolgten keine Arbeiten zur Enzymaktivität oder zur Identifizierung
des Cofaktors von KsuC und KsuB. Als Substrate der Aldo-Keto Reduktasen dienen
aliphatische und aromatische Aldehyde und Ketone wie Zucker, Steroide, Prostaglandine und
Xenobiotika (Jez, J.M., et al.; 1997). Die Substratspezifität ist gering. So ist die Ratten-Leber
Aflatoxin-Dialdehyd Reduktase (AKR7A1) in der Lage, neben Aflatoxin B1 Dialdehyd auch
eine Reihe weiterer Aldehyde und Diketone zu reduzieren. Hierbei zeigt sich eine sehr hohe
Affinität zu den strukturell sehr unterschiedlichen Succinat-Semialdehyd, 2-CarboxyBenzalaldehyd und 9,10-Phenanthrenquinon (Kozma, E. et al.; 2002; Kelly, V.P., et al.; 2000;
Ellis, E.M. and Hayes, J.D.; 1995). Wie für „konjugierte Polyketon-Reduktasen“ aus
verschiedenen Pilzstämmen gezeigt wurde, besitzen auch diese eine sehr große
Substratdiversität, mit strikter Stereospezifität (Hidalgo, A.-R. G. D., et al.; 2001). Eine strikte
Stereospezifität des verwendeten Substrates ist typisch für NAD(P)H abhängigen Enzymen,
wie schon 1953 für die Alkohol-Dehydrogenase gezeigt wurde (Fisher, H.F., et al.; 1953).
Auf Grund der sehr geringen Substratspezifität der Aldo-Keto Reduktasen und der
Möglichkeit, sowohl KsuC als auch KsuB als His-Tag Proteine in S.lividans-Transformanten
zu produzieren und als lösliches Protein aufzureinigen, sollte ein Nachweis und Untersuchung
einer enzymatischen Aktivität und des Cofaktors möglich sein.
Es konnten keine Hinweise gefunden werden, dass KsuC und KsuB als Oligomer vorliegen.
Die meisten Mitglieder der Aldo-Keto Reduktase Superfamilie sind monomere Proteine. Es
finden sich jedoch auch Dimere, wie AKR7A1 und AKR7A4 und vermutlich die gesamte
AKR7-Familie der Aldo-Keto Reduktasen (Kozma, E., et al.; 2002) und Tetramere, wie
AKR6A2, der β-Untereinheit der spannungsabhängigen Kalium-Kanäle (Gulbis, J.M., et al.;
Diskussion
- 151 -
2000). YDHF, eine Aldo-Keto Reduktase aus E.coli unbekannter Funktion wurde als Trimer
kristallisiert (Pdb:1og6 Chain a-c, keine Publikation). Bisher ist die strukturelle Aufklärung
von einer Reihe von Aldo-Keto Reduktasen gelungen. Sowohl KsuC als auch KsuB zeigen
die größten Übereinstimmungen zu Proteinen dieser Familie mit bekannter Struktur zu einer
Aldo-Keto Reduktase aus E.coli (YDHF, Pdb:1og6 Chain a-c). Aus einem Sequenzvergleich
zu YDHF (siehe Abb. 3.48) wurden sowohl für KsuC wie auch KsuB, einschließlich des
Cofaktors NADP, die Kristallstrukturen errechnet und in Abb. 3.49 a-d) dargestellt. Eine
enzymatische Aktivität für dieses Protein ist bisher nicht publiziert. YDHF wurde als Trimer
kristallisiert und die abgeleitete Struktur in die Datenbank gestellt. Da trotz Ankündigung
(2003) bisher keine Publikation zu YDHF veröffentlicht wurde (Jeudy, S., et al.; to be
published), erscheint die Korrektheit der für Mitglieder der Aldo-Keto Reduktasen
einzigartigen trimeren Struktur fraglich.
Wie zuerst für die menschliche Aldose-Reduktase nachgewiesen (AKR1B1; Rondeau, J.M.,
et al.; 1992; Wilson, D.K., et al.; 1992), besitzen die Mitglieder der Aldo-Keto Reduktase
Superfamilie ein β-8/α-8-Fass (TIM Barrel) als Tertiärstruktur (Farber, G.K. and Petsko,
G.A.; 1990), das sich auch in KsuC und KsuB findet (siehe Abb. 3.48 und 3.49).
KsuB zeichnet sich im Vergleich zu YDHF durch den Besitz einer 17 Aminosäuren langen
Insertion (Aminosäuren 186-202 von KsuB) im Anfangsbereich der α-6-Helix aus, für die
eine antiparallele β/β-Faltblattstruktur postuliert wird (siehe Abb. 3.48 und Abb. 3.49 a).
Diese liegt im Kontaktbereich der Untereinheiten des postulierten Trimers und lässt die
Wahrscheinlichkeit einer Oligomerisierung von KsuB gering erscheinen (siehe Abb. 3.49 c).
Die putative Ausbildung von neun Wasserstoffbrücken, hiervon sieben zwischen den
antiparallelen β-Faltblattstrukturen, spricht für die Korrektheit der postulierten antiparallelen
β/β-Faltblattstruktur (erstellt mit Deep View/Swiss PDB Viewer).
Die an der Cofaktorbindung beteiligten Aminosäuren sind aus einer Reihe von
Röntgenstrukturanalysen von Mitgliedern der Aldo-Keto Reduktase Familie bekannt. In
Abb. 3.48 sind die über Salzbrücken und Wasserstoffbrückenbindungen beteiligten, der
Aldehyd-Reduktase (ALR1), der Aldose-Reduktase (ALR2) und des „Fibroblast
Wachstumsfaktor induzierten Proteins“ (FR-1), eingetragen (El-Kabbani, O., et al.; 1998, ElKabbani, O., et al.; 1997; Wilson, D.K., et al.; 1993; Wilson, D.K., et al.; 1995). Von den 17
an der Cofaktor-Bindung beteiligten Aminosäuren sind acht in YDHF, sieben in KsuB und
sechs in KsuC konserviert. Alle Aminosäuren, die an der Bindung des katalytisch aktiven
Nicotinamid Teils von NADP beteiligt sind, sind sowohl in KsuB, als auch in KsuC
vollständig konserviert (KsuB: Asp47, Ser151, Asn152 und Gln175; KsuC: Asp48, Ser158,
Asn159 und Gln182). Auf Grund der Kristalldaten wird postuliert, dass der katalytische
Mechanismus der Aldo-Keto Reduktasen auf einem stereospezifischen Transfer des 4-pro-R
Wasserstoff des C-4 des Nicotinamids von NADPH zum C-Atom der Carbonylgruppe des
Substrates basiert, gefolgt von der Protonierung des Sauerstoffes der Carbonylgruppe des
Substrates durch eine Protonen Donor Gruppe. Tyr50 und Lys80 bilden eine
Wasserstoffbrücke mit der Ammonium Seiten-Kette des Lys80 in ALR1 aus, welches eine
- 152 -
Diskussion
Salz-Brücke mit Asp45 ausbildet. Diese sind am Protonen-Transfer beteiligt (El-Kabbani, O.,
et al.; 1998) und sowohl in KsuC wie auch KsuB konserviert (KsuB: Tyr52, Lys82 und
Asp47; KsuC: Tyr53, vermutlich Lys86 und Asp48). Für beide Proteine ist somit ein
vergleichbarer katalytischer Mechanismus anzunehmen (siehe Abb. 3.48.). Eigene
Auswertung der Kristalldaten von YDHF ergaben, das Gly264 eine Wasserstoffbrücke zur
Phosphatgruppe und Gly213 eine zum Pyrophosphat von NADP ausbildet (Deep View/Swiss
PDB Viewer). Gly264 ist in KsuC (Gly257) und KsuB (Gly275) konserviert, wie auch
Gly213 in KsuC (Gly211); in KsuB findet sich an dieser Position ein Glutamin (Gln223). Mit
Hilfe der putativen Kristalldaten kann nicht bestimmt werden, ob NAD oder NADP als
Cofaktor für KsuC und KsuB verwendet wird.
Die Synthese von KsuC und KsuB wird vermutlich von einer polycistronischen mRNA
determiniert, mit einem Transkriptionsstart vor ksuC; ksuC und ksuB sind durch einen
intergenischen Bereich von 55 Bp Länge getrennt. Es konnten keine Hinweise gefunden
werden, dass in diesem Bereich ein Promoter zu finden ist. Dies konnte auch mit Hilfe der
∆ksuC und ∆ksuB Disruptionsmutanten gezeigt werden. Weder KsuC noch KsuB konnten in
der ∆ksuC Disruptionsmutante nachgewiesen werden. In der ∆ksuB Disruptionsmutante ist
KsuC vergleichbar dem Wildtyp nachweisbar (siehe Abb. 3.63 a-d). Beide
Disruptionsmutanten zeigen bei Wachstum auf Minimalmediumplatten eine erhöhte
Produktion von Undecylprodigiosin (RED), jedoch keine Veränderung bezüglich der
Produktion von Actinorhodin (Act) (siehe folgendes Kapitel: UndecylprodigiosinÜberproduktion in Mutanten). Wie auch bei KsuF gefunden, ist die Synthese von KsuC und
KsuB bei Wachstum in Minimalmedium mit hohen Salzkonzentrationen deutlich erhöht. Die
Synthese ist jeweils unabhängig davon, ob NaCl oder KCl verwendet wurden (siehe
Abb. 3.10 und Abb. 3.11, jeweils b und c) und wird in einem der folgenden Kapitel
besprochen (siehe: Synthese von drei Proteinen unter verschiedenen physiologischen
Bedingungen).
Diskussion
- 153 -
Das in unser Artbeitsgruppe entdeckte Kalium Kanalprotein KcsA (Schrempf, H. et al.; 1995)
ist, seit der gelungenen Kristallisation und Aufklärung der Struktur, der Archetyp aller
Kanalproteine (Doyle, D.A., et al.; 1998). Vorwiegend für die Strukturaufklärung von KcsA
wurde im Jahre 2003 der Nobelpreis an R. MacKinnon im Bereich Chemie vergeben. Wie
Sequenzvergleiche zeigen, ist KcsA mit seiner geringen Länge und dem im Verhältnis zu
anderen Kanalproteinen sehr kurzen cytoplasmatischen C-terminalen Teil einzigartig. Es
konnte im Rahmen der Diplomarbeit in Hybridisierungsexperimenten an chromosomalen
DNA’s verschiedener Streptomycetenstämme nach „Puls Feld“ Gelelektrophorese gezeigt
werden, dass kcsA nur in Mitgliedern der S.violaceoruber Familie (S.violaceoruber, S.lividans
und dem getesteten S.coelicolor A3(2) Derivat M145) vorhanden ist.
Die gegen KcsA vorhandenen Antikörper (H.Splitt) waren, da sie nur eine verhältnismäßig
geringe Spezifität gegen KcsA besaßen und sowohl gegen die Proteine der
Membranfraktionen aus E.coli als auch S.lividans WT sehr starke unspezifische
Kreuzreaktionen zeigten, nur bedingt zu gebrauchen. Da die membrandurchspannenden Teile
eines Membranproteins häufig nur eine geringe Antigenität besitzen, erfolgte die
Antikörperherstellung gegen das cytoplasmatische C-terminale Ende von KcsA. Hierbei
zeigte sich, dass die vorletzte „Charge“ eine deutlich größere Reaktion gegen KcsA besaß als
die zuletzt gelieferte. Mit nur 6,3 kDa ist das zur Immunisierung eingesetzte Peptid
verhältnismäßig klein. Wie in zahlreichen Versuchen gezeigt wurde, besitzen kurze
Peptidfragmente eine geringere Antigenität als große Proteine (The QIAexpressionistTM,
Qiagen, Hilden). Die vorgefundenen Probleme sind vermutlich hierauf zurückzuführen.
Es ist nicht gelungen, KcsA im Wildtyp oder in S.lividans Transformanten, die kcsA auf
einem Konstrukt trugen, in der Membranfraktion mit Hilfe von Antikörpern („Western Blot“)
nachzuweisen. Auch in Transkriptionsstudien war weder im Wildtyp noch in kcsA auf einem
Konstrukt tragenden Transformanten ein entsprechendes Transkriptionsprodukt zu finden
(J. Ritz, pers. Mitteilung). In den EGFP Insertionsmutanten, die die Synthese eines KcsAEGFP Fusionsproteins ermöglichen sollten, ist weder mit Hilfe von „Western Blot“ noch
durch Fluoreszensmessungen eine Produktion von KcsA-EGFP nachweisbar. Auch in den
KcsA-EGFP Produktions-Test Transformante S.lividans TK21 pOVG11 war unter keiner der
getesteten Bedingungen eine EGFP-Produktion zu finden (siehe Abb. 3.34. und Abb. 3.35,
jeweils c und d). Ein Nachweis im „Western Blot“ ist nur in den S.lividans pOVE31 und
pOVE51 Produktions-Transformanten, die die Synthese eines N-terminalen His-Tag KcsA
ermöglichen, erfolgreich (siehe Abb. 3.21). Es ist unklar, ob die Synthesesrate von KcsA zu
gering ist, um KcsA mit Hilfe von Antikörpern nach Transfer auf Membranen nachzuweisen
oder ob der KcsA-Transfer auf Grund der Bildung nicht auflösbarer hochmolekularer
Aggregate („Cluster“) verhindert wird.
Ein Nachweis von KcsA mit Hilfe der in dieser Arbeit hergestellten Antikörper im Wildtyp ist
bisher ausschließlich elektronenmikroskopisch möglich (Hegermann, J., et al.; 2006, im
Druck). KcsA liegt hierbei in „Clustern“ vor und ist im S.lividans WT nur in ca. einer von
fünfzig angeschnittenen Hyphen nachweisbar, jedoch nicht in den in dieser Arbeit
- 154 -
Diskussion
hergestellten Deletionsmutanten. In Zusammenarbeit mit Jan Heggemann konnte KcsA in den
S.lividans pOVE31 Transformanten ebenfalls in „Clustern“ nachgewiesen werden. Sie sind
jedoch anscheinend größer und in nahezu jedem Schnitt einer Hyphe nachweisbar. Die
S.lividans pOVE3 Transformante als Kontrolle zeigt eine dem S.lividans Wildtyp
vergleichbar geringere Anzahl (nicht dargestellt). Jan Hegermann konnte in weiterführenden
Arbeiten mit Hilfe von „Energy-filtering-TEM“ (EFTEM) für die ∆kcsA Mutante, gegenüber
dem Widtyp, eine ca. 30 % geringere Akkumulation von Cäsium-Ionen in der Zelle
nachweisen (Hegermann, J., et al.; 2006, im Druck).
Der S.lividans Wildtyp und die ∆kcsA-Disruptionsmutante unterscheiden sich weder
bezüglich des Wachtums und der Differenzierung, noch finden sich Unterschiede im
Wachstumsverhalten bei Verwendung von unterschiedlichen NaCl- und KCl-Konzentrationen
im Medium. Auch Stämme, die zusätzlich zum chromosomalen kcsA weitere Kopien auf
einem Konstrukt tragen und die His-KcsA Produktionstransformanten S.lividans TK21
pOVE31 und pOVE51, zeigen keine Unterschiede zu den entsprechenden Kontrollen.
Im S.coelicolor A3(2) Genom finden sich neben kcsA eine Reihe weiterer Gene für putative
Kalium-Transportproteine. So findet sich ein weiteres Kanalprotein (SCO7196), ein
vollständiges Kalium-Transport ATPase A Operon (SCO3719-3716), Gluthathion regulierte
Kalium-Efflux-System Proteine der KefB- (SCO3279 und SCO5782) und der KefC-Familie
(SCO3602 und SCO3826), zwei Kupfer/Kalium-Transport ATPase A Proteine (SCO0860 und
SCO6460), zwei auf einem Operon liegende TrkA Kalium-Aufnahme Proteine (SCO5876
und SCO5875) und ein Kalium-Efflux-System Protein (SCO6958), das hohe Identitäten zu
zwei Proteinen aus Rhizobium meliloti zeigt. Des Weiteren ist eine große Anzahl von weiteren
abgeleiteten Kation-Efflux Proteinen und ATPasen zu finden. Es ist zu vermuten, dass diese
in der Lage sind, den Verlust von KcsA durch Disruption vollständig zu kompensieren.
KcsA findet sich nach Produktion in E.coli als Tetramer, das sich durch eine
außergewöhnliche Stabilität gegenüber Detergenzien und Hitze auszeichnet. Längeres
Erhitzen von KcsA über 80°C in SDS-haltigem Probenpuffer führt zum Zerfall des Tetramers
in Monomere (Meuser, D., et al.; 2001, siehe auch Abb. 3.5 a, Spuren 1-3 und 4-6).
Mutationen im Bereich des Selektivitätsfilters (GYG) von KcsA haben einen Einfluß auf die
Stabilität des Tetramers gegenüber Hitze (Meuser, D., et al.; 2001). KcsA ist frei von
Cysteinresten. Die Gabe von reduzierenden Agenzien hat somit keinen Einfluss auf die
Stabilität des Tetramers. Wie im Rahmen dieser Arbeit gezeigt wurde, zeigt KcsA nach
Produktion als His-Tag Protein in S.lividans (siehe z.B. Abb. 3.21 a, Spuren 3 und 4) und
nach Synthese mit Hilfe des Baculovirus-Systems in Insektenzellen als His-Tag Protein oder
als Protein „nativer“ Länge ein vergleichbares Verhalten.
KcsA inseriert sich von selbst innerhalb der kürzesten messbaren Zeit (<30’’) nach Synthese
vollständig als Monomer in die Membran (van Dalen, A., et al.; 2000). Die elektrische
Komponente des „proton motive force“ (pmf) wird für die korrekte Tetramerisierung in der
Membran benötigt. Die Integration des Monomers in die Membran ist unabhängig von
aktiven ATP verbrauchenden Systemen wie z.B. SecA (van Dalen, A., et al.; 2000). Dies
Diskussion
- 155 -
konnte auch im Rahmen dieser Arbeit gezeigt werden. Es wurde versucht, KcsA, His-KcsA,
und KcsA und His-KcsA als EGFP-Fusionsprotein (mit und ohne N-terminalen Signalpeptid)
mit Hilfe des Baculovirussystems in Insektenzellen zu produzieren und die Kanalaktivität mit
der „Patch Clamp“ Methode zu messen (in Zusammenarbeit mit K.Hill, nicht im Ergebnisteil
dargestellt). Nach Herstellung der Konstrukte und Transfektion zeigte sich, das diese
Versuche nicht erfolgreich waren. Die Translokation von KcsA und der entsprechenden
Derivate in die äußere Membran gelang nicht. KcsA (und Derivate) konnte sowohl nach
Produktion mit als auch ohne Signalpeptid ausschließlich in den inneren Zellmembranen der
Insektenzellen nachgewiesen werden, das Signalpeptid war (wenn vorhanden) nicht
abgeschnitten. Des Weiteren wurde vermutlich im C-terminalen Endbereich von KcsA eine
Proteaseschnittstelle gefunden, KcsA und die Derivate lagen jeweils C-terminal verkürzt vor;
mit Hilfe von Floreszenzmikroskopie wurde gezeigt, dass EGFP im Cytoplasma lokalisiert
und nicht Membran-assoziiert vorlag (nicht dargestellt). Eine Kanalaktivität konnte jeweils
nicht nachgewiesen werden (pers. Mitteilung K.Hill). Weitere Arbeiten wurden aufgegeben.
Bis zum heutigen Zeitpunkt finden sich keine Veröffentlichungungen über Versuche, KcsA
mit Hilfe des Baculovirus-Systems in Insektenzellen produzieren und die Kanalaktivität mit
Hilfe der „Patch Clamp“-Methode oder nach Aufreinigung und Rekonstitution mit Hilfe
„planarer Bilyer-Systeme“ zu messen. Es ist zu vermuten, dass KcsA nach Synthese mit Hilfe
des Baculovirussystems nicht funktionell ist.
Das von cmlR determinierte Cloramphenicol-Resistenzprotein CmlR wurde in dieser Arbeit
nur marginal untersucht. CmlR wurde in früheren Arbeiten in unserer Arbeitsgruppe entdeckt
und als Chloramphenicol-Resistenzprotein charakterisiert. Es schleust das Antibiotikum
Chloramphenicol als membranständiges Transportprotein aus (Dittrich, W., et al.; 1991).
Antikörper gegen CmlR sind nicht vorhanden. Wie im Rahmen dieser Arbeit mit Hilfe der
S.lividans pOVG12 Transformante, die das EGFP-CmlR-Produktionstestkonstrukt trägt,
gezeigt wurde, wird die CmlR-Synthese durch die Gabe von Chloamphenicol induziert. In
Medien ohne Chloramphenicol ist keine oder nur eine marginal über der Nachweisgrenze
liegende Produktion von EGFP nachweisbar. Nach Gabe von Chloramphenicol ist eine starke
Fluoreszenz zu erkennen (Abb. 3.34 und 3.35, jeweils e und f und Abb. 3.36 a-d, i und j). Die
Synthese von CmlR wird somit, wie für andere Resistenzproteine beschrieben, durch das
Antibiotikum induziert (Wright, G.D.; 2005). Die S.lividans pOVG12 Transformante zeigt,
bei Gabe von Chloramphenicol im Medium, eine deutlich verringerte Wachstumsrate im
Vergleich zu anderen Stämmen; nach ca. vier Tagen Wachstum als Schüttelkultur wird ein
vergleichbares Zellvolumen erreicht. Es ist zu vermuten, dass der in hoher Kopienzahl
vorliegende konstruktdeterminierte Promoter-Bereich von cmlR, das für die Transkription von
cmlR verantwortliche Regulatorprotein abfängt. Dies hat eine verringerte Synthese des
chromosomal determinierten Resistenzproteins zur Folge. Flussaufwärts von cmlR finden sich
orfI und kcsA, die jeweils in identischer Leserichtung zu cmlR vorliegen. Es ist in diesem
Abschnitt kein potentieller Terminator zu erkennen. Zwischen orfI und cmlR liegt ein 238 Bp
langer intergenischer Bereich. Es wurde postuliert, das CmlR sowohl von einer
- 156 -
Diskussion
polycistronischen mRNA mit einem Transkriptionsstartpunkt vor kcsA, als auch einer
monocistronischen mRNA mit einem Startpunkt im intergenischen Bereich zwischen orfI und
cmlR, determiniert würde. Jürgen Ritz führte in seinen Arbeiten zu kcsA auch
Transkriptionsstudien zu cmlR durch. Er konnte bei Arbeiten mit S.lividans WT und den in
dieser Arbeit hergestellten S.lividans NI pOV001/005/006/007 Transformanten unter
Chloramphenicol-Induktion ein monocistronisches cmlR-Transkript nachweisen. Für die
postulierte polycistronische mRNA gelang dies nicht (Jürgen Ritz, pers. Mitteilung). Dies
entspricht den zu den ∆kcsA und ∆orfI-Disruptionsmutanten erhaltenen Ergebnissen. Beide
Mutanten zeigten im Vergleich zum Wildtyp keinen Unterschied in der Resistenz gegen
Chloramphenicol. Die cmlR Transkription wird durch die Anwesenheit von Chloramphenicol
induziert und CmlR wird unter den getesteten Bedingungen primär von einer
monocistronischen mRNA determiniert.
Diskussion
- 157 -
4.2. Synthese von drei Proteinen unter verschiedenen physiologischen Bedingungen
Wie in dieser Arbeit gezeigt wurde, ist die Synthese von KsuF abhängig vom Vorhandensein
des tsr-Gens und der Synthese des hiervon determinierenden Thiostreptonresistenzproteins
Tsr aus Streptomyces azureus (siehe Ergebnisse 3.3.5). In Stämme, die kein tsr-Gen enthalten
(S.lividans 66 WT und S.coelicolor M145), ist die Synthese von KsuF auch unter
Thiostrepton-Gabe nicht nachweisbar. Eine Beteiligung von Konstrukt-determinierten Genen
konnte durch die Verwendung von Stämmen, die das tsr-Gen ins Chromosom integriert hatten
(S.coelicolor M145 sigH:tsr und S.colicolor J1984 sigF:tsr) ausgeschlossen werden.
Thiostrepton wird für die Transkription des tsr-Gens und die nachfolgende Synthese des
Resistenzproteins benötigt. Es kann nicht vollkommen ausgeschlossen werden, dass das
Thiostreptonresistenzprotein zusammen mit Thiostrepton für die Induktion der KsuFSynthese benötigt wird. Dies erscheint jedoch unwahrscheinlich, da Thiostrepton nicht in der
Lage ist, an A1067 O2methylierte 23S mRNA zu binden (Thompson, C.J., et al.;1982b).
In Zusammenarbeit führte Jürgen Ritz in seinen mRNA Arbeiten zu kcsA auch Arbeiten zu
ksuF durch. Während im S.lividans Wildtyp kein ksuF-Transkript nachzuweisen war, konnte
in S.lividans 66 pJO1 und S.lividans NI pOV005 Transformanten, beides Konstrukte, die ksuF
tragen, eine extrem hohe Menge eines monocistronischen ksuF-Transkriptes gefunden
werden. Es wurden keine Versuche mit einer der S.lividans Wildtyp Transformanten
durchgeführt, die ein tsr haltiges Konstrukt ohne ksuF tragen. Nach den Produktionsdaten zu
schließen, wäre hier ein ksuF-Transkript gefunden worden. Die Transkriptions- und
Produktionsstudien zeigen, dass das Vorhandensein des Tsr-Proteins die Transkription von
ksuF bedingt. Es konnten in der Literatur keine Beispiele gefunden werden, dass das
Thiostreptonresistenzprotein zur Transkription von Genen führt. Dieses Phänomen wurde
auch für andere Resistenzproteine, die eine Modifikation der 16S bzw. 23S rRNA
durchführen, nicht beschrieben. Die in dieser Arbeit gefundenen Erkenntnisse sind neu.
Das von Streptomyces azureus synthetisierte Thiostrepton (multizyklisches Thiazol PeptidAntibiotikum) hemmt die Peptid Synthese, indem es am L11-23S rRNA Komplex bindet, die
Bindung von EF-G am Ribosom verhindert (Lentzen, G., et al.; 2003; Cameron, D.M., et al.;
2002) und so die Termination der Translation bewirkt (übersichtlich dargestellt in: Bowen,
W.S., et al.; 2005). Des Weiteren inhibiert es die prokaryotischen Terminationsfaktoren RF1,
RF2 sowie RelA (Brot, N., et al.; 1974; Haseltine, W.A., et al.; 1972). Trotz jahrzehntelanger
Forschung ist die genaue Ursache der Peptidsynthese-Inhibition durch Thiostrepton noch
nicht verstanden. Das von tsr determinierte Thiostreptonresistenzprotein von S.azureus (Bibb,
M.J., et al.; 1985; Thompson, C.J., et al.; 1982a) ist eine O2Methylase und methyliert das
Adenosin 1067 der 23S rRNA bevor es in die 50S ribosomale Untereinheit eingebaut wird
(Bechthold, A. and Floss, H.G.; 1994; Cundliffe, E.; 1989). Thiostrepton induziert die
Synthese des Thiostreptonresistenzproteins (Janssen, G.R. and Bibb, M.J.; 1990) und tsr wird
seit langem als Resistenz zur Selektion in Streptomyceten Vektoren eingesetzt; es ist zurzeit
der gebräuchlichste Marker.
- 158 -
Diskussion
Im S.coelicolor A3(2) Genom-Sequenzierungsprojekt (Bentley, S.D., et al.; 2002) konnte kein
tsr Homolog gefunden werden. Somit ist anzunehmen, dass die durch das Resistenzprotein
induzierte Synthese von KsuF artifiziell ist. Es ist zu vermuten, dass die durch das
Thiostreptonresistenzgen durchgeführte Methylierung des Adenin 1067 der 23S rRNA und
u.U. hierdurch variierte Konformation des Ribosoms oder des ribosomalen Proteins L11, die
Translation regulatorischer Proteine oder Sigma-Faktoren beeinflusst, die nachfolgend die
Transkription von ksuF ermöglichen. Außer den präsentierten eigenen Daten sind keine
Studien zu diesem Effekt bekannt. Neben der spezifischen Methylierung in der 23S rRNA
wurden bisher keine weiteren Stellen gefunden, die durch das Tsr-Protein methyliert werden
und so die Transkription von ksuF bewirken könnten. Durch weiterführende Studien wie 2D
Gelelektrophoresen und Microarraystudien, mit S.lividans Wildtyp, tsr und tsr unter z.B.
einem konstitutiven Regulator tragenden S.lividans Transformanten als Vergleich, sollte es
gelingen, die für die Synthese von KsuF beteiligten Proteine zu identifizieren.
Es wird für Thiostrepton und weiteren komplexen Thiopeptiden die Funktion als Hormon
vermutet (Chiu, M.L., et al.; 1999). Durch die Gabe von „sublethalen“ Konzentrationen von
Thiostrepton (<10-9 M) wird in S.lividans die Synthese von 17 Proteinen induziert und von 4
reprimiert (Chiu, M.L., et al.; 1999, Holmes, D.J., et al.; 1993, Murakami, T. et al.; 1989).
Nur die von tipA determinierten zwei „in-frame“ Translationsprodukte TipAL und TipAS
(werden hierbei als ein Protein gezählt) wurden identifiziert und im Folgenden genauer
charakterisiert. Die N-terminale Domäne von TipAL ist ein Transkriptions-Aktivator der
MerR Familie. TipAS ist um die N-terminale Domäne verkürzt und besteht nur aus der Cterminalen Domäne von TipAL, die in der Lage ist, Thiostrepton kovalent zu binden (Chiu,
M.L., et al.; 1996). TipAL bindet als Dimer an einem Operatorbereich des eigenen Promoters
ptipA (Kahmann, J.D., et al.; 2003), induziert unter Thiostrepton die Produktion des eigenen
Proteins und weiteren sieben, zwei werden reprimiert (Chiu, M.L., et al.; 1999).
Die Regulation der 11 weiteren durch Thiostrepton induzierten (9) oder reprimierten (2)
Proteine ist unklar und nicht untersucht (Chiu, M.L., et al.; 1999). Alle oben genannten
Arbeiten zur Thiostrepton abhängigen Induktion erfolgten an S.lividans Transformanten, die
tsr tragende Konstrukte enthielten. Es ist nicht auszuschließen, dass deren Translation, wie
bei KsuF gezeigt, alle oder teilweise vom Vorhandensein des Thiostreptonresistenzproteins
abhängig sind. Dies wird in weiteren Studien zu untersuchen sein auch ob eines dieser 11
Proteine die beobachtete Transkription von ksuF bedingt.
In den S.lividans ksuF-EGFP Fusions-Insertionsmutanten konnte keine Synthese des KsuFEGFP nachgewiesen werden. Dies ist mit diesen Erkenntnissen auch nicht zu erwarten, da die
Produktion von KsuF abhängig von der Synthese des Thiostreptonresistenzproteins ist. Auf
Grund von Zeitmangel unterblieb die Transformation eines Thiostreptonresistenzgen
tragenden Vektors.
Diskussion
- 159 -
Wie dargelegt wurde, ist die Synthese von KsuC, KsuB und KsuF abhängig von der erhöhten
NaCl- bzw. KCl-Konzentration, für die Produktion von KsuF ist zusätzlich das
Vorhandensein des Thiostreptonresistenzproteins notwendig. In Gegenwart hoher
Konzentrationen von NaCl oder KCl erfolgt eine deutlich erhöhte Synthese dieser Proteine,
mit einer starken Erhöhung der Produktion ab einer Salzkonzentration von ca. 150-200 mM
und Erreichen der maximalen um ca. 200-250 mM. Transkriptionsstudien zu ksuF
untermauern dieses Ergebnis mit einer deutlich erhöhten mRNA-Produktion unter hohen
NaCl- und KCl-Konzentrationen (J. Ritz, pers. Mitteilung). Die Gabe von 10 % (300 mM),
15 % (450 mM) Sucrose hat keinen Einfluss auf die Synthese von KsuC, KsuB oder KsuF,
durch 20 % (600 mM) Sucrose wird das Wachstum inhibiert. Da sich die Synthese von KsuC,
KsuB und KsuF unter hohen Salzkonzentrationen jeweils identisch verhält, ist anzunehmen,
dass die Produktion der gleichen Regulation unterliegt und die erhöhte Synthese von KsuC
und KsuB unter Hochsalz ebenfalls Transkriptions-abhängig ist.
Die Synthese von KsuC, KsuB und KsuF unterscheidet sich in S.coelicolor M145-Mutanten,
bei denen jeweils das chromosomale Gen für einen Sigma-Faktor (σH bzw. σF) zerstört
worden war, nicht von denen des S.coelicolor M145 und des S.lividans Wildtyps. Der von
sigF determinierte Sigma-Faktor σF ist in einem der letzten Schritte der Sporenreifung und der
Sporen-Pigmentbildung involviert und nicht an der Osmoregulation beteiligt (Kormanec, J.,
pers. Mitteilung; Potuckova, L., et al.; 1995). Die erhöhte Produktion einiger SigH (σH)
regulierter Proteine erfolgt bei Anwesenheit von NaCl/KCl (200-300 mM), wird jedoch nicht
durch Sucrose beeinflusst (J. Kormanec, pers. Mitteilung; Kormanec, J. and Sevcikova, B.;
2003; Kormanec, J. and Sevcikova, B.; 2002a; Viollier, P.H., et al.; 2003a; Kelemen, G.H., et
al.; 2001; Sevcikova, B., et al.; 2001; Kormanec. J., et al.; 2000). Diese Beobachtung
entspricht derjenigen, die für KsuC/B und KsuF gemacht wurde. Neben der Hochsalzabhängigen Regulation ist σH über dem von ssgB determinierten Sporulations-spezifischen
Zell-Teilungs Proteins SsgB an der Differenzierung beteiligt (Kormanec, J., Sevcikova;
2002b). Die Hochsalz-abhängige Transkription von sigH und nachgeschaltete σH-abhängige
Transkription von weiteren Genen erfolgt vom sigH-P2 Promoter (Kormanec, J., et al.; 2000).
Eine putative sigH-P2 ähnliche Promotersequenz konnte nicht vor ksuC/ksuB und ksuF
gefunden werden.
S.coelicolor A3(2) verwendet ein osmotisches Sensor System, welches die Aktivität
verschiedener Sigma-Faktoren koordiniert und somit die Aktivität verschiedener Promotoren
unter ähnlichen Stress-Bedingungen kontrolliert (Viollier, P.H., et al.; 2003b). Sowohl σH als
auch das in der Kontrolle getestete σF gehören zu einer in S.coelicolor A3(2) identifizierten
Gruppe von zehn Sigma-Faktoren, die zum Stress-„Master-Regulator“ σB aus Bacillus subtilis
(Price, C.W., et al.; 2001; Völker, U. et al.; 1999; Hecker, M. and Völker, U.; 1998) ähnlich
sind. Dies sind σWhiG, σB, σF, σG, σH, σI, σK, σL, σM und σN (Lee, E.-J., et al.; 2005; Lee, E.-J.,
et al.; 2004a), in weiteren Arbeiten wird mit σJ zusätzlich ein elfter hinzugezählt (Viollier,
P.H. et al.; 2003a und b). Für einige dieser konnte bisher eine Beteiligung an der
Osmoregulation in gezeigt werden, es muss allerdings kritisch angemerkt werden, dass außer
- 160 -
Diskussion
für σB und σH anscheinend ausschließlich hohe NaCl- bzw. KCl-, jedoch nicht z.B. hohe
Sucrose-Konzentrationen getestet wurden (Cho, Y.-H., et al.; 2001, J. Kormanec, pers.
Mitteilung).
σB ist in S.coelicolor A3(2) an der allgemeinen Osmoregulation, Reaktion auf oxidativen
Stress und Differentierung involviert (Cho, Y.-H., et al.; 2001) und ist hauptverantwortlich für
die Osmoregulation (Lee, E.-J., et al.; 2005), sowohl unter hohen Salz- wie auch SucroseKonzentrationen (Cho, Y.-H., et al.; 2001). Die Gene für σB, σL, σM und σHrdD werden unter
hohen KCl-Konzentrationen in σB abhängiger Weise induziert (Lee, E.-J., et al.; 2005). Drei
weitere der elf oben erwähnten Sigma-Faktoren werden unter „osmotischem“ Stress induziert.
Zwei hiervon konnten σI und σJ zugerechnet werden, die unabhängig von σB und σH reguliert
werden (Lee, E.-J., et al.; 2005; Viollier, P.H., et al.; 2003b). Ein weiteres, als SigX
bezeichnet, konnte nicht identifiziert werden (Viollier, P.H., et al.; 2003b). σB-Gruppe
typischen Regulator-Bindestellen (Sevcikova, B., et al.; 2005; Lee, E.-J., et al.; 2004a und b;
Kormanec, J., and Sevcikova, B.; 2002b) sind weder vor ksuC/ksuB und ksuF noch vor allen
anderen Genen des im Rahmen dieser Arbeit untersuchten Genomabschnittes des S.lividans
Chromosoms zu finden.
Die Transkription des für TipAL/AS determinierenden Gens tipA wird durch die Bindung von
Thiostrepton bzw. weiteren komplexen Thiopeptiden an den Transkriptionsregulator TipAL
autoreguliert und ist bei Vorhandensein von Thiostrepton deutlich erhöht. Des Weiteren wird
die Transkription von tipA auch unter hohen osmotischen Bedingungen deutlich erhöht (Ali,
N., et al.; 2002). Unter diesen Bedingungen erfolgt eine reduzierte negative Überwindung der
DNA. Ähnliche Beobachtungen gibt es für verschiedene Promoterbereiche, wie z.B. beim
merT Promoter pmerT unter hohen Hg-Konzentrationen in E.coli (Ansari, A.Z., et al.; 1992;
Parkhill, J., et al.; 1993). Eine osmotische Regulation der Transkription von ksuC/B und ksuF
durch TipAL ist auszuschließen. Die Synthese von KsuC, KsuB und KsuF ist unabhängig von
der Gegenwart von Thiostrepton (für KsuC und KsuB nicht dargestellt), Thiostrepton ist nur
indirekt über die Induktion der Transkription von tsr an der Produktion von KsuF beteiligt
(siehe oben).
Im Rahmen des S.coelicolor A3(2) Genom Projektes wurden 965 Gene (12,3 %) identifiziert,
für dessen Genprodukte eine putative Beteiligung an regulatorischen Funktionen
angenommen wird (Bentley, S.D., et al.; 2002). Ob eines dieser Regulatorproteine einen ptipA
vergleichbaren osmotisch regulierten Promoter besitzt, ist nicht untersucht aber anzunehmen.
Diskussion
- 161 -
4.3. Undecylprodigiosin-Überproduktion in Mutanten
Die ∆ksuC und ∆ksuB Mutanten zeigen bei Wachstum auf Minimal-Festmedium eine, im
Verhältnis zum Wildtyp und der anderen, in dieser Arbeit hergestellten Mutanten, erhöhte und
verfrühte Produktion eines roten, Mycel-assoziierten Farbstoffes. Dieser wird aus einer
Mischung der Antibiotika Undecylprodigiosin und des cyclischen Derivats Butyl-metacycloheptylprodiginin gebildet (zusammen als RED bezeichnet) und vom RED-„Cluster“
(SCO5877-5898) determiniert (Butner, S.D., et al.; 2002). Die Produktion von RED erfolgt
z.B. bei Wachstum auf Minimalmedium um ca. sechs Stunden früher als beim Wildtyp (siehe
Tabelle 3.1). Vergleichbares findet sich bei einer Reihe von Mutanten, die Einfluss auf die
Antibiotikaproduktion von S.coelicolor A3(2) haben (Bibb, M.; 1996). Die Actinorhodin
(Act)-Produktion ist in den Mutanten unverändert; sowohl der Produktionsbeginn als auch die
Menge des produzierten Antibiotikums ist unbeeinflusst.
Die Produktion von RED und Act der Mutanten ist weiterhin abhängig von der
Wachstumsphase und der Fähigkeit, ein Luftmycel auszubilden; sie ist frühestens mit Beginn
der Zwischenphase zwischen der vegetativen und der Vermehrungsphase nachweisbar. Unter
den meisten getesteten Wachstumsbedingungen erfolgt sie erst nach Start der Ausbildung des
Luftmycels (ca. 40 h nach Ausstreichen auf Minimalmedium, siehe Tabelle 3.1). Der Beginn
der Luftmycelbildung findet deutlich früher als bei S.coelicolor statt (nach ca. 72 h, Huang, J.,
et al.; 2005 und eigene Versuche, nicht dargestellt). Unter Kulturbedingungen bei denen keine
Luftmycelbildung beobachtet werden konnte (Standard-Minimalmedien mit Zusatz von
Casaaminosäuren oder 20 % Sucrose oder reduziertem Phosphatgehalt von 0,1 g/l KH2PO4,
siehe Tabelle 3.1), ist auch bei verlängertem Wachstum keine Antibiotikaproduktion
nachweisbar. Eine Wachstumsphasen-abhängige Synthese der Sekundärmetabolit- vor allem
der Antibiotikasynthese ist typisch für viele Streptomyceten, einschließlich S.coelicolor A3(2)
und S.lividans (Challis, G.L. and Hopwood, D.A.; 2003, Demain, A.L. and Fang, A.; 1995;
Martin, J.F. and Demain, A.L.; 1980).
Bei Wachstum auf Minimal-Festmedium mit Hygromycin zeigt die ∆ksuC Mutante eine
gegenüber der ∆ksuB Mutante deutlich erhöhte und früher einsetzende RED-Produktion
(siehe Abb. 3.67). Die geringere RED-Produktion der ∆ksuB Mutante wird vermutlich durch
das Durchlesen des hinter hygR liegenden Terminators und der Synthese von KsuB
hervorgerufen. Vergleichbares ist bei Wachstum in Minimalmedium-Flüssigkulturen ohne
zusätzlich Salz zu beobachten (nicht dargestellt). Die RED-Produktion der ∆ksuB Mutante ist
sehr viel stärker als die der ∆ksuC Mutante, die wiederum intensiver ist als die des Wildtyps.
Dies muss als guter Hinweis gewertet werden, dass ausschließlich das Fehlen von KsuB für
die beobachtete erhöhte und verfrühte RED-Produktion verantwortlich ist, KsuC jedoch
keinen Einfluss hat.
KsuC und KsuB sind, als Mitglieder der Aldo-Keto Reduktase-Familie, Oxidoreduktasen. Mit
Ausnahme der Strukturgene der jeweiligen Biosynthesewege betreffen alle bisher gefundenen
Mutanten und Überexpressionsstämme, die Einfluss auf die Act- und RED-Biosynthese
- 162 -
Diskussion
zeigen, Gene, die für Proteine mit regulatorischer Funktion, für Transportproteine oder die
RNA Polymerase β-Untereinheit determinieren. Die in dieser Arbeit gefundenen Erkenntnisse
sind einzigartig. Der Phänotyp der erhöhten RED-Produktion der ∆ksuC- und ∆ksuBMutanten wurde zu einem verhältnismäßig späten Zeitpunkt der Arbeit gefunden. Im
Folgenden werden die ersten Versuche diskutiert, die zur Aufklärung dieses Phänotyps
durchgeführt wurden.
Die Ergebnisse eines Ausstrichtests zeigten, dass die erhöhte RED-Produktion der ∆ksuCund ∆ksuB-Mutanten unabhängig von möglichen ausgeschiedenen Zwischenprodukten und
extrazellulären Hormonen ist (Abb. 3.66). S.lividans und S.coelicolor A3(2) produzieren
während der transienten Phase in hohen Konzentrationen das extrazelluläre γ-ButyrolactonHormon SCB1. Die Produktion ist in der vegetativen- und Vermehrungs-Phase reduziert
(Takano, E., et al.; 2001; Onaka, H., et al.; 1998). Die Deletion des entsprechenden Gens scbA
in S.coelicolor A3(2) oder S.lividans WT erhöht unter anderem die Produktion von Act und
RED (Takano, E., et al.; 2001; Butler, M.J., et al. 2003).
Niedrige extrazelluläre Phospatkonzentrationen führen zu einer erhöhten Produktion von
RED, Act sowie den zwei weiteren Antibiotika in S.coelicolor A3(2), während hohe
Konzentrationen deren Synthese inhibieren (Doull, J. and Vining, C.L.; 1990; Hobbs, G., et
al.; 1990; Hobbs, G., et al.; 1992). Dasselbe wird auch für die Antibiotika-Produktion in
S.lividans 1326 WT (entspricht dem in dieser Arbeit verwendete Stamm S.lividans 66 WT,
der von D. A. Hopwood umbenannt wurde) und der Plasmid-reduzierten S.lividans-Variante
TK24 postuliert (Ghorbel, S, et al.; 2006; Sola-Landa, A., et al.; 2003; Martín, J.F.; 2004).
Wie an diesen Stämmen untersucht, erfolgt die Phospat-Regulation über das „ZweiKomponenten System“ PhoR-PhoP, wobei PhoR das Membran-gebundene Sensorprotein ist
(es liegt keine Namensverwechslung vor!). Dieses Zwei-Komponenten System besitzt eine
negative regulatorische Funktion auf die Antibiotikasynthese von RED und Act (SolanaLanda, A., et al.; 2003).
Sowohl die ∆ksuC und ∆ksuB Mutanten als auch der S.lividans WT zeigen bei Wachstum auf
niedrigen Phosphatkonzentrationen (1,47 mM) die erwartete hohe Produktion von Act und
RED (siehe Abb. 3.68 k und Tabelle 3.1). Die RED-Produktion erfolgt in den
Disruptionsmutanten um ca. 3-4 h früher als im Wildtyp (Beginn nach ca. 39 h).
Überraschender Weise zeigt sich bei Wachstum in Gegenwart sehr hoher
Phosphatkonzentrationen (73,5 mM) nach 72 h die stärkste RED- wie auch Act-Produktion;
nach 48 h ist diese nicht erhöht und entspricht ca. der bei mittleren (7,35 mM)
Phosphatkonzentrationen (Abb. 3.68 a und l, Tabelle 3.1). S.coelicolor M145 ist im
Gegensatz zu S.lividans in der Lage, bei 0,735 mM Phosphat zu wachsen, hier findet sich die
erwartete hohe Produktion an Act und RED (nicht dargestellt). Bei Wachstum auf sehr hohen
Phosphatkonzentrationen (73,5 mM) ist im Vergleich zu S.lividans die Auskeimungsrate
deutlich reduziert, die Kolonien sind deutlich kleiner und die Act- und RED-Synthese ist nicht
Diskussion
- 163 -
erhöht (nicht dargestellt). S.coelicolor A3(2) und S.lividans könnten in einem Ökosystem
unterschiedliche Nischen besetzen.
Eine Abhängigkeit niedriger Phospatkonzentration auf die Synthese von Sekundärmetaboliten
konnte schon seit den 70er Jahren (Aussage von Martín, J.F.; 2004) für eine Reihe von
Streptomyceten produzierten Antibiotika und weiteren Sekundärmetaboliten nachgewiesen
werden. Hohe Phosphatkonzentrationen inhibieren diese (Martin, J.F.; 2004; McDowall, K.A.
et al.; 1999; Liras, P., et al.; 1990; Asturias, J.A., et al.; 1990; Rebollo, A., et al.; 1989;
Masuma, R., et al.; 1986; Martin, J.F. and Demain, A.L.; 1980). Es wird postuliert, dass die
erhöhte
Antibiotikaund
Sekundärmetabolit-Produktion
unter
niedrigen
Phosphatkonzentrationen induziert wird, um die Nährstoffquelle gegen andere Konkurrenten
zu verteidigen (reviewed in: Martin, J.F.; 2004). Die gefundene deutlich erhöhte
Antibiotikasynthese in S.lividans unter sehr hohen Phosphatkonzentrationen widerspricht
allen bisherigen Erkenntnissen. Vergleichbares wurde bisher nicht beschrieben. Dies
überrascht, da ein Großteil der Arbeiten zur Phosphat-abhängigen Regulation der
Antibiotikasynthese an S.lividans WT und Mutanten dieses Stammes erfolgten, wenn auch
nicht unter vergleichbar hohen Phosphatkonzentrationen (Ghorbel, S, et al.; 2006; Martin,
J.F., 2004; Sola-Landa, A., et al.; 2003).
Im S.coelicolor A3(2) Genom können durch Sequenzvergleiche zwei weitere PhoR-PhoP
ähnliche putative Regulator Paare identifiziert werden (SCO3741/3740 und SCO3013/3012).
Eines dieser könnte die Regulation der Act und RED-Produktion gegenüber PhoR-PhoP unter
sehr hohen Phosphatkonzentrationen (73,5 mM) und zu einem späten Zeitpunkt durchführen,
jedoch anscheinend nicht im genetisch nah verwandten S.coelicolor A3(2). Das Verhältnis der
Act- zur RED-Produktion zueinander scheint sowohl unter niedrigen, wie auch sehr hohen
Phosphatkonzentrationen, identisch zu sein.
Der in den Mutanten gefundene Phänotyp der erhöhten RED-Biosynthese ist vermutlich
unabhängig von der Phosphatkonzentration. Diese hat sowohl Einfluss auf die RED-, als auch
auf die Act-Biosynthese. Die Deletion von ∆ksuC und ∆ksuB beeinflusst jedoch
ausschließlich die RED-Biosynthese.
Hohe Salzkonzentrationen im Medium führen in S.coelicolor M145 zu einer stark erhöhten
RED-Produktion; die Act-Produktion ist unter diesen Bedingungen jedoch deutlich reduziert.
Die Transkription der jeweiligen Regulatorgene redD und actII-orf4 korreliert unter diesen
Bedingungen mit der Antibiotikaproduktion (Sevkikova, B. and Kormanec, J.; 2004;
Sevkikova, B., et al.; 2001). Die Synthese von RED und Act ist vermutlich ausschließlich
abhängig von der Salzkonzentration und unabhängig von der Osmolarität; Wachstum auf
Festmedium mit Zusatz von 10,3 % Sucrose hatte keinen Effekt auf die RED- und ActBiosynthese; Transkriptionsstudien wurden hierzu jedoch nicht durchgefüht (Sevcikova, B.
and Kormanec, J.; 2004). Der Effekt ist unabhängig des vom sigH determinierten StressAntwort Sigma-Faktor (σH) auf hohe Salzkonzentrationen (Sevcikova, B. and Kormanec, J.;
2004).
- 164 -
Diskussion
Hohe Konzentrationen von NaCl und KCl steigern die Produktion von KsuC und KsuB
deutlich. Auf Grund dessen erfolgten der Ausstrich auf Minimal-Medium mit Zusatz von
NaCl, KCl und Sucrose. Bei Wachstum auf 300 mM NaCl zeigt sich der gleiche Phänotyp,
wie für S.coelicolor M145 bei Wachstum auf hohen Salzkonzentrationen beschrieben
(Sevcikova, B. and Kormanec, J.; 2004). Die RED-Produktion erfolgt verfrüht und ist
deutlich erhöht, eine Act-Produktion ist nicht zu erkennen (siehe Abb. 3.68 e, Tabelle 3.1).
Die ∆ksuC und ∆ksuB Mutanten verhalten sich hierbei identisch mit dem Wildtyp.
Überraschender Weise zeigt sich bei Wachstum auf hohen KCl Konzentrationen eine sehr
stark reduzierte RED-Produktion, die in den Mutanten geringfügig stärker ausfällt als im WT.
Eine Act-Produktion ist, wie auch bei Wachstum auf 300 mM NaCl, nicht zu erkennen (siehe
Abb. 3.68 f und Tabelle 3.1). Somit wird durch hohe NaCl-Konzentrationen die REDBiosynthese gesteigert und durch hohe KCl-Konzentrationen reduziert. Diese Beobachtungen,
erstmals im Rahmen dieser Arbeit dargestellt, widersprechen der Aussage einer Arbeit
anderer Autoren, dass die RED-Produktion unter hohen Salz-Konzentrationen gesteigert ist.
Alle Versuche mit hohen Salz-Konzentrationen in dieser Veröffentlichung erfolgten
ausschließlich mit Zusatz von 2,5 % NaCl im Medium, jedoch nicht mit KCl (Sevcikova, B.
and Kormanec, J.; 2004).
Flussaufwärts von redD (SCO5877) finden sich in entgegengesetzter Flussrichtung, durch
einen 268 Bp langen intergenischen Bereich getrennt, ein Operon aus zwei offenen
Leserastern (SCO5876 und SCO5875), die für zwei TrkA Kalium-Transportprotein
Homologe aus E.coli determinieren. Die Transkription von SCO5876/SCO5875 könnte
ausschließlich KCl-abhängig und nicht osmotisch reguliert sein. Die bei Wachstum auf hohen
KCl Konzentrationen beobachtete reduzierte RED-Synthese wäre somit durch Überlappung
der jeweiligen Promoter- oder Operatorbereiche und Blockierung der redD Transkription
hervorgerufen worden. Dies hätte eine deutlich verringerte Konzentration des REDBiosyntheseweg spezifischen Regulators RedD zur Folge. Untersuchungen zu SCO5876 und
SCO5875 und der hiervon determinierenden putativen Kalium-Transportproteine wurden
bisher nicht veröffentlicht; in einem Nebensatz wird erwähnt, jedoch nicht genauer
beschrieben, dass das trkA-Operon den RED-Titer bei Wachstum in Flüssigmedium
„beeinflussen“ kann (Cerdeno, A. M., et al.; 2001).
Bei Wachstum auf 10 % Sucrose ist zwischen den Mutanten und dem S.lividans WT kein
Unterschied zu erkennen; die RED-Produktion ist deutlich erhöht, eine Act-Produktion ist
nicht zu erkennen. Der Produktionsbeginn von RED in S.lividans erfolgt hierbei am Ende der
vegetativen Wachstumsphase oder zu Beginn der Zwischenphase, ca. 4-6 h vor Beginn der
Luftmycelbildung, deutlich früher als unter allen anderen getesteten Bedingungen (siehe Abb.
3.68 g und Tabelle 3.1). Die hier gefundenen Ergebnisse stehen im direkten Widerspruch zu
den für S.coelicolor M145 gewonnen, dass die Zugabe von 10,3 % Sucrose die RED- und
Act-Synthese nicht beeinflusst (Sevcikova, B. and Kormanec, J.; 2004). Dies kann als ein
Beispiel für die unterschiedliche Regulation der Antibiotikasynthese der nahe verwandten
S.coelicolor M145 und S.lividans angesehen werden; auf Grund einiger Unstimmigkeiten
Diskussion
- 165 -
erscheint jedoch auch ein Fehler in der oben erwähnten Veröffentlichung nicht
unwahrscheinlich zu sein.
Da unter hohen NaCl-, KCl- oder Sucrose-Konzentrationen in S.lividans eine vergleichbare
(vermutlich vollständige) Inhibierung der Act- und deutlich erhöhte RED-Produktion (mit
Ausnahme von hohen KCl-Konzentrationen, vermutlich aus den oben beschriebenen
Gründen) gefunden wurde, kann eine jeweils von einer hohen Osmolarität abhängige
komplexe Regulation der Act- und RED-Synthese angenommen werden. Vermutlich
unterliegt auch die Act- und RED-Biosynthese in S.coelicolor M145 einer von einer hohen
Osmolarität und nicht wie behauptet, einer Hochsalz abhängigen komplexen Regulation
(Sevcikova, B. and Kormanec, J.; 2004). Hauptverantwortlich für die osmotische Regulation
(getestet wurden bisher NaCl, KCl und Sucrose) in S.coelicolor A3(2) sind der Sigmafaktor
σB und die niederrangigen von σB regulierten σL und σM (Lee, E.-J., et al.; 2005).
Die beobachtete erhöhte RED- und inhibierte Act-Synthese unter hoher Osmolarität könnte
durch eine gesteigerte Transkription von catB oder eine gesteigerte intrazelluläre ProlinKonzentration verursacht sein. Die Transkription von catB, das für die Katalase CatB
determiniert, ist (direkt oder indirekt) σB-abhängig (Lee, E.-J., et al.; 2005; Cho, Y.-H.; et al.;
2001) und osmotisch reguliert (Cho, Y.-H.; et al.; 2001). Die Deletion von catB führt zu einer
erhöhten und verfrühten Act-Produktion, die von RED ist deutlich reduziert, die Zellen sind
osmosensitiv und zeigen einen „bald“-Phänotyp; hohe Kopienzahlen von catB führen zu einer
reduzierten Act- und erhöhten RED-Produktion (Lee, E.-J., et al.; 2005; Cho, Y.-H.; et al.;
2001; Cho, Y.-H., et al.; 2000). Die intrazelluläre Prolin-Konzentration in Streptomyceten
wird zur Osmotolerans unter hohen osmotischen extrazellulären Konzentrationen um bis zu
50-80fach erhöht (Kilham, K. and Firestone, M.K.; 1984). Prolin Transportmutanten, die
gleichzeitig auch eine geringere Fähigkeit zur Degradation von Prolin besitzen und eine
gesteigerte intrazelluläre Prolinkonzentration aufweisen, überproduzieren RED, die ActProduktion ist deutlich reduziert (Hood, D.W., et al.; 1992).
Da eine hohe Osmolarität sowohl die RED- wie auch die Act-Synthese beeinflusst, scheint sie
nicht verantwortlich für die in den ∆ksuC und ∆ksuB Mutanten beobachtete erhöhte
Produktion von RED zu sein. Es ist zu vermuten, dass dieser in den Mutanten gefundene
Phänotyp durch die durch Sucrose und NaCl induzierte verfrühte und sehr starke REDProduktion überdeckt wird. Hierfür spricht auch die Beobachtung, der gegenüber dem
Wildtyp leicht erhöhten RED-Produktion der Mutanten bei Wachstum auf KCl.
Der Biosyntheseweg von RED wurde in der Veröffentlichung von Cerdeno (Cerdeno, A.M.,
et al.; 2001) aus der Sequenz des dazugehörigen „Clusters“ postuliert und in der
Veröffentlichung von Williamson (Williamson, N.R., et al.; 2005) sehr gut grafisch
zusammenfassend dargestellt. Prolin, Serin und Glycin, des Weiteren Acetyl- und MalonylCoA, sind die Grundbausteine der RED-Biosynthese.
Durch den Zusatz von Prolin (8,96 mM) wird die Antibiotikaproduktion sowohl der Mutanten
als auch des Wildtyps im Vergleich zum Wachstum auf Minimalmedium nicht verändert
- 166 -
Diskussion
(siehe Abb. 3.68 a und b; Tabelle 3.1). Die externe Gabe von Prolin ist nicht in der Lage, die
intrazelluläre Prolinkonzentration zu steigern, so die erhöhte Produktion von RED zu
induzieren und die Act-Produktion zu inhibieren, wie in Prolin-Transportmutanten gefunden
(siehe oben, Hood, D.W., et al.; 1992). Durch die Zugabe von Glycin (13,3 mM) und Serin
(9,5 mM) wird die RED-Überproduktion der Mutanten teilweise (bei Glycin) oder vollständig
(bei Serin) komplementiert. Nach längerem Wachstum von 6 Tagen entspricht die REDProduktion jeweils ungefähr der des Wildtyps auf Minimalmedium. Die SerinHydroxymethyltransferase katalysiert die Umwandlung von Serin in Glycin, unter
Freisetzung von Tetrahydrofolsäure~CH2OH. Die Reaktion ist bidirektional. Da die Mutanten
bei Zugabe von Glycin, trotz einer höher eingesetzten Konzentration als bei Serin, eine leicht
höhere RED-Produktion zeigen, ist anzunehmen, dass die Komplementation Serin-abhängig
ist. Im Rahmen des S.coelicolor A3(2) Genomprojektes wurden drei potentielle SerinHydroxymethyltransferasen identifiziert, determiniert von glyA1 (SCO5470), glyA2
(SCO5470) und glyA3 (SCO5364). Serin ist der Grundbaustoff der Cysteinbiosynthese. Ob
Cystein oder das Zwischenprodukt O-Acetylserin für die Komplementation verantwortlich
sind, bzw. ebenfalls eine Komplementation bewirken, wurde nicht untersucht.
Da Gabe von externen Glycin, vor allem von Serin, die RED-Überproduktion der Mutanten
auf die Produktionsmenge des Wildtyps reduziert (ca. in der Stärke des Wildtyps bei
Wachstum auf Minimalmedium), wurde eine Beteiligung am gefundenen Phänotyp der REDÜberproduktion angenommen. Dies ist jedoch auszuschließen, da die Act-Produktion
inhibiert wird. Vergleichbares wurde auch in früheren Versuchen zu S.coelicolor A3(2)
gefunden, Glycin, Glutamin und Ammoniumnitrat beeinflussen die RED-Biosynthese nur
unwesentlich, die Act-Produktion wird inhibiert (Hobbs, G., et al.; 1990). KsuC und KsuB
sind Mitglieder der Aldo-Keto Reduktase-Familie, Aminosäuren sind keine typischen
Substrate dieser Familie.
Die Regulation der Antibiotika-Synthese ist, wie explizit für S.coelicolor A3(2) und S.lividans
gezeigt, äußerst komplex und nur zum Teil verstanden, viele unterschiedliche Faktoren sind
hieran beteiligt (siehe Einleitung). Ein vergleichbarer Phänotyp einer veränderten RED- und
einer gering oder unbeeinflussten Act-Synthese zeigen Mutanten von an der REDBiosynthese involvierten Genen (Cerdeno, A.M., et al.; 2001), Mutanten und hohe
Kopienzahlen von redZ oder redD, die für die „Biosyntheseweg spezifischen Regulatoren“
determinieren (White, J. and Bibb, M.; 1997, Malpartida, F., et al.; 1990; Narva, K.E. and
Feitelson, J.S.; 1990; Feitelson, J.S., et al.; 1985), Mutanten von ercA1/A2, determinierend für
ein Zwei-Komponenten System der NarL Familie (Li, Y.-q., et al.; 2004) und eine der
spontan entstandenen Rifampicin resistenten Mutanten der RNA Polymerase β-Untereinheit,
determiniert von rpoB (S.lividans EN1 rif-9, trägt eine Deletion des für Lys430
determinierenden Kodons; Hu, H., et al.; 2002).
Nicht ausgeschlossen werden kann, dass KsuC/B, auf Grund der großen Substratdiversität der
Aldo-Keto Reduktasen, Zwischenprodukte der RED-Biosynthese modifizieren. Eine Reihe
Diskussion
- 167 -
von Zwischenprodukten der RED-Biosynthese sind Ketone, Diketone und Aldehyde und
somit potentielle Substrate der Aldo-Keto Reduktasen (Williamson, N.R., et al.; 2005;
Cerdeňo, A.M., et al.; 2001). Für das von ercA1/A2 determinierte „Zwei Komponenten
System“ wird eine positive regulatorische Funktion für den RED-Biosynthese „Cluster“
postuliert. Jedoch ist weder bekannt noch postuliert, auf welche Art und Weise dieses an der
Regulation der RED-Biosynthese beteiligt ist (Li, Y.-q., et al.; 2004). Es kann vermutet
werden, dass der Antwort-Regulator (determiniert von ercA1) über eine Kaskade weiterer
Regulatorproteine die Transkription von redD und redZ reguliert. In der oben erwähnten
Rifampicin resistenten Mutante der RNA Polymerase β-Untereinheit könnte hierbei die
Bindung des niederrangigsten Regulatorproteins dieser Kaskade vor redD oder redZ
mimikrieren sein. Es ist möglich, dass ein Endprodukt von KsuC/KsuB an eines der
Regulatorproteine der postulierten Kaskade bindet und so die RED-Produktion beeinflusst.
Des Weiteren könnte KsuB (auf Grund der großen Substratdiversität der Aldo-Keto
Reduktasen) ein Molekül, das durch Bindung an eines dieser Regulatorproteine an der
Kaskade beteiligt ist, als Substrat modifizieren. Eine Koordinierung der Synthese von KsuC/B
mit der RED-Biosynthese wurde in dieser Arbeit nicht beobachtet. Wie in Microarray-Studien
zu 1500 Genen aus S.coelicolor A3(2) gezeigt wurde, werden ecrA1/ecrA2 koordiniert mit
den Genen des RED spezifischen Biosyntheseweges transkribiert, jedoch nicht ksuC und ksuB
(Zusatzmaterial Fig.S3 und Fig.S1 zu: Huang, J., et al.; 2005, http://www.blackwellsynery.com).
Zusammenfassung
- 169 -
5. ZUSAMMENFASSUNG
Das lineare Chromosom von S.lividans zeichnet sich durch eine hohe Variabilität
insbesondere der chromosomalen Endbereiche aus. Hier finden sich unter anderen auch
verschiedene Gene, die bisher einzigartig sind. Um die Funktion dieser zu untersuchen
wurden verschiedene Strategien angewandt.
Nach Klonierung der Gene in E.coli wurden die entsprechenden Genprodukte als His-Tag
Fusionsproteine überproduziert, aufgereinigt und zur Herstellung von Antikörpern verwendet.
Der untersuchte Abschnitt, als Ganzes und in Unterabschnitten, wurde auf einem „Hoch
Kopien Vektor“ in S.lividans transformiert. In extra hierfür konstruierten Vektorsystemen
erfolgte die Produktion von His-Tag Proteinen in S.lividans. Nach Fusion von potentiellen
Promoterbereichen mit dem promoterlosen EGFP-Gen, gelang deren Identifizierung in
„enhanced green fluorescent protein“ (EGFP) produzierenden S.lividans Transformanten. Mit
Hilfe eines Vektors, der ein Thiostrepton-Resistenzgen trägt und ein Temperatur sensitives
Replikon besitzt, wurden Gene durch die Integration eines Hygromycin-Resistenzgenes
ersetzt, bzw. als Fusionsgen mit dem EGFP-Gen erstellt.
Mit weiteren pysiologischen, biochemischen und immunologischen Untersuchungen, zum
Teil in Kooperation mit Mitgliedern der Arbeitsgruppe, wurde erstmals ein Gen identifiziert,
dessen Genprodukt für die Interaktion zwischen Streptomyceten-Hyphen wichtig ist. Ein
Flavoprotein wurde zur Homogenität gereinigt. Es wurde nachgewiesen, dass in S.lividans pro
Monomer ein FAD-Molekül interagiert. Physiologische Studien zeigen, dass die Synthese des
chromosomal determinierten Proteins in S.lividans nur erfolgt, wenn dieser Stamm ein
Plasmid- oder chromosomal- kodiertes Thiostrepton Resistenzprotein (23S rRNA Methylase)
enthält. Es muss geschlussfolgert werden, dass die Methylierung der 23S rRNA die
Translation verschiedener mRNAs beeinflusst. Die Synthese dieses Proteins ist des Weiteren
abhängig von hohen Konzentrationen an NaCl und KCl im Medium, wie auch die zweier
Aldo-Keto Reduktasen. Disruptionsmutanten eines dieser zwei Aldo-Keto Reduktase-Gene
zeigen jeweils eine erhöhte und verfrühte Produktion eines rot gefärbten Mycel-assoziierten
Antibiotikums (Undecylprodigiosin), während die eines weiteren (Actinorhodin)
unbeeinflusst blieb. Die Beteiligung einiger Faktoren an diesem Phänotyp konnte
ausgeschlossen werden. Als Nebenaspekt zeigten sich eine hier erstmals beschriebene, zu
einem späten Zeitpunkt erfolgende, deutlich erhöhte Produktion der beiden Antibiotika bei
Wachstum auf sehr hohen Phosphat-Konzentrationen und zusätzlich eine vermutlich
osmotische Regulation der Synthese dieser beiden Antibiotika.
Literaturverzeichnis
- 171 -
6. LITERATURVERZEICHNIS
Adamidis T, Champness W. Genetic analysis of absB, a Streptomyces coelicolor locus
involved in global antibiotic regulation. J Bacteriol. 1992 Jul;174(14):4622-8.
Aigle B, Wietzorrek A, Takano E, Bibb MJ. A single amino acid substitution in region 1.2
of the principal sigma factor of Streptomyces coelicolor A3(2) results in pleiotropic loss
of antibiotic production. Mol Microbiol. 2000 Sep;37(5):995-1004.
Ali N, Herron PR, Evans MC, Dyson PJ. Osmotic regulation of the Streptomyces lividans
thiostrepton-inducible promoter, ptipA. Microbiology. 2002 Feb;148(Pt 2):381-90.
Alting-Mees MA, Short JM. pBluescript II: gene mapping vectors. Nucleic Acids Res.
1989 Nov 25;17(22):9494.
Anderson TB, Brian P, Champness WC. Genetic and transcriptional analysis of absA, an
antibiotic gene cluster-linked two-component system that regulates multiple antibiotics
in Streptomyces coelicolor. Mol Microbiol. 2001 Feb;39(3):553-66.
Ansari AZ, Chael ML, O'Halloran TV. Allosteric underwinding of DNA is a critical step in
positive control of transcription by Hg-MerR. Nature. 1992 Jan 2;355(6355):87-9.
Asturias JA, Liras P, Martin JF. Phosphate control of pabS gene transcription during
candicidin biosynthesis. Gene. 1990 Sep 1;93(1):79-84.
Balbas P, Soberon X, Bolivar F, Rodriguez RL. The plasmid, pBR322. Biotechnology.
1988;10:5-41. Review.
Bechthold A, Floss HG. Overexpression of the thiostrepton-resistance gene from
Streptomyces azureus in Escherichia coli and characterization of recognition sites of the
23S rRNA A1067 2'-methyltransferase in the guanosine triphosphatase center of 23S
ribosomal RNA. Eur J Biochem. 1994 Sep 1;224(2):431-7.
- 172 -
Literaturverzeichnis
Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides:
SignalP 3.0. J Mol Biol. 2004 Jul 16;340(4):783-95.
Bentley SD, Brown S, Murphy LD, Harris DE, Quail MA, Parkhill J, Barrell BG, McCormick
JR, Santamaria RI, Losick R, Yamasaki M, Kinashi H, Chen CW, Chandra G, Jakimowicz D,
Kieser HM, Kieser T, Chater KF. SCP1, a 356,023 bp linear plasmid adapted to the
ecology and developmental biology of its host, Streptomyces coelicolor A3(2). Mol
Microbiol. 2004 Mar;51(6):1615-28.
Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis GL, Thomson NR, James KD, Harris
DE, Quail MA, Kieser H, Harper D, Bateman A, Brown S, Chandra G, Chen CW, Collins M,
Cronin A, Fraser A, Goble A, Hidalgo J, Hornsby T, Howarth S, Huang CH, Kieser T, Larke
L, Murphy L, Oliver K, O'Neil S, Rabbinowitsch E, Rajandream MA, Rutherford K, Rutter S,
Seeger K, Saunders D, Sharp S, Squares R, Squares S, Taylor K, Warren T, Wietzorrek A,
Woodward J, Barrell BG, Parkhill J, Hopwood DA. Complete genome sequence of the
model actinomycete Streptomyces coelicolor A3(2). Nature. 2002 May 9;417(6885):141-7.
Berdy J. Bioactive microbial metabolites. J Antibiot (Tokyo). 2005 Jan;58(1):1-26. Review.
Erratum in: J Antibiot (Tokyo). 2005 Apr;58(4):C-1.
Bhushan B, Halasz A, Spain JC, Hawari J. Initial reaction(s) in biotransformation of CL20 is catalyzed by salicylate 1-monooxygenase from Pseudomonas sp. strain ATCC
29352. Appl Environ Microbiol. 2004 Jul;70(7):4040-7.
Bibb M. 1995 Colworth Prize Lecture. The regulation of antibiotic production in
Streptomyces coelicolor A3(2). Microbiology. 1996 Jun;142 ( Pt 6):1335-44. Review.
Bibb MJ, Bibb MJ, Ward JM, Cohen SN. Nucleotide sequences encoding and promoting
expression of three antibiotic resistance genes indigenous to Streptomyces. Mol Gen
Genet. 1985;199(1):26-36.
Bibb MJ, Cohen SN. Gene expression in Streptomyces: construction and application of
promoter-probe plasmid vectors in Streptomyces lividans. Mol Gen Genet.
1982;187(2):265-77.
Blanco J, Coque JJ, Martin JF. The folate branch of the methionine biosynthesis pathway
in Streptomyces lividans: disruption of the 5,10-methylenetetrahydrofolate reductase
gene leads to methionine auxotrophy. J Bacteriol. 1998 Mar;180(6):1586-91.
Literaturverzeichnis
- 173 -
Blondelet-Rouault MH, Weiser J, Lebrihi A, Branny P, Pernodet JL. Antibiotic resistance
gene cassettes derived from the omega interposon for use in E. coli and Streptomyces.
Gene. 1997 May 6;190(2):315-7.
Bosch R, Garcia-Valdes E, Moore ER. Genetic characterization and evolutionary
implications of a chromosomally encoded naphthalene-degradation upper pathway from
Pseudomonas stutzeri AN10. Gene. 1999 Aug 5;236(1):149-57.
Bourn WR, Babb B. Computer assisted identification and classification of streptomycete
promoters. Nucleic Acids Res. 1995 Sep 25;23(18):3696-703.
Bowen WS, Van Dyke N, Murgola EJ, Lodmell JS, Hill WE. Interaction of thiostrepton
and elongation factor-G with the ribosomal protein L11-binding domain. J Biol Chem.
2005 Jan 28;280(4):2934-43.
Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976
May 7;72:248-54.
Brockmann H, Pini H. Actinorhodin, ein roter Farbstoff aus Actinomyceten. Die
Naturwissenschaften. 1947; 34:190.
Brot N, Tate WP, Caskey CT, Weissbach H. The requirement for ribosomal proteins L7
and L12 in peptide-chain termination. Proc Natl Acad Sci U S A. 1974 Jan;71(1):89-92.
Bullock WO, Fernandez JM, Short JM. XL1-Blue: A high efficiency plasmid transforming
recA Escherichia coli strain with beta-galactosidase selection. BioTechniques 1987 5:367
Burnette WN. "Western blotting": electrophoretic transfer of proteins from sodium
dodecyl sulfate--polyacrylamide gels to unmodified nitrocellulose and radiographic
detection with antibody and radioiodinated protein A. Anal Biochem. 1981
Apr;112(2):195-203.
Butler MJ, Takano E, Bruheim P, Jovetic S, Marinelli F, Bibb MJ. Deletion of scbA
enhances antibiotic production in Streptomyces lividans. Appl Microbiol Biotechnol. 2003
Jun;61(5-6):512-6.
Butler MJ, Bruheim P, Jovetic S, Marinelli F, Postma PW, Bibb MJ. Engineering of primary
carbon metabolism for improved antibiotic production in Streptomyces lividans. Appl
Environ Microbiol. 2002 Oct;68(10):4731-9.
- 174 -
Literaturverzeichnis
Bystrykh LV, Fernandez-Moreno MA, Herrema JK, Malpartida F, Hopwood DA, Dijkhuizen
L. Production of actinorhodin-related "blue pigments" by Streptomyces coelicolor
A3(2). J Bacteriol. 1996 Apr;178(8):2238-44.
Bystrykh LV, Dijkhuizen L, Harder W. Modification of flavin adenine dinucleotide in
alcohol oxidase of the yeast Hansenula polymorpha. J Gen Microbiol. 1991
Oct;137(10):2381-6.
Cameron DM, Thompson J, March PE, Dahlberg AE. Initiation factor IF2, thiostrepton
and micrococcin prevent the binding of elongation factor G to the Escherichia coli
ribosome. J Mol Biol. 2002 May 24;319(1):27-35.
Cerdeno AM, Bibb MJ, Challis GL. Analysis of the prodiginine biosynthesis gene cluster
of Streptomyces coelicolor A3(2): new mechanisms for chain initiation and termination
in modular multienzymes. Chem Biol. 2001 Aug;8(8):817-29.
Cerdeno-Tarraga AM, Efstratiou A, Dover LG, Holden MT, Pallen M, Bentley SD, Besra GS,
Churcher C, James KD, De Zoysa A, Chillingworth T, Cronin A, Dowd L, Feltwell T, Hamlin
N, Holroyd S, Jagels K, Moule S, Quail MA, Rabbinowitsch E, Rutherford KM, Thomson
NR, Unwin L, Whitehead S, Barrell BG, Parkhill J. The complete genome sequence and
analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res. 2003 Nov
15;31(22):6516-23.
Challis GL, Hopwood DA. Synergy and contingency as driving forces for the evolution of
multiple secondary metabolite production by Streptomyces species. Proc Natl Acad Sci U
S A. 2003 Nov 25;100 Suppl 2:14555-61. Review.
Champness W, Riggle P, Adamidis T, Vandervere P. Identification of Streptomyces
coelicolor genes involved in regulation of antibiotic synthesis. Gene. 1992 Jun 15;115(12):55-60.
Chang HM, Chen MY, Shieh YT, Bibb MJ, Chen CW. The cutRS signal transduction
system of Streptomyces lividans represses the biosynthesis of the polyketide antibiotic
actinorhodin. Mol Microbiol. 1996 Sep;21(5):1075-85.
Chiu ML, Folcher M, Katoh T, Puglia AM, Vohradsky J, Yun BS, Seto H, Thompson CJ.
Broad spectrum thiopeptide recognition specificity of the Streptomyces lividans TipAL
protein and its role in regulating gene expression. J Biol Chem. 1999 Jul
16;274(29):20578-86.
Literaturverzeichnis
- 175 -
Chiu ML, Folcher M, Griffin P, Holt T, Klatt T, Thompson CJ. Characterization of the
covalent binding of thiostrepton to a thiostrepton-induced protein from Streptomyces
lividans. Biochemistry. 1996 Feb 20;35(7):2332-41.
Cho YH, Lee EJ, Ahn BE, Roe JH. SigB, an RNA polymerase sigma factor required for
osmoprotection and proper differentiation of Streptomyces coelicolor. Mol Microbiol.
2001 Oct;42(1):205-14.
Cho YH, Lee EJ, Roe JH. A developmentally regulated catalase required for proper
differentiation and osmoprotection of Streptomyces coelicolor. Mol Microbiol. 2000
Jan;35(1):150-60.
Chouayekh H, Virolle MJ. The polyphosphate kinase plays a negative role in the control
of antibiotic production in Streptomyces lividans. Mol Microbiol. 2002 Feb;43(4):919-30.
Cole LJ, Entsch B, Ortiz-Maldonado M, Ballou DP. Properties of p-hydroxybenzoate
hydroxylase when stabilized in its open conformation. Biochemistry. 2005 Nov
15;44(45):14807-17.
Cole ST, Eiglmeier K, Parkhill J, James KD, Thomson NR, Wheeler PR, Honore N, Garnier
T, Churcher C, Harris D, Mungall K, Basham D, Brown D, Chillingworth T, Connor R,
Davies RM, Devlin K, Duthoy S, Feltwell T, Fraser A, Hamlin N, Holroyd S, Hornsby T,
Jagels K, Lacroix C, Maclean J, Moule S, Murphy L, Oliver K, Quail MA, Rajandream MA,
Rutherford KM, Rutter S, Seeger K, Simon S, Simmonds M, Skelton J, Squares R, Squares S,
Stevens K, Taylor K, Whitehead S, Woodward JR, Barrell BG. Massive gene decay in the
leprosy bacillus. Nature. 2001 Feb 22;409(6823):1007-11.
Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K,
Gas S, Barry CE 3rd, Tekaia F, Badcock K, Basham D, Brown D, Chillingworth T, Connor R,
Davies R, Devlin K, Feltwell T, Gentles S, Hamlin N, Holroyd S, Hornsby T, Jagels K, Krogh
A, McLean J, Moule S, Murphy L, Oliver K, Osborne J, Quail MA, Rajandream MA, Rogers
J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston JE, Taylor K, Whitehead S,
Barrell BG. Deciphering the biology of Mycobacterium tuberculosis from the complete
genome sequence. Nature. 1998 Jun 11;393(6685):537-44. Erratum in: Nature 1998 Nov
12;396(6707):190.
Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res.
1988 Nov 25;16(22):10881-90.
- 176 -
Literaturverzeichnis
de Crecy-Lagard V, Servant-Moisson P, Viala J, Grandvalet C, Mazodier P. Alteration of the
synthesis of the Clp ATP-dependent protease affects morphological and physiological
differentiation in Streptomyces. Mol Microbiol. 1999 May;32(3):505-17.
Dittrich W, Betzler M, Schrempf H. An amplifiable and deletable chloramphenicolresistance determinant of Streptomyces lividans 1326 encodes
transmembrane protein. Mol Microbiol. 1991 Nov;5(11):2789-97.
a
putative
Doull JL, Vining LC. Nutritional control of actinorhodin production by Streptomyces
coelicolor A3(2): suppressive effects of nitrogen and phosphate. Appl Microbiol
Biotechnol. 1990 Jan;32(4):449-54.
Doyle DA, Morais Cabral J, Pfuetzner RA, Kuo A, Gulbis JM, Cohen SL, Chait BT,
MacKinnon R. The structure of the potassium channel: molecular basis of K+ conduction
and selectivity. Science. 1998 Apr 3;280(5360):69-77.
Dulley JR, Grieve PA. A simple technique for eliminating interference by detergents in
the Lowry method of protein determination. Anal Biochem. 1975 Mar;64(1):136-41.
Ellis EM, Hayes JD. Substrate specificity of an aflatoxin-metabolizing aldehyde
reductase. Biochem J. 1995 Dec 1;312 ( Pt 2):535-41.
El-Kabbani O, Wilson DK, Petrash M, Quiocho FA. Structural features of the aldose
reductase and aldehyde reductase inhibitor-binding sites. Mol Vis. 1998 Sep 29;4:19.
Review.
el-Kabbani O, Carper DA, McGowan MH, Devedjiev Y, Rees-Milton KJ, Flynn TG. Studies
on the inhibitor-binding site of porcine aldehyde reductase: crystal structure of the
holoenzyme-inhibitor ternary complex. Proteins. 1997 Oct;29(2):186-92.
Enroth C, Neujahr H, Schneider G, Lindqvist Y. The crystal structure of phenol
hydroxylase in complex with FAD and phenol provides evidence for a concerted
conformational change in the enzyme and its cofactor during catalysis. Structure. 1998
May 15;6(5):605-17.
Entsch B, Cole LJ, Ballou DP. Protein dynamics and electrostatics in the function of phydroxybenzoate hydroxylase. Arch Biochem Biophys. 2005 Jan 1;433(1):297-311.
Review.
Literaturverzeichnis
- 177 -
Entsch B, van Berkel WJ. Structure and mechanism of para-hydroxybenzoate
hydroxylase. FASEB J. 1995 Apr;9(7):476-83. Review.
Eppink MH, Bunthol C, Schreuder HA, van Berkel WJ. Phe161 and Arg166 variants of phydroxybenzoate hydroxylase. Implications for NADPH recognition and structural
stability. FEBS Lett. 1999 Jan 29;443(3):251-5.
Eppink MH, Schreuder HA, van Berkel WJ. Interdomain binding of NADPH in phydroxybenzoate hydroxylase as suggested by kinetic, crystallographic and modeling
studies of histidine 162 and arginine 269 variants. J Biol Chem. 1998a Aug
14;273(33):21031-9.
Eppink MH, Schreuder HA, van Berkel WJ. Lys42 and Ser42 variants of phydroxybenzoate hydroxylase from Pseudomonas fluorescens reveal that Arg42 is
essential for NADPH binding. Eur J Biochem. 1998b Apr 1;253(1):194-201.
Eppink MH, Schreuder HA, Van Berkel WJ. Identification of a novel conserved sequence
motif in flavoprotein hydroxylases with a putative dual function in FAD/NAD(P)H
binding. Protein Sci. 1997 Nov;6(11):2454-8.
Eppink MH, Schreuder HA, Van Berkel WJ. Structure and function of mutant Arg44Lys
of 4-hydroxybenzoate hydroxylase implications for NADPH binding. Eur J Biochem.
1995 Jul 1;231(1):157-65.
Farber GK, Petsko GA. The evolution of alpha/beta barrel enzymes. Trends Biochem Sci.
1990 Jun;15(6):228-34. Review.
Feitelson JS, Malpartida F, Hopwood DA. Genetic and biochemical characterization of the
red gene cluster of Streptomyces coelicolor A3(2). J Gen Microbiol. 1985 Sep;131(9):243141.
Fisher HF, Conn EE, Vennesland B, Westheimer FH. The enzymatic transfer of hydrogen.
I. The reaction catalyzed by alcohol dehydrogenase. J Biol Chem. 1953 Jun;202(2):687-97.
Fischer, E. Effekt der Zuckerkonfiguration auf die Enzymwirkung. Berichte der
Deutschen Chemischer Gesellschaft 1894; 27: 2984-2993.
- 178 -
Literaturverzeichnis
Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J, DeBoy R, Dodson
R, Gwinn M, Haft D, Hickey E, Kolonay JF, Nelson WC, Umayam LA, Ermolaeva M,
Salzberg SL, Delcher A, Utterback T, Weidman J, Khouri H, Gill J, Mikula A, Bishai W,
Jacobs Jr WR Jr, Venter JC, Fraser CM. Whole-genome comparison of Mycobacterium
tuberculosis clinical and laboratory strains. J Bacteriol. 2002 Oct;184(19):5479-90.
Fraser CM, Casjens S, Huang WM, Sutton GG, Clayton R, Lathigra R, White O, Ketchum
KA, Dodson R, Hickey EK, Gwinn M, Dougherty B, Tomb JF, Fleischmann RD, Richardson
D, Peterson J, Kerlavage AR, Quackenbush J, Salzberg S, Hanson M, van Vugt R, Palmer N,
Adams MD, Gocayne J, Weidman J, Utterback T, Watthey L, McDonald L, Artiach P,
Bowman C, Garland S, Fuji C, Cotton MD, Horst K, Roberts K, Hatch B, Smith HO, Venter
JC. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature. 1997
Dec 11;390(6660):580-6.
Gatti DL, Entsch B, Ballou DP, Ludwig ML. pH-dependent structural changes in the
active site of p-hydroxybenzoate hydroxylase point to the importance of proton and
water movements during catalysis. Biochemistry. 1996 Jan 16;35(2):567-78.
Gatti DL, Palfey BA, Lah MS, Entsch B, Massey V, Ballou DP, Ludwig ML. The mobile
flavin of 4-OH benzoate hydroxylase. Science. 1994 Oct 7;266(5182):110-4.
Ghorbel S, Kormanec J, Artus A, Virolle MJ. Transcriptional studies and regulatory
interactions between the phoR-phoP operon and the phoU, mtpA, and ppk genes of
Streptomyces lividans TK24. J Bacteriol. 2006 Jan;188(2):677-86.
Goodner B, Hinkle G, Gattung S, Miller N, Blanchard M, Qurollo B, Goldman BS, Cao Y,
Askenazi M, Halling C, Mullin L, Houmiel K, Gordon J, Vaudin M, Iartchouk O, Epp A, Liu
F, Wollam C, Allinger M, Doughty D, Scott C, Lappas C, Markelz B, Flanagan C, Crowell C,
Gurson J, Lomo C, Sear C, Strub G, Cielo C, Slater S. Genome sequence of the plant
pathogen and biotechnology agent Agrobacterium tumefaciens C58. Science. 2001 Dec
14;294(5550):2323-8.
Gramajo HC, Takano E, Bibb MJ. Stationary-phase production of the antibiotic
actinorhodin in Streptomyces coelicolor A3(2) is transcriptionally regulated. Mol
Microbiol. 1993 Mar;7(6):837-45.
Gulbis JM, Zhou M, Mann S, MacKinnon R. Structure of the cytoplasmic beta subunit-T1
assembly of voltage-dependent K+ channels. Science. 2000 Jul 7;289(5476):123-7.
Literaturverzeichnis
- 179 -
Haug I, Weissenborn A, Brolle D, Bentley S, Kieser T, Altenbuchner J. Streptomyces
coelicolor A3(2) plasmid SCP2*: deductions from the complete sequence. Microbiology.
2003 Feb;149(Pt 2):505-13.
Hara O, Horinouchi S, Uozumi T, Beppu T. Genetic analysis of A-factor synthesis in
Streptomyces coelicolor A3(2) and Streptomyces griseus. J Gen Microbiol. 1983
Sep;129(9):2939-44.
Harayama S, Kok M, Neidle EL. Functional and evolutionary relationships among diverse
oxygenases. Annu Rev Microbiol. 1992;46:565-601. Review.
Hecker M, Volker U. Non-specific, general and multiple stress resistance of growthrestricted Bacillus subtilis cells by the expression of the sigmaB regulon. Mol Microbiol.
1998 Sep;29(5):1129-36. Review.
Hegermann J, Overbeck J, Schrempf H. In vivo monitoring of the potassium channel KcsA
in Streptomyces lividans hyphae using immuno-electron microscopy and energyfiltering transmission electron microscopy. Microbiology. 2006 Sep;152(Pt 9):2831-41.
Helmann JD. The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol.
2002;46:47-110. Review.
Hesketh A, Sun J, Bibb M. Induction of ppGpp synthesis in Streptomyces coelicolor A3(2)
grown under conditions of nutritional sufficiency elicits actII-ORF4 transcription and
actinorhodin biosynthesis. Mol Microbiol. 2001 Jan;39(1):136-44.
Hidalgo AR, Akond MA, Kita K, Kataoka M, Shimizu S. Isolation and primary structural
analysis of two conjugated polyketone reductases from Candida parapsilosis. Biosci
Biotechnol Biochem. 2001 Dec;65(12):2785-8.
Hillemann D, Dammann T, Hillemann A, Wohlleben W. Genetic and biochemical
characterization of the two glutamine synthetases GSI and GSII of the
phosphinothricyl-alanyl-alanine producer, streptomyces viridochromogenes Tu494. J
Gen Microbiol. 1993 Aug;139(8):1773-83.
Hobbs G, Obanye AI, Petty J, Mason JC, Barratt E, Gardner DC, Flett F, Smith CP, Broda P,
Oliver SG. An integrated approach to studying regulation of production of the antibiotic
methylenomycin by Streptomyces coelicolor A3(2). J Bacteriol. 1992 Mar;174(5):1487-94
- 180 -
Literaturverzeichnis
Hobbs G, Frazer CM, Gardner DCJ, Flett F, Oliver SG. Pigmented antibiotic production by
Streptomyces coelicolor A3(2): kinetics and the influence of nutrients. J Gen Microbiol.
1990;136:2291-2296.
Holmes DJ, Caso JL, Thompson CJ. Autogenous transcriptional activation of a
thiostrepton-induced gene in Streptomyces lividans. EMBO J. 1993 Aug;12(8):3183-91.
Hood DW, Heidstra R, Swoboda UK, Hodgson DA. Molecular genetic analysis of proline
and tryptophan biosynthesis in Streptomyces coelicolor A3(2): interaction between
primary and secondary metabolism--a review. Gene. 1992 Jun 15;115(1-2):5-12. Review.
Hopwood DA. The Streptomyces genome--be prepared! Nat Biotechnol. 2003
May;21(5):505-6.
Hopwood DA, Bibb MJ, Chater KF, Kieser T, Burton CJ,Kieser HM, Lydrate DJ, Smith CP,
Ward JM and Schrempf H. Genetic manipulation of Streptomyces. A laboratory manual
(Norwich: The John Innes Foundation) 1985
Hopwood DA, Kieser T, Wright HM, Bibb MJ. Plasmids, recombination and chromosome
mapping in Streptomyces lividans 66. J Gen Microbiol. 1983 Jul;129(7):2257-69.
Hopwood DA, Wright HM. Bacterial protoplast fusion: recombination in fused
protoplasts of Streptomyces coelicolor. Mol Gen Genet. 1978 Jul 4;162(3):307-17.
Horinouchi S. AfsR as an integrator of signals that are sensed by multiple
serine/threonine kinases in Streptomyces coelicolor A3(2). J Ind Microbiol Biotechnol.
2003 Aug;30(8):462-7. Review.
Hu H, Zhang Q, Ochi K. Activation of antibiotic biosynthesis by specified mutations in
the rpoB gene (encoding the RNA polymerase beta subunit) of Streptomyces lividans. J
Bacteriol. 2002 Jul;184(14):3984-91.
Huang J, Shi J, Molle V, Sohlberg B, Weaver D, Bibb MJ, Karoonuthaisiri N, Lih CJ, Kao
CM, Buttner MJ, Cohen SN. Cross-regulation among disparate antibiotic biosynthetic
pathways of Streptomyces coelicolor. Mol Microbiol. 2005 Dec;58(5):1276-87.
Huang J, Lih CJ, Pan KH, Cohen SN. Global analysis of growth phase responsive gene
expression and regulation of antibiotic biosynthetic pathways in Streptomyces coelicolor
using DNA microarrays. Genes Dev. 2001 Dec 1;15(23):3183-92.
Literaturverzeichnis
- 181 -
Hunt AC, Servin-Gonzalez L, Kelemen GH, Buttner MJ. The bldC developmental locus of
Streptomyces coelicolor encodes a member of a family of small DNA-binding proteins
related to the DNA-binding domains of the MerR family. J Bacteriol. 2005
Jan;187(2):716-28.
Hutchings MI, Hoskisson PA, Chandra G, Buttner MJ. Sensing and responding to diverse
extracellular signals? Analysis of the sensor kinases and response regulators of
Streptomyces coelicolor A3(2). Microbiology. 2004 Sep;150(Pt 9):2795-806. Review.
Ikeda H, Ishikawa J, Hanamoto A, Shinose M, Kikuchi H, Shiba T, Sakaki Y, Hattori M,
Omura S. Complete genome sequence and comparative analysis of the industrial
microorganism Streptomyces avermitilis. Nat Biotechnol. 2003 May;21(5):526-31.
Ishikura S, Horie K, Sanai M, Matsumoto K, Hara A. Enzymatic properties of a member
(AKR1C19) of the aldo-keto reductase family. Biol Pharm Bull. 2005 Jun;28(6):1075-8.
Ishizuka H, Horinouchi S, Kieser HM, Hopwood DA, Beppu T. A putative two-component
regulatory system involved in secondary metabolism in Streptomyces spp. J Bacteriol.
1992 Dec;174(23):7585-94.
Jalkanen S, Salmi M. Cell surface monoamine oxidases: enzymes in search of a function.
EMBO J. 2001 Aug 1;20(15):3893-901. Review.
Janssen GR, Bibb MJ. Tandem promoters, tsrp1 and tsrp2, direct transcription of the
thiostrepton resistance gene (tsr) of Streptomyces azureus: transcriptional initiation
from tsrp2 occurs after deletion of the -35 region. Mol Gen Genet. 1990 May;221(3):33946.
Jensen SE, Paradkar AS. Biosynthesis and molecular genetics of clavulanic acid. Antonie
Van Leeuwenhoek. 1999 Jan-Feb;75(1-2):125-33. Review.
Jeudy, S, Abergel, C, Claverie, JM. Crystal Structure of Ydhf, an Aldo-Keto Reductase
from Escherichia Coli. To be Published
Jez JM, Penning TM. The aldo-keto reductase (AKR) superfamily: an update. Chem Biol
Interact. 2001 Jan 30;130-132(1-3):499-525.
Jez JM, Bennett MJ, Schlegel BP, Lewis M, Penning TM. Comparative anatomy of the
aldo-keto reductase superfamily. Biochem J. 1997 Sep 15;326 ( Pt 3):625-36. Review.
- 182 -
Literaturverzeichnis
Kahmann JD, Sass HJ, Allan MG, Seto H, Thompson CJ, Grzesiek S. Structural basis for
antibiotic recognition by the TipA class of multidrug-resistance transcriptional
regulators. EMBO J. 2003 Apr 15;22(8):1824-34.
Kalinowski J, Bathe B, Bartels D, Bischoff N, Bott M, Burkovski A, Dusch N, Eggeling L,
Eikmanns BJ, Gaigalat L, Goesmann A, Hartmann M, Huthmacher K, Kramer R, Linke B,
McHardy AC, Meyer F, Mockel B, Pfefferle W, Puhler A, Rey DA, Ruckert C, Rupp O,
Sahm H, Wendisch VF, Wiegrabe I, Tauch A. The complete Corynebacterium glutamicum
ATCC 13032 genome sequence and its impact on the production of L-aspartate-derived
amino acids and vitamins. J Biotechnol. 2003 Sep 4;104(1-3):5-25. Review.
Kaneko T, Nakamura Y, Sato S, Asamizu E, Kato T, Sasamoto S, Watanabe A, Idesawa K,
Ishikawa A, Kawashima K, Kimura T, Kishida Y, Kiyokawa C, Kohara M, Matsumoto M,
Matsuno A, Mochizuki Y, Nakayama S, Nakazaki N, Shimpo S, Sugimoto M, Takeuchi C,
Yamada M, Tabata S. Complete genome structure of the nitrogen-fixing symbiotic
bacterium Mesorhizobium loti. DNA Res. 2000 Dec 31;7(6):331-8.
Katz E, Thompson CJ, Hopwood DA. Cloning and expression of the tyrosinase gene from
Streptomyces antibioticus in Streptomyces lividans. J Gen Microbiol. 1983
Sep;129(9):2703-14.
Kawabuchi M, Hara Y, Nihira T, Yamada Y. Production of butyrolactone autoregulators
by Streptomyces coelicolor A3(2). FEMS Microbiology Letters 1997 157:1 81
Kelemen GH, Viollier PH, Tenor J, Marri L, Buttner MJ, Thompson CJ. A connection
between stress and development in the multicellular prokaryote Streptomyces coelicolor
A3(2). Mol Microbiol. 2001 May;40(4):804-14.
Kelemen GH, Brian P, Flardh K, Chamberlin L, Chater KF, Buttner MJ. Developmental
regulation of transcription of whiE, a locus specifying the polyketide spore pigment in
Streptomyces coelicolor A3 (2). J Bacteriol. 1998 May;180(9):2515-21.
Kelly VP, Ireland LS, Ellis EM, Hayes JD. Purification from rat liver of a novel
constitutively expressed member of the aldo-keto reductase 7 family that is widely
distributed in extrahepatic tissues. Biochem J. 2000 Jun 1;348 Pt 2:389-400.
Kessler RJ, Fanestil DD. Interference by lipids in the determination of protein using
bicinchoninic acid. Anal Biochem. 1986 Nov 15;159(1):138-42.
Literaturverzeichnis
- 183 -
Khokhlov AS, Tovarova II, Borisova LN, Pliner SA, Shevchenko LN, Kornitskaia EIa, Ivkina
NS, Rapoport IA. [The A-factor, responsible for streptomycin biosynthesis by mutant
strains of Actinomyces streptomycini]. Dokl Akad Nauk SSSR. 1967 Nov-Dec;177(1):2325. Russian.
Killham K, Firestone MK. Salt Stress Control of Intracellular Solutes in Streptomycetes
Indigenous to Saline Soils. Appl Environ Microbiol. 1984 Feb;47(2):301-306.
Klinman JP. New quinocofactors in eukaryotes. J Biol Chem. 1996 Nov 1;271(44):2718992. Review.
Klinman JP, Mu D. Quinoenzymes in biology. Annu Rev Biochem. 1994;63:299-344.
Review.
Kormanec J, Sevcikova B. A relation between stress and differentiation in Streptomyces.
Meeting: Biology of streptomycetes and related actinomycetes. Talk 10. 2003 Febr. 27.
Kormanec J, Sevcikova B. Stress-response sigma factor sigma(H) directs expression of
the gltB gene encoding glutamate synthase in Streptomyces coelicolor A3(2). Biochim
Biophys Acta. 2002a Aug 19;1577(1):149-54.
Kormanec J, Sevcikova B. The stress-response sigma factor sigma(H) controls the
expression of ssgB, a homologue of the sporulation-specific cell division gene ssgA, in
Streptomyces coelicolor A3(2). Mol Genet Genomics. 2002b Jun;267(4):536-43.
Kormanec J, Sevcikova B, Halgasova N, Knirschova R, Rezuchova B. Identification and
transcriptional characterization of the gene encoding the stress-response sigma factor
sigma(H) in streptomyces coelicolor A3(2). FEMS Microbiol Lett. 2000 Aug 1;189(1):31-8.
Koshland DE. Application of a Theory of Enzyme Specificity to Protein Synthesis. Proc
Natl Acad Sci U S A. 1958 Feb;44(2):98-104.
Kozma E, Brown E, Ellis EM, Lapthorn AJ. The crystal structure of rat liver AKR7A1. A
dimeric member of the aldo-keto reductase superfamily. J Biol Chem. 2002 May
3;277(18):16285-93.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 1970 Aug 15;227(5259):680-5.
- 184 -
Literaturverzeichnis
Lai C, Xu J, Tozawa Y, Okamoto-Hosoya Y, Yao X, Ochi K. Genetic and physiological
characterization of rpoB mutations that activate antibiotic production in Streptomyces
lividans. Microbiology. 2002 Nov;148(Pt 11):3365-73.
Lee EJ, Karoonuthaisiri N, Kim HS, Park JH, Cha CJ, Kao CM, Roe JH. A master regulator
sigmaB governs osmotic and oxidative response as well as differentiation via a network
of sigma factors in Streptomyces coelicolor. Mol Microbiol. 2005 Sep;57(5):1252-64.
Lee EJ, Cho YH, Kim HS, Ahn BE, Roe JH. Regulation of sigmaB by an anti- and an antianti-sigma factor in Streptomyces coelicolor in response to osmotic stress. J Bacteriol.
2004a Dec;186(24):8490-8.
Lee EJ, Cho YH, Kim HS, Roe JH. Identification of sigmaB-dependent promoters using
consensus-directed search of Streptomyces coelicolor genome. J Microbiol. 2004b
Jun;42(2):147-51.
Lee SC, Omer CA, Brasch MA, Cohen SN. Analysis of recombination occurring at SLP1
att sites. J Bacteriol. 1988 Dec;170(12):5806-13.
Lentzen G, Klinck R, Matassova N, Aboul-ela F, Murchie AI. Structural basis for
contrasting activities of ribosome binding thiazole antibiotics. Chem Biol. 2003
Aug;10(8):769-78.
Li J, Vrielink A, Brick P, Blow DM. Crystal structure of cholesterol oxidase complexed
with a steroid substrate: implications for flavin adenine dinucleotide dependent alcohol
oxidases. Biochemistry. 1993 Nov 2;32(43):11507-15.
Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D, Banerji N, Kanjilal S, Kapur V.
The complete genome sequence of Mycobacterium avium subspecies paratuberculosis.
Proc Natl Acad Sci U S A. 2005 Aug 30;102(35):12344-9.
Li YQ, Chen PL, Chen SF, Wu D, Zheng J. A pair of two-component regulatory genes
ecrA1/A2 in S. coelicolor. J Zhejiang Univ Sci. 2004 Feb;5(2):173-9.
Liljenstrom H, von Heijne G. Translation rate modification by preferential codon usage:
intragenic position effects. J Theor Biol. 1987 Jan 7;124(1):43-55.
Lin YS, Kieser HM, Hopwood DA, Chen CW. The chromosomal DNA of Streptomyces
lividans 66 is linear. Mol Microbiol. 1993 Dec;10(5):923-33
Literaturverzeichnis
- 185 -
Liras P, Asturias JA, Martin JF. Phosphate control sequences involved in transcriptional
regulation of antibiotic biosynthesis. Trends Biotechnol. 1990 Jul;8(7):184-9. Review.
Liu DQ, Liu H, Gao XL, Leak DJ, Zhou NY. Arg169 is essential for catalytic activity of 3hydroxybenzoate 6-hydroxylase from Klebsiella pneumoniae M5a1. Microbiol Res.
2005;160(1):53-9.
Loenen WA, Blattner FR. Lambda Charon vectors (Ch32, 33, 34 and 35) adapted for DNA
cloning in recombination-deficient hosts. Gene. 1983 Dec;26(2-3):171-9.
Lyles GA. Mammalian plasma and tissue-bound semicarbazide-sensitive amine
oxidases: biochemical, pharmacological and toxicological aspects. Int J Biochem Cell
Biol. 1996 Mar;28(3):259-74. Review.
MacNeil DJ. Characterization of a unique methyl-specific restriction system in
Streptomyces avermitilis. J Bacteriol. 1988 Dec;170(12):5607-12.
Malpartida F, Niemi J, Navarrete R, Hopwood DA. Cloning and expression in a
heterologous host of the complete set of genes for biosynthesis of the Streptomyces
coelicolor antibiotic undecylprodigiosin. Gene. 1990 Sep 1;93(1):91-9.
Malpartida F, Hopwood DA. Physical and genetic characterisation of the gene cluster for
the antibiotic actinorhodin in Streptomyces coelicolor A3(2). Mol Gen Genet. 1986
Oct;205(1):66-73.
Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A LABORATORY MANUAL.
1982. (Cold Spring Harbor Laboratory)
Maplestone RA, Stone MJ, Williams DH. The evolutionary role of secondary metabolites-a review. Gene. 1992 Jun 15;115(1-2):151-7. Review.
Martin JF. Phosphate control of the biosynthesis of antibiotics and other secondary
metabolites is mediated by the PhoR-PhoP system: an unfinished story. J Bacteriol. 2004
Aug;186(16):5197-201. Review.
Martin JF, Demain AL. Control of antibiotic biosynthesis. Microbiol Rev. 1980
Jun;44(2):230-51.
- 186 -
Literaturverzeichnis
Martinez-Costa OH, Arias P, Romero NM, Parro V, Mellado RP, Malpartida F. A relA/spoT
homologous gene from Streptomyces coelicolor A3(2) controls antibiotic biosynthetic
genes. J Biol Chem. 1996 May 3;271(18):10627-34.
Masuma R, Tanaka Y, Tanaka H, Omura S. Production of nanaomycin and other
antibiotics by phosphate-depressed fermentation using phosphate-trapping agents. J
Antibiot (Tokyo). 1986 Nov;39(11):1557-64.
McDowall KJ, Thamchaipenet A, Hunter IS. Phosphate control of oxytetracycline
production by Streptomyces rimosus is at the level of transcription from promoters
overlapped by tandem repeats similar to those of the DNA-binding sites of the OmpR
family. J Bacteriol. 1999 May;181(10):3025-32.
Meuser D, Splitt H, Wagner R, Schrempf H. Mutations stabilizing an open conformation
within the external region of the permeation pathway of the potassium channel KcsA.
Eur Biophys J. 2001 Sep;30(5):385-91.
Miguelez EM, Hardisson C, Manzanal MB. Hyphal death during colony development in
Streptomyces antibioticus: morphological evidence for the existence of a process of cell
deletion in a multicellular prokaryote. J Cell Biol. 1999 May 3;145(3):515-25.
Mochizuki S, Hiratsu K, Suwa M, Ishii T, Sugino F, Yamada K, Kinashi H. The large linear
plasmid pSLA2-L of Streptomyces rochei has an unusually condensed gene organization
for secondary metabolism. Mol Microbiol. 2003 Jun;48(6):1501-10.
Mori K. Revision of the absolute configuration of A-factor, the inducer of streptomycin
biosynthesis, basing on the reconfirmed (R)-configuration of (+)-paraconic acid.
Tetrahedon. 1983; 38:2919-2921
Muller F, Voordouw G, Van Berkel WJ, Steennis PJ, Visser S, Van Rooijen PJ. A study of phydroxybenzoate hydroxylase from Pseudomonas fluorescens. Improved purification,
relative molecular mass, and amino acid composition. Eur J Biochem. 1979 Nov
1;101(1):235-44.
Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed
chain reaction. Methods Enzymol. 1987;155:335-50.
Murakami T, Holt TG, Thompson CJ. Thiostrepton-induced gene expression in
Streptomyces lividans. J Bacteriol. 1989 Mar;171(3):1459-66.
Literaturverzeichnis
- 187 -
Muth G, Farr M, Hartmann V, Wohlleben W. Streptomyces ghanaensis plasmid pSG5:
nucleotide sequence analysis of the self-transmissible minimal replicon and
characterization of the replication mode. Plasmid. 1995 Mar;33(2):113-26
Muth G, Nussbaumer B, Wohlleben W, Puehler A. A vector system with temperaturesensitive replication for gene disruption and mutational cloning in streptomycetes. Mol
Gen Genet. 1989, 219:341-348
Nakano T, Miyake K, Endo H, Dairi T, Mizukami T, Katsumata R. Identification and
cloning of the gene involved in the final step of chlortetracycline biosynthesis in
Streptomyces aureofaciens. Biosci Biotechnol Biochem. 2004 Jun;68(6):1345-52.
Narva KE, Feitelson JS. Nucleotide sequence and transcriptional analysis of the redD
locus of Streptomyces coelicolor A3(2). J Bacteriol. 1990 Jan;172(1):326-33.
Nielsen H, Krogh A. Prediction of signal peptides and signal anchors by a hidden
Markov model. Proc Int Conf Intell Syst Mol Biol. 1998;6:122-30.
Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and
eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 1997
Jan;10(1):1-6.
Okamoto-Hosoya Y, Hosaka T, Ochi K. An aberrant protein synthesis activity is linked
with antibiotic overproduction in rpsL mutants of Streptomyces coelicolor A3(2).
Microbiology. 2003a Nov;149(Pt 11):3299-309.
Okamoto-Hosoya Y, Okamoto S, Ochi K. Development of antibiotic-overproducing strains
by site-directed mutagenesis of the rpsL gene in Streptomyces lividans. Appl Environ
Microbiol. 2003b Jul;69(7):4256-9.
Okamoto S, Lezhava A, Hosaka T, Okamoto-Hosoya Y, Ochi K. Enhanced expression of Sadenosylmethionine synthetase causes overproduction of actinorhodin in Streptomyces
coelicolor A3(2). J Bacteriol. 2003 Jan;185(2):601-9.
Onaka H, Nakagawa T, Horinouchi S. Involvement of two A-factor receptor homologues
in Streptomyces coelicolor A3(2) in the regulation of secondary metabolism and
morphogenesis. Mol Microbiol. 1998 May;28(4):743-53.
- 188 -
Literaturverzeichnis
Ortiz-Maldonado M, Entsch B, Ballou DP. Oxygen reactions in p-hydroxybenzoate
hydroxylase utilize the H-bond network during catalysis. Biochemistry. 2004 Dec
7;43(48):15246-57.
Ortiz-Maldonado M, Entsch B, Ballou DP. Conformational changes combined with
charge-transfer interactions are essential for reduction in catalysis
hydroxybenzoate hydroxylase. Biochemistry. 2003 Sep 30;42(38):11234-42.
by
p-
Palfey BA, Murthy YV, Massey V. Altered balance of half-reactions in phydroxybenzoate hydroxylase caused by substituting the 2'-carbon of FAD with
fluorine. J Biol Chem. 2003 Jun 20;278(25):22210-6.
Palfey BA, Basu R, Frederick KK, Entsch B, Ballou DP. Role of protein flexibility in the
catalytic cycle of p-hydroxybenzoate hydroxylase elucidated by the Pro293Ser mutant.
Biochemistry. 2002 Jul 2;41(26):8438-46.
Palfey BA, Moran GR, Entsch B, Ballou DP, Massey V. Substrate recognition by
"password" in p-hydroxybenzoate hydroxylase. Biochemistry. 1999 Jan 26;38(4):1153-8.
Park BH, Levy SB. The cryptic tetracycline resistance determinant on Tn4400 mediates
tetracycline degradation as well as tetracycline efflux. Antimicrob Agents Chemother.
1988 Dec;32(12):1797-800.
Parkhill J, Ansari AZ, Wright JG, Brown NL, O'Halloran TV. Construction and
characterization of a mercury-independent MerR activator (MerRAC): transcriptional
activation in the absence of Hg(II) is accompanied by DNA distortion. EMBO J. 1993
Feb;12(2):413-21.
Phillips RW, Wiegel J, Berry CJ, Fliermans C, Peacock AD, White DC, Shimkets LJ.
Kineococcus radiotolerans sp. nov., a radiation-resistant, gram-positive bacterium. Int J
Syst Evol Microbiol. 2002 May;52(Pt 3):933-8.
Plotho Ov. Farbstoffbildung bei Actinomyceten. Die Naturwissenschaften. 1947; 34:190.
Potuckova L, Kelemen GH, Findlay KC, Lonetto MA, Buttner MJ, Kormanec J. A new RNA
polymerase sigma factor, sigma F, is required for the late stages of morphological
differentiation in Streptomyces spp. Mol Microbiol. 1995 Jul;17(1):37-48.
Literaturverzeichnis
- 189 -
Price B, Adamidis T, Kong R, Champness W. A Streptomyces coelicolor antibiotic
regulatory gene, absB, encodes an RNase III homolog. J Bacteriol. 1999
Oct;181(19):6142-51.
Price CW, Fawcett P, Ceremonie H, Su N, Murphy CK, Youngman P. Genome-wide
analysis of the general stress response in Bacillus subtilis. Mol Microbiol. 2001
Aug;41(4):757-74.
Rajasekharan S, Rajasekharan R, Vaidyanathan CS. Substrate-mediated purification and
characterization of a 3-hydroxybenzoic acid-6-hydroxylase from Micrococcus. Arch
Biochem Biophys. 1990 Apr;278(1):21-5.
Rao ST, Rossmann MG. Comparison of super-secondary structures in proteins. J Mol
Biol. 1973 May 15;76(2):241-56.
Rebollo A, Gil JA, Liras P, Asturias JA, Martin JF. Cloning and characterization of a
phosphate-regulated promoter involved in phosphate control of candicidin biosynthesis.
Gene. 1989 Jun 30;79(1):47-58.
Richter G, Fischer M, Krieger C, Eberhardt S, Luttgen H, Gerstenschlager I, Bacher A.
Biosynthesis of riboflavin: characterization of the bifunctional deaminase-reductase of
Escherichia coli and Bacillus subtilis. J Bacteriol. 1997 Mar;179(6):2022-8.
Rondeau JM, Tete-Favier F, Podjarny A, Reymann JM, Barth P, Biellmann JF, Moras D.
Novel NADPH-binding domain revealed by the crystal structure of aldose reductase.
Nature. 1992 Jan 30;355(6359):469-72.
Rose RE. The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988 Jan
11;16(1):355.
Schagger H, von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel
electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal
Biochem. 1987 Nov 1;166(2):368-79.
Scheu AK, Martinez E, Soliveri J, Malpartida F. abaB, a putative regulator for secondary
metabolism in Streptomyces. FEMS Microbiol Lett. 1997 Feb 1;147(1):29-36.
Schrempf H, Bujard H, Hopwood DA, Goebel W. Isolation of covalently closed circular
deoxyribonucleic acid from Streptomyces coelicolor A3(2). J Bacteriol. 1975
Feb;121(2):416-21.
- 190 -
Literaturverzeichnis
Schreuder HA, Prick PA, Wierenga RK, Vriend G, Wilson KS, Hol WG, Drenth J. Crystal
structure of the p-hydroxybenzoate hydroxylase-substrate complex refined at 1.9 A
resolution. Analysis of the enzyme-substrate and enzyme-product complexes. J Mol Biol.
1989 Aug 20;208(4):679-96.
Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: An automated protein
homology-modeling server. Nucleic Acids Res. 2003 Jul 1;31(13):3381-5.
Seibold B, Matthes M, Eppink MH, Lingens F, Van Berkel WJ, Muller R. 4Hydroxybenzoate hydroxylase from Pseudomonas sp. CBS3. Purification,
characterization, gene cloning, sequence analysis and assignment of structural features
determining the coenzyme specificity. Eur J Biochem. 1996 Jul 15;239(2):469-78.
Sejlitz T, Neujahr HY. Phenol hydroxylase from yeast. A model for phenol binding and
an improved purification procedure. Eur J Biochem. 1987 Dec 30;170(1-2):343-9.
Sevcikova B, Mazurakova V, Kormanec J. Characterization of the alternative sigma factor
sigmaG in Streptomyces coelicolor A3(2). Folia Microbiol (Praha). 2005;50(1):47-58.
Sevcikova B, Kormanec J. Differential production of two antibiotics of Streptomyces
coelicolor A3(2), actinorhodin and undecylprodigiosin, upon salt stress conditions. Arch
Microbiol. 2004 May;181(5):384-9.
Sevcikova B, Benada O, Kofronova O, Kormanec J. Stress-response sigma factor sigma(H)
is essential for morphological differentiation of Streptomyces coelicolor A3(2). Arch
Microbiol. 2001 Dec;177(1):98-106.
Sheldon PJ, Busarow SB, Hutchinson CR. Mapping the DNA-binding domain and target
sequences of the Streptomyces peucetius daunorubicin biosynthesis regulatory protein,
DnrI. Mol Microbiol. 2002 Apr;44(2):449-60.
Shi W, Zusman DR. Fatal attraction. Nature. 1993 Dec 2;366(6454):414-5.
Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto
EK, Goeke NM, Olson BJ, Klenk DC. Measurement of protein using bicinchoninic acid.
Anal Biochem. 1985 Oct;150(1):76-85. Erratum in: Anal Biochem 1987 May 15;163(1):279.
Speer BS, Salyers AA. Characterization of a novel tetracycline resistance that functions
only in aerobically grown Escherichia coli. J Bacteriol. 1988 Apr;170(4):1423-9.
Literaturverzeichnis
- 191 -
Sola-Landa A, Moura RS, Martin JF. The two-component PhoR-PhoP system controls
both primary metabolism and secondary metabolite biosynthesis in Streptomyces
lividans. Proc Natl Acad Sci U S A. 2003 May 13;100(10):6133-8.
Strauch E, Takano E, Baylis HA, Bibb MJ. The stringent response in Streptomyces
coelicolor A3(2). Mol Microbiol. 1991 Feb;5(2):289-98.
Strohl WR. Compilation and analysis of DNA sequences associated with apparent
streptomycete promoters. Nucleic Acids Res. 1992 Mar 11;20(5):961-74. Review.
Studholme DJ, Bentley SD, Kormanec J. Bioinformatic identification of novel regulatory
DNA sequence motifs in Streptomyces coelicolor. BMC Microbiol. 2004 Apr 8;4:14.
Suemori A, Nakajima K, Kurane R, Nakamura Y. o-, m- and p-hydroxybenzoate
degradative pathways in Rhodococcus erythropolis. FEMS Microbiol Lett. 1995 Jan
1;125(1):31-5.
Suwa M, Sugino H, Sasaoka A, Mori E, Fujii S, Shinkawa H, Nimi O, Kinashi H.
Identification of two polyketide synthase gene clusters on the linear plasmid pSLA2-L in
Streptomyces rochei. Gene. 2000 Apr 4;246(1-2):123-31.
Takano E, Tao M, Long F, Bibb MJ, Wang L, Li W, Buttner MJ, Bibb MJ, Deng ZX, Chater
KF. A rare leucine codon in adpA is implicated in the morphological defect of bldA
mutants of Streptomyces coelicolor. Mol Microbiol. 2003 Oct;50(2):475-86.
Takano E, Chakraburtty R, Nihira T, Yamada Y, Bibb MJ. A complex role for the gammabutyrolactone SCB1 in regulating antibiotic production in Streptomyces coelicolor
A3(2). Mol Microbiol. 2001 Sep;41(5):1015-28.
Thompson CJ, Kieser T, Ward JM, Hopwood DA. Physical analysis of antibiotic-resistance
genes from Streptomyces and their use in vector construction. Gene. 1982a Nov;20(1):5162.
Thompson CJ, Skinner RH, Thompson J, Ward JM, Hopwood DA, Cundliffe E. Biochemical
characterization of resistance determinants cloned
streptomycetes. J Bacteriol. 1982b Aug;151(2):678-85.
from
antibiotic-producing
Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl
Acad Sci U S A. 1979 Sep;76(9):4350-4.
- 192 -
Literaturverzeichnis
Tsao SW, Rudd BA, He XG, Chang CJ, Floss HG. Identification of a red pigment from
Streptomyces coelicolor A3(2) as a mixture of prodigiosin derivatives. J Antibiot (Tokyo).
1985 Jan;38(1):128-31.
Tu SC, Romero FA, Wang LH. Uncoupling of the substrate monooxygenation and
reduced pyridine nucleotide oxidation activities of salicylate hydroxylase by flavins.
Arch Biochem Biophys. 1981 Jul;209(2):423-32.
Uguru GC, Stephens KE, Stead JA, Towle JE, Baumberg S, McDowall KJ. Transcriptional
activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in
Streptomyces coelicolor. Mol Microbiol. 2005 Oct;58(1):131-50.
Umeyama T, Tanabe Y, Aigle BD, Horinouchi S. Expression of the Streptomyces
coelicolor A3(2) ptpA gene encoding a phosphotyrosine protein phosphatase leads to
overproduction of secondary metabolites in S. lividans. FEMS Microbiol Lett. 1996 Nov
1;144(2-3):177-84.
van Dalen A, Schrempf H, Killian JA, de Kruijff B. Efficient membrane assembly of the
KcsA potassium channel in Escherichia coli requires the protonmotive force. EMBO
Rep. 2000 Oct;1(4):340-6.
Vara J, Lewandowska-Skarbek M, Wang YG, Donadio S, Hutchinson CR. Cloning of genes
governing the deoxysugar portion of the erythromycin biosynthesis pathway in
Saccharopolyspora erythraea (Streptomyces erythreus). J Bacteriol. 1989
Nov;171(11):5872-81.
Verma S, Bhatia Y, Valappil SP, Roy I. A possible role of poly-3-hydroxybutyric acid in
antibiotic production in Streptomyces. Arch Microbiol. 2002 Dec;179(1):66-9.
Villarejo MR, Zabin I. Beta-galactosidase from termination and deletion mutant strains.
J Bacteriol. 1974 Oct;120(1):466-74.
Viollier PH, Weihofen A, Folcher M, Thompson CJ. Post-transcriptional regulation of the
Streptomyces coelicolor stress responsive sigma factor, SigH, involves translational
control, proteolytic processing, and an anti-sigma factor homolog. J Mol Biol. 2003a Jan
24;325(4):637-49.
Viollier PH, Kelemen GH, Dale GE, Nguyen KT, Buttner MJ, Thompson CJ. Specialized
osmotic stress response systems involve multiple SigB-like sigma factors in Streptomyces
coelicolor. Mol Microbiol. 2003b Feb;47(3):699-714.
Literaturverzeichnis
- 193 -
Vivian A, Hopwood DA. Genetic control of fertility in Streptomyces coelicolor A3(2): the
IF fertility type. J Gen Microbiol. 1970 Nov;64(1):101-17.
Volker U, Maul B, Hecker M. Expression of the sigmaB-dependent general stress regulon
confers multiple stress resistance in Bacillus subtilis. J Bacteriol. 1999 Jul;181(13):3942-8.
Wang J, Ortiz-Maldonado M, Entsch B, Massey V, Ballou D, Gatti DL. Protein and ligand
dynamics in 4-hydroxybenzoate hydroxylase. Proc Natl Acad Sci U S A. 2002 Jan
22;99(2):608-13.
Wang LH, Hamzah RY, Yu YM, Tu SC. Pseudomonas cepacia 3-hydroxybenzoate 6hydroxylase: induction, purification, and characterization. Biochemistry. 1987 Feb
24;26(4):1099-104.
Wang SX, Nakamura N, Mure M, Klinman JP, Sanders-Loehr J. Characterization of the
native lysine tyrosylquinone cofactor in lysyl oxidase by Raman spectroscopy. J Biol
Chem. 1997 Nov 14;272(46):28841-4.
White J, Bibb M. bldA dependence of undecylprodigiosin production in Streptomyces
coelicolor A3(2) involves a pathway-specific regulatory cascade. J Bacteriol. 1997
Feb;179(3):627-33.
Whittle G, Hund BD, Shoemaker NB, Salyers AA. Characterization of the 13-kilobase
ermF region of the Bacteroides conjugative transposon CTnDOT. Appl Environ
Microbiol. 2001 Aug;67(8):3488-95.
Wietzorrek A, Bibb M. A novel family of proteins that regulates antibiotic production in
streptomycetes appears to contain an OmpR-like DNA-binding fold. Mol Microbiol. 1997
Sep;25(6):1181-4.
Williamson NR, Simonsen HT, Ahmed RA, Goldet G, Slater H, Woodley L, Leeper FJ,
Salmond GP. Biosynthesis of the red antibiotic, prodigiosin, in Serratia: identification of
a novel 2-methyl-3-n-amyl-pyrrole (MAP) assembly pathway, definition of the terminal
condensing enzyme, and implications for undecylprodigiosin biosynthesis in
Streptomyces. Mol Microbiol. 2005 May;56(4):971-89.
Wilson DK, Nakano T, Petrash JM, Quiocho FA. 1.7 A structure of FR-1, a fibroblast
growth factor-induced member of the aldo-keto reductase family, complexed with
coenzyme and inhibitor. Biochemistry. 1995 Nov 7;34(44):14323-30.
- 194 -
Literaturverzeichnis
Wilson DK, Tarle I, Petrash JM, Quiocho FA. Refined 1.8 A structure of human aldose
reductase complexed with the potent inhibitor zopolrestat. Proc Natl Acad Sci U S A.
1993 Nov 1;90(21):9847-51.
Wilson DK, Bohren KM, Gabbay KH, Quiocho FA. An unlikely sugar substrate site in the
1.65 A structure of the human aldose reductase holoenzyme implicated in diabetic
complications. Science. 1992 Jul 3;257(5066):81-4.
Wood WB. Host specificity of DNA produced by Escherichia coli: bacterial mutations
affecting the restriction and modification of DNA. J Mol Biol. 1966 Mar;16(1):118-33.
Woodcock DM, Crowther PJ, Doherty J, Jefferson S, DeCruz E, Noyer-Weidner M, Smith
SS, Michael MZ, Graham MW. Quantitative evaluation of Escherichia coli host strains
for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids
Res. 1989 May 11;17(9):3469-78.
Wright GD. Allostery trumps antibiotic resistance. Structure. 2005 Aug;13(8):1089-90.
Yang W, Moore IF, Koteva KP, Bareich DC, Hughes DW, Wright GD. TetX is a flavindependent monooxygenase conferring resistance to tetracycline antibiotics. J Biol Chem.
2004 Dec 10;279(50):52346-52.
Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host
strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 1985;33(1):10319. Erratum in: Gene. 1992 May 1;114(1):81-3.
Yonekawa T, Ohnishi Y, Horinouchi S. Involvement of amfC in physiological and
morphological development in Streptomyces coelicolor A3(2). Microbiology. 1999
Sep;145 ( Pt 9):2273-80.
You IS, Murray RI, Jollie D, Gunsalus IC. Purification and characterization of salicylate
hydroxylase from Pseudomonas putida PpG7. Biochem Biophys Res Commun. 1990 Jun
29;169(3):1049-54.
Zazopoulos E, Huang K, Staffa A, Liu W, Bachmann BO, Nonaka K, Ahlert J, Thorson JS,
Shen B, Farnet CM. A genomics-guided approach for discovering and expressing cryptic
metabolic pathways. Nat Biotechnol. 2003 Feb;21(2):187-90.
Anhang A-E
ANHANG
i
ii
Anhang A
Anhang A
iii
iv
Anhang A
Anhang A
v
vi
Anhang A
Anhang A
vii
viii
Anhang A
Anhang A
ix
x
Anhang A
Anhang A
xi
xii
Anhang A
Anhang A
xiii
xiv
Anhang A
Anhang A: Der sequenzierte 13920 Bp lange Abschnitt aus S.lividans 66. Die Sequenz ist doppelsträngig
dargestellt, die jeweils determinierte Aminosäuresequenz der Proteine in grün. Die jeweils 19 Bp langen
„inverted repeats“ des zwischen ksuL und ksuF gelegenen Terminators sind durch rote Pfeile markiert. Die
potentiellen Ribosomen-Bindestellen (Shine-Delgarno) sind jeweils in Fett dargestellt, eine zweite mögliche
Bindestelle vor ksuC ist unterstrichen. Die möglichen Bindestellen wurden aus der Sequenz des 3’ Endes der
16S rRNA von S.lividans erstellt (3’-OH-UCUUUCCUCCACUAG-5’; Bibb, M.J., et al; 1985). Alle liegen im
beschriebenen Bereich zwischen 5-12 Nukleotiden (Durchschnitt von 8,5) vor dem Startkodon, hierbei wird der
Abstand vom A, bzw. des entsprechenden Nukleotids der GGAGG Konsensussequenz zum ersten Nukleotid des
Starkodons berechnet (Strohl, W. R.; 1992). Die zwischen ksuF und kcsA gefundenen repetetiven Sequenzen
sind in schwarz (Palyndrome), in rot („direct repeats“) und in grün („invertet repeats“) durch Linien oder Pfeile
markiert. Es wurden nur „direct repeats ab einer Länge von 6 und „invertet repeats“ ab 7 Nukleotiden
eingetragen. Die Signalpeptidase-Schnittstelle in KsuL ist durch einen roten Pfeil markiert, die Schnittstelle
zwischen der N-terminalen und C-terminalen Domäne durch einen blauen Pfeil.
Anhang B
xv
Anhang B: Terminatorstruktur zwischen ksuF und ksuL. Im intergenischen Bereich zwischen ksuL und ksuF
findet sich eine 45 Bp lange Terminator-Struktur, die aus zwei 19 Bp „invertet repeats“ und einem 7 Bp langen
Loop-Bereich gebildet wird. Dargestellt ist die Terminator-Struktur in Leserichtung von ksuF.
xvi
Anhang C
Anhang C
xvii
xviii
Anhang C
Anhang C
xix
Anhang C: Konstruktion von pACYC001 bis pACYC010. Die in pACYC001 bis pACYC010 inserierten
Fragmente wurden zur Konstruktion der pOV001-pOV010 Konstrukte mit XbaI/PstI ausgeschnitten und mit
pWHM3be ligiert.
Anhang Tabelle D
xx
Probe
A1
A2
A3
A4
Durchschnitt A1-4
σx A1-4
B1
B2
B3
B4
B5
Durchschnitt B1-5
σx B1-5
C1
C2
C3
C4
C5
Durchschnitt C1-5
σx C1-5
Gesamt D
σx D
Konz. FAD
(in mM)
0,01534
0,01967
0,01592
0,00923
0,015037
Konz. Protein
(in mM)
0,0165
0,0183
0,0158
0,0095
0,015025
0,00642
0,01320
0,01145
0,01086
0,00641
0,01028
0,007
0,0146
0,016
0,0123
0,0072
0,01142
0,01506
0,01642
0,01377
0,007942
0,003521
0,0115361
0,0142
0,0163
0,0123
0,008
0,0036
0,01088
Verhältnis
FAD/Protein
0,92945818
1,07482022
1,00743481
0,97113368
0,99571172
0,06161493
0,91677857
0,90389795
0,90776750
0,88295122
0,88978889
0,90023683
0,01370853
1,06038
1,00749
1,119297
0,992786
0,978158
1,03162242
0,0580149
0,9744388
0,074055
Anhang Tabelle D: Messwerte der FAD/KsuF Verhältnisbestimmung. Dargestellt sind die drei
unterschiedlichen Messreihen (A1-A4, B1-B5 und C1-C5), die jeweiligen FAD- und Proteinkonzentrationen und
das FAD/Protein-Verhältnis, des Weiteren die Mittelwerte der einzelnen Messreihen, das
Gesamtdurchschnittverhältnis (D) und jeweils die Standartabweichung (mittlerer Fehler) σx.
Anhang E
xxi
Anhang E: Sequenzvergleich von KsuL mit den homologen Proteinen. Dargestellt sind, neben KsuL, die
homologen Proteine aus S.avermitilis (BAC72171), S.scabies (4945557-4943764) und Nocardia spec. JS614
(ZP_00656873). Die mit KsuL identischen Aminosäuren sind schwarz hinterlegt, die homologen grau. Die vier
jeweils konservierten Cysteine sind rot umrandet, die Position der Signalpeptidase Schnittstelle in KsuL ist
durch einen roten Pfeil, die proteolytische Schnittstelle zwischen der N- und C-terminalen Domäne von KsuL
durch einen blauen Pfeil markiert.
Hiermit versichere ich, dass die vorliegende Dissertation selbständig und ohne unerlaubte
Hilfe verfasst und keine anderen Quellen und Hilfsmittel als die angegebenen verwendet
wurden.
Ich versichere, dass ich weder an der Universität Osnabrück noch anderweitig versucht habe,
eine Dissertation einzureichen oder mich einer Promotionsprüfung zu unterziehen.
______________________
Ort, Datum
______________________
Unterschrift
Ich danke Frau Prof. Dr. H. Schrempf für die Überlassung des interessanten Themas, für die
Betreuung und die Korrekturen.
Herrn PD Dr. U. Keller danke ich für die Übernahme des Koreferats.
Bei Herrn Jan Kormanec bedanke ich mich für die Überlassung der sigH- und sigFDeletionsstämme.
Und meiner gesamten Arbeitsgruppe, der „Angewandten Genetik der Mikroorganismen“,
danke ich für das gute Arbeitsklima.
Und natürlich bedanke ich mich bei allen Personen, die mich in irgendeiner Weise unterstützt
haben, wie auch für die Unterstützung durch meine Familie.
>>…Das ist das gleiche<<
Karl Edward Wagner,
Lynortis’ Reprise
Herunterladen