- Universität zu Köln

Werbung
Spezifische Elimination Hepatitis B Virus infizierter
Hepatozyten durch modifizierte humane T-Zellen die
einen chimären T-Zellrezeptor exprimieren und eine
zytotoxische Immunantwort etablieren
Inaugural-Dissertation
zur
Erlangung des Doktorgrades
der Mathematisch-Naturwissenschaftlichen Fakultät
der Universität zu Köln
vorgelegt von
Felix Bohne
aus Stuttgart
Köln, September 2006
Berichterstatter:
Prof. Dr. Jens C. Brüning
Prof. Dr. Hinrich Abken
PD Dr. Ulrike Protzer
Prüfungsvorsitzender:
Tag der Disputation:
Prof. Dr. Helmut W. Klein
28.November 2006
Zusammenfassung
Eine Infektion mit dem Hepatitis B Virus führt in einem Teil der Patienten zu einem
chronischen Infektionsverlauf mit schwerwiegenden Spätfolgen. Die Ursache dafür ist
die Etablierung einer unzureichenden schwachen und oligoklonalen T-Zellantwort, die
nur gegen wenige Epitope des HBV gerichtet ist. Ein Hauptziel bei der Therapie der
chronischen
Hepatitis
B
stellt
die
Entfernung
der
persistierenenden
viralen
Replikationsmatritze dar, der sogenannten kovalent geschlossenen zirkulären DNA
(cccDNA). Die gängigen Therapien umfassen Hemmstoffe der viralen Replikation
(Interferon α) und der viralen reversen Transkription (Lamivudin). Dadurch kann die
Virusreplikation zwar zum Teil kontrolliert, jedoch keine Elimination der episomalen
cccDNA erreicht werden, von der nach Beendigung der Therapie eine neue
Replikationsrunde initiiert werden kann.
Ein möglicher therapeutischer Ansatz für eine erfolgreiche Behandlung der
chronischen Hepatitis B stellt eine künstliche T-Zellantwort mit rezeptormodifizierten TZellen dar. Im Rahmen dieser Arbeit wurden dafür HBV-spezifische chimäre TZellrezeptoren generiert und durch retrovirale Transduktion in T-Zellen transferiert.
Diese chimären Rezeptoren tragen ein extrazelluläres Antikörperfragment für die
Antigenerkennung und sind dadurch unabhängig von der Antigenpräsentation durch
MHC-Moleküle. Als Antigen für diese chimären T-Zellrezeptoren dienten zwei HBVHüllproteine, die in die Zellmembran der infizierten Zelle eingelagert werden. Die
Antigenerkennung bewirkte eine Aktivierung der T-Zellen, wobei eine modulare
Signaldomäne sowohl ein T-Zellrezeptorsignal als auch ein kostimulatorisches Signal
generierte. Dies führte zur spezifischen Elimination HBV-infizierter Hepatozyten und
zur Entfernung der episomalen Replikationsmatritze. Außerdem wurde die Sekretion
des proinflammatorischen Zytokins Interferon γ und zusätzlich die Sekretion von
Interleukin-2 induziert. Dadurch wurde ein proliferatives Signal generiert, das eine
antigenspezifische Expansion der T-Zellen bewirkte. Die Apoptose der Zielzellen wurde
durch Degranulation Perforin und Granzym enthaltender Vesikel vermittelt und es kam
zur
Aktivierung
des
Transkriptionsfaktors
NFκB
und
der
proapoptotischen
Effektorcaspasen 3 und 7.
Durch diese Ergebnisse konnte gezeigt werden, daß eine solche gentherapeutische TZellrezeptormodifikation die Elimination HBV-infizierter Zielzellen vermitteln kann und
das Hauptziel der Therapie, die Entfernung der episomalen Replikationsmatritze
erreicht wird. Dieses System könnte eine vielversprechende Alternative zu den
Standardtherapien der chronischen HBV-Infektion darstellen.
Abstract
For a proportion of patients, HBV infection results in chronic desease with severe
consequences like liver cirrhosis or hepatocellular carcinoma. This results from a weak
and oligoclonal T-cell response targeting only limited HBV epitopes. A major goal in the
therapy of chronic HBV infection is the elimination of the episomal replication template,
the so called covalently closed circular DNA (cccDNA). The therapeutic approaches
are inhibitors of viral replication (interferon α) or inhibitors of viral reverse transcription
(Lamivudin). By these means replication is controlled partially but cccDNA persists,
generating a relaps of infection after therapy has ceased.
A possible immunotherapeutical approach for a succesfull treatment could be
acchieved by receptormodified T-cells inducing an artificial T-cell response. Therefore,
T-cells were equipped with recombinant T-cell receptors, using single chain antibody
fragments (scFv) for antigen recognition and hence beeing independent of peptide
antigen presentation via MHC-molecules. The chimeric T-cell receptors, generated in
this work, are directed against two HBV surface proteines, which are present on the
surface of infected cells, as a result of virus production and secretion.
Modified T-cells were activated upon antigen recognition resulting in the generation of
a T-cell receptor signal and a costimulatory signal provided by a modular signalling
domain. HBV-infected primary human hepatocytes were specifically eliminiated and the
episomal replication template was removed. Furtheron activation led to the secretion of
proinflammatory interferon γ and of interleukin-2. This generated a proliferative signal
inducing an antigen specific expansion of receptor modified T-cells. Apoptosis of target
cells was mediated through degranulation of perforin and granzyme containing vesicles
and activation of NFκB and proapoptotic effector caspases 3 and 7 was observed.
These results demonstrate that a genetherapeutic modification of T-cells results in
specific elimination of HBV infected hepatocytes. Since the therapeutic goal, the
elimination of cccDNA was acchieved, this system could be a promising alternative to
the actual standard therapeutics against HBV.
Inhaltsverzeichnis
Inhaltsverzeichnis
Zusammenfassung....................................................................................................................... III
Abstract ........................................................................................................................................ IV
Inhaltsverzeichnis.......................................................................................................................... V
1 Einleitung .................................................................................................................................. 1
1.1 Das Immunsystem................................................................................................................... 1
1.2 Das angeborene Immunsystem .............................................................................................. 3
1.3 Die adaptive Immunantwort .................................................................................................... 4
1.4 T-Lymphozyten........................................................................................................................ 5
1.5 Der T-Zellrezeptorkomplex...................................................................................................... 7
1.6 Die zytotoxische T-Zellantwort .............................................................................................. 10
1.7 Adoptive T-Zelltherapie ......................................................................................................... 12
1.8 Modifikation von T-Zellrezeptoren......................................................................................... 13
1.9 Gentransfer in primäre humane T-Zellen.............................................................................. 16
1.10 Hepatitis B Virus.................................................................................................................. 17
1.11 Epidemiologie der HBV-Infektion ........................................................................................ 18
1.12 Partikelaufbau des HBV ...................................................................................................... 19
1.13 Genomorganisation des HBV.............................................................................................. 21
1.14 Replikationszyklus des HBV ............................................................................................... 22
1.16 HBV-spezifische Immunantwort .......................................................................................... 26
2 Ergebnisse .............................................................................................................................. 30
2.1 Generierung chimärer T-Zellrezeptorkonstrukte ................................................................... 30
2.2 Charakterisierung der chimären T-Zellrezeptoren ................................................................ 32
2.3 Produktion retro- und lentiviraler Vektoren ........................................................................... 33
2.4 Primäre humane T-Zellen ..................................................................................................... 35
2.4.1 Präparation und Charakterisierung .................................................................................... 35
2.4.2 Retro- und lentivirale Transduktion .................................................................................... 37
2.5 Herstellung HBV-replizierender Hepatomazelllinien ............................................................. 40
2.6 Zytotoxizität HBV-spezifischer T-Zellen ................................................................................ 43
2.6.1 HBV-replizierende Hepatomazellen als Zielzellen ............................................................. 43
2.6.2 Zeitlicher Verlauf der Rezeptoraktivierung......................................................................... 44
2.6.3 Vergleich HBV-replizierender Zielzellen ............................................................................ 47
2.6.4 Lamp-2 Mobilisierung......................................................................................................... 48
2.6.5 Maximale Zytotoxizität........................................................................................................ 49
2.6.6 Dosisabhängigkeit der zytotoxischen T-Zellantwort........................................................... 50
2.6.7 Antigenspezifische Proliferation ......................................................................................... 51
2.7 HBV-infizierte primäre humane Hepatozyten als Zielzellen.................................................. 52
2.7.1 Lebertransaminasen als Marker der Zytotoxizität .............................................................. 53
V
Inhaltsverzeichnis
2.7.2 Zytokinsekretion ................................................................................................................. 54
2.7.3 Intrazelluläre HBV DNA...................................................................................................... 54
2.7.4 Intrazelluläres HBV Kapsid-Protein.................................................................................... 57
2.7.5 Sekretion von HBV-Antigenen ........................................................................................... 57
2.8 Charakterisierung der zytotoxischen T-Zellantwort............................................................... 58
2.8.1 NFκB Aktivierung ............................................................................................................... 58
2.8.2 Caspaseaktivierung............................................................................................................ 60
2.8.3 CD95-Expression ............................................................................................................... 62
2.9 Charakterisierung rezeptortragender T-Zellen...................................................................... 63
2.9.1 Aktivierung durch HBV-Partikel.......................................................................................... 63
2.9.2 Aktivierung des CEA-spezifischen Kontrollrezeptors......................................................... 65
3 Diskussion .............................................................................................................................. 67
3.1 HBV-spezifische Immunantwort ............................................................................................ 68
3.2 Chimäre T-Zellrezeptoren ..................................................................................................... 69
3.3 Genmodifikation primärer T-Zellen........................................................................................ 70
3.4 Rezeptorvermittelte Zytotoxizität........................................................................................... 71
3.5 Zeitlicher Verlauf der Zytotoxizität......................................................................................... 72
3.6 Elimination HBV-replizierender Hepatomazelllinien.............................................................. 74
3.6.1 Charakterisierung der Zytotoxizität .................................................................................... 74
3.6.2 T-Zellaktivierung und Zytokinsekretion .............................................................................. 75
3.7 Zytotoxische Elimination HBV-infizierter Hepatozyten.......................................................... 77
3.7.1 Charakterisierung der eliminierten Hepatozyten................................................................ 78
3.7.2 Charakterisierung der T-Zellantwort .................................................................................. 79
3.7.3 Apoptoseinduktion.............................................................................................................. 80
3.7.4 HBV-Antigensekretion........................................................................................................ 81
3.8 NFκB Aktivierung .................................................................................................................. 82
3.9 Ausblick ................................................................................................................................. 84
4 Material und Methoden .......................................................................................................... 85
4.1 Biotisches und abiotisches Material ...................................................................................... 85
4.1.1 Verbrauchsmaterial ............................................................................................................ 85
4.1.2 Chemikalien........................................................................................................................ 85
4.1.3 Kits ..................................................................................................................................... 87
4.1.4 Medien und Medienzusätze ............................................................................................... 88
4.1.4.1 Zellkultur.......................................................................................................................... 88
4.1.4.2 Antibiotika........................................................................................................................ 88
4.1.4.3 Primäre humane Hepatozyten ........................................................................................ 88
4.1.4.4 Primäre humane Blutlymphozyten .................................................................................. 89
4.1.4.5 Retrovirusproduktion ....................................................................................................... 89
4.1.4.6 Bakterienkultur ................................................................................................................ 89
VI
Inhaltsverzeichnis
4.1.5 Enzyme .............................................................................................................................. 89
4.1.6 Oligonukleotide................................................................................................................... 90
4.1.7 Gewichts- und Längenstandards ....................................................................................... 91
4.1.8 Antikörper ........................................................................................................................... 91
4.1.9 HBV-Antigene..................................................................................................................... 92
4.1.10 Bakterienstämme ............................................................................................................. 92
4.1.11 Vektoren und Plasmide .................................................................................................... 93
4.1.11.1 Vektoren ........................................................................................................................ 93
4.1.11.2 Plasmide........................................................................................................................ 93
4.1.12 Geräte und Software ........................................................................................................ 94
4.1.12.1 Geräte ........................................................................................................................... 94
4.1.12.2 Software ........................................................................................................................ 95
4.2 Methoden .............................................................................................................................. 95
4.2.1 Molekularbiologische Methoden......................................................................................... 95
4.2.1.1 Transformation ................................................................................................................ 95
4.2.1.2 Plasmidpräparation ......................................................................................................... 95
4.2.1.3 Konzentrationsbestimmung von DNA ............................................................................. 96
4.2.1.4 Restriktionsverdau .......................................................................................................... 96
4.2.1.5 Ligation............................................................................................................................ 96
4.2.1.6 Agarosegelelektrophorese .............................................................................................. 97
4.2.1.7 Polymerasekettenreaktion............................................................................................... 97
4.2.1.8 TA-Klonierung ................................................................................................................. 98
4.2.1.9 DNA-Sequenzierung ....................................................................................................... 98
4.2.1.10 Light Cycler© PCR ......................................................................................................... 99
4.2.2 Zellbiologische Methoden ................................................................................................ 100
4.2.2.1 Eukaryontische Zelllinien .............................................................................................. 100
4.2.2.2 Präparation primärer humaner Hepatozyten................................................................. 101
4.2.2.3 HBV-Infektion von PHH................................................................................................. 102
4.2.2.4 Präparation primärer humaner T-Zellen........................................................................ 103
4.2.3 Generierung chimärer TZR Konstrukte............................................................................ 103
4.2.4 Expression der chimären TZR ......................................................................................... 104
4.2.5 Vektorproduktion .............................................................................................................. 104
4.2.6 Transduktion..................................................................................................................... 105
4.2.7 Kokultur mit Hepatomazielzelllinien ................................................................................. 106
4.2.7.1 Herstellung einer HBV transfizierten Hepatomazelllinie ............................................... 106
4.2.7.2 Kokulturen mit HBV-replizierenden Zielzelllinien .......................................................... 107
4.2.7.3 Zytokinsekretionsmessung durch ELISA ...................................................................... 108
4.2.8 Kokultur mit HBV infizierten PHH..................................................................................... 109
4.2.8.1 PHH und cTZR-exprimierende Effektorzellen............................................................... 109
4.2.8.2 Messung der HBV-Antigensekretion durch ELISA........................................................ 109
4.2.8.3 Western Blot der intrazellulären Proteinmengen .......................................................... 109
VII
Inhaltsverzeichnis
4.2.8.4 HBV-DNA-Messung mit Light-Cycler-PCR ................................................................... 110
4.2.9 Charakterisierung der Zytotoxizität .................................................................................. 110
4.2.9.1 NFκB-Aktivierung .......................................................................................................... 110
4.2.9.2 Caspase-Aktivierung ..................................................................................................... 111
4.2.9.3 Caspase Inhibitoren ...................................................................................................... 111
4.2.9.4 Lamp-2 Mobilisierung.................................................................................................... 111
4.2.9.5 Ermittlung der CD95-Expression................................................................................... 111
4.2.9.6 Antigenabhängige Proliferation ..................................................................................... 112
4.2.10 Charakterisierung cTZR-exprimierender T-Zellen ......................................................... 112
4.2.10.1 Aktivierung durch HBV-Partikel................................................................................... 112
4.2.10.2 HBV-Adhärenz an Hepatomazelllinien........................................................................ 113
4.2.10.3 Funktionskontrolle des CEA-spezifischen T-Zellrezeptors ......................................... 113
5 Literatur................................................................................................................................. 114
6 Abkürzungsverzeichnis....................................................................................................... 129
7 Sequenzen ............................................................................................................................ 131
7.1 pBULLET-αS-C8 ................................................................................................................. 131
7.2 pBULLET-αS-C9 ................................................................................................................. 132
7.3 pBULLET-αL-5a19 .............................................................................................................. 134
Danksagung .............................................................................................................................. 136
Erklärung ................................................................................................................................... 137
Lebenslauf................................................................................................................................. 138
VIII
Einleitung
1 Einleitung
1.1 Das Immunsystem
Lebewesen stehen in ständigem Kontakt mit ihrer belebten Umwelt. Dabei kommt es
zum Kontakt mit den verschiedensten Mikroorganismen, welche die funktionellen
Abläufe im Körper bedrohen. Das Immunsystem ist für die Abwehr infektiöser
Krankheitserreger wie Bakterien, Pilze, Viren und auch mehrzelliger Parasiten
unersetzbar, die ständig versuchen sich im Körper zu etablieren. Zusätzlich eliminiert
das
Immunsystem
transformierte
Zellen,
die
sich
zu
malignen
Tumoren
weiterentwickeln können. Das Immunsystem wird grundsätzlich in zwei phylogenetisch
unterschiedlich alte Syteme unterteilt. Die ältere angeborene Immunantwort ist direkt
und nicht antigenspezifisch. Sie basiert auf der Erkennung erregerspezifischer Muster
durch genetisch determinierte Rezeptoren und Effektorproteine und kann schnell
aktiviert werden. Sie stellt die erste Abwehr von schädlichen Mikroorganismen dar. Die
adaptive Immunantwort verläuft langsamer und ist antigenspezifisch. Sie kann auf
neue Erreger oder Antigene durch Adaptation reagieren und hinterlässt ein Gedächtnis
nach erfolgreicher Elimination eines Erregers, das bei erneuter Konfrontation eine
schnellere Aktivierung ermöglicht. Alle Komponenten des Immunsystems basieren auf
weißen Blutzellen, den Leukozyten. Diese und auch die roten Blutkörper (Erythrozyten)
stammen von einem gemeinsamen Progenitor, der hämatopoetischen Stammzelle ab.
Die weitere Differenzierung zu den verschiedenen Vorläuferzellen findet im
Knochenmark statt. Zuerst differenzieren lymphoide und myeloide Vorläuferzellen,
wobei die lymphoide Linie die B-, T- und natürlichen Killerzellen (NK-Zellen) bildet. Aus
der
myeloiden
Linie
entsteht
ein
Granulozyten/Makrophagen-
und
ein
Megakaryozyten/Erythrozytenvorläufer, der die Blutplättchen und Erythrozyten bildet.
Der
Granulozyten/Makrophagenvorläufer
bildet
die
Neutrophilen,
Basophilen,
Eosinophilen, Makrophagen und die Monozyten, aus welchen sich die myeloiden
dendritischen Zellen (dendritic cell, DC) entwickeln. Eine zweite Population von
lymphoiden DC entsteht aus der lymphoiden Vorläuferzelle (Abb. 1.1). Die
Neutrophilen, Makrophagen und DC sind durch Phagozytose, Antigenaufnahme und
Produktion der Komponenten des löslichen Komplementsystems an der angeborenen
Immunantwort beteiligt. Makrophagen und DC präsentieren fremde aufgenommene
Antigene in der Peripherie oder in lymphatischen Organen an die Lymphozyten,
wodurch bei einer spezifischen Erkennung durch den entsprechenden Antigenrezeptor
eine adaptive Immunantwort etabliert wird.
1
Einleitung
Abbildung 1.1: Entstehung und Herkunft der Zellen des Immunsystems
Alle Vorläuferzellen des Immunsystems gehen auf eine pluripotente hämatopoetische
Stammzelle zurück und entwickeln sich im Knochenmark (Bone marraow). Im Blut entwickeln
sich aus einer gemeinsamen lymphoiden Vorläuferzelle B-, T- und NK-Zellen. Aus einer
geeinsamen myeloiden Vorläuferzelle entwickeln sich die Granulozyten/Makrophagen- und die
Megakaryozyten/Erythrozyten Vorläufer. Aus der ersteren entwickeln sich Neutrophile,
Eosinophile, Basophile, Monozyten und die Vorläufer der Mastzellen. Aus den Monozyten
entsetehen Makrophagen und dendritischen Zellen. Eine zweite Population der dendritischen
Zellen entwickelt sich aus einem lymphoiden Vorläufer. (modifiziert nach (Janeway et al., 2004))
Für
die
Erkennung
erregerspezifischer
Proteine
besitzen
T-
und
B-Zellen
Antigenrezeptoren, die T-Zellrezeptoren (TZR) und B-Zellrezeptoren (BZR), wobei
letztere aus membrangebundenen Immunglobulinen bestehen. Beide Rezeptortypen
erreichen durch die somatische Rekombination eine enorme Diversität (Weigert et al.,
1980). Dabei werden während der Zelldifferenzierung verschiedene variable DNASegmente kombiniert, transkribiert und nach der Translation beider Ketten miteinander
verbunden. Dieser Vorgang erzeugt eine Variabilität von ca. 1018 verschiedenen
Antigenspezifitäten, mit der das Immunsystem theoretisch jedes beliebige Antigen
erkennen kann (Janeway et al., 2004).
2
Einleitung
1.2 Das angeborene Immunsystem
Das angeborene Immunsystem besteht aus einer zellulären und einer löslichen
Komponente. Die lösliche Komponente des Komplementsystems besteht aus inaktiven
Effektorproteinen, die im Serum gelöst sind und Zymogene genannt werden. Durch ein
aktivierendes Signal wie die Erkennung durch lösliche Antikörper, wird eine
proteolytische Kaskade ausgelöst. Dieser Verstärkungsprozeß kann zu einer massiven
und schnellen Komplementaktivierung führen und bewirkt zum Beispiel die Elimination
von Erregern durch Phagozytose oder Membrandestabilisierung.
Die
Aufgaben
des
zellulären
Systems
werden
von
verschiedenen
Zellen
wahrgenommen, zu denen Granulozyten, Makrophagen, dendritische Zellen und NKZellen zählen. Die Erkennung von fremden Proteinen oder Makromolekülen findet
durch Mustererkennungsrezeptoren (pattern recognition receptors, PRR) statt, die von
einer Vielzahl von Zellen, darunter auch nicht-Immunzellen, produziert werden. Die
vom zellulären System verwendeten PRR kommen auf antigenpräsentierenden Zellen
vor und besitzen unterschiedliche Lokalisierungen. Sie sind entweder membranär und
befinden sich in der Plasmamembran, wodurch sie extrazelluläre Muster erkennen
können.
Eine
andere
Klasse
der
mebranären
PRR
befindet
sich
in
der
Endosomenmembran und erkennt Fragmente phagozytierter Erreger. Wegen ihrer
funktionellen Homologie mit dem Toll-Rezeptor in D. melanogaster werden die
membranären PRR als Toll-like Rezeptoren (TLR) bezeichnet (Rock et al., 1998). Bis
heute wurden 11 humane TLR identifiziert, die jeweils ein spezifisches, nicht in
Säugetieren
vorkommendes
Muster,
erkennen.
Dies
können
zum
Beispiel
Lipopolysacharide, Peptidoglykane, Flagelline, einzelsträngige RNA oder unmethylierte
CpG-DNA-Abschnitte sein. Die Aktivierung der TLR bewirkt unter anderem eine
Translokation von Rel-Typ Trankriptionsfaktoren wie NFκB in den Nukleus (Rock et al.,
1998), wodurch die Sekretion verschiedener Zytokine wie Interferon α/β und Interleukin
2, 6 und 10 ausgelöst wird. Dies induziert eine Entzündung, wirkt stimulierend auf die
Zellen des angeborenen Immunsystems und reguliert die adaptive Immunantwort.
Zusätzlich gibt es nicht membranäre PRR, die zytoplasmatisch vorkommen oder als
Bestandteile des Komplementsystems sekretiert werden. Die zytoplasmatischen PRR
erkennen intrazelluläre Muster wie zum Beispiel virale doppelsträngige RNA, die durch
die
RNA-Helikasen
RIG-I
und
MDA5
erkannt
wird
und
durch
ihre
Caspaserekrutierungsdomäne (CARD) Entzündungsreaktionen auslösen (Yoneyama
et al., 2005). Eine weitere zytoplasmatische Klasse der PRR sind die NOD-Proteine
(Nukleotidbindungs-Oligomerisierungs Domäne), die Muramyl-Dipeptide, Bestandteile
der Zellwand intrazellulärer Bakterien, erkennen und eine NFκB-vermittelte Antwort
generieren (Inohara et al., 2001).
3
Einleitung
Die erkannten Muster entsprechen typischen Komponenten mikrobieller und
mykotischer Krankheitserreger, doch auch die Erkennung viraler Strukturen durch TLR
7, 8 und 9 wurde in neueren Ergebnissen bestätigt. (Hoebe et al., 2003; Kurt-Jones et
al., 2000).
1.3 Die adaptive Immunantwort
Die adaptive Immunantwort kann weiterhin in eine humorale und eine zellvermittelte
Antwort unterteilt werden. Die humorale, antikörperabhängige Antwort wird durch BZellen und die zellvermittelte durch T-Zellen ausgeführt. Diese Komponenten sind
adaptiv und benötigen mehrere Tage für eine volle Aktivierung. Während dieser
Adaption finden nach Antigenkontakt komplexe Sortierungs- und Stimulationsprozesse
der wenigen antigenspezifischen Immunzellen im Körper statt. Einzelne B- und TZellklone, die einen für das entsprechende Antigen spezifischen Rezeptor exprimieren,
werden dabei durch klonale Expansion vervielfältigt. Erst diese Proliferation,
ausgehend von einer geringen Frequenz der Vorläuferzellen, ermöglicht eine
wirkungsvolle Immunantwort.
Die humorale Immunantwort wird durch B-Lymphozyten vermittelt und basiert auf der
Produktion von Antikörpern. Sie ist sowohl gegen pathogene Organismen und Viren,
als auch gegen Fremdproteine, die durch den Körper zirkulieren, gerichtet. Dabei dient
das exprimierte, membranständige Immunglobulin (IgM) als B-Zellrezeptor der erst
durch eine Antigenerkennung die Aktivierung der B-Zelle vermittelt. Durch alternatives
Spleißen
der
µ-Ketten
mRNA,
erfolgt
die
Produktion
sekretierter
IgM-
Antikörperkomplexe, die im Körper zirkulieren, den Erreger für die Phagozytose
markieren oder Interaktionen von Viren und intrazellulären Mikroorganismen mit der
Wirtszellmembran verhindern können.
Neben der Gensegmentreorganisation der somatischen Rekombination während der
Differenzierung findet während der Immunantwort die somatische Hypermutation statt
(Weigert et al., 1970). Dabei werden zusätzliche Punktmutationen, in die bereits
reorganisierten Gene eingeführt. Dies erzeugt eine enorme Anzahl an mutierten
Varianten der variablen Regionen der schweren und leichten Kette des spezifischen
Antikörpers. Dabei entstehen selbst unproduktive Mutanten die nicht exprimiert
werden. Dieser Prozeß ist nicht ganz zufällig, sondern betrifft „hotspots“, die bestimmte
kurze Nukleotidmotive enthalten und oft zu einer verbesserten Antigenbindung führen
(Michael et al., 2002). Nach einer erfolgreichen Immunantwort wird der größte Teil der
aktivierten B-Zellpopulation apoptotisch eliminiert, was durch das Fehlen des Antigens
eingeleitet wird (Banchereau et al., 1994). Ein kleiner Teil der Zellen durchläuft einen
4
Einleitung
Isotypwechsel der Immunglobuline von IgM zu IgG und entwickelt sich zu GedächtnisB-Zellen. Diese sind langlebig und zirkulieren durch die lymphatischen Organe,
wodurch sie eine lebenslange Immunität vermitteln (Liu et al., 1991).
Die zelluläre Immunantwort richtet sich hauptsächlich gegen intrazelluläre Pathogene
und benötigt die Präsentation eines prozessierten, erregerspezifischen Peptidantigens
durch die infizierte Zelle. Auch bei Karzinomzellen kommt es zur Präsentation von
tumorspezifischen
Peptidantigenen.
Die
Effektorfunktionen
der
zellulären
Immunantwort werden von T-Lymphozyten und NK-T-Zellen ausgeführt und basieren
unter anderem auf der Lyse von infizierten oder transformierten Zellen. Außerdem
können T-Lymphozyten verschiedene Zytokine sezernieren und so mit der Zielzelle
oder anderen Zellen des Immunsystems kommunizieren. Die Initiierung und Regulation
einer
adaptiven,
zellvermittelten
Immunantwort
beinhaltet
eine
Vielzahl
von
Komponenten und Zellen des Immunsystems. Diese sind für Aktivierung, Zielfindung,
Effektorfunktionen und Kontrolle zuständig und bilden ein hochkomplexes Netzwerk.
Die ausgewogene Regulation dieser Systeme ist essentiell für das Überleben eines
Organismus und Fehlfunktionen führen meist zu schwerwiegenden Erkrankungen. Die
Abwehr der verschiedensten Pathogene und die Bekämpfung von körpereigenen
Zellen, deren Proliferationskontrolle durch Mutationen gestört wurde, ist eine ständige
Herausforderung.
Der
dadurch
erzeugte
Selektionsdruck
führte
zu
den
unterschiedlichsten Anpassungen, um der Kontrolle durch das Immunsystem zu
entgehen (Janeway et al., 2004). Viele Viren beeinflussen die Expression von
Proteinen der Wirtszelle, wodurch die Präsentation erregerspezifischer Antigene
veringert werden kann (Hirata et al., 2001). Zusätzlich kommt es bei Erregern oft zu
schnellen Veränderungen der Hüllproteine und damit der Antigenität, wodurch sie eine
Persistenz induzieren können (Kotwal, 1997). Eine weitere Immunausweichstrategie ist
die Infektion von Zellen des Immunsystems selbst, wie am Beispiel des humanen
Immundeffizienz Virus (HIV). Und auch bei malignen Tumoren kommt es zur
Verringerung der Antigenpräsentationsmoleküle oder zur gezielten Elimination von TZellen durch Expression des Fas-Liganden, um eine Elimination zu verhindern (Dong
et al., 1997; O'Connell et al., 1996).
1.4 T-Lymphozyten
Die T-Lymphozyten (T-Zellen) sind neben NK- und NK-T-Zellen die Haupteffektorzellen
der zellvermittelten Immunantwort und differenzieren im Knochenmark aus lymphoiden
Vorläuferzellen. Bevor sie im lymphatischen Gewebe zirkulieren, werden sie im
Thymus
auf
Aktivierung
durch
körpereigene
5
Antigene
überprüft
und
bei
Einleitung
Selbsterkennung durch Apoptoseinduktion aussortiert. Diese Lokalisierung im Thymus
führte auch zu ihrer Namensgebung. Zusätzlich findet im Thymus eine positive
Selektion statt, bei der nur T-Zellen überleben, die ein Überlebenssignal durch ihren TZellrezeptor übermitteln. Dies dient der Entfernung von T-Zellen mit nicht funktionellen
T-Zellrezeptoren (Linette and Korsmeyer, 1994). T-Zellen werden aufgrund der
Korezeptoren CD4 und CD8 (cluster of differentiation) auf ihrer Oberfläche in zwei
Gruppen
unterteilt.
Diese
Korezeptoren
unterscheiden
die
beiden
Zelltypen
grundsätzlich und determinieren auch die Interaktion mit den entsprechenden
Antigenpräsentationsmolekülen (MHC, major histocompatibility complex) (Woodland
and Dutton, 2003). CD8 interagiert dabei mit dem konstanten Bereich von MHC I und
CD4 mit dem konstanten Bereich von MHC II (Lustgarten et al., 1991).
Die Unterteilung der MHC Moleküle in MHC I und MHC II bezieht sich auf die
subzelluläre Struktur, die Lokalisation und die Funktion. MHC I Moleküle werden auf
der Oberfläche jeder kernhaltigen Zelle exprimiert und präsentieren vorwiegend
Antigene
intrazellulärer
Erreger.
Sie
dienen
außerdem
als
körpereigener
Identitätsnachweis der Zelle. MHC II Moleküle werden dagegen hauptsächlich auf der
Oberfläche
von
professionellen
antigenpräsentierenden
Zellen
(APC,
Antigen
Presenting Cell) exprimiert und präsentieren phagozytierte Proteine extrazellulärer
Herkunft. Als Ausnahme findet die sogenannte Kreuzpräsentation (cross-presentation)
statt,
wobei
extrazelluläre
Proteine
durch
rezeptorvermittelte
Endo-
oder
Makropinocytose aufgenommen werden und durch einen unbekannten Mechanismus
ins Zytoplasma transportiert werden. Dort werden sie von Proteasomen zu Peptiden
prozessiert, mit Hilfe der TAP Transporter ins Lumen des endoplasmatischen
Retikulums transportiert und auf MHC I Moleküle geladen und präsentiert (Bevan,
1976). Dies ermöglicht der professionellen APC, phagozytierte Antigene aus der
Körperperipherie oder Antigene von Viren, die keine APC infizieren, zu präsentieren
(Sigal et al., 1999). Diese Methode könnte beispielsweise bei viralen Infektionen mit
strengem Organtropismus ein entscheidender Vorteil sein (Kurts, 2000).
Die CD8 positiven (CD8+) T-Zellen werden auch als zytotoxische T-Zellen (Cytotoxic
T-Lymphocytes, CTL) bezeichnet. Sie erkennen intrazelluläre oder phagozytierte
Antigene die durch MHC I Moleküle präsentiert werden. CD4+ T-Zellen werden als THelferzellen (TH-Zellen) bezeichnet und sind maßgeblich an der Etablierung der
zellulären und humoralen Immunantwort beteiligt. Außerdem regulieren sie die
Initiierung und Entwicklung des immunologischen Gedächtnisses. Sie werden in TH1
und TH2-Zellen unterteilt, die sich in ihrer Zytokinexpression unterscheiden und
unterschiedliche Komponenten des Immunsystems kontrollieren. TH1-Zellen aktivieren
Makrophagen und stimulieren B-Zellen opsonisierende Immunglobuline (hauptsächlich
6
Einleitung
IgG) zu sezernieren, die zur Phagozytose des markierten Erregers führen. TH2-Zellen
dagegen führen zu einer maßgeblich humoralen Immunantwort, indem B-Zellen zur
Produktion neutralisierender Antikörper (IgM, IgA und IgE) angeregt werden. Die
strenge Einschränkung der Expression von MHC II auf professionellen APCs dient der
Steuerung der TH-Zellaktivierung, da diese sowohl CTLs als auch B-Zellen aktivieren
und weitere regulatorische Aufgaben bei der Etablierung der Immunantwort besitzen
(Janeway et al., 2004).
T-Zellen können auch regulatorische Funktionen in der adaptivenn Immunantwort
ausüben, weshalb eine Subpopulation der T-Zellen als regulatorische T-Zellen (Treg)
definiert wurde. Diese Zellen exprimieren entweder CD4 oder CD8 und werden
grundsätzlich durch die Expression verschiedener Oberflächenmarker wie CD25, CD45
und FoxP3 unterschieden. Es konnte zum Beispiel gezeigt werden, daß sie an der
inhibitorischen Regulation von immunpathologischen Effekten beteiligt sind (Suvas et
al., 2004).
1.5 Der T-Zellrezeptorkomplex
Die Antigenerkennung der T-Zelle wird maßgeblich durch die Bindung des TZellrezeptors (TZR) an prozessierte Peptidantigene, die im Komplex mit MHCMolekülen präsentiert werden vermittelt. Stehen dabei zusätzliche kostimulatorische
Signale zur Verfügung, wird die T-Zelle aktiviert und eine zytotoxische T-Zellantwort
etabliert. Der TZR besteht aus einem Heterodimer von α- und β- oder γ- und δ-Kette,
das durch eine Disulfidbrücke stabilisiert ist. Beide TZR-Ketten tragen mit ihrer
variablen Region zur Spezifität der Antigenbindung bei und besitzen Ähnlichkeit mit
den variablen und konstanten Regionen der Antigenerkennungsdomäne von
Antikörpern. Trotz dieser Ähnlichkeiten zu den Immunglobulinen wird die Diversität der
TZR nicht durch zusätzliche somatische Hypermutation erweitert. Wahrscheinlich dient
dies der Vermeidung von T-Zellklonen mit selbstreaktiven TZR.
Zu
Beginn
der
Embryogenese
werden
haupsächlich
T-Zellen
mit
der γ/δ-
Kettenkombination und relativ geringer Rezeptorvariabilität gebildet, die dann in die
Epidermis translozieren und eine noch unbekannte Aufgabe übernehmen. An γ/δKnockout-Mäusen konnte gezeigt werden, daß die Kontrolle von Virusinfektionen
unproblematisch ist, verschiedene bakterielle Infektionen scheinen im Gegensatz dazu
aber unkontrollierbar zu verlaufen. Außerdem wird eine mögliche Beteiligung der γ/δTZR an der Tumorimmunität diskutiert (Carding and Egan, 2002). Im Laufe der
Entwicklung werden dann größtenteils T-Zellen mit der α/β-Kettenkombination gebildet,
die einen dominanten Anteil von 95% aller T-Zellen ausmachen. Um einen
7
Einleitung
vollständigen
TZR-Komplex
zu
bilden,
wird
das
Heterodimer
mit
weiteren
Komponenten des TZR-Komplexes umgeben. Diese sind ein Homodimer aus zwei ζKetten, die ebenfalls durch eine Disulfidbrücke stabilisiert sind, und zwei CD3Heterodimere, bestehend aus je einer CD3 ε- und einer CD3 δ- oder γ-Kette (Call et al.,
2002; Pan et al., 2004) (Abb. 1.2).
Abbildung 1.2: Der TZR/CD3/ζ-Ketten Komplex
Der TZR/CD3-Komplex besteht extrazellulär aus einem Heterodimer aus α- und β-Kette des
TZR und den zwei CD3-Heterodimeren, aus je einer ε- und einer δ- oder γ-Kette. Intrazellulär
ist ein ζ-Kettenhomodimer mit je drei ITAM am Komplex beteiligt. Außerdem tragen die
intrazellulären Carboxytermini der CD3-Heterodimere je ein ITAM. (aus (Janeway et al., 2004))
Dieser Rezeptorkomplex ermöglicht es der aktivierten T-Zelle ein prozessiertes
Peptidantigen im Komplex mit einem MHC-Molekül auf der Oberfläche einer
potentiellen Zielzelle zu erkennen. Dies führt zur Ausbildung einer streng organisierten
Zell-Zell-Kontaktzone, der immunologischen Synapse (IS) (Bromley et al., 2001). Diese
konzentrierenden Prozesse erlauben multiple Interaktionen zwischen TZR/CD3- und
Peptidantigen/MHC-Komplex, was für die Signaltransduktion unerlässlich ist. Die
Interaktion einer minimalen Anzahl von T-Zellrezeptoren mit Antigen/MHC-Komplexen
ist dafür nötig, bevor ein Signal generiert wird. Der zeitliche Ablauf dieser Prozesse ist
streng organisiert und dauert ca. 10 Sekunden, von der ersten Lokalisierung der TZRKomplexe an der Kontaktzone, bis zur vollen Aktivierung (Campi et al., 2005) (Abb.
1.3).
8
Einleitung
Abbildung 1.3: Initialisierung der Immunologischen Synapse
Der zeitliche Verlauf der Initialisierung der immunologischen Synapse wurde durch totale
interne Reflektionsfluoreszenzmikroskopie (TIRFM) bestimmt. Ermittelt wurde dabei die
Distribution der CD3-TZR in der IS und der Kalziuminflux als Marker für die Aktivierung der TZelle. (aus (Campi et al., 2005))
Durch Untersuchungen mit modernen bildgebenden Verfahren konnten verschiedene
Formen der IS unterschieden werden, die sich im molekularen Aufbau und der
Proteinzusammensetzung der Membranmikrodomänen (lipid rafts) unterscheiden.
Diese agieren dabei als funktionelle, cholesterin- und sphingolipidreiche Einheiten und
erhalten die Membranorganisation der IS aufrecht (Friedl et al., 2005).
In der IS wird außerdem die Komplexierung mit dem entsprechenden Korezeptor
(CD4/CD8) eingeleitet, die eine Aktivierung der intrazellulär gebundenen ProteinTyrosin-Kinase Lck bewirkt. Dies führt zur Phosphorylierung der Immunrezeptor
Tyrosin-basierten Aktivierungsmotive (ITAM). ITAM befinden sich in den intrazellulären,
carboxyterminalen Regionen der ζ-Kette und der CD3-Moleküle. Darauf folgt die
Rekrutierung und Aktivierung der ζ-assoziierten Proteinkinase Zap70, die durch
weitere Phosphorylierung und Aktivierung von Adaptorproteinen verschiedene
Signalkaskaden initiiert. Zu diesen gehören zum Beispiel spezifische Rel-Typ
Transkriptionsfaktoren wie Aktivatorprotein-1 (AP-1), nukleärer Faktor aktivierter TZellen (NFAT), nukleärer Faktor κB (NFκB) (Cantrell, 1996). Außerdem sind
Proteinkinasen wie Ras, Rac (Cantrell, 2003), Proteinkinase C (PKC) und die
Calzineurin Signalwege (Bram and Crabtree, 1994) beteiligt. Diese Faktoren führen zur
Aktivierung verschiedener Zielgene, zum Beispiel zur Expression von Chemokinen,
inhibierenden Rezeptoren und weiteren Faktoren, welche die T-Zellantwort regulieren
und eine zytotoxische T-Zellantwort induzieren.
9
Einleitung
1.6 Die zytotoxische T-Zellantwort
Die
primäre
Aktivierung
einer
ruhenden
T-Zelle
findet
durch
eine
antigenpräsentierende Zelle (APC) statt, die ein in der Peripherie aufgenommenes
Antigen in den lymphatischen Organen präsentiert (Schlienger et al., 2000). Zu den
APC zählen Makrophagen, die verschiedenen Subpopulationen der dendritischen
Zellen (DC) und organspezifische phagozytierende Zellen. Die primäre Antigenbindung
durch den TZR führt zu einer Aktivierung des Lymphozyten Funktionsassoziierten
Antigens-1 (LFA-1), ein Adhäsionsmolekül, das einen engen Kontakt zwischen der TZelle und der APC herstellt. Die durch Antigenerkennung ausgelöste Signalkaskade
führt unter anderem zur Aktivierung des Transkriptionsfaktors NFAT und zu dessen
Translokation in den Nukleus. Dort wird die Transkription des IL-2 Gens gestartet,
dessen Produkt für die volle Aktivierung der T-Zelle unerlässlich ist. Die IL-2 mRNA
wird aber nicht translatiert, bevor ein zusätzliches kostimulatorisches Signal durch
Interaktion der B7-Liganden auf der APC und dem CD28-Korezeptor auf der T-Zelle
zur Verfügung steht (Gonzalo et al., 2001). Durch das CD28-Signal wird eine
Stabilisierung der IL-2 mRNA eingeleitet, die zur Translation und Sekretion des
Zytokins führt. Außerdem wird durch die Kostimulation die Expression eines
hochaffinen IL-2-Rezeptors initiiert, der den niedrigaffinen Rezeptor ruhender T-Zellen
ersetzt (Cerdan et al., 1995; Minami et al., 1993). Eine autokrine Interaktion mit dem IL2-Rezeptor leitet dann die Differenzierung und proliferative Expansion der aktivierten TZelle ein. Dadurch entsteht eine hohe Anzahl monoklonaler, antigenspezifischer TZellen zur Bekämpfung infizierter oder transformierter Zellen, die den entsprechenden
Antigen/MHC I-Komplex präsentieren. Die Aktivierung führt außerdem zur erhöhten
Expression des CTLA-4-Rezeptors, der ebenfalls B7 bindet aber nun als inhibitorisches
Regulationselement der T-Zellantwort dient. Eine Aktivierung des TZR ohne
zusätzliches kostimulatorisches Signal führt zur Inaktivierung der entsprechenden TZelle (Schwartz, 2003).
Nach diesen primären Aktivierungsprozessen wird die Expression von L-Selektin, dem
Signal für die Lokalisation im lymphatischen Gewebe, abgeschaltet. Die aktivierten TZellen beginnen nun als Effektor T-Zellen im Körper zu zirkulieren und VLA-4Adhäsionsmoleküle zu exprimieren. Die Endothelzellen im Infektionsgebiet wurden
durch das angeborene Immunsystem bereits aktiviert und exprimieren VCAM-1, den
Bindungspartner von VLA-4, wodurch die Rekrutierung der Effektor-T-Zellen in die
Region der Inflammation erfolgt (Janeway et al., 2004).
Die infizierten Zielzellen exprimieren unspezifische Adhäsionsmoleküle (ICAM) die
über Bindung an LFA-1 auf der Effektor T-Zelle den ersten Zell-Zell Kontakt herstellen
(Dustin, 2001). Danach findet die Erkennung des präsentierten, MHC-gebundenen
10
Einleitung
Antigens, durch den TZR der Effektor T-Zelle statt. Durch die Rekrutierung weiterer
TZR kommt es zur Initiation eines supramolekularen Adhäsionskomplexes (SMAC).
Dies führt zu einer strikten Reorganisation des Zytoskeletts und einer fokusierten
Ausbildung der immunologischen Synapse im Bereich der Zell-Zell-Kontaktzone
(Trambas and Griffiths, 2003). Die Reorganisation des Zytoskeletts polarisiert die
Effektor T-Zelle und ermöglicht eine räumlich orientierte Interaktion mit der Zielzelle
(Abb. 1.4).
Abbildung 1.4: Die zytotoxische T-Zellantwort
Die zytotoxische T-Zellantwort wird durch eine Antigenerkennung des MHC/PeptidantigenKomplexes eingeleitet (links). Die Apoptose der Zielzelle wird initiiert (mitte), wobei benachbarte
Zellen, die kein Antigen präsentieren, unangetastet bleiben (rechts).(aus (Janeway et al., 2004))
Die Zytotoxizität von antigenaktivierten Effektor-T-Zellen wird durch die Induktion der
Zielzellapoptose vermittelt, wofür die Effektor-T-Zelle zwei unterschiedliche Systeme
besitzt. Das Fas/Fas-Ligand (CD95/CD178) System ist ein rezeptorvermitteltes
System, bei dem es durch Synthese und Rezeptorbindung des von der T-Zelle
exprimierten Fas-Liganden an den Todesrezeptor Fas auf der Oberfläche der Zielzelle
zur Initiation der Apoptose kommt (Medana et al., 2000). Bei der zweiten Methode, der
Degranulation, exozytiert die aktivierte Effektor-T-Zelle lytische Granuolen in den
synaptischen Spalt der immunologischen Synapse, wodurch Perforin und Granzym
freigesetzt werden (Barry and Bleackley, 2002; Lieberman, 2003). Perforin ist ein
Porenbildner, der durch Heteromerkomplexierung Poren in die Zellmembran der
Zielzelle einführt. Durch diese kann Granzym in die Zelle eindringen. Das Granzym
leitet dann durch proteolytische Aktivierung seiner Substrate, die Apoptose in der
Zielzelle ein. Die T-Zelle selbst schützt sich durch die Expression eines Perforin
Antagonisten vor diesen aggressiven Proteinen.
Die
maßgeblich
an
der
Apoptose
beteiligten
Enzyme
sind
die
Cystein-
Aspartatspezifischen Proteasen (Caspasen), die im aktivierten Zustand proteolytischen
Verdau vermitteln. Sowohl die Perforin/Granzym, als auch die Fas/Fas-Ligand
induzierte Apoptose werden durch Aktivierung von Initiatorcaspasen (Casapase 2,8,9
und 10) initiiert. Diese beginnen daraufhin mit der proteolytischen Aktivierung der
11
Einleitung
Exekutiv- oder Effektorcaspasen (Caspase 3,6 und 7), die durch die Aktivierung
proapoptotischer Faktoren den Zelltod verursachen. Dabei werden proapoptotische
Enzyme wie zum Beispiel die caspaseaktivierte DNAse (CAD) proteolytisch aktiviert,
indem der an ihr gebundene Inhibitor I-CAD von Caspase 3 entfernt wird. CAD kann
daraufhin in den Nukleus translozieren und die genomische DNA degradieren, was zur
Apoptose führt (Enari et al., 1998).
Neben der zytotoxischen T-Zellantwort kommt es auch zur Sekretion von Zytokinen
durch aktivierte Effektor T-Zellen. Sie sezernieren große Mengen an Interferon gamma
(IFNγ) und sowohl lösliche als auch membranständige Proteine aus der Familie der
Tumornekrosiefaktoren (TNF). Die Zytokine tragen auf verschiedene Arten zur
Verteidigung gegen Pathogene bei. IFNγ inhibiert zum Beispiel die Replikation von
Viren direkt (Guidotti et al., 1996; Protzer et al., 1999). Zusätzlich reguliert sezerniertes
IFNγ die Expression von MHC I und weiteren Proteinen, die an der Prozessierung und
Ladung von Peptidantigenen beteiligt sind, was zu einer gesteigerten Präsentation von
Antigenen durch die APC führt und die T-Zellantwort erleichtert (Yang et al., 1995).
Eine weitere Funktion des IFNγ ist die Aktivierung von Makrophagen, was zu deren
Rekrutierung in den Entzündungsherd führt. Dort können sie sowohl als Effektorzellen,
als auch als antigenpräsentierende Zellen wirken. Der membranständige CD40-Ligand
aus der TNF-Familie ist besonders wichtig für die Aktivierung von B-Zellen und
Makrophagen durch TH-Zellen. Das lösliche TNF, das von TH1-, einigen TH2- und von
zytotoxischen T-Zellen sekretiert wird, arbeitet bei der Aktivierung von Makrophagen
mit IFNγ zusammen. Lymphotoxin (TNF) β, das von TH2-Zellen produziert wird, aktiviert
ebenfalls Makrophagen, inhibiert B-Zellen und kann in manchen Zielzellen direkt die
Apoptose initiieren. Außerdem werden von TH-Zellen verschiedene Interleukine (IL)
produziert, die zum Teil aktivierend auf B-Zellen (IL-4, -5, -9, -13) oder inhibierend auf
Makrophagen wirken (IL-10) (Janeway et al., 2004).
1.7 Adoptive T-Zelltherapie
Unter adoptiver T-Zelltherapie versteht man die Transplantation bzw. den Transfer von
autologen oder heterologen immunologischen Effektorzellen. Diese Effektorzellen
können eine bestimmte Spezifität besitzen oder, in Form von hämatopoetischen
Stammzellen, dem Wiederaufbau des Immunsystems dienen. Therapeutisch wird der
Stammzelltransfer, in Form einer allogenen Knochenmarks- oder Blutstammzelltransplantation erfolgreich bei hämatologischen Tumoren wie chronischer myelogener
Leukämie (CML) und akuter lymphoblastischer Leukämie (ALL) eingesetzt (Kolb et al.,
1990; Slavin et al., 1996). Bei der Weiterentwicklung
12
dieser Methode, wurde die
Einleitung
Effektor Zellpopulation anhand ihrer Spezifität isoliert, vermehrt und reimplantiert. Dies
führte zum erfolgreichen Einsatz gegen Eppstein-Barr-Virus (EBV) assoziierte BLymphome in immunsuprimierten Patienten (Rooney et al., 1995) und gegen
Cytomegalievirus (CMV) vermittelte Erkrankungen (Walter et al., 1995).
Grundsätzlich ist bei einem solchen Therapieansatz die Übereinstimmung der
humanen Leukozytenantigene (HLA) auf den MHC-Molekülen von Wirt und Donor von
größter Bedeutung und muß streng kontrolliert werden. Trotzdem tritt immer wieder die
sogenannte Transplantat-gegen-Wirt-Erkrankung (Graft versus Host Disease, GvHD)
auf und führt zu schweren Komplikationen. Allogene CTL greifen dabei körpereigenes
Gewebe an und schädigen vor allem Haut, Leber, Augen und Darm (Falkenburg and
Kluin-Nelemans, 1999; Kolb et al., 1995; Maraninchi et al., 1986). Der Grund für diese
Entwicklung scheinen Unterschiede in den Histokompatibilitätsantigenen zu sein, da
GvHD in autologen Transplantationen oder zwischen eineiigen Zwillingen sehr viel
seltener auftritt (Gale et al., 1994; Horowitz et al., 1990).
Um mit adoptivem T-Zelltransfer weitere Krankheitsbilder behandeln zu können, ist die
Verbindung
mit
gentherapeutischen
Techniken
am
vielversprechendsten.
Mit
rezeptormodifizierten T-Zellen könnten Antigenspezifitäten ex vivo vorbestimmt und
große Mengen an T-Zellen für eine Repopulation erzeugt werden (Gross and Eshhar,
1992).
1.8 Modifikation von T-Zellrezeptoren
Die ersten Modifikationen von TZR begannen mit der Klonierung und Expression
vollständiger α- und β-Ketten die in den endogenen TZR-Komplex eingebaut wurden.
Dazu
wurden
die
revers
transkribierten
Volllängen
mRNAs
von
tumorantigenspezifischen TZR in eine T-Zelllinie transfiziert (Cole et al., 1995). Die
Oberflächenexpression des transgenen TZR führte zu Zellen mit artifizieller Spezifität
gegen den entsprechenden Tumorantigen/MHC-Komplex. Die endogenen Rezeptoren
können dabei durch spezifische Antikörper negativ moduliert werden um eine
Bispezifität auszuschließen. In neueren Arbeiten wurden TZR kloniert, die aus
tumorinfiltrierenden T-Zellen gewonnen wurden. Diese Rezeptoren stammten aus
Patienten mit erfolgreicher Tumorregression und wurden durch retrovirale Vektoren
übertragen. Eine Repopulation immundepletierter Tumorpatienten führte zu einer fast
vollständigen Elimination metatstasierender Tumoren (Morgan et al., 2006). Die
Selektion der spezifischen T-Zellklone und die Klonierung der cDNAs ist jedoch
zeitraubend. Und auch die MHC-restringierte Erkennung der Antigene ist für bestimmte
Anwendungen unerwünscht. Alternativ wurden deshalb auch zusätzlche Methoden zur
13
Einleitung
Modifikation von T-Zellrezeptoren gesucht und erforscht. Erste Versuche fusionierten
dafür variable Antikörperregionen mit den konstanten Regionen der TZR-Ketten und
erhielten funktionelle chimäre Rezeptoren mit aktivierendem Potential (Gross et al.,
1989; Kuwana et al., 1987). Die Etablierung vollständig artifizieller TZR-Konstrukte
wurde durch die Fusion einer transmembranären/intrazellulären Signaldomäne mit
einer extrazellulären Antigenerkennungsdomäne erreicht. Das erzeugte Fusionsprotein
wurde durch ein Einzelkettenantikörperfragment (single chain fragment of the variable
vegion, scFv) antigenspezifisch modifiziert und erhielt dadurch die Spezifität des
parentalen Antikörpers (Eshhar et al., 1993). ScFv werden auf der Grundlage einer
cDNA-Bibliothek aus B-Zellen durch Amplifikation der Gene für die variablen Regionen
der Immunglobuline erzeugt. Die Fusion der amplifizierten Fragmente durch einen
Peptidlinker erzeugt eine Bibliothek linearer Proteine, die jeweils einer IgAntigenbindungsdomäne
entsprechen.
Um
spezifische
Antikörperfragmente
zu
erhalten wird ein sogenannter „Phage Display“ durchgeführt. Dafür wird die scFvBibliothek an das Oberflächenprotein eines Phagen fusioniert, wodurch die
Antikörperfragmente auf dessen Oberfläche exprimiert werden. Durch Selektion der
Phagenbindung an das entsprechenden Antigen und darauffolgende Expansion der
spezifisch gebundenen Phagen in Bakterien kann ein spezifisches scFv isoliert
werden. Die mehrfache Wiederholung dieses Prozesses wird „Panning“ genannt. Die
genetische Information des scFv kann anschliessend leicht aus der Phagenpräparation
isoliert und in ein Expressionssystem überführt werden.
Die Verwendung eines scFv als Antigenbindedomäne ermöglicht es Antigene zu
erkennen, die nicht durch MHC-Moleküle präsentiert werden. Tumorantigene und virale
Antigene werden häufig schlechter in MHC-Komplex präsentiert, da eine Inhibition der
Präsentation vorliegt. In vielen malignen und viralen Erkrankungen sind aber
Zelloberflächenmarker bekannt, die spezifisch für die transformierte oder infizierte Zelle
sind. Diese können mit T-Zellen, die scFv-vermittelte chimäre TZR exprimieren erkannt
und eliminiert werden. Es ist mit diesem System möglich eine Vielzahl von Antigenen
anzugreifen, da die extrazelluläre scFv-Domäne relativ leicht ausgetauscht werden
kann, während die intrazellulären Signaldomänen verbleiben.
In bisherigen Experimenten wurden verschiedene Tumorantigene auf diese Weise
angegriffen und auch virale Proteine wurden als Zielantigen evaluiert (Tabelle 1.1). Die
ersten virusantigenspezifischen TZR-Konstrukte mit scFv-vermittelter Erkennung,
erkannten das gp120 des HIV-1 auf infizierten T-Zellen und HIV-replizierenden TZelllinien (Masiero et al., 2005). Als Signaldomänen wurden die intrazellulären
Domänen der γ- und ζ-Ketten des TZR-Komplexes eingesetzt. Die Aktivierung dieser
modularen, chimären TZR (cTZR) durch scFv-vermittelte Antigenerkennung führte zu
14
Einleitung
zytotoxischen Antworten gegenüber antigenpositiven Zellen und zur Sekretion des
proinflammatorischen Zytokins IFNγ (Moritz et al., 1994).
Tabelle 1.1: Antigene und Zielzellen für rekombinante T-Zellrezeptoren
Beispiele für Ansätze mit rekombinanten TZR um T-Zellen mit einer artifiziellen Spezifität gegen
Tumoren oder Virusinfektionen auszustatten. (modifiziert nach (Hombach et al., 2002))
Antigen
Zielzelle
Referenz
Neu/Her2
Brust-, Eierstockkarzinom
(Stancovski et al., 1993)
G250
Blasenkarzinom
mIgE
IgE+ Lymphom
(Weijtens et al., 1996; Weijtens et al.,
1998b)
(Lustgarten and Eshhar, 1995)
CD20
B-Zell Lymphom
(Jensen et al., 1998)
CD30
Hodgkin’s Lymphoma
CA72-4
Adenokarzinom
(Hombach et al., 2000; Hombach et
al., 1998)
(Hombach et al., 1997)
CEA
Gastrointestinalkarzinom
MAGE-A1
Melanom
gp120
HIV-1 infizierte PBL
(Beecham et al., 2000; Blanco et al.,
2002; Darcy et al., 1998; Hombach et
al., 1999)
(Willemsen et al., 2000)
(Hege et al., 1996; Masiero et al.,
2005; Mitsuyasu et al., 2000; Roberts
et al., 1994; Tran et al., 1995; Yang et
al., 1997)
Zu weiteren Modifikationen dieser cTZR gehört zum Beispiel die Einführung einer
extrazellulären Fc-Linker-Domäne. Diese wurde zwischen scFv und Zellmembran
eingesetzt, besteht aus der konstanten Fc-Domäne eines IgG-Moleküls und verbessert
die Bindung des scFv an sein Antigen (Guest et al., 2005). Die zusätzliche Fusion einer
kostimulatorischen CD28-Korezeptor Signaldomäne führte bei Antigenerkennung durch
den cTZR zur Sekretion von Interleukin-2 (IL-2) und verstärkte die Produktion von IFNγ
(Hombach et al., 2001a). IL-2 ist ein Zytokin, das von Effektor-T-Zellen als
stimulierendes Proliferationssignal gebildet wird und zur klonalen Expansion aktivierter
T-Zellen, als Antwort auf ein aktivierendes Antigen führt (Beadling et al., 1993). Eine
weitere Modifikation ist die zusätzliche Fusion einer OX40-Signaldomäne im
intrazellulären Bereich der cTZR, die eine verstärkte IL-2 Produktion und proliferative
Expansion der rezeptortragenden T-Zellen zur Folge hatte (Pule et al., 2005).
15
Einleitung
1.9 Gentransfer in primäre humane T-Zellen
Primäre humane T-Zellen können nur sehr schwer gentechnisch modifiziert werden.
Die Transfektion mit Kalzium-Phosphat oder Lipofektionsreagenzien ist ineffizient, und
die Elektroporation benötigt große Mengen DNA und wird von einer hohen
Zellmortalität begleitet. Durch den Einsatz von onkoretroviralen Vektoren mit
definierten Gewebespezifitäten konnte der Transfer genetischen Materials erheblich
verbessert
werden.
Das
erste
verwendete
amphotrophe
Moloney
murine
Leukämievirus (MLV) kann sowohl murine als auch humane Zellen infizieren. Doch die
rezeptorvermittelte Transduktion über den Rezeptor Pit2, ein Phosphattransporter, ist
wegen dessen niedriger Expression ineffizient (Muhlebach et al., 2003). Die
produzierbaren Virustiter waren gering, konnten jedoch durch die Verwendung von
Simian Virus 40 (SV40)-transduzierten Zellen für die Virusproduktion 25-100fach
gesteigert werden (Landau and Littman, 1992). Dafür wurde ein SV40-OriReplikationsstartpunkt
in
Interaktion
grossen
mit
dem
die
retroviralen
Vektorplasmiden
SV40-T-Antigen
resultiert
intergriert.
in
einer
Dessen
episomalen
Amplifikation der retroviralen Plasmide im Zellkern der virusproduzierenden Zellen. Um
die Transduktionseffizienz weiter zu verbessern, wurden verschiedene Hüllproteine
eingesetzt, wodurch definierte Gewebetropismen vermittelt und pseudotypisierte
Vektoren
produziert
werden
konnten.
Die
Verwendung
des
Gibbon
Affen
Leukämievirus (GaLV) Hüllproteins, dessen Rezeptor Pit1 auf T-Zellen hoch exprimiert
wird, ermöglichte eine effiziente Transduktion primärer humaner T-Zellen (Kavanaugh
et al., 1994; Lam et al., 1996). Die Verwendung retroviraler Vektoren ist jedoch auf
mitotisch proliferierende Zellen beschränkt, da das Genom nur während der Zellteilung
in den Nukleus transloziert und ins Wirtsgenom integriert werden kann (Miller et al.,
1990; Roe et al., 1993). Humane periphere Blutlymphozyten müssen deshalb vor ihrer
Transduktion aktiviert und zur Proliferation angeregt werden. In der Zellkultur wird dies
durch stimulierende CD3-spezifische Antikörper erreicht, die eine Antigenbindung an
den TZR simulieren und durch Zugabe von rekombinantem IL-2, das proliferative
Signale erzeugt.
Um nicht-proliferierende Zellen zu transduzieren wurden lentivirale Vektoren, die auf
HIV-1 basieren, etabliert (Vigna and Naldini, 2000). Ruhende T-Zellen und frühe
Vorläufer hämatopoetischer Stammzellen scheinen jedoch resistent gegen den
effizienten Gentransfer mit Lentiviren zu sein, die mit dem Oberflächenglykoprotein (G)
des Vesikulären Stomatitis Virus (VSV-G) pseudotypisiert wurden (Sutton et al., 1999).
Grundsätzlich
müssen
bei
der
Konstruktion
solcher
Vektoren
besondere
Sicherheitsmaßnahmen beachtet werden, da es durch homologe Rekombination zur
Produktion von replikationseffizientem Wildtyp-Nachkommenvirus kommen kann
16
Einleitung
(Delenda, 2004). Um dies zu kontrollieren, wurden Cis-Elemente des Transfervektors
minimiert und Trans-Elemente mit Helferplasmiden zur Verfügung gestellt. Außerdem
konnten die Promotorregionen der langen terminalen Wiederholungen (LTR) durch
heterologe Promotoren oder durch selbstinaktivierende (SIN) Sequenzen ersetzt
werden. Dabei führt eine Deletion der U3-Region im 3’-LTR während der reversen
Transkription
des
Nachkommenvirusgenoms
zu
einer
Deaktivierung
der
Promotorsequenz (Kim et al., 1998). Durch die Deletion der Strukturproteine im
retroviralen
Genom
wurden
relativ
große
Transgenkapazitäten
erreicht,
die
hauptsächlich durch die Verpackungseffizienz des RNA-Provirus bestimmt werden
(Sinn et al., 2005). Die Komplementierung dieser verpackungsdeffizienten Genome mit
Hilfe von Verpackungsplasmiden oder die Verwendung von stabil transfizierten
Verpackungszelllinien,
dient
der
Herstellung
replikationsdeffizienter
retroviraler
Vektoren. Die Verwendung gewebespezifischer Promotorsequenzen ermöglicht eine
weitere Spezialisierung des Tropismus für einen bestimmten Zielzelltyp (Follenzi et al.,
2002). Diese verschiedenen Manipulationen der Eigenschaften retroviraler Vektoren
öffnen ein breites Spektrum an Anwendungen, vor allem im Bereich der Gentherapie.
1.10 Hepatitis B Virus
Das Hepatitis B Virus (HBV) ist ein nicht-zytopathisches DNA-Virus, aus der Familie
der Hepadnaviridae, einer Familie membranumhüllter DNA-Viren mit ausgeprägtem
Lebertropismus und hoher Wirtsspezifität. Die Infektion erfolgt durch Austausch von
Körperflüssigkeiten (Blut- und Sexualkontakt) und findet entweder horizontal zwischen
Erwachsenen oder vertikal von der infizierten Mutter auf das Neugeborene statt
(Ganem, 1982). Nach der akuten Phase der Infektion kann je nach Alter und
Immunstatus des Patienten eine chronische Hepatitis B entstehen. Diese kann im
weiteren Verlauf mehrerer Jahre mit einem stark erhöhten Risiko zur Entwicklung von
lebensbedrohlichen Folgeerkrankungen wie Leberzirrhose oder hepatozellulärem
Karzinom
(HCC)
führen.
Das
nicht-zytopathische
HBV
selbst
ruft
weder
schwerwiegende Leberzellschäden, noch starke Entzündungsreaktionen hervor, wie in
immuntoleranten HBV-transgenen Mausmodellen gezeigt werden konnte (Chisari,
1995).
Das humane HBV infiziert neben dem Menschen nur hominide Primaten wie
Schimpansen (Pan troglodytes). Nahe Verwandte des HBV sind auf tierische
Populationen spezialisiert. Diese sind Wollaffen (Lagothrix lagotricha, Wooly Monkey
Hepatitis B virus (Lanford et al., 1998)), Waldmurmeltiere (Marmota monax,
Woodchuck Hepatitis B virus (Summers et al., 1978)), Erdhörnchen (Xerus inauris,
17
Einleitung
Groundsquirrel Hepatitis B virus (Marion et al., 1980)) und innerhalb der Vögel
Pekingenten (Anas platyrhynchos, Duck Hepatitis B (Mason et al., 1980)), Reiher
(Ardeidae, Heron Hepatitis B virus (Sprengel et al., 1988)) und Schneegänse (Anser
caerulescens, Snow Goose Hepatitis B virus (Schettler, 1971)). Da es sich bei diesen
Arten nicht um isolierte und charakterisierte Labortierstämme handelt, fehlt ein
etabliertes und ausreichend charakterisiertes Tiermodell, zur Untersuchung der
Wechselwirkungen zwischen Virus und Wirt. Zu diesem Zweck wurden HBV-transgene
Mäuse entwickelt, die wegen ihrer in der Embryonalentwicklung erworbenen Toleranz
gegen HBV, als Modell für die chronische Hepatitis B dienen. (Chisari et al., 1985;
Guidotti et al., 1995). Ein adenovirales System zur Transduktion muriner Zellen mit
Hepatozyten-spezifischer Expression eines HBV-Genoms spiegelt mehrere Aspekte
einer akuten Infektion mit Leberentzündung und Elimination der HBV-Replikation
wieder (Isogawa et al., 2005b; Ren and Nassal, 2001; Sprinzl et al., 2001). Außerdem
wurde eine experimentelle HBV-Infektion von Hepatozyten des südostasiatischen
Spitzhörnchen (Tupaia belangeri chinenesis) beschrieben, was ungewöhnlich ist, da
diese Art nicht zu den Primaten zählt und neben ihnen eine eigene Ordnung darstellt
(Walter et al., 1996; Yan et al., 1996). Diese Hepatozyten können in einem
Xenotransplantationsmodell in immundeffizienten uPA/RAG-2-Mäusen die Leber
repopulieren, deren endogene Hepatozyten durch die toxische Wirkung eines
leberspezifisch exprimierten Urokinase Plasminogenaktivatorgens zerstört wurden
(Dandri et al., 2005). Dieses Infektionsmodell ist aber ineffizient und selbstlimitierend.
1.11 Epidemiologie der HBV-Infektion
Das HBV wurde erstmals 1966 beschrieben und als Australien-Antigen bezeichnet, da
es in familiären Studien von australischen Ureinwohnern entdeckt wurde (Blumberg et
al., 1966). Bald darauf wurde es als infektiöses Agens der viralen Hepatitis identifiziert
(Blumberg et al., 1969). Das HBV hat seitdem stetig an Aufmerksamkeit gewonnen, da
die
chronische
Hepatitis
B
zu
schwerwiegenden
und
lebensbedrohlichen
Folgeerkrankungen führen kann. Trotz der Verfügbarkeit eines Impfstoffes steigen die
weltweiten Infektionsraten besonders in den Entwicklungsländern ständig weiter
(Ganem and Schneider, 2001). WHO-Angaben zufolge sind weltweit ca. 400 Millionen
Menschen chronisch mit HBV infiziert und jährlich sterben ca. eine Millionen Menschen
an den direkten Folgen einer chronischen Hepatitis B Erkrankung.
Der Krankheitsverlauf nach einer HBV-Infektion ist individuell sowohl vom Alter des
Infizierten,
als
auch
von
dessen
allgemeinem
Immunstatus
abhängig.
Der
Primärinfektion folgt eine 4-6 monatige symptomfreie Inkubationszeit, welche in die
18
Einleitung
akute Phase der Infektion übergeht. In 50% der Fälle verläuft auch die akute Phase bei
Erwachsenen symptomlos und eine neutralisierende Immunität wird entwickelt. Der
Großteil der verbleibenden Patienten entwickelt eine akute Leberentzündung
(Hepatitis), die in den meisten Fällen vollständig ausheilt. Eine chronische Erkrankung
entwickelt sich bei etwa 5% der infizierten Erwachsenen, bei 30% der Kleinkinder und
bei etwa 90% der infizierten Neugeborenen, wobei hier die neonatale Toleranzbildung
eine Rolle spielen könnte (Chisari and Ferrari, 1995a). In Deutschland leben ca.
500.000 Patienten mit chronischer Hepatitis B (0,4-0,7%; Robert Koch Institut,
Epidemiologisches Bulletin, Januar 2004), welche durch eine aktive Replikation des
HBV in den Hepatozyten und nachweisbaren HBs-Antigenkonzentrationen im Serum
gekennzeichnet ist, was auch zu der Bezeichnung HBsAg-Träger führte (Ganem and
Prince, 2004). Eine variable, aber persitierende Viruslast im Blut des Patienten ist
dabei über mehr als 20 Wochen nachweisbar (Robinson, 1996).
1.12 Partikelaufbau des HBV
HBV infizierte Zellen sezernieren verschiedene Formen viraler Partikel. Es werden die
infektiösen Dane-Partikel, mit einem Durchmesser von 42 nm, und die morphologisch
unterschiedlich aufgebauten, subviralen Partikel sezerniert, die nicht infektiös sind
(Dane et al., 1970). In den infektiösen Partikeln umschliesst eine vom Wirt stammende
Lipiddoppelmembran das Nukleokapsid. In diese Lipidmembran sind die drei
verschiedenen HBV-Hüllproteine eingelagert, die vom viralen Genom exprimiert
werden und sich in ihrer Länge unterscheiden. Das längste ist das L(large)-Protein
(P39 bzw. GP42), gefolgt vom M(middle)-Protein (P35 bzw. GP38) und das kürzeste ist
das S(small)-Protein (P24 bzw. GP28) (Heermann and Gerlich, 1991; Neurath et al.,
1985). Sie besitzen alle den selben, stark hydrophoben C-Terminus, der sie durch vier
transmembranäre α-Helices in der Membran verankert (Berting et al., 1995).
Das Nukleokapsid ist aus 180 bzw. 240 Untereinheiten des Kapsid-Proteins (core, C,
P21) aufgebaut und besitzt die Form eines Ikosaeders. Es enthält neben dem 3,2 kb
großen viralen Genom auch die virale Polymerase, welche über ein terminales Protein
kovalent an den negativen DNA-Strang des viralen Genoms gebunden ist
(Bartenschlager and Schaller, 1992).
Neben infektiösen Viruspartikeln, werden auch nicht infektiöse, subvirale Partikel von
den Leberzellen sekretiert (Ganem and Prince, 2004). Die Population der subviralen
Partikeln besteht aus den sphärischen und den filamentösen Partikeln, mit einem
Durchmesser von 15 bis 22 nm. Die Länge der filamentösen Partikel kann variieren
19
Einleitung
und sie bestehen aus L-, M-, und S-Proteinen. Die sphärischen Partikel dagegen
bestehen hauptsächlich aus S- und geringen Mengen an M-Protein (Abb. 1.5).
Filament
Sphäre
Kapsid Protein
L-Protein
S-Protein
M-Protein
Durchmesser:
15-22 nm
42 nm
nichtinfektiöse
subvirale Partikel
Abbildung 1.5: Aufbau der infektiösen Dane Partikel und subviralen Partikel
Die von der Wirtszelle stammende Lipiddoppelmembran, mit den eingelagerten HBVOberfächenproteinen (L-, M- und S-Protein) umschließt das aus Kapsidproteinen (Core Protein)
aufgebaute Nukleokapsid. In diesem ist das HBV-DNA-Genom mit dem gebundenen Komplex
aus Polymerase (pol) und terminalem Protein eingeschlossen. Die subviralen Partikel liegen in
filamentöser
oder
sphärischer
Form
vor
und
unterscheiden
sich
in
ihrer
Hüllproteinzusammensetzung. Sie enthalten weder Kapside noch HBV-DNA. (aus
Bundesgesundheitsblatt, 43:240–248, 2000)
In infektiösem Serum von Patienten sind die sphärischen Partikel mit durchschnittlich
1013/ml Blutserum am häufigsten, während die filamentösen Partikel mit 1010/ml und
die Dane-Partikel mit 109/ml in geringeren Konzentrationen vorkommen. Die
Komplexierung der Hüllproteine zu Dimeren findet durch inter- und intramolekulare
Quervernetzung von Cysteinresten des S-Proteins statt und erfolgt ohne die
Beteiligung zellulärer Proteine (Heermann and Gerlich, 1991). Die sphärischen
subviralen Partikel besitzen eine, für Proteinkomplexpartikel, sehr ungewöhnliche
oktahedrische Form und die darin enthaltenen Lipide scheinen nicht in einer typischen,
semifluiden Lipiddoppelmembran sondern unmobil auf der Oberfläche der Partikel
lokalisiert zu sein (Gilbert et al., 2005; Satoh et al., 2000). Die genaue Funktion der
subviralen Partikel ist noch nicht vollständig aufgeklärt, sie sind aber stark immunogen
und enthalten weder HBV-DNA, noch Kapside und sind daher nicht infektiös.
20
Einleitung
1.13 Genomorganisation des HBV
Das HBV Genom besitzt eine Länge von weniger als 3.2 kb und ist somit das kleinste
bekannte, voll replikationfähige Virusgenom unter den Tierviren. Dies erklärt auch die
hohe Komplexität seiner Genomorganisation mit multiplen und überlappenden
offenenen Leserastern (ORF). Jedes Nukleotid im HBV-Genom kodiert für eines der
HBV-Proteine und mehr als 50% sind in mindestens zwei simultanen Leserastern
organisiert (Abb. 1.6).
Abbildung 1.6: Genomorganisation von HBV
Die äußeren Kreise zeigen die Transkripte der genomischen und subgenomischen RNAs,
wobei die Dreiecke die Transkriptionsstartstellen und der Kasten die ε-Verpackungssequenz
symbolisieren. Die mittleren, dicker linierten Kreise stellen das partiell doppelsträngige Genom
dar, die Kästen zeigen Verstärkerelemente (Enh) und posttranskriptionale Regulationselemente
(direct Repeats, DR1+2). Die pfeilartigen Kreise im Inneren der Zeichnung zeigen die vier
offenen Leseraster (ORF) und die translatierten Produkte X-, Kapsid(C)- und Polymerase(P)Protein und die Hüllproteine S, M (preS2) und L (preS1). (modifiziert nach (Protzer et al., 1999))
Als Konsequenz daraus sind alle wichtigen cis-aktiven Sequenzen Teil eines ORF, wie
z.B.
die
Promotor-
und
Verstärker-
(Enhancer)
Elemente
oder
das
ε-
Verpackungssignal. Das 3’-Ende des positiven DNA-Stranges variiert in seiner Länge,
21
Einleitung
woraus einzelsträngige Genombereiche resultieren. Da die entstandenen Enden nicht
ligiert werden, sondern nur durch kohäsive Enden verbunden sind, liegt das virale
Genom in entspannter, nicht verdrillter Form vor (rcDNA, relaxed circular DNA).
Nachdem das virale Genom im Zellkern der infizierten Wirtszelle angelangt ist, wird es
durch wirtszelleigene DNA-Reparaturenzyme zu einem Doppelstrang vervollständigt
und liegt anschließend in kovalent geschlossener, zirkulärer Form (cccDNA) vor. Diese
dient als Transkriptionsmatritze für die prägenomische und die subgenomischen
mRNAs. Das HBV Genom besteht aus vier mehrfach überlappenden Leserastern
(preC, C, preS1, preS2, S, P, X) auf dem negativ orientierten DNA-Strang. Diese
hochkomplexe Überlappung der Leseraster, und die relativ geringe Anzahl an
Virusproteinen, ermöglicht die geringe Größe des HBV Genoms. Die Transkription der
mRNAs wird durch vier Promotoren kontrolliert. Diese sind der Core-, der preS1(L)-,
der preS2(S)- und der X-Promotor. Beginnend von diesen Promotoren endet die
Transkription der mRNAs immer am einzigen vorhandenen Polyadenylierungssignal,
was zur Synthese der verschiedenen subgenomischen RNAs führt (Cattaneo et al.,
1984). Die mRNAs für die Hüllproteine werden von einem einzigen ORF transkribiert
und besitzen rasterinterne Startkodons. Dies hat zur Folge, daß die drei translatierten
Proteine S,M und L unterschiedlich lange N-teminale Domänen besitzen (Berting et al.,
1995).
Die
zwei
internen
Verstärkerelemente
(Enh1/Enh2)
üben
einen
unterschiedlichen Einfluß auf die vier Promotoren aus. Enh1 beeinflusst alle
Promotoren, während Enh2 nur die Transkriptionsrate des präS2(M)-Promotors steuert
(Ganem and Schneider, 2001).
Das X-Protein wird vom X-Promotor aus transkribiert, doch seine Funktion ist nicht
vollständig
aufgeklärt.
Eine
mögliche
Funktion
als
Transaktivator
wurde
in
Zellkulturexperimenten beschrieben und die Infektiösität des Virus geht ohne das XProtein verloren (Rossner, 1992). Die virale Polymerase und das Kapsid-Protein
werden, ausgehend von unterschiedlichen Startkodons, von dem 3,5 kb großen
prägenomischen Überlängentranskript translatiert. Diese prägenomische mRNA dient
zusätzlich als Matritze für die reverse Transkription des RNA-Prägenoms und wird
zusammen mit dem Komplex aus viraler Polymerase und terminalem Protein in das
Nukleokapsid verpackt.
1.14 Replikationszyklus des HBV
Die Replikation der Hepadnaviren erfolgt wie bei Retroviren über ein RNA-Intermediat,
welches im Zytoplasma der Wirtszelle, im viralen Nukleokapsid verpackt und erst
danach in doppelsträngige DNA umgeschrieben wird. Deshalb wird HBV auch als
22
Einleitung
Pararetrovirus bezeichnet (Ganem and Schneider, 2001). Die Replikation erfolgt,
aufgrund des strengen Lebertropismus, ausschließlich in den Hepatozyten des
Wirtsorganismus. Die frühen Schritte der HBV Infektion, die Anlagerung des
Viruspartikels an die Wirtszelle, das Eindringen und die Freisetzung des Kapsids und
der Transport des genetischen Materials in den Zellkern sind nicht vollständig
aufgeklärt. Die vorhandenen Daten legen nahe, daß der Anlagerung, die maßgeblich
durch das L-Protein vermittelt wird, eine rezeptorvermittelte Endozytose folgt. Diese
Schritte werden wahrscheinlich von den HBV-Oberfächenproteinen, der Zellmembran,
spezifischen Rezeptoren und der extrazellulären Matrix gesteuert (Abb. 1.7).
Dane-
subvirale
Partikel
Partikel
Abbildung 1.7: Infektion und Replikationszyklus des HBV
Das HBV lagert sich über einen noch unbekannten Rezeptor an der Membran der Hepatozyten
an und dringt durch Endozytose in die Zelle ein. Nach dem Entfernen der Lipidmembran durch
Membranfusion mit dem Endosom wird das Kapsid zum Nukleus transloziert, die rcDNA in den
Zellkern transportiert und durch zelleigene Reparaturenzyme zur cccDNA vervollständigt. Von
dieser Matritze beginnt die Transkription der sub- und prägenomischen RNAs, die verpackt
bzw. translatiert werden und die strukturellen und nichtstrukturellen Proteine zur Verfügung
stellen. Nach der Zusammensetzung des Nukleokapsids beginnt die reverse Transkription des
RNA-Genoms zur partiell doppelsträngigen, reifen DNA. Erst nach diesem Prozess wird das
Kapsid entweder durch Sekretion ins ER-Lumen mit einer Lipiddoppelmembran, in die die HBVHüllproteine eingelagert sind, umhüllt oder zurück zum Zellkern transportiert um einen Pool an
cccDNA aufzubauen. Die reifen HBV-Partikel verlassen die Wirtszelle durch Sekretion.
Aufgrund des Fehlens eines tierischen Infektionsmodells für HBV, wurde für die
Aufklärung dieser Vorgänge hauptsächlich das Enten-HBV System verwendet (Cooper
et al., 2003).
23
Einleitung
Um das Endosom verlassen zu können, müssen die HBV-Hüllproteine durch
endosomale Proteasen prozessiert werden, wodurch ein Translokationsmotiv (TLM)
exponiert wird (Stoeckl et al., 2006). Dieses vermittelt die Translokation der
Viruspartikel durch die Membran des Endosoms. Das DNA-entaltende Kapsid wird ins
Zytoplasma entlassen und transloziert zum Nukleus, wobei das Kapsidprotein eine
Interaktion mit dem Kernporenkomplex vermittelt (Bock et al., 1996). Ob das HBVGenom als partiell doppelsträngige DNA an der Kernmembran freigesetzt oder das
intakte Nukleokapsid in den Nukleus transloziert wird, ist nicht vollständig augeklärt
(Ganem
and
Schneider,
2001).
Im
Zellkern
erfolgt
durch
zelluläre
DNA-
Reparaturenzyme die Vervollständigung der rcDNA in die cccDNA. Die daran
beteiligten Mechanismen und Enzyme werden intensiv erforscht. Die cccDNA
persistiert in episomaler Form im Nukleus der Wirtszelle und da ihr ein
Replikationsstartpunkt fehlt, wird das Genom ausschließlich durch die reverse
Transkription und den Reimport vervielfältigt (Tuttleman et al., 1986). Die cccDNA stellt
im Zellkern der Wirtszelle eine ständige Quelle für die HBV-Replikation dar (WerleLapostolle et al., 2004). In dem erwähnten Tiermodell der HBV-transgenen Mäuse
kommt es jedoch nicht zur Etablierung einer episomalen cccDNA im Zellkern.
Die prägenomischen und subgenomischen RNAs werden von der zellulären RNAPolymerase II transkribiert und ungespleißt ins Zytoplasma transportiert (Kock and
Schlicht, 1993). Dort findet die Translation der viralen Hüllproteine L, M, S, und des XProtein an den Ribosomen der Wirtszelle, basierend auf den subgenomischen RNAs
statt. Von der prägenomischen RNA wird die virale Polymerase translatiert und, unter
Verwendung unterschiedlicher Startkodons, werden von diesem Transkript auch das
Kapsid-Protein und das sekretierte HBeAg translatiert.
Das Volllängentranskript prägenomische RNA, bildet das virale Genom und wird im
Zytoplasma der HBV-infizierten Zelle in das Viruskapsid verpackt. Zur Initiation der
Verpackung interagiert ein Komplex aus viraler Polymerase und terminalem Protein
(TP)
mit
einer
Haarnadelstruktur
(ε-Erkennungssequenz)
am
5’-Ende
der
prägenomischen RNA und wird dort kovalent gebunden (Bartenschlager and Schaller,
1992). Durch Anlagerung von core-Proteindimeren an diese Sequenz erfolgt die
Enkapsidierung des RNA-Polymerase-Komplexes (Ganem et al., 1994; Pollack and
Ganem, 1994). Nach der Vervollständigung des neugebildeten Nukleokapsids beginnt
die Reverse Transkriptase mit der cDNA Synthese des negativ orientierten DNA
Strangs, unter Verwendung eines Tyrosinrestes des terminalen Proteins als Primer
(Wang and Seeger, 1992; Zoulim and Seeger, 1994). Durch die ebenfalls vorhandene
RNAse H-Aktivität der reversen Transkriptase wird die positiv orientierte RNA im
24
Einleitung
RNA/DNA-Hybriden noch während der reversen Transkription entfernt (Walton et al.,
2001).
Der
neu
synthetisierte
Minusstrang
ist
nun
die
Matritze
für
die
partielle
Plusstrangsynthese des HBV Genoms wobei ein verbleibendes, 18-19 Basen langes
RNA-Stück, aus der ε-Erkennungssequenz am 5’-Ende als Primer dient (Lien et al.,
1986). Bevor der Überhang des Plusstrangs synthetisiert wird, findet über
komplementäre Sequenzen am 5’-Ende des Plus- und am 3’-Ende des Minusstranges,
die zirkuläre Schließung des Genoms statt. Dadurch entsteht das endgültige, partiell
doppelsträngige virale Genom (Lien et al., 1987). Die nun reifen Nukleokapside können
entweder in den Nukleus reimportiert oder ins Lumen des endoplasmatischen
Retikulums sezerniert werden, um von einer Lipiddoppelmembran umbegen zu
werden, welche die viralen Oberflächenantigene enthält (Huovila et al., 1992; Patzer et
al., 1986). Der Reimport reifer Nukleokapside in den Zellkern, dient dem Aufbau eines
Vorrats von 5-50 Kopien an cccDNA pro Wirtszelle. Von diesem cccDNA-Pool werden
die prä- und subgenomischen RNAs transkribiert. Diese Anreicherung im Zellkern
findet wahrscheinlich vor der Sekretion von reifen Viruspartikeln statt, um eine effektive
Transkription zu etablieren (Moraleda et al., 1997).
Mit Hilfe des Golgi-Apparates werden die reifen Viruspartikel aus der Wirtszelle
sekretiert. Die nachgewiesenen Verhältnisse der Oberflächenantigene im Blut
infizierter Patienten betragen für das L-Protein 1-2%, für das M-Protein 5-15% und für
das S-Protein 83-94% (Ganem and Schneider, 2001).
Die HBV-Hüllproteine werden für die Membranumhüllung der Viruspartikel in die
Golgimembran eingelagert. Durch Invagination der Kapside werden diese mit einer
Lipidmembran umhüllt, welche die Hüllproteine enthält. In der Membran sekretorischer
Vesikel, die vollständige HBV-Partikel zur Zellmembran transportieren, müssten somit
die HBV-Hüllproteine vorkommen, die nicht in Virusmembranen eingelagert wurden.
Durch die Membranfusion dieser Vesikel gelangen diese Proteine in die Zellmemran
der Wirtszelle (Abb.1.8).
Dies führt zu einer spezifischen Distribution der HBV-Hüllproteine in der Zellmembran
HBV-replizierender Zellen, die darüber identifiziert werden können. Aufgrund dieses
Mechanismus sollten die Hüllproteine in ähnlichen Verhältnissen in der Zellmembran
vorkommen, wie sie im Blut infizierter Patienten beschrieben wurden.
25
Einleitung
Abbildung 1.8: Oberflächendistribution des HBV S-Proteins
HBV S-Protein spezifische immunhistologische Färbung in eines Schnittes durch eine HBVreplizierende Mausleber S-Protein spezifischen Antikörpern. Zellen die HBV replizieren (rechte
Bildhälfte) zeigen eine deutliche Oberflächenfärbung für das S-Protein. Zur Verfügung gestellt
von Prof. Ben Yen, Universität von Californien, San Francisco.
1.16 HBV-spezifische Immunantwort
Nach der Primärinfektion, kann nach einer Inkubationszeit von ca. vier Wochen HBV
DNA per PCR amplifiziert werden. Zu diesem Zeitpunkt sind jedoch nur relativ geringe
Konzentrationen von 102 bis 104 Genomäquivalenten pro Milliliter Blut vorhanden
(Rehermann and Nascimbeni, 2005). Nach zwei bis zehn Wochen sind nachweisbare
Mengen an HBsAg vorhanden und kurz danach können spezifische Antikörper gegen
HBV Kapsid-Proteine (HBcAg) detektiert werden (Abb. 1.9), die im frühen Verlauf
hauptsächlich einen IgM-Isotyp besitzen (Hoofnagle, 1981).
Eine etablierte Virämie mit hohen Virustitern zwischen 109 und 1010 Virionen pro
Milliliter ist zu diesem Zeitpunkt typisch (Ribeiro et al., 2002). Zirkulierendes HBeAg
kann nun nachgewiesen werden und Studien an Schimpansen haben gezeigt, daß zu
diesem Zeitpunkt 75% bis 100% der Hepatozyten infiziert sind (Kajino et al., 1994).
Etwa 5 bis 15 Wochen nach der Primärinfektion beginnen die Konzentrationen der
Alaninaminotransferasen (ALT) im Serum anzusteigen, was die zytotoxische
Leberentzündung durch die einsetzende adaptive Immunantwort anzeigt. ALT werden
von apoptotischen Hepatozyten freigesetzt und dienen der klinischen Einschätzung der
Leberschädigung.
26
Einleitung
akute selbstlimitierte Infektion
HBV DNA
HBeAg
Anti-HBs
HBsAg
Anti-HBc
Anti-HBe
ALT
Wochen
Jahre
chronische Infektion
HBV DNA
HBeAg
Anti-HBs
HBsAg
Anti-HBc
Anti-HBe
ALT
Wochen
Jahre
Abbildung 1.9: Schematischer Hepatitis B Verlauf
Die Graphik zeigt die Mengen HBV-spezifischer Antikörper (Anti-HBc, -HBs, -HBe), HBVProteine (HBs-, HBeAg), die Virusreplikation (HBV DNA) und die Leberschädigung (Alanin
Aminotransferase, ALT) im Verlauf der Zeit nach der ersten Exposition des HBV.
Gegenübergestellt werden die akute, selbstlimitierte (A) und die chronische (B) Hepatitis B (aus
(Ganem and Prince, 2004)).
Bei ca. 90% der infizierten Erwachsenen kommt es nach der akuten Infektion zu einem
Ausheilen der Infektion, begleitet von der Bildung HBc- und HBeAg spezifischer IgGAntikörper, die eine lebenslange, protektive Immunität vermitteln (Rehermann and
Nascimbeni, 2005).In Patienten mit ausgeheilter Hepatitis B konnte gezeigt werden,
daß noch Jahrzehnte nach der Erkrankung eine minimale Virusreplikation nachweisbar
ist. Diese wird von einer aktiven und antigenspezifischen T-Zellantwort kontrolliert
(Rehermann et al., 1996a). Möglicherweise ist neben einer humoralen Erinnerung
dieses ausbalancierte Verhältnis zwischen Virusreplikation und Kontrolle durch die TZellantwort für die lebenslange Immunität mit verantwortlich. (Rehermann et al.,
1996b).
Im chronischen Verlauf kommt es dagegen zwar zur Bildung HBeAg-spezifischer, nicht
aber HBsAg-spezifischer Immunglobuline. Typisch ist neben einer persistierenden
Produktion des HBsAg auch eine lange Nachweisbarkeit des HBeAg. In seltenen
Fällen kommt es im Zusammenhang mit Virämierückfällen, zu einem unregelmäßigen
Ansteigen von Lebertransaminasen im Serum. Diese sogenannten hepatischen Flares
stehen oft in Verbindung mit der Beendigung einer antiviralen Therapie (Mels et al.,
27
Einleitung
1994). Die Entwicklung des Infektionsverlaufes ist stark von der Immunantwort des
Wirts abhängig und die zytotoxische T-Zellantwort des Wirts wird sowohl für die
Elimination des Virus als auch für die entzündliche Schädigung der Leber bei der
persistierenden
HBV-Infektion
verantwortlich
gemacht.
Diese
chronische
Leberentzündung und die daraus folgenden massiven regenerativen Prozesse,
erzeugen einen mutagenen und mitogenen Einfluß. Dieser kann zu DNASchädigungen und somit zur Entwicklung eines hepatozellulären Karzinomes führen
(Chisari and Ferrari, 1995b).
Während in Patienten mit ausgeheilter Hepatitis B eine starke und polyklonale TZellantwort beobachtet wurde (Bertoletti et al., 1991; Rehermann et al., 1995), wurde
bei Patienten mit chronischem Infektionsverlauf nur eine schwache und oligoklonale TZellantwort beschrieben (Penna et al., 1996; Penna et al., 1991). Dies scheint der
maßgebliche Unterschied in der Kontrolle der HBV-Infektion zu sein. So wurden in
klinischen Studien mit immundefizienten Patienten relativ milde Leberentzündungen
nach einer HBV-Infektion beobachtet, jedoch hohe Wahrscheinlichkeiten für die
Entwicklung einer persistierenden Infektion ermittelt (Stevens et al., 1975). Außerdem
wurde gezeigt, daß regulatorische T-Zellen, die an der suppressiven Regulation der TZellantwort beteiligt sind, in erhöhten Zahlen in chronisch HBV-Infizierten vorhanden
sind. Im Vergleich zu gesunden und ausgeheilten Kontrollpatienten, in welchen
normale Konzentrationen ermittelt wurden, könnte dies ein Faktor für die nicht
ausreichende T-Zellantwort sein, der die Persistenz des HBV begünstigt (Stoop et al.,
2005).
Ein zweiter wichtiger Mechanismus bei der Abwehr von HBV ist das angeborene
Immunsystem. Die dabei verwendeten TLR erkennen spezifische Muster, die nur in
Pathogenen vorkommen. Da sie nicht adaptiv sind, kann dieses System schnell
reagieren. Die typischen erkannten Muster sind mikrobielle und mykotische Strukturen,
wie Membrankomponenten oder unmethylierte CpG-Abschnitte in der DNA. Durch
diese Mustererkennung kommt es zur Aktivierung von Signalkaskaden, die zu einer
Sekretion von Zytokinen durch die Immunzellen führt und zur Aktivierung der adaptiven
Immunantwort führt. Neuere Ergbenisse zeigen, daß die Aktivierung der TLR 3, 4, 5, 7
und 9 durch spezifische Liganden eine Inhibition der HBV-Replikation in HBVtransgenen Mäusen bewirkt (Isogawa et al., 2005c). Außerdem wurde eine verringerte
Expression des TLR 2 auf peripheren Monozyten in chronisch HBV infizierten
Patienten nachgewiesen. Dies könnte eine weitere Immunausweichstrategie darstellen
und an der Etablierung einer Persistenz beteiligt sein (Riordan et al., 2006).
Um der Elimination durch das Immunsystem zu entgehen haben viele Viren
Immunausweichstrategien entwickelt (Klenerman and Hill, 2005). HBV vermindert
28
Einleitung
wahrscheinlich die Expression des Antigenpräsentationsmoleküls MHC und der ζ-Kette
der TZR-Signaldomäne. Außerdem scheint die Sekretion des HBeAg an der
Tolerisierung von HBV-spezifischen T-Zellen beteiligt zu sein. Ein weiterer möglicher
Immunausweichmechanismus ist die Produktion großer Mengen subviraler Partikel.
Sie bestehen aus ca. 100 HBsAg-Monomeren, sind stark imunogen und wurden im
Blut infizierter Patienten in Verhälnissen von 104-106 pro infektiösem Dane-Partikel
ermittelt. Das deutet auf eine Tarnung der infektiösen Partikel vor der Immunantwort
hin (Rehermann and Nascimbeni, 2005). Durch das Abfangen neutralisierender
HBsAg-spezifischer Antikörper könnten die infektiösen Dane-Partikel mit ihrer geringen
Konzentration, so der Neutralisierung entgehen (Mangold and Streeck, 1993).
Die Langzeifolgen der chronischen Hepatitis B, Leberzirrhose und hepatozelluläres
Karzinom, Infektion sind ein weltweites Problem und sind für eine hohe Mortalität der
infizierten Patienten verantwortlich. Die gängigen Therapien sind nur in einem Teil der
Behandelten wirksam und eineLebertransplantation bleibt die einzige Möglichkeit eine
stark geschädigte Leber zu ersetzen. Eine profunde Immunantwort durch adoptiv
transferierte immuntherapeutische T-Zellen könnte die inefiziente T-Zellantwort, die zur
Persistenz des Hepatitis B Virus führt, ersetzen oder unterstützen. Für eine solche
potentielle Anwendung sollten in dieser Arbeit verschiedene chimäre T-Zellrezeptoren
generiert werden, die HBV-Oberflächenantigene direkt erkennen und eine funktionelle
Immunantwort induzieren. Die nicht MHC-restringierte Antigenerkennung durch
Antikörperfragmente
und
eine
modulare
Signaldomäne,
die
ein
zusätzliches
Expansionssignal erzeugt, sollten dafür optimal geeignet sein. Mit diesen Konstrukten
könnten autologe T-Zellen des Patienten transduziert, vervielfältigt und adoptiv
transferiert
werden.
Dies
würde
eine
chronischen HBV-Infektion ermöglichen.
29
vielversprechende
Immuntherapie
der
Ergebnisse
2 Ergebnisse
2.1 Generierung chimärer T-Zellrezeptorkonstrukte
Um für eine Immuntherapie eine künstliche T-Zellantwort zu generieren, können
entweder native T-Zellrezeptoren oder artifizielle chimäre TZR-Kontstrukte transferiert
werden. Beim Transfer selektierter spezifischer T-Zellrezeptoren, werden rekombinante
α- und β-Ketten exprimiert, die von einem MHC/Antigenkomplex abhängig sind. Da die
T-Zellen auch endogene Rezeptorketten exprimieren, kann es zu einer Falschpaarung
kommen, wodurch nicht-funktionelle TZR entstehen. Um die MHC-Restriktion zu
umgehen, wurden in dieser Arbeit chimäre T-Zellrezeptoren (cTZR) hergestellt, die
HBV-infizierte Zielzellen spezifisch erkennen und zytotoxisch eliminieren sollten. Als
Grundlage für die cTZR wurden etablierte Konstrukte verwendet (Hombach et al.,
2001b) deren antigenspezifische Erkennungsdomäne verändert wurde. Diese cTZR
bestehen aus einer extrazellulären Antigenerkennungsdomäne, die über eine LinkerDomäne
aus
einem
Immunglobulin-Fc,
mit
einer
modularen
intrazellulären
Signaldomäne fusioniert ist. Letztere enthält neben einer CD3ζ-Ketten Signaldomäne
eine zusätzliche kostimulatorische CD28-Signaldomäne, um ein proliferatives Signal
durch Antigenbindung zu generieren (Abb. 2.1).
Abbildung 2.1: T-Zellrezeptorvergleich
Im Unterschied zum nativen TZR (links), der einen MHC/Peptidantigenkomplex erkennt, kommt
es beim chimären TZR (rechts zu) einer direkten Erkennung der HBV-Hüllproteine in der
Zellmembran der Zielzelle.
Um die cTZR mit einer HBV-spezifischen Antigenerkennungsdomäne auszustatten,
wurden drei HBV-spezifische Antikörperfragmente (single chain fragment of the
30
Ergebnisse
variable region, scFv) eingesetzt. Diese vermitteln die Spezifität der parentalen
Antikörper. Die verwendeten scFv sind gegen HBV-S-Protein (αS-C8 und αS-C9
(Kuerschner, 2000)) und gegen HBV-L-Protein (αL-5a19 (Pizarro et al., 2001))
gerichtet und wurden mit Polymerasekettenreaktion (PCR) aus prokaryontischen
Expressionsplasmiden
pHOG21
amplifiziert.
Durch
Verwendung
spezieller
Oliginukleotidprimer wurde am 5’-Ende eine NcoI-Schnittstelle und am 3’-Ende eine
BglII-Schnittstelle für die Klonierung eingeführt. Eine am 5’-Ende eingefügte 90
Nukleotide lange κ-Leadersequenz vermittelt die transmembranäre Lokalisation des
translatierten rekombinanten T-Zellrezeptors. Für den Gentransfer in primäre T-Zellen
wurde das retrovirale Vektorplasmid pBULLET (Hombach et al., 2001b) verwendet, das
von pSTITCH (Weijtens et al., 1998a) abgeleitet wurde (Abb. 2.2). Die Klonierung
ergab die retroviralen Expressionsplasmide pBULLET-αS-C8, pBULLET-αS-C9 und
pBULLET-αL-5a19. Der parentale cTZR besitzt eine Antigenerkennungsdomäne die
karzinoembryonisches Antigen (CEA) erkennt (scFv bw432). Dieser wurde bei den
Versuchen als unspezifische cTZR-Kontrolle eingesetzt, da die verwendeten Zielzellen
CEA-negativ sind.
Abbildung 2.2: Struktur der chimären TZR-Konstrukte
Das im retroviralen Plasmiden pBULLET kodierte Transgen des chimären TZR (cTZR) besteht
aus einer κ-Leadersequenz (Lκ), gefolgt vom scFv, der aus variablen schweren (VH) und
leichten (VL) Immunglobulinketten zusammengesetzt ist. Eine IgG-Fc-Linker-Domäne verbindet
die extrazelluläre Antigenerkennungsdomäne mit der transmemranären/intrazellulären
Signaldomäne, die aus einer CD28- und einer CD3ζ-Kettensignaldomäne besteht. Dieses
Transgen ist in ein retrovirales Genom eingelagert, dessen Expression von einem CMVPromotor (PCMV) kontrolliert wird. Das Konstrukt wird beidseitig von den retroviralen langen
terminalen Wiederholungen (LTR) flankiert und beinhaltet die regulatorischen Sequenzen für
Spleißdonor (SD) und Spleißakzeptor (SA) und die virale Verpackungssequenz ψ.
In einem weiteren Ansatz wurden lentivirale Konstrukte für die Transduktion humaner
T-Zellen hergestellt. Dafür wurden die vollständigen cTZR-Konstrukte ausgeschnitten
©
und unter Verwendung des Gateway -Systems in das lentivirale Destinationsplasmid
pLENTI6 eingefügt. Dabei wurde die Klonierung für eine einfachere Handhabung in
31
Ergebnisse
©
einem pENTRY -Transferplasmid vorgenommen und das Transgen anschließend
durch Rekombination in das eigentliche lentivirale Vektorplasmid überführt. Die fertigen
Plasmide wurden vermehrt und das gesamte cTZR-Konstrukt mit multiplen positiv und
negativ
orientierten
Primern
sequenziert
um
die
am
Computer
konstruierte
Nukleotidsequenz zu bestätigen (Anhang: 8 Sequenzen).
2.2 Charakterisierung der chimären T-Zellrezeptoren
Für eine erste Charakterisierung wurden die cTZR-Konstrukte transient in Hek293TZellen exprimiert indem die Zellen mit den transgenkodierenden retroviralen Plasmiden
transfiziert wurden. Da die Verpackungsplasmide nicht kotransfiziert wurden, kam es
nicht zur Produktion retroviraler Vektorpartikel. Nach der Fixation und der cTZRspezifischen Antikörperfärbung wurden Fluoreszenzaufnahmen angefertigt. Dabei
konnte
eine
deutliche
Oberflächenexpression
der
cTZR
αS-C8
und
αS-C9
nachgewiesen werden (Abb. 2.3).
αS-C9
Inkubation mit
αS-C8
DAPI
HBV Partikeln
αS-C8
HBsAg
Ueberlagerung
Abbildung 2.3: Charakterisierung der cTZR-Expression
Hek293T Zellen wurden mit den cTZR-kodierenden retroviralen Plasmiden transient transfiziert,
nach 72h Expression fixiert und immunhistochemisch gefärbt (grün: anti Fc-Linker-Domäne im
cTZR, blau: nukleäre DAPI-Färbung). Oberflächenexpression der cTZR (αS-C8, αS-C9) auf
Hek293T-Zellen (links) und gebundenes HBV S-Protein in Viruspartikeln (rot: anti HBsAg)
überlagern mit den exprimierten cTZR (grün: αS-C8) auf der Oberfläche der transfizierten
Hek293T-Zellen (rechts).
Um die Funktionalität der scFv-Antigenbindungsdomäne zu untersuchen wurden die
cTZR-exprimierenden Hek293T-Zellen mit Mediumüberständen HBV-produzierender
HepG2.2.15-Zellen inkubiert. Die in den Überständen vorhandenen HBV-Partikel
sollten aufgrund der Oberfächenproteine in der Virushülle, von den scFvAntigenerkennungsdomänen der exprimierten cTZR gebunden werden. Durch
32
Ergebnisse
fluoreszenzmarkierte Antikörper gegen die Fc-Linker-Domäne, zur Identifikation cTZRexprimierender Zellen und gegen HBsAg in der Hepatitis B Virushülle wurde die
Bindung bestätigt. Es konnte eine spezifische Überlagerung der cTZR und der an den
scFv gebundenen HBV-Partikel nachgewiesen werden (Abb. 2.3).
In einem zweiten Experiment mit verbessertem Fixationsprotokoll, konnte ein Maximum
dieser Bindung durch die Antigenerkennungsdomäne auf Membranfortsätzen oder in
intrazellulären Kompartimenten gezeigt werden. Die nicht vollständige Überlagerung
könnte auf eine unspezifische Adhäsion oder Internalisation der HBV-Partikel
hinweisen. Auf der zweiten, nicht transduzierten Zelle unten im Bild war dagegen keine
Färbung des cTZR und daran gebundener HBV-Partikel zu erkennen (Abb.2.4).
Abbildung 2.4: Expression der cTZR-Konstrukte
Die Signale der cTZR (grün: anti-Fc-Linker-Domäne im αS-C8-TZR) auf Hek293T-Zellen
überlagern mit Signalen gebundener HBV Partikel (rot: anti HBsAg). Der rot umrandete
Ausschnitt wurde vergrößert (rechts). Aufnahmen der einzelnen Fluoreszenzkanäle sind unten
rechts dargestellt.
2.3 Produktion retro- und lentiviraler Vektoren
Um die Produktion retroviraler Vektoren zu optimieren, wurden unterschiedliche
Produktionsprotokolle verwendet und verglichen. Die Transgenexpression erfolgt von
dem retroviralen Vektorplasmiden pBULLET, der den chimären T-Zellrezeptor als
Transgen kodiert. Eine Deletion der U3 Promotorsequenz im 5’ LTR dient dabei der
Sicherheit der Vektoren, da keine selbstreplizierenden Viruspartikel entstehen können.
Das fehlende Promotorelement im LTR wurde durch einen CMV-Promotor/Enhancer
ersetzt.
Um
infektiöse
retrovirale
Vektoren
herzustellen,
wurden
zwei
Verpackungsplasmide kotransfiziert, die für ein pseudotypisierendes GALV-env
Oberflächenprotein (pCOLT-GALV) und die Kapsid- und Polymerasegene (pHIT60)
kodieren (Abb. 2.5).
33
Ergebnisse
pBULLET
CMV
5`LTR SD ψ SA
U5
cTCR
3`LTR SV ori
U3 U5
Kotransfektion
Transgene
Hek 293T
pCOLT-GALV CMV
pHIT60 CMV
GALV env
MoMLV gag/pol
poly A SV ori
poly A SV ori
Abbildung 2.5: Retrovirale Vektorproduktionsplasmide
Das retrovirale Plasmidsystem besteht aus drei Plasmiden, pBULLET, pCOLT-GALV und
pHIT60. Diese stehen unter der Kontrolle des Cytomegalievirus (CMV) Promotors. Das
genomische Plasmid pBULLET enthält das cTZR-Konstrukt als Transgen. pCOLT-GALV kodiert
das GALV-Hüllprotein, pHIT60 die Kapsidproteine und die Reverse Transkriptase/Polymerase
(Bolhuis and Gratama, 1998; Hombach et al., 2001b).
Durch die Kotransfektion wurde die Vektorproduktion in den transfizierten Zellen
induziert und transduzierende Viruspartikel produziert. Um die Vektorproduktion zu
optimieren wurden verschiedene virusproduzierende Zelllinien, die alle auf den
parentalen
Hek293-Zellen
basieren,
und
verschiedene
Transfektionprotokolle
©
verglichen. Dafür wurden die Transfektionsreagenzien Polyfekt , Lipofektamin 2000
©
und die Calzium-Phosphat-Kopräzipitation untersucht.
Die retroviralen Vektoren übertragen das Transgen in die infizierte Zelle und integrieren
es ins Wirtszellgenom, was zu seiner stabilen Expression führt. Für eine
Charakterisierung der produzierten retroviralen Vektoren wurden HT1080-Zellen
transduziert. Diese Zelllinie ist besonders geeignet, da sie sich gut mit den
amphotrophen
GALV-pseudotypisierten
Retroviren
transduzieren
lässt.
Mit
Durchflußzytometrie wurde die Zahl der cTZR-exprimierenden HT1080-Zellen ermittelt
um die verschiedenen Vektorproduktionen zu vergleichen. Dies ergab eine optimale
retrovirale
Tranduktion
(ca.
90%
positiv
transduzierte
HT1080-Zellen)
mit
Viruspartikeln, die durch Calzium-Phosphat-Transfektion in Hek293T Zellen produziert
und frisch eingesetzt wurden. Hek293T-Zellen exprimieren das große T-Antigen des
Simian
Virus
40
(SV40),
welches
mit
einem
integrierten
SV40-Ori
Replikationsstartpunkt auf den retroviralen Plasmiden interagiert und zu deren
episomaler Verfielfältigung führt. Vektorproduktionen, die nach der Ernte bei -80°C
gelagert wurden zeigten einen Verlust der Transduktionseffizienz von 30-70%. Eine
Lagerung der Vektoren bei 4°C um die einzelnen Ernten (3 mal 12 h Produktion) zu
vereinigen, führte zu einem Verlust von bis zu 90% Transduktionseffizienz.
34
Ergebnisse
2.4 Primäre humane T-Zellen
2.4.1 Präparation und Charakterisierung
Da im Rahmen dieser Arbeit eine HBV-spezifische T-Zellantwort generiert werden
sollte, mußten zunächst primäre T-Zellen isoliert werden, um die konstruierten cTZR zu
exprimieren. Dafür musste eine möglichst homogene Population CD3-positiver TZellen aus humanen Blutproben präpariert werden. In venösem Blut ist neben einer
großen Anzahl an Erythrozyten ein Gemisch aus verschiedenen peripheren
mononukleären Blutzellen (PBMC), den Leukozyten, enthalten. Diese unterteilen sich
weiter in lymphoide und myeloide Blutzellen und bilden die Subpopulationen der
Immunzellen. Primäre PBMC wurden durch Dichtegradientenzentrifugation aus
frischem heparinisiertem Blut präpariert, wobei sie aufgrund ihrer geringeren Dichte
von den Erythrozyten getrennt werden. Um lymphoide T-Zellen anzureichern und für
die retrovirale Transduktion vorzubereiten, wurden die Präparationen durch einen antiCD3 Antikörper T-zellspezifisch aktiviert, wodurch eine Antigenerkennung am
endogenen TZR imitiert wird. Durch die Zugabe von rekombinantem Interleukin-2 (IL-2)
wurde ein kostimulatorisches Signal erzeugt, das eine proliferative Expansion
aktivierter T-Zellen vermittelt. Zunächst wurden die adhärenten myeloiden Leukozyten
durch
Plastikadhärenz
depletiert,
wodurch
eine
weitere
Anreicherung
der
nichtadhärenten lymphoiden Zellen erreicht wurde. Durchschnittlich wurden aus 40 ml
Blut 4x106-8x106 PBMC gewonnen, von denen 60-80% durch Plastikadhärenz
depletiert wurden. Nach dreitägiger T-zellspezifischer Aktivierung der nicht-adhärenten
Fraktion lagen 1,0x107-1,5x107 periphere Blutlymphozyten (PBL) vor. Dies entspricht
einer durchschnittlichen, aktivierungsbedingten Teilungsrate von etwa einer Teilung pro
24 h. Um die enthaltenen Zelltypen genauer zu charakterisieren wurden die
verschiedenen Fraktionen mit spezifischen fluoreszenzmarkierten Antikörpern gegen
unterschiedliche Oberflächenmarker gefärbt und mit Durchflußzytometrie untersucht.
Dabei konnte gezeigt werden, daß in der nichtadhärenten Lymphozytenfraktion nach
12 h Aktivierung 30% CD3-positive (+) T-Zellen vorkommen, von denen 72% aktiviert
vorliegen (59% CD69+ und 13% HLA-DR+). Außerdem sind in dieser Fraktion 2,5% BZellen (CD19+), 7% natürliche Killerzellen (NK, CD56+) und 4,1% NK-T-Zellen
(CD3+/CD56+) enthalten (Abb. 2.6 A).
In der adhärenten Population kamen typische Zellen wie Makrophagen (11% CD68+),
Monozyten/Makrophagen
(8%
CD11b+),
myeloide
dendritische
Zellen
(13%
CD11b+/CD14+) und plasmazytoide dendritische Zellen (22% CD80+) vor (Abb. 2.6 C).
Auch in dieser Fraktion war eine große Zahl aktivierter T-Zellen vorhanden, die bei der
Abnahme der nicht-adhärenten Zellen verblieb (Abb. 2.6 B).
35
Ergebnisse
Abbildung 2.6: Fraktionen der Blutpräparation
Die isolierten Blutzellfraktionen wurden mit spezifischen Antikörpern gegen Blutzellmarker
gefärbt und mit Durchflußzytometrie analysiert. (A) nichtadhärente Fraktion nach 12 h
Aktivierung (HLA-DR/CD69: T-Zellaktivierung; CD19: B-Zelle; CD56: NK-Zelle; CD3: T-Zelle).
(B) adhärente Fraktion nach 12 h Aktivierung (CD68: Makrophagen; CD80: plasmazytoide
dendritische Zelle (DC); CD11b: Monozyte/Makrophage, doppelt positiv mit CD14: myeloide
DC). (C) T-zellspezifisch aktivierte Fraktion nach 72 h Aktivierung (Blutzellmarker: CD3: T-Zelle;
CD19: B-Zelle; CD56: NK-Zelle; CD4/8: T-Zellpopulationen).
Nach drei Tagen T-zellspezifischer Aktivierung waren die T-Zellen auf einen Anteil von
87% expandiert und unterteilten sich in 45% CD8+, 37% CD4+ und 2,5% CD4+/CD8+ TZellen. Der Anteil der B-Zellen verringerte sich auf 0,8%, NK-Zellen auf 1% und NK-TZellen auf 0,7%. Trotz T-zellspezifischer Aktivierung und Plastikadhärenz konnten 6%
plasmazytoide dendritische Zellen und 4% Monozyten/Makrophagen aber keine
myeloiden dendritischne Zellen spezifisch angefärbt werden (Abb. 2.6 C).
36
Ergebnisse
2.4.2 Retro- und lentivirale Transduktion
Wie im vorhergehenden Abschnitt gezeigt wurde, liegt nach 72h eine aktivierte und
proliferierende T-Zell Population vor, die eine maximale Kontamination von 13% CD3negativen Blutzellen aufweist. Dies ist eine Grundvorraussetzung für die retrovirale
Transduktion, da diese Vektoren nur proliferierende Zellen infizieren und ihr
genetisches Material ins Wirtszellgenom integrieren können. Diese T-Zellpräparationen
wurden in Kokultur mit virusproduzierenden Hek293T-Zellen direkt transduziert. Um
retro- und lentivirale Vektoren zu vergleichen wurden 1,5 x 106 T-Zellen mit 3 x 106
virusproduzierenden Zellen 72 h kokultiviert.
Die retroviralen Vektoren basieren auf dem murinen Leukämievirus (MLV) und sind mit
dem Gibbonaffen Leukämievirus Oberflächenprotein (GALV-env) pseudotypisiert. Die
lentiviralen Vektoren basieren auf dem humanen Immundeffizienzvirus-1 (HIV-1) und
sind mit dem Oberflächenglykoprotein des vesikulären Stomatitisvirus (VSV-G)
pseudotypisiert. Beide Vektorsysteme eignen sich gut für die Transduktion primärer
humaner T-Zellen (Muhlebach et al., 2003).
Um die Transgenexpression zu untersuchen, wurden retroviral transduzierte T-Zellen
mit FITC-markierten Antikörpern gegen die Fc-Linker-Domäne im cTZR gefärbt und im
Fluoreszenzmikroskop analysiert. Die cTZR-transduzierten humanen T-Zellen zeigten
Fokussierungsebene zu erkennen ist (Abb.2.7).
αS-C8
PBL
Abbildung 2.7: Fluoreszenzmikroskopie der Transduktion
Fluoreszenzfärbung der cTZR-Expression auf der Oberfläche primärer humaner T-Zellen nach
retroviraler Transduktion (links, grün: anti Fc-Linker-Domäne im αS-C8-cTZR). Die Zellkerne
wurden zu Kontrolle mit DAPI gefärbt (blau).
Für die Ermittlung der Transduktionseffizienzen der lenti- und retroviralen Vektoren
wurden transduzierte T-Zellen mit fluoreszenzmarkierten Antikörpern gefärbt. Dabei
wurden Doppelfärbungen mit Antikörpern gegen humanes CD3 als T-Zellmarker und
37
Ergebnisse
gegen die extrazelluläre Fc-Linker-Domäne des cTZR durchgeführt und mit
Durchflußzytometrie quantifiziert. Aus der Gesamtheit der gemessenen Ereignisse
wurde anhand der Vorwärts- und Seitwärtslichtstreuung (Forward und Sideward
Scattering, FFC, SSC), die Population der aktivierten T-Zellen eingegrenzt um stark
abweichende Einzelergebnisse auszuschließen. Diese Eingrenzung erfolgte anhand
der ermittelten Daten aus der Charakterisierung der Blutzellpopulationen und umfasste
90-95% der insgesamt gemessenen Zellen. Zusätzlich wurden tote rezeptortragende
Zellen durch eine Propidiumjodidfärbung ausgegrenzt, um falschpositive Ergebnisse zu
minimieren. Positiv transduzierte Zellen wurden im oberen rechten Quadranten
quantifiziert,
wobei
die
Messparameter
des
Durchflußzytometers
auf
ein
Kontrollhintergrundsignal untransduzierter PBL eingestellt wurden.
Die lentivirale Transduktion humaner T-Zellen ergab eine Transduktionseffizienz von
51% für den HBV S-Protein spezifischen aS-C8 TZR und 44% für den HBV L-Protein
spezifischen αL-5a19 (Abb. 2.8).
Abbildung 2.8: Transduktionseffizienz lentiviraler Vektoren
Transduzierte T-Zellen wurden mir spezifischen, fluoreszenzmarkierten Antikörpern gegen CD3
(αhuman-CD3) als T-Zellmarker und gegen die Fc-Linker-Domäne (αhuman-Fc) im chimären
TZR gefärbt und mit Durchflußzytometrie quantifiziert. Im oberen rechten Quadrant ist die
Transduktionseffizienz in Prozent angegeben. Die Messparameter für den unspezifischen
Hintergrund wurden für die untransduzierte Kontrolle (PBL) eingestellt und gegen die cTZRExpressionen von αS-C8, αL-5a19 und αCEA verglichen.
Die untersuchte Population war nahezu homogen CD3-positiv und bestätigte damit die
Ergebnisse aus der Charakterisierung der Blutzellpräparationen. Außerdem konnte im
Vergleich zur PBL-Kontrolle eine grundsätzliche Verschiebung der gesamten
Population zu höheren cTZR-spezifischen Fluoreszenzintensitäten beobachtet werden.
Dies zeigt, daß eine niedrigere aber positive Expression des cTZR in der als negativ
eingegrenzten Population stattfindet.
38
Ergebnisse
Die Effizienzen der retroviralen Transduktion ergaben 25% cTZR-exprimierender TZellen für αS-C8, 31% für αL-5a19 und 60% für den CEA-spezifischen Kontroll-cTZR
αCEA. Im Gegensatz zur lentiviralen Transduktion ist eine starke Varianz in der
Fluoreszenzintensität des
cTZR-Signals zu erkennen. Die
Verschiebung der
Gesamtpopulation, die auf eine niedrige aber positive cTZR-Expression hinweist, ist
bei αCEA besonders deutlich zu erkennen (Abb.2.9).
Abbildung 2.9: Transduktionseffizienz der retroviralen Vektoren
Für die Ermittlung der Transduktionseffizienz wurden transduzierte primäre T-Zellen mit
fluoreszenzmarkierten Antikörpern gegen humanes CD3 (αhuman-CD3) als T-Zellmarker und
gegen die Fc-Linker-Domäne in der extrazellulären Domäne des cTZR (αhuman-Fc) spezifisch
gefärbt.
Die Transduktionseffizienzen wurden für jedes Experiment neu ermittelt und ergaben
Werte zwischen 15% und 50%. Präparationen mit geringeren Transduktionseffizienzen
wurden nicht verwendet.
39
Ergebnisse
2.5 Herstellung HBV-replizierender Hepatomazelllinien
Um die HBV-spezifischen cTZR in vitro zu testen, wurden HBV-positive Zielzellen
benötigt, die HBV-Hüllproteine exprimieren und als Antigen der cTZR dienen. Die
Verfügbarkeit HBV-infizierbarer primärer humaner Hepatozyten (PHH) ist aber stark
eingeschränkt, da sie aus Leberresektionen gewonnen werden. Darum wurden für die
funktionelle Überprüfung der cTZR stabil transfizierte HBV-replizierende Zelllinien
hergestellt, die auf den parentalen Hepatomazelllinien HepG2 und HuH7 basieren.
Hepatomazellen wurden dafür mit den Plasmiden pSVneo (Neomycinresistenz) und
pTH1.3 (1.3-faches HBV-Überlängengenom) transfiziert. Die Propagation unter
Selektionsdruck mit Neomycin führte zu einer stabilen Integration der Plasmide ins
Genom der Zellen, die durch die Linearisierung der Plasmide erleichtert wurde.
Vereinzelte antibiotikaresistente Klone wurden vervielfältigt und durch HBV-DNADotblot auf ihre Virusproduktion hin untersucht. Die HBV-transfizierten Huh7-Klone
sekretierten sehr geringe Mengen an HBV-Partikeln. Bessere Werte wurden in der
HepG2-Kultur erzielt von der acht Klone weiter charakterisiert und HepG2H1.3 (Nr. 2,
3, 4, 5, 8, 9, 10 und 21) genannt wurden. Für die Messung der sekretierten DNAenthaltenden HBV-Partikel wurde aus Mediumüberständen konfluenter Zellkulturen
©
nach dreitägiger Inkubation die HBV-DNA extrahiert und mit Light-Cycler -PCR
quantifiziert. Die Ergebnisse wurden gegen einen definierten HBV-DNA-Standard
normalisiert und als HBV-DNA-Kopien pro Mikroliter Zellkulturüberstand angegeben.
Dabei konnten zwischen 4,9x104 und 5,1x106 Kopien pro Zelle ermittelt werden (Tab.
2.1).
Tabelle 2.1: Charakterisierung der stabil transfizierten Zelllinie HepG2H1.3.
In Spalte eins ist die Nummer des entsprechenden Klons, in Spalte zwei die Anzahl der
produzietren HBV-DNA-Kopien pro Mikroliter Medium (Viruspartikel), in Spalte drei die
sekretierte HBsAg-Menge in Signal pro Hintergrund (S/N) und in Spalte vier die sekretierte
Menge an HbeAg in Signal pro Kontrolle (S/CO) angegeben.
Klon
HBV-DNA (Kopien/ml)
HBsAg (S/N)
HBeAg (S/CO)
HepG2H1.3 Klon 2
1,6 x 106
126,8
69,9
HepG2H1.3 Klon 3
2,9 x 106
132,6
62,6
HepG2H1.3 Klon 4
9,5 x 105
126,2
61,5
HepG2H1.3 Klon 5
4,9 x 10
4
103,9
47,0
HepG2H1.3 Klon 8
1,6 x 10
5
135,8
55,6
HepG2H1.3 Klon 9
1,8 x 106
124,9
56,3
HepG2H1.3 Klon 10
4,1 x 106
129,4
54,3
HepG2H1.3 Klon 21
5,1 x 106
143,8
58,5
40
Ergebnisse
Zusätzlich wurden die Zellkulturüberstände durch die Serologieabteilung der Klinischen
Diagnostik (Institutes für Virologie) untersucht. Dabei wurden die Konzentrationen der
sekretierten HBV-Antigene HBsAg (HBV S-, M und L-Protein) und HBeAg quantifiziert.
Alle acht stabil mit dem HBV-Genom transfizierten Hepatomazellklone zeigten dabei
eine positive Antigensekretion. Die Werte wurde im Vergleich zu einer negativen
Hintergrundkontrolle ermittelt (Signal/Hintergrund) und lagen für HBsAg zwischen
103,9 und 143,8 und für HBeAg zwischen 47,0 und 67,0. Für spätere Experimente
wurden die Klone 2 und 21 verwendet, da diese die jeweils höchsten Einzelwerte
besaßen (Tab. 2.1).
Um die Integration der transfizierten HBV-DNA-Genome in dieser Zelllinie zu
charakterisieren, wurde sie mit einer Southern Blot Anylyse der genomischen DNA
untersucht (Abb. 2.10, zur Verfügung gestellt von Dr. D. Webb).
10
8
6
Abbildung 2.10: Untersuchung des integrierten HBV-Genoms
Southern Blot Analyse der in der genomischen DNA integrierten, HBV Genome. Verdau mit
dem Enzym HindIII (rechts) und EcoRI (Mitte) zeigte ein unterschiedliches Laufverhalten in der
Gelelektrophorese. Zur Kontrolle wurde ein DNA-Marker (M, links) mit den angegebenen
Fragmentgrößen verwendet.
Durch einen Verdau, mit der Restriktionsendonuklease HindIII, die nicht im HBVGenom
schneidet,
konnte
die
Integration
eines
einzigen
1.3-fachen
Überlängengenkonstrukt ins Wirtszellgenom gezeigt werden. Als Kontrolle wurde ein
weiterer Verdau mit EcoRI durchgeführt, das einmal im HBV-Genom schneidet und in
zwei Fragmente aufteilt, die mit den flankierenden genomischen DNA-Fragmenten in
zwei unterschiedlichen Banden laufen. Im Vergleich dazu besitzt die etablierte HBVreplizierende Zelllinie HepG2.2.15, vier doppelte HBV-Überlängengenome als stabile
Tandemintegrate (Sells et al., 1987).
41
Ergebnisse
In weiteren Untersuchungen der HBV-replizierenden HepG2H1.3 Zelllinie konnte eine
Etablierung der episomalen cccDNA (covalently closed circular DNA) im Zellkern
dieser stabil transfizierten, HBV-replizierenden Zelllinie nachgewiesen werden. Dazu
wurden Zellen aus konfluenten Kulturen geerntet und die nicht proteinassoziierte DNA
mittels Hirt-Lyse aus den Zellkernextrakten isoliert. Dies führte zu einer Anreicherung
der episomalen cccDNA, wodurch diese im Southern Blot mit einer radioaktiv
markierten HBV-DNA-Sonde nachgewiesen werden konnte.
Die cccDNA verhält sich durch ihre verdrillte „supercoiled“ Konformation, im Vergleich
zur entspannten zirkulären rcDNA (relaxed circular DNA), wie ein viel kleineres
Fragment, obwohl beide DNA-Spezies dieselbe Größe besitzen. Durch einen
linearisierenden Kontrollverdau von cccDNA und rcDNA mit XhoI wurde eine
Bandenverschiebung beider DNA-Spezies auf die gemeinsame Laufhöhe der
linearisierten HBV-DNA erreicht, was die Identität der cccDNA nachweist (Abb. 2.11,
zur Verfügung gestellt von Dr. D. Webb).
Abbildung 2.11: Southern Blot Analyse der cccDNA
Durch Hirt-Lyse extrahierte DNA wurde auf einem Agarosegel aufgetrennt, auf eine
Nylonmembran übertragen und mit einer radioaktiv markierten HBV-DNA-Sonde hybridisiert.
Die cccDNA (covalently closed circular) läuft in der linken Spur deutlich unter der rcDNA
(relaxed circular), was an ihrem verdrillten „supercoiled“ Zustand liegt. Rechts fallen beide DNASpezies durch Linearisierung mit XhoI in derselben Bande der linearisierten HBV-DNA
zusammen.
42
Ergebnisse
2.6 Zytotoxizität HBV-spezifischer T-Zellen
2.6.1 HBV-replizierende Hepatomazellen als Zielzellen
Eine erste Einschätzung der zytotoxischen Eigenschaften cTZR-transduzierter T-Zellen
erfolgte durch mikroskopische Beobachtung der Zielzellmorphologie. Dafür wurde eine
Kokultur von rezeptortragenden T-Zellen und HBV-replizierenden Hepatomazielzellen
über einen Zeitraum von 96h untersucht. Für diese Experimente wurde eine definierte
Anzahl
an
cTZR-exprimierenden
Effektor-T-Zellen
pro
HBV-replizierender
Hepatomazelle eingesetzt. Man spricht dabei von der Effektor zu Zielzellratio (E:T
Ratio). Um die verschiedenen cTZR-Konstrukte direkt vergleichen zu können wurden
die Transduktionsraten durch Verdünnung mit untransduzierten Zellen angeglichen und
mit einer E:T Ratio von 2:1 eingesetzt. Nach 72h waren antigenspezifische
zytotoxische Läsionen im konfluenten Zellrasen der HBV-replizierenden HepG2.2.15Zielzellen sichtbar. Als Kontrolle dienten vergleichbare Ansätze, die den unspezifischen
αCEA-TZR exprimierten und unbehandelte T-Zellen. Als weitere Kontrolle wurden alle
rezeptortragenden T-Zellen mit HBV-negativen HepG2-Zielzellen kokultiviert. In keinem
der Kontrollansätze wurde eine zytotoxische Elimination der Zielzellen beobachtet
(Abb.2.12).
Abbildung 2.12: Zytotoxische T-Zellantwort
Kokulturen von cTZR-exprimierenden T-Zellen (αS-C8, αL-5a19, αCEA) und HBVreplizierenden (HBV+) Zielzelllinien (HepG2.2.15) bei einer E:T Ratio von 2:1. Als Kontrollen
dienten der unspezifische αCEA-TZR und untransduzierte T-Zellen (PBL). Zusätzlich wurden
die rezeptortragenden T-Zellen mit HBV-negativen (HBV-) Zielzellen (HepG2) kokultiviert.
43
Ergebnisse
Um die zytotoxische T-Zellantwort genauer zu untersuchen wurden die Kokulturen mit
spezifischen Farbstoffen in einem Zellvitalitätsassay angefärbt. Dabei kann der grün
fluoreszierende Farbstoff Calcein nur durch aktive Aufnahme in die Zelle gelangen und
ist ein Marker für vitale Zellen mit intakter Zellmembran. Das rot fluoreszierede
Ethidium Homodimer kann dagegen nur bei fehlender Membranintegrität in die Zelle
diffundieren, sich an die DNA anlagern und dient als Marker für tote Zellen. In den
Kokulturansätzen mit den HBV-spezifischen T-Zellen sind deutlich weniger vitale
Zielzellen sichtbar. Die zellfreien Bereiche in der Kokultur zeigen die Elimination der
HBV-replizierenden Hepatomazellen. Den stärksten Effekt vermittelte der HBV SProtein spezifische aS-C8-TZR. Die relativ geringe Anzahl der rotgefärbten toten Zellen
liegt an einem Waschschritt, bei welchem die von der Oberfläche der Zellkulturgefäße
abgelösten eliminierten Zellen entfernt wurden und nicht mehr angefärbt werden
konnten. In den Ansätzen mit HBV-spezifischen T-Zellen sind zusätzlich deutlich
kleinere Zellen grün gefärbt, bei welchen es sich wahrscheinlich um proliferierende TZellen handelt (Abb. 2.13).
Abbildung 2.13: Zielzellviabilität
Charakterisierung der zytotoxischen Aktivität durch Färben der Kokulturen von HBVreplizierenden (HBV+, HepG2.2.15) und HBV-negativen (HBV-, HepG2) Zielzellen und cTZRexprimierenden (aS-C8, aL-5a19, aCEA) oder unbehandelte T-Zellen (PBL) mit spezifischen
Farbstoffen. Der grüne Farbstoff Calcein färbt vitale Zellen, das verwendete rote Ethidium
Homodimer färbt tote Zellen.
2.6.2 Zeitlicher Verlauf der Rezeptoraktivierung
Um den zeitlichen Verlauf der Aktivierung cTZR-exprimierender T-Zellen zu bestimmen
wurde die Sekretion des Zytokins Interferon gamma (IFNγ) analysiert. Dies fand zu
44
Ergebnisse
unterschiedlichen Zeitpunkten in Kokulturen mit HBV-replizierenden und als Kontrolle
mit HBV-negativen Hepatomazielzielzellen statt (Abb. 2.14).
Abbildung 2.14: Zeitrafferaufnahmen der zytotoxischen T-Zellantwort
Die Zeitrafferaufnahmen wurden im Durchlichtkanal mit einem Fluoreszenzmikroskop
aufgenommen und computerunterstützt in Filmsequenzen animiert. Die zu Beginn der Sequenz
(0 h) vorhandenen zytotoxischen Läsionen sind rot umrandet, die nach 16 h sichtbaren
Läsionen wurden grün umrandet. Die Überlagerung zeigt die Veränderung in der Größe.
45
Ergebnisse
Um einen maximalen Effekt zu erzielen kamen relativ hohe E:T Ratios von 4:1 zum
Einsatz.
Zusätzlich
wurden
im
Verlauf
dieses
Experiments
mikroskopische
Zeitrafferaufnahmen durchgeführt. Diese wurden im Abstand von 5 min über einen
Zeitraum von 16 h aufgenommen und danach zu einer Filmsequenz animiert. Die
Auswertung diente der Charakterisierung des zeiltlichen Verlaufs der Zytotoxizität und
der Untersuchung der Motilität der rezeptortragenden T-Zellen.
Die gezeigten Ausschnitte dokumentieren die zytotoxischen Läsionen zu Beginn der
Sequenz und am Ende der Sequenz nach 16 h Inkubation. Es konnte eine deutliche
Zunahme in der Größe der zytotoxischen Läsionen gezeigt und eine hohe Motilität der
cTZR-exprimierenden T-Zellen beobachtet werden. Außerdem sind große Mengen an
toten, nichtadhärenten Zellen sichtbar, die als Komplexe mit stärkerem Kontrast zu
erkennen sind und fast die gesamte Fläche der 16 h Aufnahme, im Vergleich zur
Aufnahme des 0 h-Wertes bedecken.
In
einem
zwölfstündigen
Rhythmus
wurden
die
Überstände
eines
Kokulturexperimentes geerntet und mit ELISA die aktivierunginduzierte Sekretion von
IFNγ untersucht. Das Zytokin dient dabei als ein Aktivierungsmarker für die
Signaltransduktion durch die CD3ζ-Ketten Signaldomäne des cTZR-Konstruktes.
Die Ergebnisse zeigten eine deutlich frühere und stärkere Aktivierung des HBV SProtein spezifischen αS-C8 TZR, der bereits nach 24 h deutlich aktiviert war (Abb.
2.15).
Abbildung 2.15: Zeitverlauf der Aktivierung
Die rezeptovermittelte Aktivierung nach Antigenerkennung wurde durch ELISA-Messung der
IFNγ-Sekretion ermittelt. Dazu wurden Kokulturen mit E:T Ratios von 4:1 zu unterschiedlichen
Zeitpunkten (12 h-72 h) untersucht und die IFNγ-Menge im Medium in ng/ml ermittelt.
In den folgenden 12 h wurde ein maximaler Anstieg der IFNγ-Sekretion von 2,5 ng/ml
auf 12,6 ng/ml vermittelt. Im weiteren Verlauf veringerte sich die IFNγ-Sekretion, blieb
aber bis 72 h positiv und erreichte einen maximalen Wert von 23 ng/ml. Im Vergleich
46
Ergebnisse
dazu zeigte der L-Protein spezifische αL-5a19 TZR eine deutlich verzögerte
Aktivierung und IFNγ-Sekretion, die erst nach 48 h einsetzte. Zu diesem Zeitpunkt
wurden minimale Mengen von 2 ng/ml ermitelt, die sich in den nächsten 12 h nicht
weiter steigerten. Erst zum 72 h Zeitpunkt der Untersuchung wurde dieser cTZR voll
aktiviert und sekretierte 10 ng/ml IFNγ.
Der zweite generierte HBV S-Protein spezifische cTZR αS-C9 zeigte in diesem
Experiment eine deutliche unspezifische Aktivierung, unabhängig von einem Antigen.
Die IFNγ-Sekretion war auf HBV-replizierenden und HBV-negativen Zielzellen
vergleichbar weshalb dieser cTZR in späteren Experimenten ausgeschlossen wurde.
2.6.3 Vergleich HBV-replizierender Zielzellen
Nach der Herstellung der stabil HBV replizierenden Zelllinie HepG2H1.3 sollte diese
gegen die etablierte Zelllinie HepG2.2.15 verglichen werden. Um die optimale
Zielzelllinie zu ermitteln wurden beide Zelllinien mit rezeptortragenden T-Zellen
kokultiviert.
Der
Effekt
der
zytotoxischen
T-Zellantwort
wurde
durch
XTT-
Viabilitätsmessung ermittelt, mit den Kontrollen normalisiert und als Viabilität der
Zielzellen in Prozent angegeben (Abb. 2.16).
100
HBV+
80
HBV-
60
Viability
(%)
40
20
0
HepG2.2.15 HepG2H1.3
HepG2
aS-C8
HepG2.2.15 HepG2.2.15
aCEA
PBL
Abbildung 2.16: Vergleich der Hepatomazielzelllinien
Die etablierte, HBV-replizierende Zelllinie HepG2.2.15 und die hergestellte, HBV-replizierende
Zelllinie HepG2H1.3 wurden als Zielzelllinien mit αS-C8-TZR-tragenden T-Zellen (αS-C8)
kokultiviert und die Zytotoxizität bestimmt. Als Kontrolle wurden αS-C8-TZR-tragende T-Zellen
mit HBV-negativen Zellen (HepG2) oder T-Zellen mit dem unspezifischen Kontroll-cTZR (aCEA)
und untransduzierte T-Zellen mit HBV-replizierenden HepG2.2.15-Zellen kultiviert.
47
Ergebnisse
Als Effektorzellen wurden T-Zellen, die den HBV S-Protein spezifischen αS-C8-TZR
exprimierten mit einer E:T Ratio von 0,5:1 eingesetzt. Die rezeptorvermittelte
Zytotoxizität der Effektorzellen führte zu einer verminderten Zielzellviabilität der HBVpositiven Zielzellen. Diese betrug 62% für die etablierte HepG2.2.15-Zielzelllinie, im
Vergleich zu 73% für die generierte HepG2H1.3-Zielzelllinie. Bezogen auf die
Kontrollansätze, die eine durchschnittliche Viabilität von 95% zeigten, ergibt dies eine
spezifische zytotoxische Lysis der Zielzellen von 33% für HepG2.215 und 22% für
HepG2H1.3. Dies entspricht einem quantitativen Unterschied von 30% in der
Effektivität der induzierten T-Zellantwort zwischen der generierten HepG2H1.3 und der
etablierten Zelllinie. Nach diesem Vergleich wurde die besser geeignete HepG2.2.15Hepatomazelllinie als Standardzielzelllinie eingesetzt.
2.6.4 Lamp-2 Mobilisierung
Um
den
zugrundeliegenden
Mechanismus
der
Apoptoseinduktion
durch
rezeptortragende T-Zellen weiter zu charakterisieren, wurden die entsprechenden
Faktoren
untersucht. Neben der Fas/FasL-Interaktion kann die Zytotoxizität durch
Degranulation lytischer Granuolen vermittelt werden. Lamp-2 (CD107b) ist in der
Membran dieser Granuolen eingelagert und gelangt bei der Sekretion durch
Membranfusion der Vesikel auf die Zellmembran der T-Zelle. Anhand der Lamp-2Menge auf der Zelloberfläche kann die Sekretion der lytischen Granuolen
semiquantitativ untersucht werden (Betts et al., 2003) (Abb. 2.17).
Positiv [%]
40
30
20
10
0
HBV
HBV+ / CD107b
HBV- / CD107b
+
-
aS-C8
Abbildung 2.17: Lamp-2 Mobilisierung
Die Mobilisierung von Lamp-2 zur Oberfläche cTZR-exprimierender T-Zellen wurde durch
Durchflußzytometrie mit spezifischen Antikörpern gegen extrazelluläres Lamp-2 untersucht. Die
hier analysierten Zellen sind cTZR-positive T-Zellen.
48
Ergebnisse
Dazu wurden cTZR-exprimierende T-Zellen nach einer 72 h Kokultur mit HBVreplizierenden
Hepatomazielzellen
geerntet
und
für
die
Durchflußzytometrie
vorbereitet. Dadurch konnte sichergestellt werden, daß nur die Aktivierung des cTZR
zur Mobilisierung von Lamp-2 beiträgt. Die Zellen wurden mit einem spezifischen,
FITC-markierten Antikörper gegen Lamp-2 und als Konrolle mit einem cTZRspezifischen, PE-markierten Antikörper gefärbt. Bei diesem Experiment wurden nur
cTZR-exprimierende T-Zellen auf Lamp-2-Mobilisierung untersucht. Die FACS-Analyse
ergab eine erhöhte Lamp-2 Mobilisation von 38% TZR/Lamp-2-positiven T-Zellen nach
der Antigenerkennung. In der Kontrollkokultur mit HBV-negativen Zielzellen wurden nur
12% TZR/Lamp2-positve T-Zellen gemessen. Dies entspricht einer 3,2-fachen
Zunahme der Lamp-2-Mobilisierung nach Antigenerkennung. In T-Zellen, die keinen
cTZR exprimierten kam es zu keiner signifikanten Mobilisierung.
2.6.5 Maximale Zytotoxizität
Die HBV-spezifischen cTZR vermitteln eine zytotoxische T-Zellantwort, die zu einer
stark verminderten Zielzellviabilität führt. Um die maximale induzierbare Zytotoxizität zu
ermitteln wurden cTZR-exprimierende T-Zellen in einer E:T Ratio von 4:1 eingesetzt
und für 72h mit HepG2.2.15-Zielzellen kokultiviert (Abb. 2.18).
120
HBV+
100
HBV-
Viability [%]
80
60
40
20
0
αS-C8
αL-5a19
αCEA
PBL
Abbildung 2.18: Maximale Zytotoxizität
Die cTZR-exprimierenden T-Zellen wurden mit einer E:T Ratio von 2:1 mit HBV-positiven
(HBV+) und HBV-negativen (HBV-) Zielzellen kokultiviert und nach 72 h die spezifische Lysis
bestimmt. Neben den spezifischen cTZR (αS-C8, αL-5a19) wurden unspezifische cTZR (αCEA)
und unbehandelte T-Zellen (PBL) als Kontrollen verwendet.
49
Ergebnisse
Die ermittelte Zielzellviabilität von 37% für den αS-C8 TZR entspricht einer maximalen
spezifischen Lysis von 63%. In diesem Experiment war die Zytotoxizität des αL-5a19
TZR mit 61% nur unwesentlich geringer. In Kontrollansätzen mit CEA-spezifischen
cTZR, nicht transduzierten PBL und rezeptortragenden T-Zellen auf HBV-negativen
Zielzellen wurde eine durchschnittliche Hintergrundzytotoxizität von 5% gemessen.
2.6.6 Dosisabhängigkeit der zytotoxischen T-Zellantwort
Um eine Dosisabhängigkeit dieser zytotoxischen T-Zellantwort zu untersuchen wurden
die cTZR-exprimierenden T-Zellen in seriellen Verdünnungen kokultviert (Abb.2.19 A).
A
B
C
Abbildung 2.19: Dosisabhängikeit der zytotoxischen T-Zellantwort
(A)Zytotoxische T-Zellantwort cTZR-exprimierender T-Zellen in Kokultur mit HBV-positiven
(HBV+) und HBV-negativen (HBV-) Hepatomazielzelllinien. Eine deutliche Dosisabhängigkeit
der antigenvermittelten Zytotoxizität von der E:T Ratio konnte nach 72 h Inkubation gezeigt
werden. In dieser Kokultur wurde die Zytokinsekretion der aktivierten T-Zellen untersucht. Die
Sekretion der Zytokine IFNγ (B) und IL-2 (C) wurde mit ELISA ermittelt.
50
Ergebnisse
Dafür wurden vier Verdünnungsschritte mit niedrigeren E:T Ratios von 1,5:10 bis
0,2:10 eingesetzt. Für beide HBV-spezifischen cTZR konnte eine deutliche
Dosisabhängigkeit der zytotoxischen T-Zellantwort gezeigt werden. Die vermittelte
Zytotoxizität korrelierte mit der eingesetzten Effektorzellzahl und die maximale
spezifische Zielzelllysis betrug in diesem Fall 40% für αS-C8. Ein unspezifisches
Hintergrundsignal von 22% wurde bei der höchsten E:T Ratio der nicht transduzierten
PBL und 19% bei αCEA-exprimierenden T-Zellen ermittelt. Bei der geringsten E:T
Ratio von 0,2:10 war keine spezifische Zytotoxizität im Vergleich zu den Kontrollen
mehr
messbar.
In
Kokulturen
mit
HBV-negativen
Zielzellen
zeigten
die
rezeptortragenden und die nicht transduzierten Kontroll T-Zellen keine spezifische
Aktivierung und die Hintergrundlysis betrug maximal 10% für αCEA.
Um die zytotoxische rezeptorvermittelte T-Zellantwort weiter zu charakterisieren, wurde
die Sekretion der Zytokine IFNγ und IL-2 mit ELISA untersucht (Abb. 2.19 B/C). IL-2
wird nach Aktivierung der kostimulatorischen CD28-Signaldomäne des cTZR sekretiert
und dient als Marker für deren Aktivierung. IL-2 ist für eine proliferative Expansion der
rezeptortragenden T-Zellen durch Antigenerkennung erforderlich.
Für IFNγ wurden erhöhte Sekretionsmengen von bis zu 1 ng/ml für αS-C8 und 0,4
ng/ml für αL-5a19 detektiert, die ebenfalls eine Dosisabhängigkeit zeigten. Auch für IL2 konnten dosisabhängige Sekretionsmengen von bis zu 2,2 ng/ml für αS-C8, jedoch
nur 0,25 ng/ml für αL-5a19 ermittelt werden. Die Zytokinsekretionen zeigten bei der
niedrigsten E:T Ratio nur basale Sekretion. In diesem Experiment konnte erneut eine
erhöhte Sekretion der gemessenen Zytokine für den HBV S-Protein spezifischen cTZR
αS-C8 im Vergleich zum HBV L-Protein spezifischen cTZR αL-5a19 festgestellt
werden. Die Sekretion von IL-2 durch αL-5a19-exprimierende T-Zellen war erniedrigt
und lag nur minimal über der Nachweisgrenze der Messung.
2.6.7 Antigenspezifische Proliferation
In der adaptiven T-Zellantwort, führt die spezifische Aktivierung der T-Zelle durch
Interaktion ihres TZR mit dem entsprechenden Antigen zu einer monoklonalen
Proliferation. Diese findet aber nur statt, wenn die antigenpräsentierende Zelle ein
zusätzliches kostimulatorisches Signal erhält, daß durch die Interaktion des CD28Korezeptors und seiner Liganden B7.1 und B7.2 generiert wird. Dieses Signal wird in
den hier verwendeten chimären TZR durch die zusätzliche Integration der CD28Signaldomäne ersetzt und führt zur Sekretion des IL-2.
Um die proliferativen Eigenschaften dieses Signals zu untersuchen wurde die
antigenvermittelte Proliferation der cTZR-exprimierenden T-Zellen quantifiziert. Dazu
wurden αS-C8-exprimierende T-Zellen mit HBV-replizierenden Zielzellen kultiviert,
51
Ergebnisse
geerntet und die Proliferation der rezeptortragenden T-Zellen untersucht. Hier wurden
nur Zellen, die den cTZR exprimierten mit Durchflußzytometrie quantifiziert. Dabei
konnte eine 1,9-fache proliferative Expansion der αS-C8-tragenden T-Zellen im
Vergleich zur Kokultur mit HBV-negativen Zellen gezeigt werden. Dies deutet auf eine
antigenvermittelte Proliferation hin (Abb. 2.20).
Positiv [%]
30
20
10
0
+
HBV
-
αS-C8
aS-C8
Abbildung 2.20: Antigenspezifische Proliferation
Rezeptortragende T-Zellen wurden für 72 h mit HBV-replizierenden oder als Kontrolle mit HBVnegativen Zielzellen inkubiert. Danach wurden die Zellen geerntet und mit spezifischen
Antikörpern gegen die Fc-Linker-Domäne im cTZR gefärbt. Die quantitative Analyse erfolgte
mit Durchflußzytometrie.
2.7 HBV-infizierte primäre humane Hepatozyten als Zielzellen
Die stabil transfizierten, HBV-replizierenden Hepatomazelllinien stellen ein artifizielles
Zielzellsystem dar. Deshalb wurden die rezeptortragenden T-Zellen weiterführend mit
HBV-infizierten
primären
humanen
Hepatozyten
(PHH)
kokuliviert
und
die
rezeptovermittelte Aktivierung untersucht. Diese primären Zellen sind als einzige mit
HBV infizierbar. PHH können aus Leberresektaten isoliert und unter speziellen
Bedingungen mehrere Wochen kultiviert werden. Sie wurden nach der HBV-Infektion
für fünf Tage kultiviert um eine produktive HBV-Replikation zu etablieren. Um die
Infektionseffizienz abzuschätzen wurden Mediumüberstände der infizierten PHH in der
Serologieabteilung des Instituts für Virologie auf ihre Konzentration an HBV-Antigenen
untersucht. Die in vitro HBV-Infektion ergibt ca. 10-15% infizierter PHH, die eine aktive
HBV-Replikation etablieren (Schulze-Bergkamen et al., 2003). Die HBV-spezifische
Immunantwort des Wirts und vor allem die zytotoxische T-Zellantwort, bestimmt die
Schwere der Leberschädigung während der HBV-Infektion. Da HBV nicht zytopathisch
ist und die infizierte Hepatozyte nicht schädigt ist die entzündliche Leberschädigung
vollständig auf die induzierte Apoptose der Zielzellen durch zytotoxische T-Zellen
zurückzuführen (Rehermann, 2000).
52
Ergebnisse
Da im PHH-Medium Hydrocortison enthalten ist und selbst geringste Mengen die
Aktivierung der T-Zellen verhindern (Wiegers et al., 2001), wurde vor deren Einsatz als
Zielzellen eine Umstellung auf PHH-Medium ohne Hydrocortison vorgenommen. Für
die Kokultur mit HBV-infizierten PHH wurden die cTZR-exprimierenden T-Zellen in
höheren E:T Ratios von 2:1 eingesetzt und für 96 h inkubiert.
2.7.1 Lebertransaminasen als Marker der Zytotoxizität
Um die rezeptorvermittelte zytotoxische T-Zellantwort gegenüber HBV-infizierten
Hepatozyten zu untersuchen, wurden diese mit rezeptortragenden T-Zellen kokultiviert.
Um die Zytotoxizität zu quantifizieren, wurde die Freisetzung des leberspezifischen
Enzyms Alanin Aminotransferase (ALT) gemessen. ALTs werden von apoptotischen
Hepatozyten ins Serum abgegeben und dienen als Marker für die Leberschädigung.
Diese Messung ist ein typischer diagnostischer Parameter, der für die Einschätzung
der Leberfunktionalität bestimmt wird.
Dabei wurden für die beiden HBV-spezifischen cTZR αS-C8 und αL-5a19 deutlich
erhöhte ALT-Werte ermittelt, die eine zytotoxische T-Zellantwort anzeigen (Abb.
2.21A).
Abbildung 2.21: Zytotoxische Antwort gegen HBV-infizierte PHH
A: Kokultur cTZR-exprimierender T-Zellen und HBV-infizierter PHH. Die Freisetzung des
leberspezifischen Enzyms Alanin Aminotransferase (ALT) wurde nach 96 h Inkubation mit
einem kolorimetrischen Nachweis gemessen (Statistik: p*<0,05 im Vergleich mit der HBVnegativen Kontrolle). B: Lichtmikroskopische Aufnahme einer PHH Kultur.
Die Kokultur führte zu maximalen freigesetzten ALT-Mengen von 24 U/ml für den HBV
S-Protein spezifischen αS-C8-TZR und 21 U/ml für den HBV L-Protein spezifischen
αL-5a19 TZR. In den Kontrollen mit unspezifischem αCEA-TZR und unbehandelten TZellen wurden Hintergrundsignale von maximal 7 U/ml gemessen. Die mikroskopische
53
Ergebnisse
Durchlichtaufnahme einer HBV-infizierten PHH-Kultur zeigt die typische Morphologie
differenzierter Hepatozyten (Abb. 2.21 B).
2.7.2 Zytokinsekretion
In Kokulturen rezeptortragender T-Zellen und HBV-infizierter PHH wurde ebenfalls die
Zytokinsekretion mit ELISA untersucht. Die Sekretion von IFNγ und IL-2 zeigte ein
Aktivierungsmuster, vergleichbar mit den vorangegangenen Experimenten mit HBVreplizierenden Hepatomazielzelllinien. Die maximalen IFNγ-Mengen betrugen für αSC8 bei 13 ng/ml und für αL-5a19 8,3 ng/ml. Die Sekretion von IL-2 wurde mit 5,5 ng/ml
für αS-C8 und mit nur 0,3 ng/ml für αL-5a19 ermittelt (Abb. 2.22).
Abbildung 2.22: Zytokinsekretion in Kokulturen mit HBV-infizierten PHH
Kokulturen von cTZR-exprimierenden T-Zellen mit HBV-infizierten (HBV+) und HBV-negativen
(HBV-) PHH wurden, nach 96 h Inkubation, auf die Zytokinsekretion der aktivierten T-Zellen
untersucht. Die Sekretion der Zytokine IFNγ und IL-2 wurde mit ELISA ermittelt.
2.7.3 Intrazelluläre HBV DNA
Die Mengen der verschiedenen HBV-DNA-Spezies geben Aufschluss über den Einfluß
der zytotoxischen T-Zellantwort auf die HBV-Replikation. Das revers transkribierte
HBV-Genom rcDNA und die episomale Replikationsmatritze cccDNA, wurden mit Light
Cycler© PCR quantitativ untersucht. Dafür wurden spezifische Oligonukleotidprimer
verwendet, die eine Unterscheidung der beiden DNA-Spezies zulassen (Untergasser et
al., 2006). Die cccDNA-Primersequenzen wurden entsprechend gewählt, um eine
Amplifikation über das partiell einzelsträngige rcDNA-Genom zu verhindern. Die
rcDNA-Primer können zwar ein Produkt mit cccDNA als Matritze amplifizieren, dieses
ist, aufgrund des 100-fachen Mengenverhältnissen von rcDNA im Vergleich zu
cccDNA, aber unerheblich. Die amplifizierten Produkte können anhand ihrer Länge
unterschieden werden, da für die rcDNA ein Amplifikat von 99 bp und für die cccDNA
54
Ergebnisse
1023 bp erzeugt wird (Abb. 2.23). Die spezifischen Oligonukleotidprimer erlauben eine
Quantifizierung der HBV-DNA-Spezies, und die Ergebnisse wurden auf die Zellzahl der
analysierten PHH normalisiert.
A)
cccDNA-Primer
(+) 92
(-) 2251
1844
rcDNA-Primer
HBV-Primer
(+) 1844
(-) 1745
1745
2251
92
Abbildung 2.23: Oligonukleotidprimer für cccDNA und rcDNA
Lage der Oligonukleotidprimer für den Nachweis von rcDNA (blau) und cccDNA (rot) im HBVGenom. Aufgrund der partiell einzelsträngigen Struktur des rcDNA Genoms (dicker schwarzer
Strich) amplifizieren die cccDNA-Primer auf dieser Matritze kein Produkt.
Die HBV-DNA wurde aus Zelllysaten der zytotoxischen Kokulturen präpariert und
repräsentiert damit die intrazellulären DNA-Mengen. Die quantitative Ermittlung der
HBV-DNA Konzentrationen zeigte einen deutlichen Effekt der zytotoxischen TZellantwort. Das revers transkribierte rcDNA-Genom wurde in Ansätzen mit beiden
HBV-spezifischen cTZR stark erniedrigt. Die DNA-Mengen fielen von durchschnittlich
250 Kopien/Zelle in den Kontrollansätzen auf 75 Kopien/Zelle in der Kokultur mit
zytotoxischen T-Zellen, die den HBV L-Protein spezifischen αL-5a19 TZR exprimierten.
In Kokulturen mit T-Zellen, die den HBV S-Protein spezifischen αS-C8 TZR trugen
wurden die DNA-Mengen auf 48 Kopien/Zelle erniedrigt. Die Konzentrationen der
episomalen Replikationsmatritze cccDNA wurden von durchschnittlich 2,3 Kopien/Zelle
in den Kontrollansätzen auf 0,4 Kopien/Zelle für αL-5a19 TZR erniedrigt. Die Kokultur
mit αS-C8-exprimierenden T-Zellen führte zu einer fast vollständigen Elimination der
cccDNA (Abb.2.24).
55
Ergebnisse
Werden die Infektionsraten von 10-15% (Schulze-Bergkamen et al., 2003) auf 100%
hochgerechnet, entsprechen die ermittelten cccDNA Mengen den Literaturangaben
von bis zu 20 Kopien pro Zelle (Zhang et al., 2003).
Abbildung 2.24: HBV-DNA Quantifizierung durch Light Cycler PCR
Die Mengen der HBV-spezifischen DNA in Lysaten der PHH wurden mit Light Cycler PCR
bestimmt und auf die Zellzahl normalisiert. Die entspannte zirkuläre DNA (rcDNA, links) ist das
revers transkribierte Virusgenom im reifen Viruspartikel, die kovalaent geschlossene zirkuläre
DNA (cccDNA, rechts) ist die episomale Replikationsmatritze im Nukleus der HBV-infizierten
Zielzellen.
Um die Identität des mit den cccDNA-Primern amplifizierten DNA-Produktes zu
überprüfen wurde der Light Cycler PCR-Ansatz in einer Agarosegelelektrophorese
untersucht. Die Auswertung zeigt nur für die HBV-infizierten PHH eine spezifische
Bande und die ermittelten Mengenunterschiede sind ebenfalls sichtbar (Abb. 2.25).
Abbildung 2.25: Überprüfung der Light Cycler PCR
Die amplifizierten Produkte wurden in der Gelelektrophorese überprüft um die Spezifität des
Produktes zu untersuchen. Aufgetragen wurden die PCR-Produkte der zellulären PHH-DNA
aus HBV-infizierten (HBV+) oder nichtinfizierten (HBV-) PHH, die mit cTZR-exprimierenden (αSC8, αL-5a19, αCEA) oder unbehandelten T-Zellen (PBL) kokultiviert wurden.
56
Ergebnisse
2.7.4 Intrazelluläres HBV Kapsid-Protein
Um den Einfluß der zytotoxischen T-Zellantwort weiter zu untersuchen, wurden die
intrazellulären Level des Kapsid-Proteins ermittelt und gegen die Albuminkonzentration
verglichen. Albumin wird nur von Hepatozyten produziert und diente als Marker für die
Vitalität. Dadurch wurde eine Verfälschung des Ergebnisses durch die vorhandenen TZellen ausgeschlossen. Um vergleichbare Werte zu erhalten wurden die einzelnen
Ansätze in identischen Volumen Lysispuffer aufgenommen und jeweils die gleiche
Menge Lysat für die Analyse eingesetzt. Die ermittelten Albuminkonzentrationen
zeigten eine maximale Schwankung von 20% und deuten auf eine nur geringe
Verringerung der Gesamtzahl an Hepatozyten hin. Dieser Verlust entspricht der
geschätzten Anzahl HBV-infizierter Zellen in diesen Ansätzen. Außerdem konnte
anhand des Verhältnisses gezeigt werden, daß 70% des Kapsidproteins in Kokulturen
mit αS-C8 und 50% mit αL-5a19 vernichtet wurde. In den Kontrollen mit HBVnegativen Zellen konnte wie erwartet kein HBV-Kapsid-Protein nachgewiesen werden
(Abb. 2.26).
Albumin
Kapsid
Protein
HBV
+
-
aS-C8
+
-
+
aL-5a19
-
+
aCEA
PBL
Abbildung 2.26: Western Blot mit intrazellulärem Protein
Western Blot Analyse mit Zellysaten nach Kokulturen aus cTZR-exprimierenden T-Zellen (αSC8,αL-5a19, Kontrollen: αCEA, PBL) und HBV-infizierten (HBV+) und HBV-negativen (HBV-)
PHH. Die Lysate wurden denaturiert, mit SDS-Page aufgetrennt und auf eine Nylonmembran
übertragen. Die Proteine wurden mit einem HBV-Kapsid-spezifischen Antikörper detektiert,
gestript und mit einem Albumin-spezifischen Antikörper detektiert. Die Quantifizierung der
Albumin- und Kapsid-Banden erfolgte durch Chemilumineszenzmessung.
2.7.5 Sekretion von HBV-Antigenen
Um die zytotoxische T-Zellantwort und ihren Einfluß auf die Virusreplikation weiter zu
charakterisieren wurden die von den HBV-infizierten PHH sekretierten HBV-Antigene
im Zellkulturmedium bestimmt. Die Mengen an HBsAg, das sowohl in der
57
Ergebnisse
Lipidmembran infektiöser Dane-Viruspartikel als auch in den nicht infektiösen
subviralen Partikeln vorkommt, ist ein Marker für die Replikationsaktivität der HBVinfizierten Wirtszelle. Das HBeAg ist ein modifiziertes Produkt des Kapsid-Protein
Leserasters und wird von HBV infizierten Zellen in großen Mengen ins Medium
abgegeben. Es dient als Marker für die Transkriptionsaktivität, da es von der
prägenomischen RNA translatiert wird.
Die ELISA-Messung der HBV-Antigene HBsAg und HBeAg zeigte eine geringe
Erniedrigung, verursacht durch die zytotoxische T-Zellantwort. Die Sekretion von
HBeAg wurde von durchschnittlich 27 ng/ml in den Kontrollansätzen auf 24 ng/ml für
den HBV L-Protein spezifischen und auf 22 ng/ml für den HBV S-Protein spezifischen
cTZR erniedrigt. Und die Sekretion von HBsAg wurde von durchschnittlich 450 ng/ml in
den Kontrollansätzen auf 380 ng/ml (αL-5a19) und 378 ng/ml (αS-C8) herabgesetzt.
Dies weist auf eine Akkumulation der HBV-Antigene im Zellkulturmedium hin, die vor
der zytotoxischen Elimination der HBV-replizierenden PHH stattfindet (Abb. 2.27).
Abbildung 2.27: HBV-Antigensekretion in zytotoxischen Kokulturen
Die Sekretion der HBV-Antigene HBeAg (links) und HBsAg (rechts) wurde mit ELISA ermittelt.
HBeAg ist eine modifizierte, sekretierte Form des Kapsid-Proteins und HBsAg ist das in den
viralen und subviralen Partikeln sekretierte kleine S-Oberflächenprotein des HBV.
2.8 Charakterisierung der zytotoxischen T-Zellantwort
2.8.1 NFκB Aktivierung
Die Aktivierung des Transkriptionsfaktors NFκB ist ein induzierter Signalprozeß nach
der Antigenbindung durch den T-Zellrezeptor. Im Verlauf der Signaltransduktion
aktiviert ZAP-70 die Phospholipase-γ (PLC-γ), die wiederum zur Aktivierung der
Proteinkinase C führt. Durch Phosphorylierung des NFκB-Inhibitors IκB wird dieser
aktiviert. Die Translokation in den Nukleus ermöglicht danach die Modulation der
Expression verschiedener Zielgene, die zur Steuerung von Proliferation und
58
Ergebnisse
Differenzierung beitragen. Um die Rekrutierung dieser Signalkaskade durch die
chimären TZR zu untersuchen wurde rezeptortragende T-Zellen mit HBV-haltigen
Mediumüberständen
inkubiert.
Dadurch
konnte
die
Aktivierung
von
NFκB
ausschließlich auf T-Zellen begrenzt und in elektrophoretischen Mobilitätsshiftassays
(EMSA) unersucht werden. Dabei wird eine radioaktiv markierte DNA-Sonde, welche
die Konsensusbindesequenz für NFκB aus dem HIV-1-LTR enthält, mit nukleären
Extrakten der zu untersuchenden Zellen inkubiert. Nur wenn aktiviertes NFκB
vorhanden ist führt dessen Bindung an die DNA-Sonde zu einer Veränderung im
Laufverhalten des Komplexes. Durch die radioaktive Markierung kann eine
Autoradiographie durchgeführt werden (Abb. 2.28).
HBV
+
αS-C8
+
-
αL-5a19
+
αCEA
Abbildung 2.28: NFκB Aktivierung durch cTZR-Konstrukte
EMSA der NFκB-Aktivierung aus Kulturen von cTZR-exprimierenden T-Zellen (αS-C8, αL-5a19,
αCEA), die mit HBV-haltigem Zellkulturüberständen von HepG2.2.15-Zellen für 72h inkubiert
wurden. Der Pfeil zeigt die Bande des aktivierten NFκB, das im Kopmplex mit der radioaktiv
markierten DNA-Sonde ein verzögertes Gellaufverhalten zeigt.
Für den HBV S-Protein spezifischen aS-C8 TZR wurde eine 5,1-fache Aktivierung im
Vergleich zur HBV-negativen Kontrolle ermittelt. Für aL-5a19 konnte nur eine minimale
1,9-fache Aktivierung im Vergleich zu einem 1,8-fachen Signal für den unspezifischen
aCEA-TZR gezeigt werden. Außerdem scheint das Vorhandensein von HBV
grundsätzlich zu einer 1,8-fachen NFκB-Aktivierung der Zellen zu führen, wie in
Ansätzen mit dem HBV-unspezifischen αCEA TZR im Vergleich zwischen den HBVpositiven und den HBV-negativen PHH zu sehen ist.
59
Ergebnisse
2.8.2 Caspaseaktivierung
Die vermittelte Zytotoxizität wird hauptsächlich durch Apoptoseinduktion der Zielzellen
eingeleitet. Dafür besitzt die zytotoxische T-Zelle zwei unterschiedliche Mechanismen.
Einerseits kann die Apoptose durch Rezeptor-Liganden-Interaktion des Todesrezeptors
Fas (Apo1/CD95) auf der Zielzelle mit dem Liganden Fas-L (Apo-1L/CD95-L/CD178)
initiiert werden. Alternativ kann die Zielzelle durch Sekretion lytischer Granuolen, die
den Porenbildner Peforin und die Serinproteasen Granzym A und B enthalten in die
Apoptose getrieben werden. Dabei bildet Perforin durch Multimerisierung eine Pore in
der Zielzellmembran durch die das Granzym eindringt und proapoptotische Enzyme
aktiviert. Dadurch werden die Effektorcaspasen 3 und 7 induziert, die durch
proteolytische Aktivierungsprozesse die Apoptose einleiten.
Um die Apoptoseinduktion zu untersuchen wurde ein Caspase 3/7 Aktivierungsassay
durchgeführt. Dafür wurden zelluläre Extrakte der Zielzellen, nach der Kokultur mit
cTZR-exprimierenden T-Zellen, mit einem lumineszenten Substrat dieser Caspasen
inkubiert. Nur die aktivierten Caspasen können dieses Substrat verwerten, wobei ein
Lumineszenzsignal entsteht, das an einem Luminometer quantitativ ausgewertet
werden kann. Dafür wurde die Caspaseaktivierung normalisiert und als x-fache
Veränderung im Vergleich zu einer Kontrolle ohne T-Zellen angegeben (Abb. 2.29).
3,5
3
HBV+
HBV+
2,5
HBVHBV-
2
1,5
x-fach
1
0,5
0
αS-C8
αL-5a19
PBL
αCEA
Abbildung 2.29: Aktivierung der Caspasen 3/7
Die Aktivierung der Effektorcaspasen 3 und 7 wurde mit einem lumineszenten
Aktivierungsassay untersucht und als x-fache Änderung im Vergleich zu unbehandelten
Kontroll-PHH angegeben. Durch die aktivierten Caspasen 3 und 7 wird ein Substrat verdaut,
was ein lumineszentes Signal erzeugt.
In Kokulturen cTZR-exprimierender T-Zellen mit HBV-infizierten PHH kam es zu einer
deutlichen Aktivierung der Effektorcaspasen 3 und 7. Dabei konnte für den HBV S60
Ergebnisse
Protein spezifischen αS-C8 TZR eine 3,5-fache Aktivierung der Caspasen ermittelt
werden. Dieses Konstrukt zeigte ebenfalls eine leicht erhöhte 1,3-fache Aktivierung auf
HBV-negativen Zielzellen, was auf eine unspezifische Aktivität schließen lässt. Für den
HBV
L-Protein
spezifischen
αL-5a19
TZR
wurde
eine
geringere
1,7-fache
Caspaseaktivierung und auch eine Hintergrundaktivität nachgewiesen.
Nachdem gezeigt wurde, daß es zu einer Aktivierung der Effektorcaspasen 3 und 7
durch Antigenerkennung der cTZR-exprimierenden Zellen kommt, sollte diese
Aktivierung weiter untersucht werden. Dafür wurden Kokulturen von
exprimierenden
und
HBV-replizierenden
Zielzelllinien
mit
cTZR-
verschiedenen
Caspaseinhibitoren inkubiert. Dies sind synthetische Tetrapeptide, die reversibel oder
irreversibel an das aktive Zentrum einer Caspase binden und deren proteolytische
Aktivität inhibieren (Garcia-Calvo et al., 1998).
Z-VAD-FMK (Benzyloxycarbonyl-Valin-Alanin-Aspartat-Fluoromethylketon) ist ein PanCaspase-Inhibitor und hemmt die Aktivität der gesamten Caspase Familie. Er gehört zu
den synthetischen Peptidinhibitoren und enthält die für Caspasesubstrate obligate
Aminosäure Aspartat am C-terminalen Ende des Peptids. Die vierte Aminosäure in der
Peptidkette ist durch den Benzyloxycarbonylrest ersetzt, wodurch Z-VAD-FMK
unspezifisch an die aktiven Zentren von allen bisher bekannten Caspasen binden
kann. Die Fluoromethylgruppe bindet kovalent an das aktive Zentrum der jeweiligen
Caspase und führt zu einer irreversiblen Hemmung der
proteolytischen Aktivität
(Borner and Monney, 1999). Der zweite verwendete Inhibitor DEVD, ebenfalls ein
Tetrapeptid aus Asp-Glu-Val-Asp, ist ein spezifischer Inhibitor der Effektorcaspase 3.
Sie besitzt eine Präferenz für diese Aminosäuresequenz und kann so relativ spezifisch
inhibiert werden (Nicholson et al., 1995).
Der Effekt dieser Caspaseinhibitoren auf die cTZR-vermittelte Apoptoseinduktion durch
rezeptortragende T-Zellen, wurde mit dem XTT-Zielzellviabilitätstest ermittelt. Die
Unterschiede in der Zytotoxizität, vermittelt durch den HBV S-Protein spezifischen αSC8 TZR wurden gegen eine maximale Zytotoxizitätskontrolle ohne Inhibitor verglichen
und quantifiziert.
Im Vergleich zur nicht inhibierten maximalen Zielzelllysis zeigte sich ein schützender
Effekt durch Inkubation mit dem Caspase 3-Inhibitor für die Viabilität der Zielzellen.
Hier kam es zu einer um 20% höheren Zielzellviabiltät, womit eine Inhibition der
Zytotoxizität nachgewiesen wurde. Die Inhibition der gesamten Caspasefamilie durch
den Pan-Caspaseinhibitor DEVD zeigte einen stärkeren Effekt. Hier konnte nur noch
eine Restzytotoxizität von 10% im Vergleich zur HBV-negativen Kontrolle ermittelt
werden. Dies entspricht einer fast vollständigen Inhibition der rezeptorvermittelten
Apoptose (Abb. 2.30).
61
Ergebnisse
100
Viability [%]
80
HBV+
HBV+
HBVHBV-
60
40
20
0
Caspase
Inhibitor
-
-
Z-VAD
αS-C8
DEVD
PBL
Abbildung 2.30: Caspaseinhibitoren
Kokulturen von αS-C8 TZR-tragenden T-Zellen und HBV-replizierenden (HBV+) Zielzellen
(HepG2.2.15) bzw. HBV-negativen (HBV-) Kontrollzielzellen (HepG2) wurden mit
verschiedenen Caspaseinhibitoren inkubiert. Die Veränderung der zytotoxischen T-Zellantwort
wurde anhand der Zielzellviabilität gemessen.
2.8.3 CD95-Expression
Neben der Sekretion von lytischen Granuolen kann die cytotoxische T-Zelle die
Apoptose der Zielzelle auch über die CD95 Rezeptor-Ligand-Interaktion induzieren. Es
ist bekannt, daß die Sekretion von IFNγ durch die aktivierte T-Zelle die Expression des
CD95-Rezeptors auf der Zielzelle erhöht. Dadurch ist die Zielzelle sensitiv gegen diese
Form der Apoptoseinduktion. Da in vorherigen Untersuchungen ein hohes Maß an
IFNγ-Sekretion ermittelt wurde, sollte ein möglicher Effekt auf die Expression des CD95
gezeigt werden.
Um dies zu untersuchen wurde die Expression des CD95-Rezeptors auf HBVinfizierten und als Kontrolle auf HBV-negativen PHH-Zielzellen ermittelt, die mit cTZRexprimierenden oder cTZR-negativen T-Zellen kokuliviert wurden. Die PHH-Zielzellen
und die Effektorzellen wurden geerntet und lysiert. Mit den zellulären Lysaten wurden
unter Verwendung eines CD95-spezifischen Antikörpers Western Blot Analysen
durchgeführt.
Es zeigte sich kein regulatorischer Unterschied in der Expression des CD95-Rezeptors
im Vergleich zu einer β-Actin-Kontrolle, einem konstitutiv exprimierten Haushaltsgen
(Abb. 2.31).
62
Ergebnisse
Kontrolle
|
PBL
|
aCEA
|
aS-C8
|
aL-5a19
HBV +
α CD 95
HBV -
HBV +
α β-Actin
HBV -
Abbildung 2.31: Western Blot der CD95 Expression
Kokulturen mit HBV-infizierten und HBV-negativen PHH und cTZR-exprimierenden und cTZRnegativen T-Zellen wurden geerntet und aus den Zielzellysaten wurde ein SDS-Page
angefertigt, auf eine Nylonmembran übertragen und mit CD95- bzw. als Konrolle mit β-Actinspezifischen Antikörpern detektiert.
2.9 Charakterisierung rezeptortragender T-Zellen
2.9.1 Aktivierung durch HBV-Partikel
Im Serum HBV-infizierter Patienten und auch im Zellkulturmedium HBV-replizierender
Hepatozyten sind große Mengen an HBV-Hüllproteinen vorhanden. Diese liegen in
Form von viralen und subviralen Partikeln vor und könnten durch Bindung an den cTZR
eine Aktivierung vermitteln.
Um dies zu untersuchen wurden cTZR-exprimierende T-Zellen mit HBV-haltigem
Mediumüberstand inkubiert und ihre Aktivierung untersucht. Die Messung der
Sekretion von IFNγ im Mediumüberstand der T-Zellkultur diente hierbei als Marker.
Diese wurde gegen eine Kontrollkultur mit HBV-negativem HepG2-Kulturüberstand
verglichen. Dabei konnte eine starke Aktivierung der rezeptortragenden T-Zellen durch
die Viruspartikel im Medium nachgewiesen werden. Eine maximale IFNγ-Sekretion von
1280 pg/ml für αS-C8 TZR und 690 pg/ml für αL-5a19 TZR konnte ermittelt werden
(Abb. 2.32, Virusinkubation). Da für die antigenvermittelte Aktivierung einer T-Zelle
eine gewisse flächige Kontaktzone für die Etablierung einer immunologischen Synapse
vorhanden sein muß, sollte überprüft werden, ob die Fläche die ein HBV-Partikel zur
Verfügung stellt, ausreichend ist. Es könnte ebenfalls durch eine Plastikadhärenz der
Viruspartikel in der Zellkulturschale zum Aufbau einer solchen flächigen Kontaktzone
kommen. Um einen möglichen Effekt durch Plastikadhärenz der Viruspartikel
auszuschließen, wurden in einer Kontrolle HBV-Partikel in einer Zellkulturschale
vorinkubiert um eine Plastikadhärenz zu ermöglichen. Nach einer 30 min Inkubation
wurde mehrmals gewaschen, um nicht adhärente Viruspartikel zu entfernen. Darauf
63
Ergebnisse
folgte die Inkubation mit cTZR-exprimierenden T-Zellen (Abb. 2.32, Plastikadherenz).
Um diese mögliche Plastikadhärenz zu kontrollieren, wurde die Zellkulturschale vor der
Plastikadhärenz
für
30
min
mit
FCS
inkubiert.
Dieses
blockiert
freie
Proteinbindungsstellen und schließt damit eine Plastikadhärenz der Viruspartikel aus
(Abb. 2.32: FCS-blockiert). Die Kontrollen (Plastikadhärenz, FCS-blockiert) zeigten
eine stark reduzierte IFNγ-Sekretion von maximal 250 pg/ml und die Negativkontrollen
sekretierten weniger als 100 pg/ml.
1400
1200
IFNg [pg/ml]
1000
800
aS-C8
aL-5a19
aCEA
PBL
600
400
200
0
FCS-blockiert
Plastikadhärenz
Virusinkubation
Negativkontrolle
Abbildung 2.32: Aktivierung durch HBV-Partikel
Die Aktivierung der cTZR-exprimierenden T-Zellen wurde durch Messung der IFNγ-Sekretion
ermittelt. Zusätzlich zur Inkubation mit HBV-Partikeln (Virusinkubation) wurden cTZRexprimierende T-Zellen in Zellkulturgefäßen mit vorangegangener HBV-Plastikadherenz, gefolgt
von zweimaligem Waschen mit PBS und, um diese Plastikadhärenz zu kontrollieren, in
Zellkulturgefäßen, die vor der Plastikadhärenz mit FCS blockiert wurden, inkubiert (FCSblockiert). Als Kontrolle diente Mediumüberstand der HBV-negativen HepG2-Zelllinie
(Negativkontrolle).
HBV-Partikel können an Zelloberflächen adhärieren ohne die entsprechenden Zellen
zu infizieren. Dies könnte ebenfalls als flächige, antigenpositive Zell-Zell-Kontaktzone
dienen und zur Aktivierung von cTZR-exprimierenden T-Zellen führen. Dies wurde an
den zwei verschiedenen Hepatomazellinien HepG2 und HuH7 und an der zervikalen
Tumorzelllinie HeLa verifiziert.
Um eine Aktivierung durch adhärente HBV-Partikel zu untersuchen, wurden die
Zelllinien mit HBV-haltigem Mediumüberstand inkubiert. Anschließend wurden die nicht
gebundenen Viruspartikel durch mehrmaliges Waschen entfernt. Nach einer Inkubation
mit cTZR-tragenden T-Zellen wurden die Mediumüberstände gesammelt und die
64
Ergebnisse
aktivierungsbedingte IFNγ-Sekretion bestimmt. Als Kontrolle diente eine aktivierende
Virusinkubation wie im vorangegangenen Experiment (Abb. 2.33).
12000
IFNgamma [pg/ml]
10000
8000
αS-C8
aS-C8
αL-5a19
aL-5a19
αCEA
PBL
6000
4000
2000
00
Virusinkubation
Virusinkubation
HepG2+HBV
HepG2+HBV
HuH7+HBV
HuH7+HBV
HeLa+HBV
HeLa+HBV
Abbildung 2.33: HBV-Partikeladhärenz an Zelllinien
Die Aktivierung der cTZR-exprimierenden T-Zellen wurde durch Messung der IFNγ-Sekretion
ermittelt. Zusätzlich zur Inkubation mit HBV-Partikeln alleine (Virusinkubation) wurden cTZRexprimierende T-Zellen mit verschiedenen Zelllinien (HepG2,HuH7,HeLa) inkubiert, die mit
HBV-Partikeln inkubiert und anschließend mehrmals mit PBS gewaschen wurden um
nichtadhärente Partikel zu entfernen. Als Kontrolle diente HBV-negativer Mediumüberstand der
HepG2-Zelllinie.
In diesem Ansatz konnte eine Aktivierung durch adhärente HBV-Partikel nur für die
zwei Hepatomazelllinien, nicht aber auf HeLa-Tumorzellen, gezeigt werden. Dies wird
wahrscheinlich durch eine leberspezifische Adhärenz der HBV-Partikel an einen
Primärrezeptor vermittelt, der auf den HeLa-Zellen nicht vorhanden ist. Dabei
verursacht der HBV S-Protein spezifische αS-C8 TZR jeweils eine stärkere Induktion
der IFNγ-Sekretion im Vergleich zu αL-5a19 TZR. Maximale Werte der IFNγ-Sekretion
wurden für αS-C8 mit 710 pg/ml auf HepG2 und mit 720pg/ml auf HuH7 Zellen
ermittelt. Eine Aktivierung durch HBV-Partikeladhärenz auf HeLa-Zellen wurde
dagegen nicht beobachtet. Diesem Effekt könnte eine spezifische Adhärenz der
Viruspartikel an Hepatomazellen zugrunde liegen.
2.9.2 Aktivierung des CEA-spezifischen Kontrollrezeptors
Der
in
dieser
Arbeit
als
Kontrolle
verwendete
cTZR
αCEA
erkennt
karzinoembryonisches Antigen. Um seine Funktion nachzuweisen wurde eine
Aktivierung auf CEA-positiven Zellen gegen die verwendeten Hepatomazellen
65
Ergebnisse
verglichen. Damit sollte die Verwendbarkeit als Kontrollrezeptor in den hier gezeigten
Experimenten verifiziert werden.
Um die Funktionalität des Kontrollrezeptors αCEA TZR zu untersuchen, wurden
rezeptortragende T-Zellen mit Hepatomazellen und mit CEA-positiven HaCat-Zellen
kokultiviert und verglichen. Die Antigenerkennung durch den αCEA TZR führte zu einer
deutlichen Aktivierung der T-Zellen. Die IFNγ-Sekretion nach der Antigenerkennung
betrug 202 pg/ml im Vergleich zu einem Hintergrundsignal von 48 pg/ml in Kokultur mit
den CEA-negativen HepG2-Zellen (Abb. 2.34).
250
200
150
CEA-positiv
CEA-negativ
IFNγ
[pg/ml]
100
50
0
HepG2
HaCat
αCEA
Abbildung 2.34: Überprüfung des Konrollrezeptors
Um die T-Zellaktivierung durch den CEA-spezifischen Kontroll-TZR zu untersuchen wurden
αCEA-exprimierende T-Zellen (αCEA) mit CEA-negativen HepG2-Hepatomazielzellen und mit
CEA-posiven HaCat-Zellen kokultiviert und die aktivierungsbedingte INFγ-Sekretion gemessen.
Durch die Abteilung für klinische Chemie der Universitätsklinik Köln wurde die
Konzentration an sekretiertem CEA im Medium von Hepatomazellen und primären
Hepatozyten gemessen und die Ergebnisse lagen unter der Nachweisgrenze des
verwendeten Tests. Für Zellkulturüberstände der humanen Keratinozytenzelllinie
HaCat wurden dagegen positive CEA-Mengen von 206 µg/ml ermittelt. Dieses lösliche
Protein wird von CEA-exprimierenden Zellen durch shedding in Medium abgegeben,
was eine Expression der Antigene auf der Zelloberfläche beweist (Adams and Glacken,
1990).
66
Diskussion
3 Diskussion
Die
aktuellen
Therapiemöglichkeiten
der
chronischen
Hepatitis
B
umfassen
Hemmstoffe der viralen Replikation wie IFNα in Kombinationen mit verschiedenen
Inhibitoren der viralen reversen Transkription. Dadurch wird die produktive Replikation
des HBV zwar unterdrückt, es kommt aber nur in 1-5% der Fälle und nur bei der
Verwendung von IFNα zu einer vollständigen Elimination der Infektion (Ganem and
Prince, 2004). Nach Beendigung der Therapie wird durch die persistierende cccDNA
ein neuer Replikationszyklus initiiert (Protzer and Schaller, 2000). Deshalb steht die
Neuentwicklung wirkungsvoller Therapien im Fokus der Forschung und eine
Elimination der episomalen cccDNA ist die Grundvoraussetzung für eine Ausheilung.
Eine artifizielle Immunantwort durch T-Zellrezeptormodifikation stellt eine mögliche
Immuntherapie für die Behandlung der chronischen Hepatitis B Infektion dar. Die
dadurch
vermittelte
zytotoxische
Entfernung
HBV-infizierter
cccDNA-positiver
Hepatozyten und die Sekretion von IFNγ, könnten zum Ausheilen der chronischen
Infektion beitragen.
Um HBV-infizierte Zellen zu eliminieren wurden im Rahmen dieser Arbeit chimäre TZellrezeptoren
(cTZR)
konstruiert,
die
durch
Antikörperfragmente
(scFv)
mit
Spezifitäten für verschiedene HBV-Hüllproteine ausgestattet wurden. Für die
Erzeugung eines aktivierenden Signals besitzen die verwendeten cTZR-Konstrukte
eine modulare Signaldomäne, die aus einer CD3ζ-Ketten- und einer CD28-KorezeptorSignaldomäne zusammengesetzt ist (Hombach et al., 2001b). Durch retrovirale
Transduktion dieser cTZR-Konstrukte konnten sie in humanen T-Zellen exprimiert
werden. Dabei vermittelte die scFv-Antigenerkennungsdomäne eine antikörperähnliche
und MHC-unabhängige Antigenbindung. Dies führte zu einer spezifischen Erkennung
von HBV-Hüllproteinen, die aufgrund der Umhüllungs- und Sekretionsmechanismen
viraler Partikel in der Plasmamembran HBV-replizierender Zellen enthalten sind (Chu
and Liaw, 1995). Die Interaktion der cTZR-Konstrukte mit HBV-Hüllproteinen induzierte
eine funktionelle T-Zellantwort und führte zur spezifischen Elimination HBV-infizierter
primärer humaner Hepatozyten (PHH) sowie HBV-replizierender Hepatomazellen.
Dabei wurde eine spezifische Elimination cccDNA positiver Hepatozyten beobachtet,
was grundsätzlich das Ziel einer HBV-Therapie ist. Zusätzlich kam es zu einer
antigenspezifischen Sekretion der Zytokine IFNγ und IL-2, wobei letzteres ein
proliferatives Signal erzeugte und zur Expansion der cTZR-exprimierenden T-Zellen
führt. Es konnte gezeigt werden, daß diese zytotoxische Elimination HBV-positiver
Zielzellen durch Degranulation Perforin/Granzym-enthaltender lytischer Granuolen
vermittelt wird und hochspezifisch verläuft.
67
Diskussion
3.1 HBV-spezifische Immunantwort
Im Allgemeinen bestimmt die Immunantwort des Wirts den Verlauf einer akuten HBV
Infektion. In eimem Großteil der Patienten führt eine starke und polyklonale TZellantwort mit multiplen T-Zellepitopen für die verschiedenen HBV-Proteine zu einer
Ausheilung der Infektion (Bertoletti et al., 1991; Rehermann et al., 1995). Dagegen
wurde bei ca. 5% der erwachsenen Patienten eine schwache und oligoklonale TZellantwort beschrieben, die in einem chronischen Infektionsverlauf resultiert (Penna
et al., 1996; Penna et al., 1991). Die dabei stattfindende lang anhaltende
Entzündungsreaktion kann zur Ausbildung einer Leberzirrhose führen. Dabei wird
durch regenerative Prozesse ein hoher mitotischer Druck erzeugt, der zu einer
gesteigerten DNA-Schädigung beiträgt. Dies erhöht die Wahrscheinlichkeit als
Langzeitfolge ein hepatozelluläres Karzinom zu entwickeln (Chisari and Ferrari,
1995b). Die Etablierung von Immuntherapien mit rezeptormodifizierten T-Zellen könnte
die ineffiziente T-Zellantwort dieser chronisch infizierten Patienten unterstützen.
Obwohl durch Kombinationstherapien eine Reduktion der HBsAg-positiven Zellen
erreicht wurde, verblieben 15-30% HBsAg-positiver Hepatozyten (Wursthorn et al.,
2006). Somit scheint bei einer antiviralen Therapie, eine Population von HBVOberflächenantigen-positiven Zellen zu verbleiben, die als potentielle Zielzellen dienen
könnten. Dies ist die Grundvoraussetzung für einen Ansatz mit cTZR-exprimierenden
T-Zellen. Eine solche Kombinationstherapie könnte demnach vorbereitend eingesetzt
werden, um die zytotoxische Leberschädigung bei der Etablierung einer artifiziellen TZellantwort zu minimieren.
Die Funktionalität eines adoptiven Transfers genmodifizierter T-Zellen wurde bereits
erfolgreich in Therapieansätzen maligner Tumoren gezeigt (Morgan et al., 2006). In
diesen Ansätzen wurden die α- und β-Ketten eines selektierten und Tumorantigenspezifischen TZR retroviral in T-Zellen transduziert. Durch den adoptiven Transfer
konnte eine hohe Repopulationsrate in immundepletierten Patienten erreicht werden,
ein Vorgang der maßgeblich am Erfolg der Behandlung beteiligt war. Außerdem konnte
ein Einwandern der voraktivierten T-Zellen in die Leber nachgewiesen werden, das
eine Tumorregression bewirkte. Eine solche Mobilität der T-Zellen, die selbst zur
Besiedelung der immunprivilegierten Leber führen kann, ist für eine Behandlung der
chronischen HBV ebenfalls notwendig. Der Einsatz MHC-restringierter α- und β-Ketten
wird dadurch erschwert, daß viele Viren die MHC-Antigenpräsentation inhibieren
(Hirata et al., 2001). Außerdem kann es zu einer Falschpaarung der rekombinanten
TZR-Ketten mit den endogenen Rezeptorketten kommen, wodurch nicht-funktionelle
Dimere entstehen. Um dies zu umgehen, wurden in dieser Arbeit cTZR mit scFvvermittelter
Antigenerkennung
verwendet,
68
die
eine
MHC-unabhängige
Diskussion
Antigenerkennung ermöglichen und als lineares transmembranäres Fusionsprotein
vorliegen.
3.2 Chimäre T-Zellrezeptoren
Chimäre T-Zellrezeptoren mit scFv-Antigenbindedomänen wie sie in dieser Arbeit
hergestellt wurden, sind bisher hauptsächlich gegen Tumorantigene maligner
Erkrankungen gerichtet und erforscht worden (Abken et al., 1997; Darcy et al., 1998;
Eshhar, 1997). Die Weiterentwicklung führte zu modularen Signaldomänen, die neben
der CD3ζ-Kette eine zusätzliche CD28-Korezeptor-Signaldomäne enthalten. Solche
cTZR etablieren funktionelle T-Zellantworten gegen Tumorzellen nach Gentransfer in
syngene T-Zellen (Hombach et al., 2006) und bewirken Tumorregressionen in vivo
(Moeller et al., 2004). Außerdem konnte durch eine spezifische Elimination HIVinfizierter CD4+-T-Zellen gezeigt werden, daß die gerichtete Antigenerkennung viraler
Antigene (Glykoprotein 120) durch cTZR möglich ist (Masiero et al., 2005).
Die in dieser Arbeit verwendeten scFv sind gegen das kleine S- und das große LHüllprotein des HBV gerichtet. Es wurden zwei HBV S-Protein spezifische scFv
(C8/C9) verglichen, die durch Selektion einer scFv-Bibliothek gewonnen wurden
(McCafferty et al., 1990). Die Bibliothek wurde aus einer B-Zell-cDNA-Bibliothek von
HBsAg-vaccinierten Spendern generiert (Kuerschner, 2000). Das HBV L-Protein
spezifische scFv-5a19 wurde aus der cDNA einer B-Zellhybridomalinie generiert
(Andreas Schulze, Heidelberg), die den etablierten monoklonalen Antikörper 5a19
exprimiert (Pizarro et al., 2001).
Um HBV-spezifische chimäre T-Zellrezeptoren zu generieren, wurde die CEAspezifische scFv-Antigenerkennungsdomäne eines etablierten cTZR-Konstruktes
gegen die unterschiedlichen HBV-spezifischen scFv ausgetauscht. Diese wurden in
das parentale cTZR-Konstrukt (Hombach et al., 2001b) eingebracht, das sich in dem
retroviralen Vektorplasmid pBULLET befand. Durch Integration in das cTZR-Konstrukt
vermitteln die HBV-spezifischen scFv eine immunglobulinähnliche Erkennung nativer
nichtprozessierter
HBV-Hüllproteine.
HBV-infizierte
Hepatozyten
zeigen
eine
Distribution der HBV-Hüllproteine, die wahrscheinlich auf die intrazelluläre Umhüllung
der
Viruskapside
durch
eine
von
der
Wirtszelle
stammende
Lipidmembran
zurückzuführen ist. Dabei werden die HBV-Hüllproteine für die Umhüllung der viralen
Kapside in die ER-Membran eingelagert. Nach der Umhüllung der Viruspartikel werden
diese durch Sekretionsvesikel zur Plasmamembran transportiert. Bei der Sekretion der
HBV-Partikel kommt es zur Membranfusion der Transportvesikel wodurch die
69
Diskussion
transmembranären HBV-Hüllproteine, die nicht bei der Umhüllung der Viruspartikel
verwendet wurden, an die Zelloberfläche gelangen.
Eine
transiente
Transfektion
Oberflächenexpression
der
der
cTZR-Konstrukte
rekombinanten
zeigte
Rezeptorkonstrukte,
eine
die
deutliche
durch
die
eingebrachte κ-Sekretionssequenz vermittelt wurde. Durch Inkubation mit löslichen
HBV-Partikeln konnte in einer Fluoreszenzfärbung eine Überlagerung des exprimierten
αS-C8-cTZR und der daran gebundenen Viruspartikel gezeigt werden. Dies diente als
erster Hinweis auf eine funktionelle Interaktion der scFv-Antigenerkennungsdomäne
des cTZR mit den HBV-Hüllproteinen in der Lipidmembranhülle der Viruspartikel.
3.3 Genmodifikation primärer T-Zellen
Für die Transduktion sollte eine möglichst homogene Population primärer humaner TZellen vorliegen. In dem hier verwendeten Protokoll wurde die Leukozytenfraktion aus
peripherem Vollblut via Dichtegradientenzentrifugation isoliert. Die darin enthaltenen TZellen wurden nach der Trennung T-zellspezifisch aktiviert indem durch anti-CD3Antikörper eine Antigenbindung am TZR simuliert wurde. Die Zugabe von
rekombinantem IL-2 erzeugte ein proliferatives Signal das zu einer Expansion der TZellen führte. Die adhärenten, myeloiden Zellen wurden durch Plastikadhärenz an der
Zellkulturflasche depletiert. Um diese Präparationen zu charakterisieren wurden die
Zellfraktionen mit fluoreszenzmarkierten Antikörpern gegen Blutzelloberflächenmarker
gefärbt und mittels Durchflußzytometrie untersucht. Die ermittelten Werte der PBL
Subpopulationen zu Beginn der Aktivierung entsprechen den in Patienten ermittelten
durchschnittlichen Verhältnissen aus Großstudien (Comans-Bitter et al., 1997; Hannet
et al., 1992). Aufgrund der T-zellspezifischen Aktivierung und des proliferativen IL-2Signals, expandierten die T-Zellen innerhalb von drei Tagen von 30% auf einen Anteil
von 85% der Gesamtfraktion und setzten sich aus 45% CD8+, 37% CD4+ und 2,5%
CD4+/CD8+ T-Zellen zusammen. Die B-Zellen verringerten ihren Anteil während der Tzellspezifischen Aktivierung von ursprünglich 2,5% auf 0,8%. Trotz T-zellspezifischer
Aktivierung
und
Plastikadhärenz
konnten
noch
geringe
Konzentrationen
plasmazytoider dendritischer Zellen, Monozyten und Makrophagen nachgewiesen
werden. Die T-zellspezifische Aktivierung führt demnach zu einer starken Anreicherung
der CD3-positiven T-Zellen, auch wenn ein geringer Anteil CD3-negativer Blutzellen
erhalten bleibt.
Die Proliferation der T-Zellen ist eine Grundvoraussetzung für die Transduktion und
Transgenexpression durch retrovirale Vektoren. Retroviren können nur mitotische
Zellen infizieren, wodurch das genetische Material stabil ins Genom integriert wird
70
Diskussion
(Weijtens et al., 1998a). Die daraus folgende langanhaltende Transgenexpression ist
besonders
dann
von
Vorteil,
wenn
eine
dauerhafte
Repopulation
mit
rezeptormodifizierten T-Zellen angestrebt wird. Es konnte gezeigt werden, daß
rezeptortransgene T-Zellen bis zu zwei Jahre im Patienten nachweisbar sind (Morgan
et al., 2006).
Die
retrovirale
Transduktion
erfolgte
durch
Kokultur
der
angereicherten
T-
Zellpopulation mit virusproduzierenden Hek293T-Zellen. Die retrovirale Transduktion
lieferte bis zu 60% rezeptorexprimierende T-Zellen. Da die Transduktion mit lentiviralen
Vektoren im Vergleich keinen quantitativen Vorteil brachte, wurde in den folgenden
Experimenten
das
retrovirale
Vektorsystem
eingesetzt.
Die
unterschiedlichen
rezeptortragenden T-Zellen wurden anhand der ermittelten Tranduktionsraten mit nicht
transduzierten T-Zellen verdünnt und auf gleiche Anzahlen cTZR-exprimierender
Zellen pro Versuch eingestellt.
3.4 Rezeptorvermittelte Zytotoxizität
Die Etablierung einer funktionellen Immunantwort sollte in Kokulturen cTZRexprimierender T-Zellen mit HBV-positiven Zielzellen untersucht werden.
Hepatomazelllinien sind grundsätzlich nicht mit HBV infizierbar. Abgesehen von der
durch spezifische Oberflächenrezeptoren limitierten Infektion, ist eine HBV-Produktion
in Hepatomazellen aber durchaus möglich. Durch die Transfektion eines zirkulären
oder linearisierten Überlängengenoms kann eine produktive Replikation etabliert
werden (Sureau et al., 1986). Dafür müssen Überlängengenome verwendet werden, da
die Leseraster überlappen und die Positionen der verschiedenen Verstärkerelemente
im HBV-Genom über die Grenzen des linearen Genoms hinaus wirken. Mit solchen
Konstrukten konnte gezeigt werden, daß die stabile Integration eines zweifachen
Überlängengenoms zur Produktion von HBV-Partikel durch HepG2-Hepatomazellen
führt (Sells et al., 1987) und diese in Schimpansen infektiös sind (Acs et al., 1987;
Sureau et al., 1988). Nach diesem Prinzip wurde unter Verwendung eines 1.3-fachen
Überlängengenoms (Guidotti et al., 1995; Sprinzl et al., 2001) eine stabil HBVreplizierende Hepatomazelllinie (HepG2H1.3) generiert und charakterisiert. Ein
Vergleich dieser Zellinie mit der etablierten HBV-replizierenden HepG2.2.15 Zelllinie
(Sells et al., 1987) zeigte eine ebenfalls stabile HBV-Partikelproduktion. Für die
HepG2H1.3 Zelllinie konnte die Integration eines einzelnen HBV-Überlängengenoms
und die Etablierung der episomalen HBV-Replikationsmatritze cccDNA nachgewiesen
werden. Dies wurde auch für die etablierte HepG2.2.15-Zellinie berichtet (Sells et al.,
1987), konnte jedoch in Charakterisierungsversuchen nicht reproduziert werden.
71
Diskussion
Für eine erste Einschätzung des zytotoxischen Potentials der cTZR-exprimierenden TZellen wurden stabil HBV-replizierende Hepatomazelllinien als Zielzellen eingesetzt.
Diese sind besonders gut als Zielzelle geeignet, da jede Zelle HBV produziert und
HBV-Hüllproteine exprimiert, die in ihrer Membran eingelagert sind. Kokulturen mit
cTZR-exprimierenden T-Zellen wurden optisch überwacht, wobei nach drei Tagen
eindeutige zytotoxische Läsionen im konfluenten Zellrasen der HBV-replizierenden
Zielzelllinien nachgewiesen wurden. Aufgrund einer um bis zu 50% veringerten
Zytotoxizität des αS-C9 TZR wurde für die folgenden Experimente der αS-C8 TZR
verwendet. In den HBV-negativen und unspezifischen Kontrollen kam es zu keiner
Elimination der Zielzellen. Dies war ein erster Hinweis auf die Etablierung einer
antigenspezifischen zytotoxischen T-Zellantwort.
Um die optimale Zielzelllinie für die Kokultur mit cTZR-tragenden T-Zellen zu ermitteln
fand ein Vergleich zwischen der generierten HepG2H1.3- und der HepG2.2.15-Zelllinie
statt. In diesem Versuch zeigte sich, daß die Kokultur mit der etablierten HepG2.2.15Zelllinie zu einer um 20% höheren Zielzellysis als mit HepG2H1.3 führte. Die
HepG2.2.15-Zellinie produziert aufgrund ihrer vier Tandem-HBV-Integrate mehr
Hüllproteine als die HepG2H1.3-Zelllinie, deren Replikation nur von einem einzelnen
Überlängenintegrat stattfindet. Die Transkripton vom etablierten cccDNA-Pool, der nur
in der HepG2H1.3- nicht aber in der HepG2.2.15-Zelllinie nachweisbar ist, findet
dagegen zeitverzögert statt, da es mehrere Tage dauert bis er etabliert ist. Dieser
Unterschied
in
der
HBV-Replikation
könnte
für
die
intensivere
Zytotoxizität
verantwortlich sein. Aufgrund dieser Ergebnisse wurde für die folgenden Experimente
die HepG2.2.15-Zelllinie als Zielzelllinie eingesetzt.
3.5 Zeitlicher Verlauf der Zytotoxizität
Die Antigenerkennung der rezeptormodifizierten T-Zellen durch den cTZR induzierte
eine IFNγ−Sekretion, die als Marker für deren Aktivierung diente. Um diese Aktivierung
zu charakterisieren wurden Kokulturen zu verschiedenen Zeitpunkten analysiert. In
diesem Experiment zeigte sich ein deutlicher Unterschied im zeitlichen Verlauf der
Aktivierung zwischen den HBV-spezifischen cTZR. Während die durch αS-C8
vermittelte IFNγ-Sekretion bereits nach 24 h messbar war, zeigte die HBV L-Protein
spezifische Aktivierung nur eine minimale und um 40 h verzögerte IFNγ-Sekretion. Für
diesen zeitlichen Unterschied in der Aktivierungskinetik könnten die unterschiedlichen
Mengen der vorhandenen Antigene verantwortlich sein. Die genauen Verhältnisse der
HBV-Hüllproteine auf Hepatomazellen sind nicht eindeutig charakterisiert. Ihre
Zusammensetzung in viralen Partikeln im Blut zeigt jedoch starke Unterschiede
72
Diskussion
zwischen den als Antigen dienenden Proteinen. Die ermittelten Werte liegen für das
HBV S-Protein bei bis zu 96%, während für HBV L-Protein nur 1-2% angegeben
werden (Ganem and Schneider, 2001). Vergleichbare Vehältnisse sollten in der
Membran HBV-replizierender Hepatozyten vorhanden sein. Des Weiteren ist für die
Ausbildung
einer
immunologischen
Synapse
das
Komplexieren
mehrerer
T-
Zellrezeptoren durch Antigenerkennung notwendig um ein ein aktivierendes Signal zu
generieren (Kolanus et al., 1993). Eine zu geringe Antigenmenge könnte diesen
Vorgang verhindern und somit eine Akkumulation von membranständigem L-Protein
durch anhaltende Partikelsekretion voraussetzen. Erst beim Erreichen einer kritischen
Menge an Hüllproteinen würde es zu einer zeitverzögerten vollen Aktivierung der aL5a19 TZR-exprimierenden T-Zellen und zur Sekretion von IFNγ kommen.
Dieser Effekt könnte alternativ auch an einer unterschiedlichen Affinität der
verwendeten scFv-Antigenerkennungsdomänen liegen. Um dies zu untersuchen
wurden vergleichende Analysen der rekombinanten scFv im Rahmen einer
Diplomarbeit (Eva Gückel) durchgeführt. Durch Plasmon-Resonanz-Messungen
konnten aufgrund der partikulären Struktur der HBV-Partikel jedoch keine eindeutigen
Bindungskinetiken erstellt werden. Außerdem zeigten die Messungen ein für Antikörper
unübliches Verhalten, da es nach einer Bindung zu keiner Dissoziation kam.
Der in diesen Experimenten verwendete, CEA-spezifische Rezeptor (Hombach et al.,
2001b) diente als Kontrolle für die Expression eines unspezifischen cTZR durch die TZellen. Sein spezifisches Antigen, das karzinoembryonische Antigen (CEA) ist im
Überstand der als Zielzellen eingesetzten Hepatomazelllinien nicht nachweisbar,
weshalb dieser Rezeptor als Kontrolle geeignet ist. Dadurch sollte der Einfluß der
Expression eines unspezifischen Rezeptorkonstruktes auf die T-Zellantwort ermittelt
werden. Um die Funktionalität des CEA-spezifischen Rezeptors zu untersuchen wurde
die CEA-positive humane Keratinozytenzelllinie HaCat verwendet und mit aCEAexprimierenden Zellen kokultiviert.
Dabei konnte eine vierfach gesteigerte aktivierungsbedingte IFNγ-Sekretion der CEAspezifischen rezeptortragenden T-Zellen im Vergleich zu Kokulturen mit CEAnegativen HepG2-Zellen gemessen werden. Dies zeigt, daß der CEA-spezifische
Kontroll-TZR sein Antigen spezifisch erkennt und dies zu einer Aktivierung der cTZRexprimierenden T-Zellen führt.
Somit ist der CEA-spezifische chimäre T-Zellrezeptor eine gute Konrolle um den
Einfluß der Expression eines unspezifischen T-Zellrezeptors zu ermitteln.
73
Diskussion
3.6 Elimination HBV-replizierender Hepatomazelllinien
In weiteren Versuchen wurde die Funktionalität der cTZR-Konstrukte genauer
untersucht, indem die maximale Zytotoxizität ermittelt wurde. Es wurde eine
spezifische
Elimination
von
bis
zu
60%
der
HBV-replizierenden
Zielzellen
nachgewiesen.
Um die Effektivität der etablierten T-Zellantwort zu charakterisieren wurde die
Abhängigkeit von der E:T Ratio untersucht. Diese erlaubt Rückschlüsse über die
Aktivität der einzelnen cTZR-tragenden T-Zellen. In vergleichbaren Arbeiten in der
Literatur werden üblicherweise E:T Ratios von 5:1 bis 50:1 eingesetzt und die
Zielzelllysis mit einem Chromfreisetzungsassay ausgewertet (Masiero et al., 2005). In
der Leber müssten aufgrund der Organmorphologie keine so hohen Ratios möglich
sein. Deshalb wurden in diesen Experimenten relativ niedrige E:T Ratios zwischen
1,5:10 und 0,2:10 eingesetzt um eine natürliche Situation zu erhalten. In diesen
Ansätzen wurden längere Inkubationszeiten benötigt, wodurch eine Chromfreisetzung
zur Ermittlung der Zytotoxizität nicht anwendbar war und wurde nach mehrtägiger
Inkubation mittels colorimetrischem Zellviabilitätsassay ermittelt.
Bei der höchsten E:T Ratio wurde eine vergelichbare Zielzelllysis der HBV spezifischen
T-Zellen von durchschnittlich 42% nachgewiesen. Durch die Untersuchung der
Dosisabhängigkeit konnte eine minimale effektive E:T Ratio von 0,4:10 ermittelt
werden.
Dies
ist
ein
Hinweis
darauf,
daß
eine
kritische
Konzentration
rezeptortragender T-Zellen vorhanden sein muß, um eine zytotoxische T-Zellantwort zu
induzieren. Diese Ergebnisse zeigen zusätzlich, daß rezeptortragende T-Zellen
mehrere Zielzellen eliminieren können. Rechnerisch entsprach die maximale
Zielzelllysis einer Elimination von vier Zielzellen pro rezeptortragender T-Zelle.
3.6.1 Charakterisierung der Zytotoxizität
Bei der Initiation einer immunologischen Synapse kommt es zur Reorganisation des
Zytoskeletts und zu einer deutlichen Polarisierung der zytotoxischen T-Zelle (Dustin
and Cooper, 2000). Diese dient der gerichteten Sekretion lytischer Granuolen in den
synaptischen Spalt (Degranulation). Die Granuolen enthalten den Porenbildner Perforin
und die proapoptotischen Proteasen Granzym A und B (Janeway et al., 2004). Die
Membran der lytischen Granuolen enthält die lysosomalen Glykoproteine Lamp-1/-2
(CD107a/b) und Lamp-3 (CD63). Wird ein solches Vesikel an die Zellmembran
transportiert und fusioniert mit ihr kommt es zur Mobilisierung der intravesikulären
Membranproteine an die Zelloberfläche der zytotoxischen T-Zelle (Peters et al., 1991).
Mit Hilfe eines durchflußzytometrischen Lamp-2-Mobilisierungsassays (Betts et al.,
74
Diskussion
2003) konnte eine eindeutige Beteiligung der Degranulation Perforin/Granzym
enthaltender Vesikel an der Lysis HBV-replizierender Zielzellen gezeigt werden.
Die Kontrollen mit αCEA-tragenden und mit unbehandelten T-Zellen zeigten auf HBVreplizierenden Zielzellen eine relativ hohe Hintergrundzytotoxizität. Diese T-Zellaktivität
war unabhängig von der Rezeptormodifikation und wurde nicht auf HBV-negativen
Zielzellen ermittelt. Demnach scheinen HBV-Proteine eine prinzipielle Aktivierung der
T-Zellen auzuslösen. Dies könnte auf eine Mustererkennung des angeborenen
Immunsystems durch Toll-like Rezeptoren (TLR) hinweisen, die neben ihrer etablierten
Rolle in der Aktivierung von Makrophagen, kürzlich auch als Modulatoren der
regulatorischen CD4+ T-Helferzellen identifiziert wurden (Peng et al., 2005). Daß in den
Kontrollen mit HBV-negativen Hepatomazellen keine erhöhten Zytotoxizität gemessen
wurden, könnte am Fehlen der HBV-Proteine und somit des TLR-Liganden liegen.
Dieser Effekt könnte aber auch auf die Verunreinigung der T-Zellpräparationen durch
dendritische Zellen und Makrophagen zurückzuführen sein, die auf HBV-Partikel mit
einer TLR-Aktivierung reagieren (Cooper et al., 2005). Eine weitere mögliche Erklärung
für diesen scheinbar unspezifischen Effekt, wäre die Präsenz impfinduzierter, HBVspezifischer T-Zellen, da die Blutpräparationen üblicherweise aus venösem Blut von
HBV-vaccinierten Probanden stammten. Diese HBV-spezifischen Erinnerungs-T-Zellen
wären zwar Anfangs in sehr geringen Mengen vorhanden, würden aber durch die
Präsentation von HBV-Peptidantigenen im Kontext eines MHC-Moleküls aktiviert
(Isogawa et al., 2005a). Dadurch könnten sie expandieren und eine zytotoxische MHCrestringierte T-Zellantwort parallel zu der cTZR-vermittelten initiieren.
Diese
Ergebnisse
zeigen,
daß
eine
spezifische
T-Zellantwort
durch
eine
Rezeptormodifikation etabliert werden konnte, die zur Elimination HBV-replizierender
Hepatomazellen führte. Zudem wurde diese zytotoxische T-Zellantwort bereits bei
niedrigen Effektorzellzahlen etabliert.
3.6.2 T-Zellaktivierung und Zytokinsekretion
Die antigenvermittelte Aktivierung der cTZR-exprimierenden T-Zellen induziert die
Sekretion von Zytokinen (Hombach et al., 2005). Dabei zeigte sich ein deutlicher
Unterschied zwischen den beiden HBV-spezifischen T-Zellrezeptorkonstrukten auf
HBV-replizierenden Zielzellen. Die maximale Sekretion von IFNγ wurde durch
Aktivierung des αS-C8 TZR erreicht, während bei αL-5a19 bis zu 60% geringere
Sekretionsraten ermittelt wurden. Bei αS-C8-tragenden T-Zellen wurde ebenfalls eine
hohe IL-2 Sekretion gemessen, die bei αL-5a19-tragenden Zellen kaum nachweisbar
war. Die Zytokinsekretion scheint demnach unabhängig von der Initiation der
Zytotoxizität zu sein, da bei der Analyse der Zielzelllysis keine drastischen
75
Diskussion
Unterschiede zwischen den einzelnen cTZR nachgewiesen wurden. Die Unterschiede
in den gemessenen IFNγ und IL-2 Werten könnten auf verschiedene Schwellenwerte
bei der Signalaktivierung beruhen. Grundsätzlich wird in diesem System die Sekretion
von IFNγ durch Aktivierung der CD3ζ-Ketten Signaldomäne vermittelt, die Sekretion
von IL-2 dagegen durch Aktivierung der kostimulatorischen CD28-Signaldomäne
(Hombach et al., 2005). Aufgrund der geringen Antigenmenge des HBV L-Proteins
würde dies bei αL-5a19-tragenden T-Zellen zu einer späteren und damit geringeren IL2-Sekretion führen.
Zusätzlich wurde in T-Zellen die aS-C8 exprimieren eine antigenabhängige
Proliferation beobachtet. In vivo werden bei der Etablierung der T-Zellantwort unreife TZellen in lymphatischen Geweben durch antigenpräsentierende Zellen (APC) aktiviert
(Janeway et al., 2004). Dabei führt die Erkennung eines spezifischen Antigens durch
den T-Zellrezeptorkomplex zur Stimulation der Zelle und zur Transkription des IL-2
Gens. Um die Sekretion von IL-2 einzuleiten wird jedoch ein kostimulatorisches Signal
durch die Interaktion des CD28-Rezeptors mit seinem Liganden (CD80/CD86) benötigt
(Krause et al., 1998). Dies führt zu einer Stabilisierung der mRNA, wodurch deren
Translation induziert wird. Erst ein autokrines IL-2-Signal bewirkt eine volle
Differenzierung und klonale Expansion der T-Zelle (Janeway et al., 2004). Durch die
Integration
der
CD28-Signaldomäne
in
die
cTZR-Konstrukte,
wurde
dieses
kostimulatorische Signal imitiert und eine IL-2 Sekretion ermöglicht.
Um eine durch IL-2 induzierte Proliferation in diesen Experimenten zu untersuchen
wurden rezeptortragende T-Zellen mittels Durchflußzytometrie analysiert. Dabei konnte
eine deutliche Expansion der cTZR-exprimierenden T-Zellen in Kokulturen mit HBVpositiven Hepatomazielzellen gezeigt werden. Während es bei diesen zu einer
Verdoppelung der T-Zellzahl kam, wurde in Kokulturen mit HBV-negativen Zielzellen
eine verringerte Anzahl der T-Zellen gemessen. Das weist auf eine Depletion der
cTZR-exprimierenden T-Zellen hin, die wahrscheinlich auf das Fehlen eines
spezifischen Antigens und der damit erzeugten stimulierenden Signale zurückzuführen
ist.
Aktivierte rezeptortragende T-Zellen sekretierten bis zu 22 ng/ml IFNγ, das nicht nur an
der Regulation der Immunantwort beteiligt ist, sondern selbst eine antivirale Funktion
besitzt. In HBV transgenen Mausmodellen konnte gezeigt werden, das IFNγ, welches
entweder von aktivierten T-Zellen sekretiert oder auch künstlich durch HBV-Vektoren
exprimiert wurde die Virusreplikation signifikant verringerte (Dumortier et al., 2005;
Guidotti et al., 1996; Protzer et al., 1999). Außerdem bewirkt IFNγ eine Rekrutierung
weiterer Immunzellen in den Entzündungsherd (Janeway et al., 2004). Durch diesen
Effekt könnte eine potentielle Therapie chronisch HBV-infizierter Patienten zusätzlich
76
Diskussion
erleichtert werden. Dieser virocidale Effekt wird in zwei Mechanismen unterteilt, die
Zerstörung der HBV-Kapside mit den darin enthaltenen Genomen und die
Destabilisierung der viralen RNA (Guidotti et al., 1996). Diese Mechanismen tragen zur
nichtzytopathischen Infektionsabwehr bei und verringern dadurch die Schädigung der
Leber durch zytotoxische Elimination von Hepatozyten.
Diese Ergebnisse zeigen, daß eine volle Aktivierung der rezeptormodifizierten T-Zellen
durch Antigenerkennung der chimären HBV-spezifischen T-Zellrezeptoren möglich ist.
Das auf der Oberfläche der HBV-replizierenden Zellen vorhandene S- und L-Protein
wurde dabei von der Antigenerkennungsdomäne gebunden und ein aktivierender
Stimulus generiert. Dadurch wurde sowohl von der CD3ζ-Ketten- als auch der CD28Signaldomäne das entsprechende Signal generiert. Als Folge dessen kam es zur
zytotoxischen Lyse der HBV-positiven Zielzellen und zur Sekretion von IFNγ und IL-2.
3.7 Zytotoxische Elimination HBV-infizierter Hepatozyten
Neben der HepaRG Zellinie sind die einzigen mit dem humanen HBV infizierbaren
Zellen primäre Hepatozyten von Mensch oder Schimpanse. Primäre humane
Hepatozyten (PHH) können nur aus Resektionen von Leberkarzinom- oder
Leberzirrhosepatienten gewonnen werden, wodurch deren Verfügbarkeit und Qualität
sehr unterschiedlich und die Kulturmöglichkeiten eingeschränkt sind. Dennoch ist dies
ein Infektionsmodell für HBV, das der in vivo Situation näher kommt (Rijntjes et al.,
1988).
Um die cTZR-vermittelte T-Zellantwort in diesem System zu untersuchen wurden im
Rahmen dieser Arbeit PHH mit HBV-Partikeln infiziert, die mit der stabil transfizierten
HepG2.2.15-Zelllinie produziert wurden. Dies führte zu einer produktiven Infektion, die
alle Aspekte der natürlichen HBV-Infektion wiederspiegelte (Schulze-Bergkamen et al.,
2003).
Dabei
wurde
auch
die
Etablierung
eines
Pools
der
episomalen
Replikationsmatritze cccDNA nachgewiesen. Bei dieser in vitro Infektion werden
Effizienzen von bis zu 15-20% HBV-infizierter PHH erreicht, die mehrere Wochen
kultiviert und analysiert werden können (Schulze-Bergkamen et al., 2003). Da in
diesem System die Mehrheit der Hepatozyten nicht HBV-infiziert ist, eignet es sich gut
um die Spezifität der cTZR-tragenden T-Zellen zu untersuchen.
Für die Charakterisierung der Immunantwort auf HBV-infizierten Zielzellen wurden
hohe E:T Ratios von 2:1 eingesetzt und die Inkubationszeit auf 96 h ausgedehnt. Diese
Parameter ergaben sich aus Vorversuchen, in welchen die Zytotoxizität stark verzögert
war. Um die Elimination der HBV-infizierten PHH zu quantifizieren, wurden die
Mengen des Hepatozyten-spezifischen Enzyms Alanin Aminotransferase (ALT) im
77
Diskussion
Zellkulturmedium ermittelt. Dieses wird von apoptotischen Hepatozyten freigesetzt und
dient in der Klinik zur Ermittlung der Leberwerte und ermöglicht eine Aussage über die
Schädigung
des
Organs.
In
Kokulturen
von
HBV-infizierten
PHH
und
rezeptormodifizierten T-Zellen wurden stark erhöhte ALT-Werte als Folge einer
zytotoxischen T-Zellantwort gemessen. Für den HBV S-Protein spezifischen αS-C8TZR waren die Werte 3-fach und für den HBV-L spezifischen αL-5a19-TZR 2,2-fach
erhöht. Obwohl in diesen PHH Kulturen nur eine geringe Anzahl an Hepatozyten mit
HBV infiziert sind liegen große Mengen an viralen und subviralen HBV-Partikeln (350
ng/ml HBsAg) im Medium vor. Dies könnte eine unspezifische Aktivierung der cTZRtragenden T-Zellen bewirken. Um eine Aussage über den Gesamtzustand der
Hepatozyten zu treffen, wurde die intrazellulären Albuminmengen als leberspezifischer
Marker quantifiziert. Dies ergab nur eine geringe Erniedrigung der Albuminmengen in
Ansätzen mit cTZR-tragenden T-Zellen (16-17% für αS-C8, 10-14% für αL-5a19).
Albumin wurde verwendet, weil dessen Synthese im Gegensatz zu z.B. β-Actin
Hepatozytenspezifisch
ist.
Dadurch
werden
die
vorhandenen
10-20%
nicht-
parenchymalen Leberzellen ausgeschlossen, die in diesen Präparationen vorhanden
sind aber keine HBV-Infektion unerstützen und demnach auch nicht eliminiert werden
(Schulze-Bergkamen et al., 2003).
3.7.1 Charakterisierung der eliminierten Hepatozyten
Um zu untersuchen, welche Hepatozyten durch diese Zytotoxizität betroffen sind,
wurden intrazelluläre Marker des HBV-Replikationszyklus untersucht und verglichen. In
HBV-infizierten PHH liegen zwei unterschiedliche Formen der zirkulären HBV-DNA vor:
Im Zellkern befindet sich die doppelsträngige episomale cccDNA. Im Zytoplasma
dagegen wird die prägenomische RNA in Kapside verpackt und zur partiell
einzelsträngigen rcDNA revers transkribiert. Um zwischen diesen beiden DNA-Formen
unterscheiden zu können, wurden spezifische Oligonukleotidprimer verwendet, um die
intrazellulären Mengen der HBV DNAs mit quantitativer Light Cycler© PCR zu
ermitteln. Die rcDNA Mengen waren in Relation zur αCEA-Kontrolle für αS-C8 um bis
zu 82% und für αL-5a19 um bis zu 72% vermindert.
Im Vergleich zu der geringen Änderung der Albuminmengen, zeigten Untersuchungen
des intrazellulären Kapsid-Proteins ebenfalls eine deutliche Erniedrigung von bis zu
73% für αS-C8 und 57% αL-5a19. Diese Daten deuten auf eine spezifische Elimination
infizierter PHH durch HBV-spezifische cTZR-tragenden T-Zellen hin.
78
Diskussion
3.7.2 Charakterisierung der T-Zellantwort
Das Hauptziel einer erfolgreichen HBV-Therapie ist die Elimination der episomalen
cccDNA da diese, nach einer antiviralen Therapie einen neuen Replikationszyklus
initiieren kann (Protzer and Schaller, 2000). Die ermittelten Konzentrationen der
nukleären cccDNA zeigten mit um 98% erniedrigten Werten für αS-C8 und 82% für αL5a19 einen noch stärkeren Effekt im Vergleich zur zytoplasmatischen rcDNA. Dies
könnte auf eine Degradation durch DNAsen hinweisen, die bei der Induktion der
Zielzellapoptose
durch
die
Procaspasen
3
und
7
aktiviert
werden.
Die
caspaseaktivierte DNAse (CAD) wird durch proteolytische Entfernung des Inhibitor ICAD aktiviert. CAD kann daraufhin in den Nukleus translozieren und die genomische
DNA degradieren (Enari et al., 1998). Sollte dieser Mechanismus in den gezeigten
Experimenten stattfinden, würde die Degradation der nukleären DNA auch die
cccDNA, nicht aber die zytoplasmatische in Kapsiden verpackte rcDNA betreffen und
die ermittelten Unterschiede erklären.
Um dies zu untersuchen wurde die Aktivierung der Caspasen 3 und 7 in Kokulturen
rezeptormodifizierter T-Zellen und HBV-infizierter PHH quantifiziert. Für beide HBVspezifischen cTZR wurde eine deutliche Aktivierung der Caspasen gemessen. Dabei
wurde aber für den HBV S-Protein spezifischen aS-C8 TZR eine 3,5-fache Steigerung
und für den HBV-L-Protein spezifischen aL-5a19-TZR eine 1,7-facher Steigerung
ermittelt. Das Verhältnis dieser Werte entspricht nicht den Unterschieden der cccDNAElimination zwischen den cTZR. Dies könnte bedeuten, daß die Elimination durch
Caspase-aktivierte DNAsen ebenfalls einem Schwellenwert unterliegt. Grundsätzlich
scheinen die proapoptotischen Effektorcaspasen 3 und 7 durch Antigenerkennung der
rezeptortragenden
T-Zellen
aktiviert
zu
werden
und
an
der
Induktion
der
Zielzellapoptose beteiligt zu sein.
Daher wurde die Beteiligung der Effektorcaspasen 3 und 7 genauer untersucht, indem
Kokulturen HBV-spezifischer T-Zellen und HBV-replizierenden HepG2.2.15-Zellen mit
verschiedenen Caspaseinhibitoren behandelt wurden. Die Inhibitoren Z-VAD und
DEVD wurden eingesetzt, wobei Z-Vad ein Pancaspaseinhibitor ist und unspezifisch
die ganze Caspase-Familie inhibiert. DEVD dagegen inhibiert spezifisch die Caspase 3
durch seine obligatorische Aminosäuresequenz. Der Einfluß der Caspaseinhibitoren
auf die vermittelte Zytotoxizität wurde im Vergleich zu einer unbehandelten
zytotoxischen und einer unspezifischen nicht-zytotoxischen Kokultur ermittelt und auf
die jeweils inhibierten Enzyme bezogen. Dabei zeigte sich, daß eine Inhbition der
Caspase 3 durch DEVD die induzierte Zytotoxizität um bis zu 50% inhibierte, aber nur
der Pancaspaseinhibitor Z-VAD eine fast vollständige Inhibition von 92% bewirkte. Dies
legt eine starke Beteiligung der Caspase 3 an der antigenspezifischen Zytotoxizität
79
Diskussion
nahe, zeigt aber auch, daß weitere Effektorcaspasen beteiligt sein müssen. Im
Gegensatz dazu wurde auch eine Beteiligung der Caspase 3 an verschiedenen
Aktivierungs- und Proliferationsprozessen in der T-Zellantwort beschrieben (Kennedy
et al., 1999). Dementsprechend könnte eine Inhibition der Caspasen auch zu einer
Hemmung der antigenspezifischen Aktivierung der T-Zelle führen, die ebenfalls in einer
Verringerung der Zytotoxizität resultieren könnte.
3.7.3 Apoptoseinduktion
Ein weiterer Vorgang, der zur Apoptoseinduktion in den Zielzellen führen kann ist die
Interaktion des Fas-Liganden (CD95-L) auf der zytotoxischen T-Zelle mit dem FasRezeptor (CD95) auf der Zielzelle. Dies führt zu einer Konformationsänderung und zur
Rekrutierung des Adaptorproteins FADD, das eine Todesdomäne (death domain, DD)
besitzt. Dieses aktiviert die Procaspase 8, die wiederum Procaspase 3 aktiviert,
wodurch die Apoptose induziert wird. Neben der Fas-vermittelten Apoptose während
der T-Zellantwort, besitzt Fas auch eine wichtige Rolle in der positiven und negativen
Regulation der T-Zellantwort selbst. Es konnte gezeigt werden, daß Fas sowohl für ein
aktivierendes Signal nach der Antigenerkennung als auch für die Apoptose der
aktivierten T-Tellen verantwortlich ist, wodurch eine zu intensive T-Zellantwort reguliert
wird (Suzuki and Fink, 2000).
Eine häufig in transformierten Tumorzellen auftretende Mutation betrifft die Expression
des Fas-Rezeptors oder von Elementen der Fas-Signalkaskade. Dadurch wird eine
Elimination, zum Beispiel durch natürliche Killerzellen (NK) verhindert, wodurch ein
Selektionsvorteil entsteht (Lee et al., 2001; Volkmann et al., 2001). Durch die Fasvermittelte Apoptose kann die Entstehung eines Tumors verhindert wedren (Screpanti
et al., 2005). Es ist bekannt, daß durch IFNγ das von aktivierten T-Zellen sekretiert
wird, eine Steigerung der Fas-Expression vermittelt werden kann und Zielzellen
dadurch empfindlicher für die Apoptoseinduktion werden (Mullbacher et al., 2002). Da
in den durchgeführten Experimenten eine massive Steigerung der IFNγ-Sekretion nach
antigenspezifischer Aktivierung beobachtet wurde, sollte dieser Effekt untersucht
werden.
In
dieser
Arbeit
wurde
die
zytotoxische
T-Zellantwort
gegen
Hepatomazielzelllinien charakterisiert, die gegen eine Apoptoseinduktion mit anti-FasAntikörpern unempfindlich sind. Dies weist auf eine fehlende oder nicht funktionelle
Signalkaskade des Fas-Rezptors hin. Aus diesem Grund wurde versucht, Unterschiede
in der Expression des Fas-Rezeptors (CD95) in Kokulturen mit primären humanen
Hepatozyten zu charakterisieren, die keine solche Mutation tragen sollten.
In Western Blot Analysen wurde die Expression des Fas-Rezeptors (CD95) gegen das
konstitutiv exprimierte β-Actin verglichen. Dabei konnten jedoch keine Veränderungen
80
Diskussion
im Expressionsmuster des CD95-Rezeptors festgestellt werden. Dies deutet darauf
hin, daß die vorhandenen CD95-Level ausreichend sind und nicht reguliert wurden
oder die ermittelte Elimination ohne CD95-aktivierte Apoptoseinduktion stattfindet.
3.7.4 HBV-Antigensekretion
HBV-infizierte PHH sekretierten bis zu 350 ng/ml an HBV-Hüllproteinen (HBsAg) und
bis zu 26 ng/ml des singulären HBeAg. In chronisch infizierten Patienten wurden
dagegen zwischen 10 und 100 µg/ml HBsAg im Serum gemessen (Wursthorn et al.,
2006).
Unter
dem
Begriff
HBsAg
sind
die
verschiedenen
HBV-Hüllproteine
zusammengefasst, die von der Zelle in Form von viralen und subviralen Partikeln
sekretiert werden (Bruss and Ganem, 1991). Diese werden von subgenomischen
RNAs translatiert und dienen als Marker für die Produktion von Nachkommenviren.
HBeAg ist eine modifizierte Variante des Kapsid-Proteins und wird im Unterschied zum
HBsAg, von der prägenomischen RNA translatiert (Jean-Jean et al., 1989). Es wird als
singuläres Protein von HBV-infizierten Zellen sekretiert und gibt Aufschluß über die
Transkriptionsaktivität der episomalen cccDNA. Eine Funktion des HBeAg als
Tarnmechanismus wird diskutiert, da dieses Antigen die Epitope des Kapsidproteins
beinhaltet, gegen welches hochpotente humorale und adaptive Immunantworten
generiert
werden
(Penna
et
al.,
1991).
Außerdem
scheint
es
an
der
Toleranzentwicklung von T-Zellen beteiligt zu sein (Milich et al., 1993). Den subviralen
Partikeln wird ebenfalls ein Schutzmechanismus zugeschrieben, da sie mit ihrer
großen Zahl neutralisierende Antikörper abfangen und die infektiösen Dane-Partikel
vor einer Antikörpererkennung schützen könnten (Rehermann and Nascimbeni, 2005).
Die Mengen an HBs- und HBeAg zeigten hohe Werte in den Kontrollen mit
unspezifischen cTZR oder unbehandelten T-Zellen. Die beiden HBV-spezifischen TZellrezeptoren führten dagegen zu einer schwachen aber deutlichen Erniedrigung der
sekretierten HBV-Antigene. Es wird davon ausgegangen, daß durch die langen
Inkubationszeiten eine Akkumulation dieser Antigene im Zellkulturmedium ermöglicht
wurde. Somit besitzt die langsame und späte zytotoxische Elimination der HBVinfzierten PHH nur einen geringen Einfluß auf die Sekretion dieser Antigenmengen
oder die Lysis der Zielzellen führt zu einer Freisetzung der intrazellulären Proteine. Die
hohen gemessenen Mengen an freiem HBV-Antigen führten allerdings zu keiner
Blockade der cTZR-vermittelten Immunantwort, wie in den Experimenten mit HBVinfizierten PHH gezeigt werden konnte.
Chimäre T-Zellrezeptoren die gegen karzinoembryonisches Antigen (CEA) oder das
gp120 des HIV-1 gerichtet sind, binden zwar monomere Antigene, werden dadurch
aber nicht aktiviert (Hombach et al., 1999; Masiero et al., 2005). Im Gegensatz zu
81
Diskussion
monomeren Proteienen liegen die löslichen HBV-Antigene in partikulärer Form als
virale oder subvirale Partikel vor. Für die Aktivierung einer T-Zelle, durch Ausbildung
der immunologischen Synapse, wird eine Zell-Zell-Kontaktzone zur Akkumulierung
(Clustering) mehrerer CD3-MHC-Interaktionen benötigt (Kolanus et al., 1993). Eine
entsprechende Interaktion der cTZR, möglicherweise zusammen mit endogenen TZR,
muß auch hier stattfinden. Da ein gebundener HBV-Partikel diese minimale Fläche zur
Verfügung stellen könnte, wurde die Aktivierung durch Viruspartikel untersucht.
In
diesem
Experiment
wurden
rezeptortragende
T-Zellen
mit
HBV-haltigem
Mediumüberstand von virusproduzierenden Zellen inkubiert. Dabei konnte eine
sechsfache Steigerung der IFNγ-Sekretion für den HBV S-Protein spezifischen und
eine dreifache Steigerung für den HBV L-Protein spezifischen T-Zellrezeptor gezeigt
werden. Dies deutet darauf hin, daß eine für die Aktivierung ausreichende
Kontaktfläche durch die HBV-Partikel zur Verfügung gestellt wird. Eine Vermittlung
dieses Effektes durch Plastikadhärenz der Viruspartikel konnte ausgeschlossen
werden. Demnach wird die Aktivierung durch die immunologische Synapse nicht durch
eine Plastikoberfläche die mit adhärierten HBV-Partikeln besetzt ist initiiert, sondern
wird in direkter Interaktion mit den Viruspartikeln aufgebaut.
Eine Aktivierung durch lösliche HBV-Partikel könnte im HBV-infizierten Organismus zu
unerwünschten Nebenwirkungen führen, da große Mengen von Viruspartikeln im Blut
zirkulieren und zu einer unspezifischen und fatalen T-Zellantwort führen könnten. Um
zu untersuchen, ob eine solche Aktivierung durch freie HBV-Partikel auch zur
Elimination HBV-negativer Zellen führen kann, wurden Hepatomazellen und eine
humane Zervikalepithelkarzinomzelllinie mit HBV-haltigem Zellkulturüberstand inkubiert
und anschliessend mit rezeptortragenden T-Zellen kokultiviert. Auf Hepatomazellen
wurde eine deutliche IFNγ-Sekretion nach Kontakt mit den eigentlich HBV-negativen
Zielzellen durch rezeptortragende T-Zellen vermittelt. Dies zeigt, daß HBV-Partikel an
die Oberfläche dieser Zellen adhärieren können und durch Waschen nicht entfernt
werden. In Kokulturen mit HeLa-Zellen kam es dagegen zu keiner IFNγ-Sekretion
durch die rezeptortragenden T-Zellen. Die Partikel scheinen nur an Hepatomazellen zu
adhärierenden und dadurch eine Aktivierung der T-Zellen zu stimulieren. Diese
Aktivierung durch lösliche HBV-Partikel schien keine unspezifische Zytotoxizität zu
verursachen, weshalb eine Inhibition bei der Anwendung dieses Systems durch große
Viruslasten im Serum vernachlässigbar scheint.
3.8 NFκB Aktivierung
In der natürlichen T-Zellantwort kommt es nach der Antigenerkennung durch den TZellrezeptorkomplex zu einer komplexen Signalkaskade, die verschiedene Prozesse
82
Diskussion
induziert und reguliert. Dies führt zu einer Aktivierung der Transkriptionsfaktoren NFκB,
NFAT und AP-1, die daraufhin in den Zellkern translozieren (Jamieson et al., 1991).
Dadurch wird die transkriptionelle Aktivierung spezifischer Gene ausgelöst und die
Proliferation und
Differenzierung der T-Zellen eingeleitet. Zusätzlich führt dieses
Signal zu einer Induktion der Transkriptionsaktivität von Zytokinen, wodurch deren
Sekretion gesteuert wird. Um die Funktionalität dieser Signalkaskade nach
Antigenerkennung des chimären T-Zellrezeptors einschätzen zu können, wurde die
terminale Aktivierung von NFκB untersucht. Hierzu wurden cTZR-exprimierende TZellen mit löslichen HBV-Partikeln inkubiert und deren Aktivierung untersucht. In dem
dafür verwendeten elektrophoretischen Mobilitätsshiftassay werden nukleäre Proteine
mit
einem
radioaktiv
markierten
Oligonukleotid
inkubiert,
das
die
Konsensusbindesequenzen für aktiviertes NFκB enthält. Diese Sequenzen stammen
aus den LTR-Promotorsequenzen des HIV-1, der seine Genregulation an diesen
Transkriptionsfaktor adaptiert hat. Das bewirkt, daß die aktivierenden Signale der TZelle auf die Transkriptionsregulierung der HIV Gene übertragen werden (Duh et al.,
1989; Tong-Starkesen et al., 1989).
Die Auswertung zeigte für αS-C8 TZR eine 2,5-fache NFκB-Aktivierung normalisiert
zur Kontrolle mit unspezifischem αCEA TZR. Für αL-5a19 dagegen wurde nur eine
minimale 1,9-fache Aktivitätssteigerung im Vergleich zu αCEA ermittelt. Außerdem
konnte in den Kontrollansätzen mit T-Zellen die einen unspezifischen cTZR
exprimierten trotzdem eine HBV-bedingte NFκB-Aktivierung beobachtet werden. Da
dieser Effekt in HBV-negativen Ansätzen nicht vorhanden war, deutet er auf einen
cTZR-unabhängigen Aktivierungsprozess der T-Zellen oder der geringen Mengen an
enthaltenen dendritischen Zellen und Makrophagen hin. Dabei könnte von den HBVPartikeln durch Mustererkennung der Toll-like Rezeptoren (TLR) des angeborenen
Immunsystems ebenfalls ein NFκB-aktivierendes Signal ausgelöst werden.
TLR wurden ursprünglich auf Zellen des angeborenen Immunsystems, wie
Makrophagen und NK-Zellen entdeckt, doch kürzlich auch auf T-Zellen beschrieben
(Caron et al., 2005; Liu et al., 2006; Xu et al., 2005). In entsprechenden Experimenten
konnte eine Aktivierung von CD4+ Erinnerungs-T-Zellen durch Aktivierung von TLR5
und TLR7/8 gezeigt werden, die zur proliferativen Expansion und zur Sekretion von
IFNγ führt (Caron et al., 2005). Außerdem wurde neben der Erkennung mikrobieller
Muster, auch eine TLR-Aktivierung auf T-Zellen durch die Präsenz viraler Partikel
gezeigt (Kurt-Jones et al., 2000).
83
Diskussion
3.9 Ausblick
Neben der Elimination stabil HBV-replizierender Hepatomazellen konnte auch eine
spezifische Zielzelllsysis HBV-infizierter primären Hepatozyten gezeigt werden wobei
eine fast vollständige Beseitigung der nukleären episomalen Transkriptionsmaritze
cccDNA beobachtet werden konnte. Eine Beseitigung der cccDNA wird allgemein als
wichtiger Schritt in einer erfolgreichen Therapie gegen die chronische Hepatitis B
angesehen (Protzer and Schaller, 2000). Außerdem wird eine aktivierungsbedingte
Sekretion der Zytokine IFNγ und IL-2 initiiert. Die Sekretion von IL-2 löste eine
Expansion der T-Zellen aus,
die eine Grundvoraussetzung für eine erfolgreiche
Repopulation in immundepletierten Patienten darstellt. Sowohl die Zytokinsekretion als
auch die zytotoxische Elimination hingen stark von der eingesetzten Zahl der
Effektorzellen und von der Verfügbarkeit des Antigens ab. An der spezifischen
Elimination der Zielzellen scheint eine Apoptoseinduktion durch Degranulation lytischer
Granuolen beteiligt zu sein.
Außerdem konnten relativ niedrige E:T-Ratios durch
verlängerte Kokulturzeiten etabliert werden, die dadurch den natürlichen Verhältnissen
einer T-Zellantwort besser entsprechen. Insgesamt scheint eine Rezeptormodifikation
mit chimären TZR-Konstrukten ein vielversprechender Ansatz für die Unterstützung der
schwachen und inefizienten T-Zellantwort chronisch HBV-infizierter Patienten zu sein.
Um dieses System in vivo zu untersuchen, werden murinisierte cTZR-Konstrukte
hergestellt, die in HBV-transgenen Mausmodellen durch adoptiven T-Zelltransfer auf
ihre Funktionalität hin untersucht werden sollen. Dabei können keimbahntransgene
oder durch einen Adenovirus transduzierte HBV-positive Mäuse verwendet werden. In
diesen Mausmodellen kann sowohl die akute (Adenovirus) als auch die chronische
(Keimbahn) Hepatitis B Infektion nachgestellt werden (Chisari et al., 1985; Sprinzl et
al., 2001). Sie eignen sich als System für die Untersuchung der verschiedenen Aspekte
und Aufgaben einer effektiven Immunantwort. In einem weiteren Ansatz soll in einem
immundeffizienten SCID-Mausmodell die Leber mit humanen Hepatozyten repopuliert
werden, die mit HBV infizierbar sind (Meuleman et al., 2005). In diesen Mäusen könnte
das bereits in vitro charakterisierte humane T-Zellsystem in vivo untersucht werden.
Diese Systeme sind nur indirekt mit der humanen Krankheitsituation zu vergleichen.
Dennoch würden solche Experimente Aufschluss über die Funktionalität des adoptiven
T-Zelltransfers im Kontext des gesamten Organismus liefern. Es könnten Aussagen
über das Ausmaß der Elimination HBV-infizierter Zellen getroffen werden und
eventuelle Nebenwirkungen eingegrenzt werden.
84
Material und Methoden
4 Material und Methoden
4.1 Biotisches und abiotisches Material
Für die Herstellung aller Lösungen wurde deionisiertes Wasser aus dem Ultra Pure
Water System „Easy Pure UV/UF“ von Barnstead Reinstwassersystem verwendet.
Dabei gilt Wasser ab einem Wiederstand von 16 Mega Ohm als vollentsalzt und ist mit
doppelt destiliertem Wasser vergleichbar.
4.1.1 Verbrauchsmaterial
ELISA 96-Well-Platten
Maxisorb, Nunc, Wiesbaden, Deutschland
Einfrierhilfe
Nalgene, Nunc, Wiesbaden, Deutschland
Einmalpipetten
Sarstedt, Nümbrecht, Deutschland
FACS-Röhren
Nunc, Wiesbaden, Deutschland
Filme
Biomax MR-Film, Kodak, Deutschland
Filterpapier
Whatman 3MM, Biometra, Göttingen, Deutschland
Cryo-Gefriergefäße
Nunc, Wiesbaden, Deutschland
Küvetten
Sarstedt, Nümbrecht, Deutschland
Nylonmembran
Roche Diagnostics, Mannheim, Deutschland
PVDF-Membran
Amersham, Little Chalford, Großbritannien
Pipettenspitzen
Starlab GmbH, Ahrensburg, Deutschland
Reaktionsgefäße
Eppendorf, Hamburg, Deutschland
Zellkulturflaschen
Nunc, Wiesbaden, Deutschland
Zellkulturschalen
Nunc, Wiesbaden, Deutschland
Zellsieb (Cellstrainer)
Nunc, Wiesbaden, Deutschland
Zentrifugenröhren (15/50 ml)
Falcon, BD GmbH, Heidelberg, Deutschland
4.1.2 Chemikalien
Acrylamid
Sigma, Deisenhofen, Deutschland
Agarose
SeaKem LE, Cambrex, Rockland, USA
Ammoniumpersulfat
Roth, Karlsruhe, Deutschland
Bromphenolblau
Merck, Darmstadt, Deutschland
BSA (Bovines Serumalbumin)
Serva, Heidelberg, Deutschland
Coomassie
Serva, Heidelberg, Deutschland
DMSO
Merck, Darmstadt, Deutschland
EDTA
Roth, Karlsruhe, Deutschland
Entwickler
G153 A + B, Agfa, Deutschland
Essigsäure
Roth, Karlsruhe, Deutschland
85
Material und Methoden
Ethidiumbromid
Merck, Darmstadt, Deutschland
Ethanol
Roth, Karlsruhe, Deutschland
Fixierer
G354, Agfa, Deutschland
Formaldehyd
Roth, Karlsruhe, Deutschland
Glycerin
Roth, Karlsruhe, Deutschland
Glycin
Roth, Karlsruhe, Deutschland
Glucose
Sigma, Deisenhofen, Deutschland
Glutaraldehyd
Sigma, Deisenhofen, Deutschland
Hefeextrakt
BD Microbiology Systems, Sparks, USA
Imidazol
Merck, Darmstadt, Deutschland
Isopropanol
Roth, Karlsruhe, Deutschland
Kaliumacetat
Merck, Darmstadt, Deutschland
Kaliumchlorid
Merck, Darmstadt, Deutschand
Kaliumdihydrogenphosphat
Roth, Karlsruhe, Deutschland
Kollagen
Serva, Heidelberg, Deutschland
Methanol
Roth, Karlsruhe, Deutschland
Milchpulver
Sigma, Deisenhofen, Deutschland
Natriumacetat
Merck, Darmstadt, Deutschland
Natriumchlorid
Roth, Karlsruhe, Deutschland
Natriumdihydrogenphosphat
Roth, Karlsruhe, Deutschland
Natriumdodecylsufat (SDS)
Merck, Darmstadt, Deutschland
Natriumhydroxid
Roth, Karlsruhe, Deutschland
Nickelsulfat
Sigma, Deisenhofen, Deutschland
Polyethylenglykol 8000 (PEG)
Sigma, Deisenhofen, Deutschland
Ponceau
Sigma, Deisenhofen, Deutschland
Propidiumjodid
Molecular Probes, Leiden, Niederlande
Saccharose
Sigma, Deisenhofen, Deutschland
Salzsäure
Roth, Karlsruhe, Deutschland
SDS
Roth, Karlsruhe, Deutschland
TEMED
Sigma, Deisenhofen, Deutschland
Tetramethylbenzidin
Biosource, Camarillo, USA
Tris-Base
Roth, Karlsruhe, Deutschland
Tris-HCl
Roth, Karlsruhe, Deutschland
Tween20
Roth, Karlsruhe, Deutschland
86
Material und Methoden
4.1.3 Kits
Aufreinigung von DNA
1. PCR Purification Kit, Qiagen, Hilden,
Deutschland
2. MinElute PCR Purification Kit, Qiagen, Hilden,
Deutschland
3. DNeasy Tissue Kit, Quiagen, Hilden,
Deutschland
Caspaseaktivierung
Caspase-Glo™ Assay, Promega, Madison, USA
Caspase Inhibitoren
Z-Vad/DEVD, Alexis, Lausen, Schweiz
DNA-Geleextraktion
QIAquick, Qiagen, Hilden, Deutschland
LIVE/DEAD-Assay
Invitrogen, Karlsruhe, Deutschland
Präparation von Plasmiden
QIAprep Miniprep, Maxiprep, EndoFree Maxiprep
Kit, Qiagen, Hilden, Deutschland
PCR Reaktionsmix
PuReTaq Ready-to-go PCR Beads, Amersham
Pharmacia, Buckinghamshire, England
Real time PCR
DNA Amplification Kit SYBR® Green 1 und Light
Cycler® Capillaries (20µl), Roche Diagnostics,
Mannheim, Deutschland
Transfektion von Zellen
FuGENE 6®, Transfection Reagent, Roche
Diagnostics, Mannheim, Deutschland
Polyfect® Transfection Reagent, Quiagen, Hilden,
Deutschland
Calcium Phosphate Transfection Kit, Sigma, Saint
Louis, USA
ELISA
1. Murex HBsAg Version 3, Abbott, Wiesbaden,
Deutschland
2. HBeAg-EIA, Axiom, Bürstadt, Deutschland
3. Human IFN-γ and IL-2 Cytosets™, Biosource,
Camarillo, USA
Viabilitätstest
XTT Cell Proliferation Kit II, Roche Molecular
Biochemicals, Mannheim, Deutschland
Western Blot
1. ECL Western Blotting Detection Reagent
Amersham Bioscience, Buckinghamshire, England
2. Enhanced Chemilumineszenz, Pierce,
Rockford, USA
87
Material und Methoden
4.1.4 Medien und Medienzusätze
4.1.4.1 Zellkultur
Dulbeccos MEM
Biochrom AG, Berlin, Deutschland
Dymethylsulfoxid (DMSO)
Merck, Darmstadt, Deutschland
Fötales Kälberserum (FCS)
Biochrom AG, Berlin, Deutschland
Glutamin
Gibco BRL, Eggenstein, Deutschland
HEPES
Gibco BRL, Eggenstein, Deutschland
Natriumpyruvat
Biochrom AG, Berlin, Deutschland
Nicht essentielle Aminosäuren
Biochrom AG, Berlin, Deutschland
Williams Medium E
Gibco BRL, Eggenstein, Deutschland
Heparin
Liquemin N 25000, Roche, Mannheim,
Deutschland
4.1.4.2 Antibiotika
Gentamycin
Gibco BRL, Eggenstein, Deutschland
Penicillin/Steptomycin
(Pen/Strep) Biochrom AG, Berlin, Deutschland
Geniticin (Neomycin)
(G418), Invitrogen, Karlsruhe, Deutschland
Phleomycin
Sigma-Aldrich, Schnelldorf, Deutschland
4.1.4.3 Primäre humane Hepatozyten
Präperfusions Medium:
HBSS (Ca/ Mg-frei)
500 ml Gibco BRL, Eggenstein, Deutschland
EGTA (100mM)
2,5 ml Sigma, Deisenhofen, Deutschland
Heparin (5000U/ml)
1 ml Roche, Mannheim, Deutschland
Collagenase Medium:
Williams Medium E
250 ml Gibco BRL, Eggenstein, Deutschland
CaCl2 (1M)
0,9 ml Gibco BRL, Eggenstein, Deutschland
Gentamycin (10 mg/ml)
2,5 ml Gibco BRL, Eggenstein, Deutschland
Collagenase TypIV (419 U/mg)
200 mg Lot 88H8620 Sigma, Deisenhofen,
Deutschland
Wasch Medium:
Williams Med E
500 ml Gibco BRL, Eggenstein, Deutschland
*Glutamin (200mM)
5,6 ml Biochrom AG, Berlin, Deutschland
*Glucose (5%)
6 ml Gibco BRL, Eggenstein, Deutschland
*Hepes (1M, pH 7,4)
11,5 ml Gibco BRL, Eggenstein, Deutschland
*Pen/Strep (5000U/ml)
5,6 ml Biochrom AG, Berlin, Deutschland
(*Die Lösungen wurden gemischt und bei –20°C als Prämix gelagert)
88
Material und Methoden
PHH Medium (Wasch-Medium mit folgenden Additiva):
Gentamycin (10mg/ml)
5 ml Gibco BRL, Eggenstein, Deutschland
Hydrocortison
0,5 ml Sigma, Deisenhofen, Deutschland
Insulin
1,4 ml Serva, Heidelberg, Germany
DMSO (100%)
8,7 ml Roth, Karlsruhe, Deutschland
Inosine (82,5mg/ml)
2 ml Serva, Heidelberg, Germany
4.1.4.4 Primäre humane Blutlymphozyten
VLE RPMI
Biochrom AG, Berlin, Deutschland
Anti human CD3 AK (OKT3)
Janssen-Cilag, Neuss, Deutschland
Rekombinantes humanes IL-2
Proleukin, Chiron, Munich, Germany
4.1.4.5 Retrovirusproduktion
Chloroquin
Sigma-Aldrich, Schnelldorf, Deutschland
Polybrene
Sigma-Aldrich, Schnelldorf, Deutschland
RetroNectin™
Takara, Shiga, Japan
4.1.4.6 Bakterienkultur
Ampicillin
Sigma, Deisenhofen, Deutschland
LB-Medium (pH 7.0)
NaCl (5 g/l), Hefeextrakt (5 g/l), Bactotrypton (10
g/l)
SOB-Medium (pH 7.0)
NaCl (0,5 g/l), Hefeextrakt (5 g/l), Bactotrypton (20
g/l), MgSO4 (5 g/l), KCl (0,186 g/l)
SOC-Medium (pH 7.0)
SOB-Medium, 20 mM Glukose
4.1.5 Enzyme
Restriktionsendonukleasen
Fermentas, St. Leon Rot, Deutschland
T4-DNA Ligase
Roche Diagnostics, Mannheim, Deutschland
Klenow Enzym
Roche Diagnostics, Mannheim, Deutschland
Alkalische Phosphatase
Roche Diagnostics, Mannheim, Deutschland
89
Material und Methoden
4.1.6 Oligonukleotide
Amplifikationsprimer:
C8KappaL (+)
5’ CGTACCATGGATTTTGAGGTGCAGATTTTCAGCTTCCTGC
TAATCAGTGCCTCAGTCATAATGTCTAGAATGGCGGAGGTG
CAGCTGGTG 3’
C8rev (-)
5’ CACAGATCTCCAGCGGCCGCAGAGGAG 3’
5a19 KappaL (+)
5’ CGTACCATGGATTTTGAGGTGCAGATTTTCAGCTTCCTGC
TAATCAGTGCCTCAGTCATAATGTCTAGAATGGCGCAGGTG
CAGCTGAAG 3’
5a19rev (-)
5’ TGTATCCGCGGCCGCTGGAGATCTGTG 3’
Sequenzierungsprimer:
Kappa leader (+)
5´ CCCTCAAAGTAGACGGCATC 3´
C8 (+)
5´ CCAAGAACACGCTGTATCTGC 3´
C8 (-)
5´ GTTGTTTCCCCCACAGGTAA 3´
C9 (+)
5´ CGCCATCTCCAGAGACACTT 3´
C9 (-)
5´ TCATAGACGACCAGCACAGG 3´
5a19 (+)
5´ CCCTGTACCTGGAAATGACC 3´
5a19 (-)
5´ ATCTGTCCCAGATCCACTGC 3´
FC (-)
5´ GGGGGAAGAGGAAGACTGAC 3´
FC (+)
5´ GCCCAAATCTCCTGACAAAA 3´
FC2 (-)
5´ CACGGTGAGCTTGCTGTAGA 3´
FC2 (+)
5´ TGACCAAGAACCAGGTCAGC 3´
TM/IC (-)
5´ TTCGTCCTAGATTGAGCTCGT 3´
TM/IC (+)
5´ TGCCTTGTTCCTGAGAGTGA 3´
TM/IC2 (+)
5´ GGTGGAGTCCTGGCTTGC 3´
ENDE (-)
5´ TGAGTCAAAACTAGAGCCTGGA 3´
Primer für quantitative Light Cycler RT-PCR:
Nachweis der HBV cccDNA:
cccDNA (92)
5´ GCCTATTGATTGGAAAGTATGT 3´
cccDNA (2251)
5´ AGCTGAGGCGGTATCTA 3´
Nachweis der HBV rcDNA:
HBV (1844)
5´ GTTGCCCGTTTGTCCTCTAATTC 3´
HBV (1745)
5´ GGAGGGATACATAGAGGTTCCTTGA 3´
90
Material und Methoden
Nachweis der mitochondriellen DNA:
mito 8686 (+)
5´ CCCTCTCGGCCCTCCTAATAACCT 3´
mito 8796 (-)
5´ GCCTTCTCGTATAACATCGCGTCA 3´
aus (Wieland et al., 2004)
4.1.7 Gewichts- und Längenstandards
DNA – Standard
SmartLadder, 0,2-10 kb
Eurogentec, Liege, Belgien
SmartLadder, 0,1-2 kb
Eurogentec, Liege, Belgien
Protein – Standard
Prestained Protein ladder
Invitrogen, Karlsruhe, Deutschland
4.1.8 Antikörper
Primäre Antikörper:
Ziege anti HBsAg
Fitzgerald Industries, Concord, USA
Maus anti HBsAg
IBT, Reutlingen, Deutschland
Ziege anti HBsAg
IBT, Reutlingen, Deutschland
Maus anti HBsAg
DAKO, Carpinteria, USA
Hase anti HBV-Kapsid (H800)
Eigenproduktion
Hase anti human Albumin
DAKO, Carpinteria, USA
Maus anti β-Aktin
Sigma, Deisenhofen, Deutschland
Maus anti human CD3 (PE)
Molecular Probes, Leiden, Niederlande
Maus anti Human CD3 (FITC)
Klon UCHT1, Dako Carpinteria, USA
Anti Human CD3 (PE)
Immunotools, Friesoythe, Deutschland
Anti Human CD4 (PE)
Immunotools, Friesoythe, Deutschland
Anti Human CD4 (FITC)
Immunotech, Paris, France
Anti Human CD8 (FITC)
Immunotools, Friesoythe, Deutschland
Anti Human CD8 (PE)
Immunotech, Paris, France
Anti Human CD11b (FITC)
Miltenyi, Bergisch Gladbach, Deutschland
Anti Human CD14 (PE)
Immunotech, Paris, France
Anti Human CD56 (PE)
Immunotech, Paris, France
Anti Human CD68 (PE)
BD Pharmingen, California, USA
Anti Human CD69 (FITC)
Immunotech, Paris, France
Anti Human CD80 (FITC)
Immunotools, Friesoythe, Deutschland
Anti Human CD107b (FITC)
DAKO, Carpinteria, USA
Anti Human HLA-DR (PE)
Immunotech, Paris, France
91
Material und Methoden
Sekundäre Antikörper:
FITC (Fab Fragment)
Ziege anti Human IgG-γ-Kette, Sigma,
Deisenhofen, Deutschland
PE (Fab Fragment)
Ziege anti Human IgG, Southern Biotech,
Birmingham, Alabama, USA
Alexa fluor 488
Huhn anti Human IgG (H+L), Molecular Probes,
Leiden, Niederlande
Alexa fluor 555
Esel anti Ziege IgG, Invitrogen, Karlsruhe,
Deutschland
Alexa fluor 555
Ziege anti Hase IgG, Invitrogen, Karlsruhe,
Deutschland
Alexa fluor 594
Ziege anti Maus IgG, Invitrogen, Karlsruhe,
Deutschland
Alexa fluor 594
Ziege anti Hase IgG, Invitrogen, Karlsruhe,
Deutschland
Meerrettichperoxidase (HRP)
Hase anti Ziege, Sigma, Deisenhofen,
Deutschland
(HRP)
Ziege anti Maus, Sigma, Deisenhofen,
Deutschland
(HRP)
Ziege anti Hase, Sigma, Deisenhofen,
Deutschland
4.1.9 HBV-Antigene
Engerix© –B Vaxin
Hepatitis B Oberflächenantigen (20µg/ml),
rekombinant in S. cerevisiae hergestellt (Subtyp
adw), GlaxoSmithKline, München, Deutschland
HBvaxProTM
Hepatitis B Oberflächenantigen (40µg/ml)
rekombinant in S. cerevisiae hergestellt (Subtyp
adw), Aventis Pasteur, Leimen, Deutschland
4.1.10 Bakterienstämme
DH5a
E. coli, Promega, Mannheim, Deutschland
XL1blue
E. coli, Stratagee, LaJolla, USA
92
Material und Methoden
4.1.11 Vektoren und Plasmide
4.1.11.1 Vektoren
pAdGH1.3
Adenoviraler Vektor zur Transduktion eukaryontischer Zelllinien
mit
1.3-fachem
HBV-Überlängengenom
und
grün
fluoreszierendem Protein (GFP) (Sprinzl et al., 2001)
pAdGTK
Adenoviraler Kontrollvektor der ein GFP-ORF transduziert
4.1.11.2 Plasmide
pBULLET
Retroviraler Vektor zur Produktion von Retroviren mit chimären
T-Zellrezeptoren (cTZR) als Transgen (Weijtens et al., 1998a)
pBULLET.bw431
pBULLET Plasmid, cTZR mit scFv-bw431 anti-Carcinoembryonisches Antigen (CEA) (Hombach et al., 1999)
pBULLET.C8
pBULLET Plasmid mit cTZR mit scFv-C8 anti HBV S-Protein
pBULLET.C9
pBULLET Plasmid mit cTZR mit scFv-C9 anti HBV S-Protein
pBULLET.5a19
pBULLET Plasmid mit cTZR mit scFv-5a19anti HBV L-Protein
pColt
Retrovirales Verpackungsplasmid, gag/pol Expression (Weijtens
et al., 1998a)
pCR®2.1
TA-Klonierungsplasmid zur Insertion von PCR-Produkten mittels
Ligation des PCR-spezifischen A-Überhang an Plasmid-TÜberhang, Invitrogen, Karlsruhe, Deutschland
pENTRY
Gateway, Invitrogen, Karlsruhe, Deutschland
pHit
Retrovirales Verpackungsplasmid, GALV-env Expression
(Weijtens et al., 1998a)
pLenti6
Gateway, Invitrogen, Karlsruhe, Deutschland
pOPE-C8
Prokaryontisches scFv-Expressionsplasmid mit C8-scFv anti
HBV S-Protein (T. Kürschner, Heidelberg, Deutschland)
pOPE-C9
Prokaryontisches scFv-Expressionsplasmid mit C9-scFv anti
HBV S-Protein (T. Kürschner, Heidelberg, Deutschland)
pOPE-5a19
Prokaryontisches scFv-Expressionsplasmid mit 5a19-scFv anti
HBV L-Protein (S. Urban, Heidelberg, Deutschland)
pSV2Neo
Eukaryontisches Expressionsplasmid zur Übertragung einer
Neomycin-Resistenz
93
Material und Methoden
4.1.12 Geräte und Software
4.1.12.1 Geräte
Autoradiographie
Molecular Imager FX, Biorad, Hercules, USA
Blotkammer
BIO-RAD Laboratories, Hercules, USA
Brutschränke
Heraeus Holding GmbH, Hanau, Deutschland
Durchflußzytometer
FACSCanto™, BD Biosciences, Heidelberg,
Deutschland
ELISA Reader
MRX Revelation, Dynex, Gaithersburg, USA
Filmentwickler
Curix 60, Agfa, Deutschland
Fluoreszenzmikroskop
IX 81, Olympus, Hamburg, Deutschland
Gelkammer
BIO-RAD Laboratories, Hercules, USA
Luminometer
GENios Pro, Tecan, Grödig, Östereich
Thermomixer
Comfort, Eppendorf, Hamburg, Deutschland
Kühl- und Gefriergeräte
Liebherr, Lientz, Deutschland
Light Cycler
Light Cycler System, Roche Diagnostics,
Mannheim, Deutschland
pH-Meter
WTW, wissenschaftlich technische Werkstätten
PCR
T3-Thermocycler, Biometra, Göttingen,
Deutschland
Photometer
Smart Spec 3000, BIO-RAD Laboratories,
Hercules, USA
Photosystem Agarosegele
Gel-doc 2000, BIO-RAD Laboratories, Hercules,
USA
Pipettierhilfe
Swift Pet®,Abimed, Langenfeld, Deutschland
Plattenluminometer
GENios Pro, Tecan, Crailsheim, Deutschland
Schüttler
Innova 4230, New Brunswick scientific, USA
Sterilbank (Zellkultur)
Heraeus Holding GmbH, Hanau, Deutschland
Feinwaage
Kern 440-47, Sartorius AG, Göttingen,
Deutschland
Zentrifugen
Centrifuge 5417C/5417R, Eppendorf, Hamburg,
Deutschland
Megafuge 1.0/1.0R, Heraeus Holding GmbH,
Hanau, Deutschland
94
Material und Methoden
4.1.12.2 Software
Autoradiographie
Quantity One Software, Biorad, Hercules, USA
Datenverarbeitung
Windows 2000, MS Office 2000, Word und Exxel,
Microsoft, Redmont, USA
Durchflußzytometrie
FACSDiva™,
BD
Biosciences,
Heidelberg,
Deutschland
Fluoreszenzmikroskop
AnalySIS, Soft Imaging System GmbH, Münster,
Deutschland
Grafikprogramme
Adobe Photoshop 5.5; 6.0, Adobe, San Jose, USA
Power Point 2000, Microsoft, Redmont, USA
Canvas, ACD Systems, Saanchiton, Kanada
Light Cycler
Probe Design Analysis und Rel Quant, Roche
Diagnostics, Mannheim, Deutschland
Luminometer
Magellan Software, Tecan, Grödig, Östereich
4.2 Methoden
4.2.1 Molekularbiologische Methoden
4.2.1.1 Transformation
Kompetente Bakterien der E. coli Stämme DH5α und XL1 blue wurden nach der
Methode von Inoue hergestellt (Inoue et al., 1990) und bei –80°C gelagert.
Bakterienaliquots (100 µl) wurden auf Eis aufgetaut und in 25 µl Aliquots verwendet.
Nach der Zugabe von 50-200 ng Plasmid oder Ligationsansatz wurden die
kompetenten Bakterien 30 min auf Eis inkubiert. Dies dient der Anlagerung der DNA an
die Bakterien. Durch den folgenden Hitzeschock bei 42°C für 60 sec wird die FremdDNA aufgenommen. Anschließend wurden die Bakterien 5 min auf Eis inkubiert und in
400 µl antibiotikafreiem SOC-Medium aufgenommen. Die Inkubation für 1 h bei 37°C
ist nötig für die Ausbildung der vom Plasmid kodierten Antibiotikaresistenz.
Anschließend wurden 100 µl Bakteriensuspension entsprechend der transformierten
Antibiotikaresistenz auf antibiotikahaltigen LB-Agarplatten ausplattiert.
4.2.1.2 Plasmidpräparation
Präparationen von Plasmiden wurden je nach Mengenbedarf der DNA mit Kits
(QIAprep Miniprep und Maxiprep Kit, Quiagen) nach den Herstellerangaben
durchgeführt. Die Bakterien werden alkalisch lysiert und durch Neutralisation werden
95
Material und Methoden
die Proteine gefällt. Die Proteinassoziierte genomische DNA wird zusammen mit den
Proteinen entfernt. Die nicht an Proteine gebundenen Plasmide verbleiben in der
Lösung und werden durch Anionenaustauschchromatographie aufgereinigt. Ein
zusätzlicher Waschschritt mit 70% Ethanol (EtOH) erhöht bei der Maxipräparation die
Reinheit der DNA, was für die Transfektion von eukaryontischen Zelllinien unerlässlich
ist. Für sensible Experimente wurde die Maxi-Präparation zusätzlich mit einem Kit zur
endotoxinfreien Präparation (QIAprep EndoFree Maxiprep Kit, Quiagen) durchgeführt.
4.2.1.3 Konzentrationsbestimmung von DNA
Um
die
Konzentration
der
präparierten
DNA
abzuschätzen
erfolgte
eine
photometrische Absorptionsbestimmung. Nukleinsäuren absorbieren, aufgrund ihrer
chemischen Struktur, ultraviolettes Licht mit einer Wellenlänge von 260 nm. Dabei
entspricht eine Absorption bei 260 nm (OD260) von 1,0 einer DNA-Konzentration von 50
µg/ml. Proteine absorbieren ultraviolettes Licht mit einem Absorptionsmaximum bei 280
nm. Der Quotient der Absorption bei 260 nm zu 280 nm ermöglicht ene Abschätzung
der Proteinverunreinigung der DNA-Präparation und sollte zwischen 1,8 und 2,0 liegen.
Die Absorption von Plasmid-DNA-Lösungen wurde gegen das entsprechende
Lösungsmittel (H2O, TE-Puffer) normalisiert.
4.2.1.4 Restriktionsverdau
Restriktionsendonukleasen sind Enzyme mit DNA-Nukleaseaktivität, die eine definierte
DNA-Sequenz erkennen und einen Schnitt in den doppelsträngigen DNA-Strang
einführen. In Abhängigkeit der erzeugten Endigungen der gegenüberliegenden DNAStränge, werden diese Schnittstellen, in stumpfe oder überhängende Schnittstellen
eingeteilt.
Aufgrund
des
parentalen
Organismus,
besitzen
die
Restriktionsendonukleasen unterschiedliche chemische Optimumsbedingungen, die
durch spezielle Restriktionspuffer und Temperatureinstellungen erreicht werden. Die
entsprechenden Puffer, ihre Kombinationen und die Reaktionsbedingungen wurden
nach Herstellerangaben ausgewählt. Die Aktivität einer Restriktionendonuklease wird
in Units gemessen. Per Definition schneidet ein Unit Enzym ein Mikrogramm ReferenzDNA vollständig in einer Stunde. Anhand der vom Hersteller angegebenen Aktivität
wurde die benötigte Menge an Enzym berechnet.
4.2.1.5 Ligation
Bei der Ligation werden ca. 50 ng geschnittener Vektor und ein 3-5-facher molarer
Überschuss an Insertionsfragment in 1x Ligasepuffer gemischt. Da Fragmente
komplementäre überhängende Einzelstrangenden aufweisen, wird mit 0,5 µl 1 U T4-
96
Material und Methoden
DNA-Ligase (Roche Biodiagnostics) 30 min bei 22°C bzw. über Nacht bei 16°C ligiert.
Das Reaktionsvolumen beträgt 10-20 µl.
4.2.1.6 Agarosegelelektrophorese
Bei der Agarosegelelektrophorese werden Moleküle aufgrund ihrer Ladung und Größe
in einem Gel aufgetrennt. Bei Nukleinsäuren ist die Ladung der Moleküle proportional
zum Molekulargewicht, daher kommt es bei linearisierter DNA zur exakten Auftrennung
nach dem Molekulargewicht.
Die elektrophoretische Auftrennung der DNA erfolgt in horizontalen 0,8-2,0%igen
Agarose-Gelen. Je nach Prozentualität des Gels wird die erforderliche Menge Agarose
abgewogen und in 1x TAE aufgekocht. Zur Detektion der DNA wird das abgekühlte Gel
mit Ethidiumbromid (0,5 µg/ml Endkonzentration) versetzt und nach der Polymerisation
mit 1xTAE als Laufpuffer überschichtet. Ethidiumbromid ist ein organischer
Fluoreszenzfarbstoff, der aufgrund seiner planaren Struktur zwischen die Basenpaare
von dsDNA interkaliert. Auch bei ssDNA und RNA kann der Farbstoff sich zwischen die
Basenpaare einlagern, allerdings ist die Interkalation hier schwächer als bei dsDNA.
Unter UV-Licht (254-366 nm) wird Ethidiumbromid angeregt und emittiert Licht im
orange-roten Bereich (590 nm), wodurch die eingelagerte DNA sichtbar wird. Die
Detektionsgrenze von Ethidiumbromid in Agarosegelen liegt bei etwa 10-20 ng dsDNA.
Die Proben wurden vor dem Auftragen mit 1x DNA-Probenpuffer versetzt. Das
enthaltene Glycerol erleichtert das Befüllen der Geltaschen und Bromphenolblau bzw.
Xylencyanol markiert die Lauffront des Gels.
Zusätzlich zu den Proben wurden 5 µl eines definierten DNA-Längenenmarkers in eine
Geltasche, zur späteren Identifikation der Bandengröße, aufgetragen. Die Auftrennung
der Proben verläuft unter konstanter Spannung (50-120 V).
4.2.1.7 Polymerasekettenreaktion
Die Polymerasekettenreaktion (Polymerase Chain Reaction) ist eine Methode zur in
vitro Amplifikation eines spezifischen DNA-Segments. Eine thermophile DNAPolymerase amplifiziert dabei in mehreren aufeinanderfolgenden Replikationszyklen
einen DNA-Abschnitt zwischen zwei entgegengesetzt gerichteten Primern. Diese
Primer sind komplementär zu den Enden des zu amplifizierenden DNA-Abschnitts
(Matrizen-DNA). Die PCR wurde mit Hilfe eines PCR-Fertigansatzes durchgeführt , der
bei einem Gesamtansatzvolumen von 25 µl ca. 2,5 Einheiten der puReTaq© DNAPolymerase, 10 mM Tris-HCl, 50 mM KCl, 1,5 mM MgCl2 und 200 µM Oligonucleotide
enthält.
97
Material und Methoden
Ein PCR-Ansatz setzt sich wie folgt zusammen:
Template DNA:
150-300 ng
Forward Primer (+):
5 pmol
Reverse Primer (–):
5 pmol
H2O
auf 20 µl auffüllen
Die Amplifikation erfolgte in einem programmierbaren PCR-Gerät. Dabei wurde
folgendes Programm verwendet:
Programmschritte
Temperatur
Zeit
1. Initiale Denaturierung
94°C
5 min
2. Zyklische Denaturierung
94°C
1 min
3. Primeranlagerung (Annealing)
55°C
1 min
4. Elongation
72°C
1 min
Die Schritte 2.-4. wurden in 30 Zyklen wiederholt.
Abschließend wurde das Produkt für 4 min auf 72°C amplifiziert, um eine vollständige
Amplifikation aller Fragmente zu erreichen.
4.2.1.8 TA-Klonierung
Wenn ein PCR-Produkt mit bei der Amplifikation eingefügten Restriktionsschnittstellen
nicht klonierbar ist kann das an zu kurzen DNA-Überhängen liegen, was einen
effektiven Restriktionsverdau verhindert. In diesem Fall kann das PCR-Produkt in den
TA-Klonierungsplasmiden pCR2.1 zwischenkloniert werden. Bei der PCR werden an
den Enden der amplifizierten DNA-Sequenzen A-Überhänge produziert und
diese
können mit den freiliegenden T-Überhängen des TA-Plasmiden Ligiert werden. Dies
führt zu einer stabilen Integration des PCR-Produktes in den Plasmiden, was einen
Restriktionsverdau ermöglicht.
4.2.1.9 DNA-Sequenzierung
Die DNA-Sequenzierung erfolgte durch Mitarbeiter des Servicelabors des Zentrums für
Molekulare Medizin Köln (ZMMK) auf einem ABI Prism 377 DNA Sequencer der Firma
Applied Biosystems mit der Taq FS BigDye-terminator cycle sequencing Methode.
Dazu wurden 300ng Plasmid-DNA plus 5 pmol Primer in 6 µl Wasser abgegeben und
mit Taq-Polymerase und Didesoxynukleosidtriphosphate (ddNTPs) vermischt.
Bei der DNA-Sequenzierung werden ddNTPs, die mit Fluoreszenzfarbstoffen markiert
wurden, eingesetzt. Jedes der vier ddNTPs wird mit einem unterschiedlichen Farbstoff
gekoppelt. Diese Modifikation erlaubt es, alle vier ddNTPs in einem Reaktionsgefäß
zuzugeben. Die entstehenden Kettenabbruchprodukte werden mittels KapillarGelelektrophorese aufgetrennt und mit Hilfe eines Lasers zur Fluoreszenz angeregt.
Die ddNTPs am Ende jedes DNA-Fragmentes zeigen dadurch Fluoreszenz
98
Material und Methoden
unterschiedlicher Farbe und können so von einem Detektor erkannt werden. Die
Abfolge der Farbsignale, die am Detektor erscheinen, gibt direkt die Sequenz der
Basen des sequenzierten DNA-Stranges wieder. Das Auswertungsprodukt ist ein
sogenanntes Elektropherogramm indem die Basenabfolge als Fluoreszenzmaximum
abgelesen werden kann.
©
4.2.1.10 Light Cycler PCR
Bei dem Light Cycler Gerät der Firma Roche Diagnostics handelt es sich um einen
Thermocycler, der mit einem Fluorimeter kombiniert ist. Als Reaktionsgefäße werden
Glaskapillaren eingesetzt, die eine hohe Effizienz des Wärmetransfers und damit kurze
Gesamtreaktionszeiten erlaubenen. Die Reaktionsansätze wurden in Glaskapillaren in
einem Karussell platziert, das Steckplätze für 32 Reaktionen besitzt. Der Light Cycler
wird über einen Computer gesteuert und die ermittelten Daten werden zur
Weiterbearbeitung gespeichert. Während der PCR kann man den Verlauf der
Reaktionen über ein Sensorgramm verfolgen. Die Intensität des Fluoreszenzsignals
aller Proben wird am Ende jeder Elongationsphase bei einer vorher festgelegten
Temperatur gemessen. Dabei werden die Kapillaren im Karussell nacheinander über
eine optische Einheit gedreht, wobei die Signalintensitäten bestimmt werden. Die
Amplifikation eines Fragmentes kann über die Änderung der Fluoreszenzintensität
nach jedem Reaktionszyklus in Echtzeit mitverfolgt werden. Als Fluoreszenzfarbstoff
wird SYBR GreenI eingesetzt, welches bevorzugt in die kleine Furche doppelsträngiger
DNA (dsDNA) interkaliert. Durch die Bindung des Farbstoffes an die dsDNA steigt die
Fluoreszenzintensität an. SYBR GreenI absorbiert Licht bei einer Wellenlänge von
488nm und emittiert bei 530 nm. Das Fluoreszenzsignal ist direkt proportional zur DNA
Konzentration.
Die anfänglich enthaltene Menge an Matrizen DNA wird durch die Bestimmung des
„Crossing Point“ (CP) ermittelt. Der CP definiert die Zyklusnummer, bei der gleiche
Fluoreszenzintensitäten für alle Amplifikationen auftreten. Zur Bestimmung dieses
Punkts muss man die Anzahl der Reaktionszyklen so wählen, daß die sigmoide Kurve
der Fluoreszenzintensität von der exponentiellen in die Sättigungs- oder Plateauphase
übergeht. Innerhalb des linearen Bereichs der logarithmischen Kurve, also dem
Bereich in dem das Fluoreszenzsignal exponentiell steigt, wird eine Gerade gelegt. Der
Punkt an dem diese Gerade die Grundlinie schneidet wird als CP bezeichnet. Um die
Auswertung zu objektivieren, wurden die CPs nicht manuell gewählt, sondern mittels
©
der Light-Cycler Software automatisch ermittelt. Die Spezifität der PCR wird durch die
Analyse der Schmelztemperatur in einer Schmelzkurve des Produkts überprüft. Hierfür
wird die Temperatur schrittweise von 40 auf 90°C erhöht mit ständiger Überwachung
99
Material und Methoden
der
Fluoreszenz.
Da
beim
Schmelzen
der
doppelsträngigen
DNA
der
Fluoreszenzfarbstoff entlassen wird, entsteht ein typischer Kurvenverlauf. Die
Schmelztemperatur ist für jedes Produkt spezifisch und ergibt sich in Abhängigkeit der
Fragmentlänge und des Gehalts an Guanin und Cytosin und im Vergleich mit einem
definierten Standard kann die Identität des Amplifikats bestimmt werden.
Alle Materialien für die quantitative Echtzeit-PCR wurden von Roche Diagnostics
bezogen. Es wurde folgender Master Mix angefertigt und zu je 2 µl Matritzen DNA
gegeben.
PCR-Ansatz:
Volumen
Reagenz
4 µl
Light Cycler© FS DNA Master Plus SYBR Green
1 µl
forward Primer (20 µM)
1 µl
reverse Primer (20 µM)
12 µl
ddH O
2
©
Im Reaktionsmastermix (Light Cycler FS DNA Master Plus SYBR Green) sind TaqDNA-Polymerase, Reaktionspuffer, MgCl2, SYBR Green I und dNTPs enthalten.
Für die Negativkontrollen wurden statt 2 µl template DNA 2 µl Wasser verwendet.
Es wurde folgendes Programm verwendet:
Programmdaten für die Echtzeit PCR
1. Initiale Denaturierung
95°C
300 sec
2. Zyklische Denaturierung
95°C
15 sec
3. Primer Annealing
60°C
5 sec
4. Elongation
72°C
15 sec
Die Schritte 2. bis 4. wurden in 45 Zyklen wiederholt.
5. Schmelzkurve von 65°C auf 95°C mit einer Geschwindigkeit von 0,1°C/sec
6. Kühlen
Die
Veränderung
40°C
der
30 sec
Fluoreszenzintensität
wurde
jeweils
am
Ende
der
Elongationsphase gemessen und für die Auswertung gespeichert.
Zur absoluten Quantifizierung des analysierteten Gens wird dessen Menge mit einem
DNA-Standard bekannter Konzentration verglichen.
4.2.2 Zellbiologische Methoden
4.2.2.1 Eukaryontische Zelllinien
In Zellkulturexperimenten wurden verschiedene humane und murine Zelllinien
verwendet. HepG2 (ATCC: HB-8065) und HuH7 sind humane hepatozelluläre
Karzinomzelllinien. Zusätzlich wurde die stabil mit HBV transfizierte Zelllinie
100
Material und Methoden
HepG2.2.15 (Sells et al., 1987) verwendet, die konstitutiv HBV produziert. Sie enthält
vier HBV Duplex-Genome und sezerniert infektiöse Dane Partikel, subvirale Partikel
und HBe-Antigen. Für die Produktion von retroviralen Vektoren wurden Hek293T
Zellen verwendet. Die parentale Hek293 Zelllinie, besteht aus humanen embryonalen
Nierenkarzinomzellen, die mit Adenovirus Typ-5-DNA transfiziert wurden (Graham et
al., 1977). Hek293T-Zellen exprimieren zusätzlich das große T-Antigen (large Tumor
antigen) des Simian Virus 40 (SV40), das mit dem integrierten SV40-OriReplikationsstartpunkt auf den retroviralen Plasmiden interagiert und zu einer
Amplifikation (bis zu 400 Kopien) der transfizierten Plasmid-DNA führt. Dadurch kommt
es zu einer Steigerung der Virusproduktion um eine bis zwei Log-Stufen (Landau and
Littman,
1992).
Für
die
Herstellung
von
lentiviralen
Vektoren
wurde
ein
schnellwachsender Klon dieser Zelllinie verwendet (Hek293FT, Invitrogen). Die
humane
Fibrosarkomazelllinie
Charakterisierung
der
HT1080
produzierten
(ATCC:
CRL-12012)
Vektorstocklösungen
wurde
für
verwendet.
die
Als
Kontrollzelllinie bei der Untersuchung der HBV-Adherenz an Hepatomazelllinien diente
die humane Zervikalepithelkarzinomzelllinie HeLa (ATCC: ECACC 93021013). Für die
funktionelle Kontrolle des CEA-spezifischen Kontroll-cTZR wurde die CEA-positive
Zelllinie HaCat (spontan immortalisierte humane Keratinozyten) verwendet.
4.2.2.2 Präparation primärer humaner Hepatozyten
Die Experimente mit humanen Leberresektaten fanden im Konsens mit dem Spender
und
dem
lokalen
Ethikkomitee
statt.
Die
Präparation
basiert
auf
einer
Kollagenaseperfusion (Berry et al., 1997) die um eine vobereitende Präperfusion mit
kalziumfreiem Medium erweitert wurde (Seglen, 1976). Diese Methode ist die
Standardtechnik zur Gewinnung von PHH. Vor der Präparation wurden die Medien
vorbereitet und Präperfusions-Medium und Collagenase-Medium auf 42°C und PHHMedium auf 37°C erwärmt. Das Waschmedium wurde auf 4°C abgekühlt. Unter der
Sterilbank wurden ein Wasserbad mit 42°C und die Perfusionspumpe vorbereitet. Für
die Präparation von PHH werden frische Stücke eines gesunden menschlichen
Leberresektats benötigt. Bei einer tumorbedingten Leberteilresektion wird der Teil der
Leber, der den Tumor enthält, vollständig entfernt, wobei prophylaktisch ein Rand
normales Gewebe um den Tumor mitentfernt wird. Nach der Entnahme des Resektates
wurde ein Teil des gesunden Gewebes vom Operateur abgetrennt und in PBS
gelagert. Kleinere Gefäße dss Leberresektats wurden mit Histoacryl-Klebstoff (B.
Braun,
Melsungen,
Venenverweilkatheter
Deutschland)
(B.
Braun,
verschlossen.
Melsungen,
Ein
Deutschland)
0,8mm
wurde
dicker
an
der
Perfusionspumpe angeschlossen und mit dem Präperfusionsmedium verbunden. Der
101
Material und Methoden
Katheder wurde in ein großes Blutgefäß eingeführt und mit Histoacryl-Klebstoff fixiert.
Nach dem Aushärten des Klebstoffes wurde das Resektat mit Präperfusionsmediums
durchspült (Durchflussrate 20 ml/min). Eine vollständige Durchspülung des Präperates
ist essentiell für die Präparation. Aus dem Leberstück austretendes Medium wurde
abgesaugt und verworfen. Nach 500 ml Präperfusionsmedium wurde auf das
Kollagenase-Perfusionsmedium
umgestellt.
In
verbleibenden
100
ml
Perfusionsmedium wurde das Leberresektat mit einem Skalpell zerteilt. Diese
Mischung aus zellhaltigem Perfusionsmedium und Leberstücken wurde in ein steriles
Becherglas überführt und für 10 min bei 37°C auf einem Magnetrührer inkubiert um im
Gewebe verbleibende Hepatozyten zu entfernen. Daraufhin wurde die Suspension
durch zwei Lagen Gaze und durch einen Sterilfilter (70 µm Porengrösse, Falcon) in 50
ml Gefäße (Falcon) filtriert. Die Zellen wurden für 5 min bei 400 Upm (50 g) und 10°C
mit deaktivierter Bremse pelletiert. Die Zellen wurden zweimal in 40 ml Waschmedium
resuspendiert und abzentrifugiert. Anschließend wurden die Zellen in 50ml PHHMedium (10% FCS) aufgenommen. Um die Zahl der vitalen Zellen zu ermitteln, wurden
mit Trypanblau die toten Zellen gefärbt und die Zellzahl bestimmt. Die Zellen wurden
mit PHH-Medium auf 8x105 / ml eingestellt und auf zuvor mit 10%-Kollagenlösung (0,2
mg/ml, Serva, Heidelberg, Deutschland) beschichteten Zellkulturplatten (1 h bei 37°C,
zweimal mit H2O waschen) ausplattiert. Nach 3 h wurde das Medium gewechselt und
die nicht adherenten Zellen entfernt. Nach 24 h wurde das Medium gegen PHHMedium mit 5% FCS ausgewechselt. Nach weiteren 24 h wurde das Medium gegen
PHH-Medium ohne FCS ausgewechselt. Die PHH wurden in PHH-Medium ohne FCS
kultiviert und für HBV-Infektionen verwendet.
4.2.2.3 HBV-Infektion von PHH
Die Infektion von PHH mit HBV findet in PHH-Medium mit Polyethylenglykol 8000
(PEG, 5%, w/v, Sigma) statt. Das PHH-Medium wurde gegen steril filtriertes, HBV
enthaltendes, PHH-PEG-Medium ausgetauscht und über Nacht inkubiert. Die PHH
wurden mit einer MOI = 250 Viren/Zelle infiziert. Nach 24 h wurde die Virensuspension
entfernt und gegen frisches PHH-Medium ausgetauscht. Zur Etablierung der HBVReplikation wurden die Zellen 72 h kultiviert und danach als HBV-positive Zielzellen
verwendet.
Für
Kokulturen
mit
cTZR-exprimierenden
primären
humanen
Blutlymphozyten (PBL), wurde 48 h vor Beginn der Kokultur auf PHH-Medium ohne
Cortison umgestellt, da dieses die Aktivierung der T-Zellen inhibiert (Wiegers et al.,
2001).
102
Material und Methoden
4.2.2.4 Präparation primärer humaner T-Zellen
Primäre
humane
heparinisiertem
periphere
Blut
Blutlymphozyten
präpariert.
Mittels
(PBL)
wurden
aus
Dichtegradienten-Zentrifugation
frischem,
(Ficoll-
Hypaque, 1.077 g/ml, Biochrom) lassen sich die mononukleären Leukozyten des
peripheren Blutes isolieren (peripheral blood mononuclear cells, PBMC). Die PBMC
sammeln sich dabei entsprechend ihrer spezifischen Dichte in der Interphase zwischen
Überstand (enthält Plasma und Thrombozyten) und Ficoll-Hypaque. Das Zellsediment
bilden Erythrozyten und Granulozyten, die eine höhere Dichte besitzen. Die frischen
Blutproben mit 40 ml extravenösem Blut wurden mit 10 ml sterilem PBS verdünnt und
mit Heparin (5 U/ml, Liquemin N, Roche) versetzt, um die Koagulation des Blutes zu
inhibieren. Jeweils 25 ml dieser Mischungen wurden in Leucosepröhren (Nunc) auf
15ml Ficoll-Hypaque-Lösung aufgeschichtet und für 30 min bei 1500 Upm zentrifugiert.
Um die Schichtung des Gradienten nicht zu stören, muss die Zentrifugation
ungebremst auslaufen. Die weißen Blutzellen sind nun auf dem Ficoll-Hypaque
aufgeschichtet und als weiße Bande sichtbar und können abpipettiert werden. Nach
der Abnahme der PBMC-Bande werden diese noch zweimal mit 50 ml PBS gewaschen
und zur Aktivierung in RPMI Medium mit anti-human CD3 Antikörpern (Klon OKT3, 100
ng/ml, Janssen-Cilag) und rekombinantem humanem Interleukin-2 (IL-2, 400 U/ml,
Proleukin, Chiron) überführt. Um unerwünschte Zellen wie Monozyten zu entfernen
werden diese durch Plastikadherenz von den nicht adherenten Lymphozyten getrennt.
Dafür werden sie 12 h in einer liegenden Zellkulturflasche inkubiert, danach die
Lymphozyten im Überstand in eine neue Flasche überführt und die adherenten Zellen
verworfen. Die Lymphozyten werden zwei weitere Tage in RPMI Medium mit IL-2
gehalten um eine T-zellspezifische Proliferation zu etablieren, die zu einer
Anreicherung peripherer Blutlymphozyten (PBL) führt.
4.2.3 Generierung chimärer TZR Konstrukte
Für die Generierung der cTZR-codierenden Plasmide wurden die scFv mit PCR aus
dem bakteriellen Expressionsplasmiden pHOG21 amplifizert. Dabei wurde mit dem
Vorwärtsprimer jeweils eine NcoI- und mit dem Rückwärtsprimer eine BglII-Schnittstelle
eingeführt. Der Vorwärtsprimer fügte zusätzlich noch eine κ-Leadersequenz ein, die
das bei der Transkription entstehende Produkt für die sekretorische Verarbeitung
markiert und zu einer transmenranären Lokalisation führt. Die amplifizierten DNAProdukte wurden in den PCR-Klonierungsplasmiden pCR2.1 ligiert, wodurch die
Zwischenklone pCR2.1-C8, pCR2.1-C9 und pCR2.1-5a19 entstanden. Aus diesen
wurden
die
scFv-Fusionsfragmente
mit
den
entsprechenden
Endonukleasen
herausgeschnitten. Anschließend wurden sie durch Gelextraktion aufgereinigt und
103
Material und Methoden
durch NcoI-NcoI- und BglII-BamHI-Ligation in die zuvor ebenfalls verdauten und
aufgereinigten pBULLET-Plasmide eingefügt. Dadurch entstanden die retroviralen
Plasmide pBULLET-C8, pBULLET-C9 und pBULLET-5a19, deren offene Leseraster
(ORF) nun mit HBV-spezifischen scFv begannen, die von einer sekretorischen kLeaderseuqenz markiert waren. Im Anschluß an den scFv folgt die extrazelluläre, IgGFc-Linker-Domäne, der den scFv an die intrazelluläre moduläre Signaldomäne
fusioniert, die aus CD28- und CD3ζ-Signalgeber besteht.
©
Für die Herstellung lentiviraler Vektoren, wurde das Gateway
verwendet.
Dafür
wurden
die
vollständigen
System (Invitrogen)
cTZR-Konstrukte
aus
pBULLET
herausgeschnitten und so in den Transferplasmiden pENTRY kloniert, daß es von attRekombinationsstellen flankiert ist. Danach wurde das in pENTRY enthaltene
Transgen durch Rekombination in den Destinationsplasmiden pLENTI6 übertragen.
4.2.4 Expression der chimären TZR
Für eine erste Charakterisierung wurden die cTZR-kodierenden pBULLET-Plasmide
mit FuGene in Hek293T-Zellen transfiziert. Nach 48 h Inkubation wurden die Zellen
gewaschen, 3 min mit Paraformaldehyd fixiert und mit Blockpuffer (PBS + 0,5% BSA)
für 30 min geblockt. Daraufhin wurden die Zellen mit cTZR spezifischen, FITCmarkierten anti Human-IgG Antikörpern 30 min inkubiert und die Zellkerne mit DAPI
kogefärbt. Die Auswertung fand an einem Immunfluoreszenzmikroskop statt.
In einem zweiten Experiment wurden die transfizierten, cTZR-exprimierenden zellen
mit HBV-Partikeln für 1 h inkubiert und für die Immunfluoreszenz vorbereitet. Zusätzlich
zu den oben genannten Färbungen wurden die Zellen mit einem anti HBV-Sprotein
Antikörper inkubiert, gewaschen und mit einem spezifischen, Alexa-555 markierten
sekundären Antikörper gefärbt.
4.2.5 Vektorproduktion
Die Produktion retroviraler Vektoren wurde in unterschiedlichen virusproduzierenden
Zelllinien untersucht um eine optimale Vektorproduktion zu erreichen. Die verwendeten
Zelllinien (Hek293-, Hek293T- und Hek293FT-Zellen) basieren auf die parentale Linie
Hek293. Für die Virusproduktion wurden die Transfektionsprotokolle von CalziumPhosphat-Kopräzipitation (Bacchetti and Graham, 1977) (Graham and van der Eb,
1973)und Polyfect (Quiagen) verglichen. Die Calzium-Phosphat Methode basiert auf
einer Komplexbildung von DNA und Calzium Phosphat. Dies wird erreicht, indem eine
Calzium-Chlorid-DNA-Lösung langsam zu zweifachem Natrium-Phosphat-gepuffertem
HEPES (2xHBS (HEPES-Buffered Saline); 50 mM HEPES, 280 mM NaCl, 1,5 mM
Na2HPO4, pH 7.05) gegeben wird. Dies führt zur Bildung der Komplexe, die an die
104
Material und Methoden
Zellmembran adherieren und von der Zelle internalisiert werden. Mit Calzium-Phosphat
wurden die DNA-Mengen pro Plasmid variiert. Für die qualitative Untersuchung der
Produktion von retroviralen Vektoren wurden die verschiedenen virusproduzierenden
Zellen mit einer Dichte von 2x106 Zellen pro 10-cm Zellkulturschale ausplattiert. Nach
24h wurden die Zellen entweder mit dem käuflichen Transfektionsreagenz Polyfect
(Quiagen) oder mit der Calzium-Phopsphat-Kopräzipitationsmethode transfiziert. Das
Verpackungsplasmid kodiert in diesem Fall für ein pseudotypisierendes Gibbon-AffenLeukämievirus Hüllprotein (GALV-ENV) und das Plasmid pHIT60 kodiert die reverse
Transkriptase/Polymerase (pol) und die Kapsidproteine (gruppenspezifisches Antigen,
gag) eines murinen Leukämievirus. Das retrovirale Vektorplasmid (pBULLET), das den
cTZR kodiert, wurde mit 8 µg, pCOLT-GALV-ENV mit 10 µg und pHIT60 mit 2,5 µg pro
10 cm-Schale eingesetzt. Die DNA wurde in 450 µl Wasser gelöst und mit 50 µl
Calzium Chlorid (2,5 M) gemischt. Diese Lösung wurde unter Vortexen tropfenweisezu
500 µl 2xHBS gegeben und gemischt. Nach einer Inkubationszeit von 20 min zur
Ausbildung der Komplexe wurde die Lösung auf die Hek293T-Zellen gegeben und
vermischt. Mit Polyfect wurden 4 µg pro Plasmid nach den Herstellerangaben auf einer
10
cm-Zellkulturschale
verwendet.
Für
die
qualitative
Untersuchung
dieser
Virusproduktionenen wurden HT1080-Zellen mit seriellen Verdünnungen dieser
Virusstocklösungen inkubiert und bei 32°C für 60 min bei 1200 rpm zentrifugiert (Spin
Down Transduktion). Die Transduktionsraten wurden mit Durchflußzytometrie mit
einem FACSCanto
©
(BD Biosciences, Heidelberg, Germany) ermittelt. Dazu wurden
die cTZR-exprimierenden Zellen resuspendiert und mit mit spezifischen Antikörpern
gegen die Fc-Linker-Domäne im extrazellulären Bereich des cTZR angefärbt. Dafür
wurden Verdünnungen von 1:500 des anti human Fc-FITC Fab-Fragmentes (Sigma)
eingesetzt. Für die Produktion lentiviraler Vektoren wurden das Vektorplasmid
©
(pLenti6 ,
Gateway,
Invitrogen),
welches
den
cTZR
kodiert,
mit
©
dem
©
Verpackungsplasmidmix Virapower (Gateway, Invitrogen) ebenfalls mit Polyfect wie
oben beschrieben transfiziert. Dies führt zur Produktion lentiviraler Vektoren, die mit
dem Hüllprotein des vesikulären Stomatitisvirus G (VSV-G) pseudotypisiert sind.
4.2.6 Transduktion
Die Transduktion primärer humaner T-Zellen fand in Kokultur mit virusproduzierenden
Hek293T-Zellen statt. Zu diesem Zweck wurden Hek293T Zellen mit retro- oder
lentiviralen Produktionsplasmiden transfiziert und nach einer 8-12 h Vorinkubation zur
Etablierung der Virusproduktion wurden 1,5x106 voraktivierte T-Zellen in 8 ml RPMIMedium mit IL-2 (400 U/ml) für 72 h mit den virusproduzierenden Hek293T-Zellen
kokultiviert. Die Transduktionseffizienz wurde mittels Durchflußzytometrie bestimmt.
105
Material und Methoden
Die nichtadherenten T-Zellen wurden aus den Kokulturen mit virusproduzierenden
Zellen geerntet und 500 µl Zellsuspension wurden für die Antikörperfärbung
abgenommen und weiterbehandelt. Diese wurden in FACS-Röhren (Nunc) mit 2 ml
PBS gewaschen und auf Eis mit fluoreszenzmarkierten Antikörpern inkubiert. Für die
Analyse wurden verschiedene Antikörper gegen humanes CD3 als T-Zellmarker und
gegen die humane Fc-Linker-Domäne im extrazellulären Bereich des cTZR eingesetzt,
um die Expression des Rezeptors zu quantifizieren. Die Antikörper waren mit
Phycoerithrin (PE) oder Fluorescein isothiocyanate (FITC) gekoppelt und wurden in
Kombinationen für Doppelfärbungen verwendet. Die Verdünnungen wurden nach
Herstellerangaben angesetzt. Nach 30 min Inkubation auf Eis wurden die Proben
zweimal mit 2 ml PBS gewaschen und mit Propidiumjodid (Molecular Probes) versetzt,
um die toten Zellen anzufärben und aus der Analyse auszuschließen. Aus der
Gesamtpopulation der erfaßten Zellen wurde anhand von Vorwärtsstreulicht (Forward
Scatter, Maß für die Größe einer Zelle) und Seitwärtsstreulicht (Sideward Scatter, Maß
für die Granulosität eine Zelle), die Population der aktivierten T-Zellen erfaßt, da diese
aktiv proliferieren und die Transduktion durch das Retrovirus, und damit die Expression
des
chimären
TZR
unterstützen.
Die
ermittelten
Transduktionsraten
wurden
anschließend für die Einstellung der Effektorzellen:Zielzellen Ratios (Effector:Target
Ratio, E:T) in den Zytotoxizitätsexperimenten verwendet.
4.2.7 Kokultur mit Hepatomazielzelllinien
4.2.7.1 Herstellung einer HBV transfizierten Hepatomazelllinie
Auf dem Hintergrund der Hepatomazelllinien HepG2 und HuH7 wurden stabil mit HBV
transfizierte Zelllinien hergestellt. Die parentalen Zelllinien wurde dazu mit einem 1.3fachen Überlängengenom von HBV transfiziert (Plasmid pTH1.3). Zur Selektion wurde
zusätzlich mit einem Plasmiden, der für eine Neomycinresistenz (Plasmid pSV2 Neo)
kodiert, kotransfiziert. Eine 50% konfluente HepG2-Zellkultur wurde in einer 6Vertiefungszellkulturplatte unter Verwendung von FuGene Transfektionsreagenz
(Roche) mit mit den beiden Plasmiden transfiziert. Die Plasmide wurden im Verhältnis
1:30 (pSV2Neo:pTH1.3) eingesetzt. Dies erhöht die Wahrscheinlichkeit eines
integrierten HBV-Genoms für alle Neomycinresistenten Klone. Die Plasmid-DNA wurde
mit der Restriktionendonuklease ScaI linearisiert um eine Integration zu erleichtern.
Anschließend wurde die DNA mit Na-Acetat gefällt um kontaminierende Salze des
Restriktionspuffers zu entfernen. Das eingesetzte Verhältnis von DNA:FuGene wurde
auf 3:2 eingestellt. Insgesamt wurden 2 µg DNA pro Vertiefung der Platte transfiziert.
Nach 24 h Inkubation bei 37°C / 5% CO2 wurde das Medium gewechselt und auf
Selektionsmedium mit 1000 µg/ml Neomycin (Geneticin, G418, Sigma) umgestellt.
106
Material und Methoden
Nach sieben Tagen Selektion, mit Mediumwechsel alle 48 h, wurden stabil transfizierte
Einzelzellklonkolonien von der Platte geerntet und in 96-Well-Zellkulturplatten
überführt. Dazu wurde 1 ml Trypsin/EDTA appliziert und nach 60 s wieder entfernt.
Nach 3 min erfolgte die Ernte mittels Pipette. Die geernteten Klone wurden unter
Selektionsdruck expandiert, bis eine Kultur in Zellkulturflaschen möglich war. Zu
diesem Zeitpunkt waren 23 Klone HepG2 und 21 Klone HuH7 Zellen verblieben. Diese
wurden HepG2H1.3 und HuH7H1.3 genannt und mit der Nummer des Klons versehen.
Eine erste Charakterisierung erfolgte anhand der seekretierten HBs- und HBe-Antigen
Mengen
in
der
Serologieabteilung
der
Klinischen
Virologie
Köln.
Die
Charakterisierungen der integrierten HBV-Konstrukte und der cccDNA wurden mit
Southern Blot Analysen vorgenommen. Dafür wurden genomische DNA-Präparationen
oder Hirt-Lyse-Präparationen aus nukleären Extrakten in Agarosegelelektrophorese
aufgetrennt und mit HBV-spezifischen, radioaktiv markierten Sonden hybridisiert. Die
Auswertung erfolgte durch Autoradiographie.
4.2.7.2 Kokulturen mit HBV-replizierenden Zielzelllinien
Für die Kokultur mit transduzierten, cTZR-exprimierenden T-Zellen wurden HBVreplizierende HepG2.2.15- oder HepG2H1.3-Zellen und als Kontrolle die HBV
negativen parentalen HepG2-Zellen als Zielzellen verwendet. Die Hepatomazielzellen
wurden subkonfluent in 100 µl DMEM auf 96-Vertiefungsmikroplatten (Nunc) ausgesät
und bis zur Konfluenz kultiviert. Aus Vorversuchen war bekannt, daß die Zellen nach
drei Tagen Konfluenz eine effektive HBV-Replikation zeigen. Zu diesem Zeitpunkt
wurden die cTZR-exprimierenden Effektor T-Zellen in 100 µl RPMI und definierten E:T
Ratios in Dreifachbestimmungen zugegeben und die Zytotoxizität untersucht. Dabei
wurde
mikroskopisch
und
Anhand
der
Zytokinsekretion
der
Zeitverlauf
der
zytotoxischen T-Zellantwort bestimmt. In spezifischen Färbungen vitaler und toter
Zellen mit unterschiedlichen Farbstoffen durch eine LIVE/DEAD-Färbung wurde die
Zytotoxizität evaluiert. In seriellen Verdünnungen wurde die Dosisabhängigkeit
ermittelt. Nach 48-72 h wurde nach einer mikroskopischen Einschätzung die
spezifische Lysis durch einen XTT-Test (Roche) erhoben. Bei diesem kolorimetrischen
Verfahren werden die Zellen mit dem gelben Tetrazoliumsalz XTT inkubiert, welches
von vitalen Zellen quantitativ in das orangene, wasserlösliche Formazan umgesetzt
wird (Scudiero et al., 1988; Weislow et al., 1989). Anhand der verschobenen
Absorptionsmaxima von 360 nm auf 470 nm kann die Viabilität einer Zellkultur direkt
mit einem Plattenspektrometer gemessen werden. Die XTT-Lösung wird mit
Zellkulturmedium gemischt (1:1, v/v) und mit einem Elektronenkopplungsreagenz
aktiviert. Aus den experimentellen Ansätzen wurden 150 µl Mediumüberstand
107
Material und Methoden
abgenommen und für die Bestimmung der Zytokinsekretion bei –20°C gelagert.
Anschließend wurden 100 µl der XTT-Lösung zugegeben und 30 min bei 37°C / 5%
CO2 inkubiert. Im Abstand von 15 min wurde für 2 h die Absorption gemessen um den
optimalen Zeitpunkt zu ermitteln.
Für die Bestimmung der Cytotoxizität wurde die spezifische, antigenvermittelte
Zielzellysis ermittelt. Dazu wurden der Viabilitätsdaten von Zielzellen in Kokultur mit
cTZR-exprimierenden Effektorzellen und als Kontrolle Zielzellen in Kokultur mit cTZRnegativen Effektorzellen, Effektorzellen in Monokultur, Zielzellen in Monokultur und
Mediumkontrollansätze nach folgender Formel verrechnet:
(Effektor/Zielzellkokultur) - (Effektorzellmonokultur)
spezifische Lysis (%) = ⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯ x 100
(Zielzellmonokultur) - (Mediumkontrolle)
Durch diese Formel werden verfälschende Ergebnisse der Effektorzellen und des
Zellkulturmediums ausgeschlossen und der Effekt auf die Zielzellen ermittelt.
4.2.7.3 Zytokinsekretionsmessung durch ELISA
Die Zytokinsekretion wurde als Marker für die Aktivierung der Effektorzellen mithilfe
von ELISA (Enzyme Linked Immunosorbent Assay) bestimmt (Engvall and Perlman,
1971). Bei dieser Methode wird ein spezifischer Antikörper zum „Einfangen“ des
gesuchten Proteins auf einer 96-Mikrotiterplatte (Maxisorb, Nunc) übernacht bei 4°C
immobilisiert. Nach der Blockierung freier Proteinbindungsstellen mit bovinem
Serumalbumin (BSA) für 2 h bei RT wird die zu untersuchende Flüssigkeit (Serum,
Mediumüberstand) zugegeben und für 2 h bei RT mit 700 rpm geschüttelt. Nach fünf
Waschschritten mit Waschpuffer (PBS, 0,05% Tween-20) wird der biotinylierte
Detektionsantikörper zusammen mit einem Meerrettichperoxidase(HRP)-gekoppelten
Streptavidin inkubiert. Der Detektionsantikörper bindet das „eingefangene“ Antigen und
assoziiert mit dem HRP-Streptavidin. Nach weiteren fünf Waschschritten wird eine
stabilisierte Substratlösung (Tetramethylbenzidin, TMB) zugegeben, die von der HRP
in ein blaues Produkt umgesetzt wird. Diese Substratumsetzung ist proportional zur
gebundenen Proteinmenge und dem assoziierten Peroxidasekomplex und kann mit
Stoplösung (2 N H2SO4) beendet werden, wodurch ein Farbumschlag nach Gelb
stattfindet. Dieser gelbe Farbstoff kann bei 450 nm im ELISA-Spektrometer gemessen
und gegen eine definierte Standardverdünnungsreihe ausgewertet werden. Dazu
werden
die
Absorptionwerte
der
Standardverdünnungsreihe
als
exponentielle
Gleichung dargestellt und mithilfe der erhaltenen mathematischen Formel werden die
experimentellen Werte in Proteinkonzentrationen pro ml Zellkulturmedium (ng/ml)
umgerechnet.
108
Material und Methoden
4.2.8 Kokultur mit HBV infizierten PHH
4.2.8.1 PHH und cTZR-exprimierende Effektorzellen
Da die cTZR-exprimierenden T-Zellen sensitiv auf das im PHH-Medium enthaltene
Hydrocortison reagierten und nicht mehr aktivierbar waren, wurde 48 h vor Beginn der
Kokultur auf PHH-Medium ohne Cortison umgestellt. Für die Zytotoxizitätstests in
Kokulturen von HBV-infizierten PHH und cTZR-exprimierenden T-Zellen wurden
Effektor:Zielzellen Ratios von 1:10 eingesetzt. Während der Kokultur wurde die
Zytotoxizität der cTZR-exprimierenden T-Zellen durch Messung der Freisetzung des
leberspezifischen Enzyms Alaninaminotransferase (ALT) überprüft. Dieses Enzym ist
ein spezifischer Marker für Leberschädigung und wird von geschädigten Hepatozyten
freigesetzt. Die ALT-Messung erfolgte mit einem automatisierten Reflotron (Roche)
Reflektionsphotometer und ALT-spezifischen Reagenzträgern.
Testprinzip:
ALT
Ketoglutarat + Alanin
Glutamat + Pyruvat
Aus dem entstandenen Pyruvat wird H2O2 abgespalten, das zusammen mit einem
Indikator zu einem blauen Farbstoff umgesetzt wird. Endogenes Pyruvat wird in einer
Vorreaktion eliminiert.
Nach einer viertägigen Inkubation wurden die Mediumüberstände geerntet und bei 20°C gelagert und für die Bestimmung der Zytokin- und der HBV-Antigensekretion
verwendet. Die Zellen wurden in NP40-Lysispuffer lysiert und die Lysate ebenfalls bei 20°C gelagert.
4.2.8.2 Messung der HBV-Antigensekretion durch ELISA
Die Sekretion von HBV Antigenen durch HBV-infizierte Zellen ist ein Marker für den
Replikationsstatus der virusproduzierenden Zelle. Deshalb wurde die Sekretion von
HBsAg und HBeAg untersucht. Aus den gesammelten Mediumüberständen wurden 50
µl Mediumüberstand auf fertige antikörperbeschichtete ELISA-Platten aufgetragen und
mit spezifischen Antikörpern detektiert. Dies erfolgte mit den diagnostischen ELISAKits Murex-HBsAg (Abbott) und
HBeAg-EIA (Axiom). Unter Verwendung eines
definierten Standards konnte die Menge an Antigen in ng/ml berechnet werden.
Zusätzlich wurde eine Quantifizierung der im Zellkulturüberstand enthaltenen HBeAg
Mengen durch die klinische Serologie des Instituts für Virologie (Köln) vorgenommen.
4.2.8.3 Western Blot der intrazellulären Proteinmengen
Um einen möglichen akkumulativen Effekt der HBV-Proteine im Zellkulturmedium
auszuschließen wurde die Menge an Kapsid-Protein und Albumin in zellulären
109
Material und Methoden
Zellysaten gemessen und miteinander verglichen. Dazu wurden intrazelluläre
Proteinpräparationen denaturiert, durch SDS-Page aufgetrennt und auf eine PVDFMembran übertragen. Durch Inkubation mit dem HBV-Kapsid-Protein spezifischen
Antikörper (H800, 1:10000) wurde das Kapsid-Protein detektiert und durch einen
Meerrettichperoxidase
(HRP)
gekoppelten
Sekundärantikörper
detektiert.
Die
Auswertung fand durch Inkubation mit einem phosphoreszierenden Substrat statt und
wurde quantifiziert. Anschließend wurde die Membran mit 0,2 M NaOH gestript und mit
einem Albumin-spezifischen Antikörper (1:2000) erneut entwickelt.
4.2.8.4 HBV-DNA-Messung mit Light-Cycler-PCR
Aus den gesammelten Zellysaten wurde mit einer Phenol-Chloroform-Präparation (aus
Current Protocols in Molecular Biology) die Gesamt-DNA gewonnen und als Matritze
für die quantitative Light-Cycler-PCR verwendet. Durch Konstruktion spezifischer
Primer kann zwischen der kovalent geschlossenen zirkulären cccDNA im Zellkern der
infizierten Zelle und der partiell doppelsträngigen DNA in reifen HBV-Kapsiden
unterschieden werden. Die ermittelten Werte für HBV rcDNA und cccDNA wurden in
Kopien pro 103 Zellen umgerechnet. Die Reaktion wurde wie unter 4.2.1.10
beschrieben durchgeführt und neben der Schmelzkurvenanalyse wurde das PCRProdukt durch Gelelktrophorese überprüft. Dazu wurden die Glaskapillaren nach der
Light-Cycler-PCR umgekehrt in Eppendorfgefässe gestellt und das Produkt durch
Zentrifugation aufgefangen. Mit diesen Proben wurde die Fragmentlänge analysiert.
4.2.9 Charakterisierung der Zytotoxizität
4.2.9.1 NFκB-Aktivierung
Die Aktivierung des Transkriptionsfaktors NFκB ist ein Marker für die Signalkaskade
nach der Antigenerkennung durch den TZR.
Zur
Ermittlung
der
NFκB-Aktivierung
wurde
ein
Elektrophoretischer
Mobilitätsveränderungs Assay (EMSA) durchgeführt (Kruppa et al., 1992). Bei dieser
Methode wird ein DNA-Fragment aus der langen terminalen Wiederholung (LTR) des
humanen Immundefizienvirus (HIV), das die Konsensusbindesequenz für NFκB enthält
mit radioaktiven
32
P-Isotopen markiert. Die DNA-Bindungsstelle von NFκB ist nur im
aktivierten Zustand zugänglich und bindet an die Konsensussequenz des Fragmentes.
Dies bewirkt eine Veränderung des Laufverhaltens des DNA:NFκB-Komplexes in
einem nativen SDS-Polyacrylamidgel und durch die radioaktive Markierung kann eine
autoradiographische Filmentwicklung durchgeführt werden. Die nicht gebundenen und
damit kleineren DNA-Fragmente bewegen sich deutlich tiefer in der Gelelektrophorese.
110
Material und Methoden
Die Bandenintensität wurde ermittelt und mit der Kontrolle verglichen und als x-fache
Veränderung dargestellt.
4.2.9.2 Caspase-Aktivierung
Aus den Kokulturen von HBV-infizierten PHH und cTZR-exprimierenden T-Zellen
wurden Zellysate gewonnen und die Aktivierung der Effektor Caspasen 3 und 7
bestimmt (Caspase-Glo™ 3/7 Assay, Promega). Diese Aktivierung dient als geeigneter
Marker für die Initialisierung der Apoptose.
Bei diesem Test wird ein proilumineszentes Caspasesubstrat zu den nativen Zellysaten
gegeben, das von vorhandenen, aktivierten Caspasen proteolytisch verdaut wird und
ein Lumineszenzsignal erzeugt. Dieses Signal wurde mit einem Plattenluminometer
(GENios Pro, Tecan) quantitativ gemessen und in Aktivierungsgrade umgerechnet.
4.2.9.3 Caspase Inhibitoren
Für die Inhibition der Caspasen in Kokulturen rezeptortragender T-Zellen und HBVreplizierendder wurden spezifische Tetrapeptid-Inhibitoren eingesetzt (Alexis). Z-VAD
ist ein Pancaspaseinhibitor und DEVD ist spezifisch für Caspase3. Diese Reagenzien
wurden in DMSO gelöst und mit 20 µM den Zellkulturmedien zugesetzt.
4.2.9.4 Lamp-2 Mobilisierung
Bei der zytotoxischen T-Zellantwort kommt es zur sekretion lytischer Granuolen, die
Perforin
und
Granzym
enthalten.
Diese Granuolen
sind
innerlich
mit dem
Memranprotein Lamp-2 (lysosomal-associated membrane protein 2, CD107b) besetzt,
das durch die Membranfusion der Granuolen auf der Zellmembran verbleibt. Dadurch
dient Lamp-2 als Marker für die zytotoxische Ausschüttung lytischer Granuolen und
kann durch extrazelluläre Antikörperfärbung und Durchflußzytometrie quantitativ
bestimmt werden. Nach 72 h Kokultur mit HBV-positiven oder HBV-negativen
Zielzellen
wurden
die
nichtadhärenden
T-Zellen
entnommen
und
für
die
Antikörperfärbung mit 2 ml PBS gewaschen. Anschließend wurden die Zellen für 30
min auf Eis mit Antikörpern gegen den cTZR und gegen Lamp-2 inkubiert. Die
Verdünnungen wurden nach den Herstellerangaben angesetzt. Danach wurde zweimal
mit 2 ml PBS gewaschen und in 500 µl PBS mit Propidiumjodid resuspendiert. Der
prozentuale Anteil an Lamp-2-positiven Zellen in der Population der cTZRexprimierenden Zellen wurde am FACSCanto ermittelt.
4.2.9.5 Ermittlung der CD95-Expression
Die T-Zelle besitzt neben der Sekretion von Perforin/Granzym in lytischen Granuolen
noch einen zweiten zytotoxischen Mechanismus. Die regulatorische Steigerung der
111
Material und Methoden
CD95-Ligandenexpression auf der Zellmembran führt durch Interaktion mit dem CD95Rezeptor auf der Zielzelle zur Initiation der Apoptose. Die Menge an CD95-Rezeptoren
kann durch IFNγ-Signalisierung hochreguliert werden, was die Zielzelle empfänglich für
ein proapoptotisches Signal durch CD95-Liganden macht.
4.2.9.6 Antigenabhängige Proliferation
Die Aktivierung durch den TZR und das zusätzliche kostimulatorische Signal durch die
Aktivierung
des
CD28-Rezeptors
führt
zur
proliferativen
Amplifikation
des
entsprechenden T-Zellklones. Durch die im chimären TZR vorhandene CD28Signaldomäne wird dieses proliferative Signal aktiviert und sollte zur Vermehrung der
cTZR-exprimierenden
T-Zellen
nach
Antigenerkennung
führen.
Um
die
antigenabhängige Proliferation der cTZR-exprimierenden T-Zellen nachzuweisen,
wurde die Anzahl der TZR-positiven T-Zellen bestimmt. Dies erfolgte mittels
Durchflußzytometrie nach einer 72 h Inkubation mit HBV-positiven, oder als Kontrolle
mit HBV-negativen Zielzellen.
4.2.10 Charakterisierung cTZR-exprimierender T-Zellen
4.2.10.1 Aktivierung durch HBV-Partikel
Um die Aktivierung der cTZR-exprimierenden Zellen durch HBV-Partikel in Lösung zu
untersuchen,
wurden
cTZR-exprimierende
T-Zellen
mit
Mediumüberständen
konfluenter, HBV-replizierender, HepG2.2.15 Hepatomazellen oder mit definierten
HBV-Lösungen
(4000
Mediumüberstand
HBV
der
Partikel/T-Zelle)
parentalen,
inkubiert.
HBV-negativen
Zellkulturmedium ohne HBV-Partikel.
Als
Kontrolle
diente
HepG2-Zelllinie
oder
Da eine Plastikadherenz der HBV-Partikel
bekannt ist, wurden Zellkulturplatten für 1 h mit HBV-haltigem Mediumüberstand
inkubiert, um die HBV-Partikel an die Plastikoberfläche des Zellkulturgefässes
adherieren zu lassen. Darau folgte zweifaches Waschen mit PBS um nichtadherierte
Viruspartikel zu entfernen. Um diesen Adherenzeffekt zu kontrollieren wurden
Zellkulturgefässe vor der Plastikadherenz für 1h mit FCS blockiert, um eine Aktivierung
durch plastikadherierte Viruspartikel auszuschließen. Außerdem wurden HBV-negative
Hepatoma-
und,
Mediumüberständen
Viruspartikeladherenz
als
für
an
Kontrolle,
1h
die
Nichthepatomazelllinien
inkubiert
und
Oberfläche
mit
dieser
PBS
mit
HBV-haltigen
gewaschen,
Zelllinien
zu
um
eine
untersuchen.
Anschließend wurden die cTZR-exprimierenden T-Zellen für 72 h inkubiert oder
kokultiviert. Aus den Mediumüberständen wurde die IFNγ-Sekretion, als Marker für die
antigenspezifische Aktivierung mit ELISA untersucht.
112
Material und Methoden
4.2.10.2 HBV-Adhärenz an Hepatomazelllinien
Die
beiden
Hepatomazelllinien
HepG2
und
HuH7
wurden
mit
der
nicht-
Hepatomazelllinie auf HBV-Adhärenz verglichen. Dazu wurden konfluente Zellkulturen
mit Zellkulturüberständen von HBV-produzierenden HepG2.2.15-Zellen für 1 h
inkubiert, mit PBS gewaschen und anschließend mit cTZR-exprimierenden T-Zellen
kokultiviert. Die Aktivierung der rezeptortragenden T-Zellen wurde nach 48h Anhand
der INFγ-Sekretion mit ELISA gemessen.
4.2.10.3 Funktionskontrolle des CEA-spezifischen T-Zellrezeptors
Um die Funktionalität des CEA-spezifischen Kontroll-cTZR zu überprüfen, wurden
CEA-spezifische,
cTZR-exprimierende
Keratinozytenzelllinien
HaCat
und
als
T-Zellen
Kontrolle
mit
mit
der
CEA-positiven
der
CEA-negativen
Hepatomazelllinie HepG2 in vergleichbaren E:T Ratios inkubiert. Die Kokultur wurde
für 72 h inkubiert und danach wurden die Zellkulturmediumüberstände untersucht. Die
Aktivierung der CEA-spezifischen Kontroll-cTZR wurde durch ELISA-Messung der
IFNγ-Sekretion ins Medium bestimmt.
113
Literatur
5 Literatur
Abken, H., Hombach, A., Heuser, C., Sircar, R., Pohl, C., and Reinhold, U. (1997).
Chimeric T-cell receptors: highly specific tools to target cytotoxic T-lymphocytes to
tumour cells. Cancer Treat Rev 23, 97-112.
Acs, G., Sells, M. A., Purcell, R. H., Price, P., Engle, R., Shapiro, M., and Popper, H.
(1987). Hepatitis B virus produced by transfected Hep G2 cells causes hepatitis in
chimpanzees. Proc Natl Acad Sci U S A 84, 4641-4644.
Adams, G. L., and Glacken, M. W. (1990). The effects of adverse growth conditions on
the shedding of carcinoembryonic antigen from cultured LS180 colon cancer cells.
Cancer Commun 2, 73-80.
Bacchetti, S., and Graham, F. L. (1977). Transfer of the gene for thymidine kinase to
thymidine kinase-deficient human cells by purified herpes simplex viral DNA. Proc
Natl Acad Sci U S A 74, 1590-1594.
Banchereau, J., Briere, F., Liu, Y. J., and Rousset, F. (1994). Molecular control of B
lymphocyte growth and differentiation. Stem Cells 12, 278-288.
Barry, M., and Bleackley, R. C. (2002). Cytotoxic T lymphocytes: all roads lead to
death. Nat Rev Immunol 2, 401-409.
Bartenschlager, R., and Schaller, H. (1992). Hepadnaviral assembly is initiated by
polymerase binding to the encapsidation signal in the viral RNA genome. Embo J
11, 3413-3420.
Beadling, C., Johnson, K. W., and Smith, K. A. (1993). Isolation of interleukin 2-induced
immediate-early genes. Proc Natl Acad Sci U S A 90, 2719-2723.
Beecham, E. J., Ortiz-Pujols, S., and Junghans, R. P. (2000). Dynamics of tumor cell
killing by human T lymphocytes armed with an anti-carcinoembryonic antigen
chimeric immunoglobulin T-cell receptor. J Immunother 23, 332-343.
Berry, M. N., Grivell, A. R., Grivell, M. B., and Phillips, J. W. (1997). Isolated
hepatocytes--past, present and future. Cell Biol Toxicol 13, 223-233.
Berting, A., Hahnen, J., Kroger, M., and Gerlich, W. H. (1995). Computer-aided studies
on the spatial structure of the small hepatitis B surface protein. Intervirology 38, 815.
Bertoletti, A., Ferrari, C., Fiaccadori, F., Penna, A., Margolskee, R., Schlicht, H. J.,
Fowler, P., Guilhot, S., and Chisari, F. V. (1991). HLA class I-restricted human
cytotoxic T cells recognize endogenously synthesized hepatitis B virus
nucleocapsid antigen. Proc Natl Acad Sci U S A 88, 10445-10449.
Betts, M. R., Brenchley, J. M., Price, D. A., De Rosa, S. C., Douek, D. C., Roederer,
M., and Koup, R. A. (2003). Sensitive and viable identification of antigen-specific
CD8+ T cells by a flow cytometric assay for degranulation. J Immunol Methods
281, 65-78.
Bevan, M. J. (1976). Cross-priming for a secondary cytotoxic response to minor H
antigens with H-2 congenic cells which do not cross-react in the cytotoxic assay. J
Exp Med 143, 1283-1288.
Blanco, B., Holliger, P., and Alvarez-Vallina, L. (2002). Autocrine costimulation: tumorspecific CD28-mediated costimulation of T cells by in situ production of a
bifunctional B7-anti-CEA diabody fusion protein. Cancer Gene Ther 9, 275-281.
114
Literatur
Blumberg, B. S., Melartin, L., Guint, R. A., and Werner, B. (1966). Family studies of a
human serum isoantigen system (Australia antigen). Am J Hum Genet 18, 594608.
Blumberg, B. S., Sutnick, A. I., and London, W. T. (1969). Australia antigen and
hepatitis. Jama 207, 1895-1896.
Bock, C. T., Schwinn, S., Schroder, C. H., Velhagen, I., and Zentgraf, H. (1996).
Localization of hepatitis B virus core protein and viral DNA at the nuclear
membrane. Virus Genes 12, 53-63.
Bolhuis, R. L., and Gratama, J. W. (1998). Genetic re-targeting of T lymphocyte
specificity. Gene Ther 5, 1153-1155.
Borner, C., and Monney, L. (1999). Apoptosis without caspases: an inefficient
molecular guillotine? Cell Death Differ 6, 497-507.
Bram, R. J., and Crabtree, G. R. (1994). Calcium signalling in T cells stimulated by a
cyclophilin B-binding protein. Nature 371, 355-358.
Bromley, S. K., Iaboni, A., Davis, S. J., Whitty, A., Green, J. M., Shaw, A. S., Weiss, A.,
and Dustin, M. L. (2001). The immunological synapse and CD28-CD80
interactions. Nat Immunol 2, 1159-1166.
Bruss, V., and Ganem, D. (1991). The role of envelope proteins in hepatitis B virus
assembly. Proc Natl Acad Sci U S A 88, 1059-1063.
Call, M. E., Pyrdol, J., Wiedmann, M., and Wucherpfennig, K. W. (2002). The
organizing principle in the formation of the T cell receptor-CD3 complex. Cell 111,
967-979.
Campi, G., Varma, R., and Dustin, M. L. (2005). Actin and agonist MHC-peptide
complex-dependent T cell receptor microclusters as scaffolds for signaling. J Exp
Med 202, 1031-1036.
Cantrell, D. A. (1996). T cell antigen receptor signal transduction pathways. Cancer
Surv 27, 165-175.
Cantrell, D. A. (2003). GTPases and T cell activation. Immunol Rev 192, 122-130.
Carding, S. R., and Egan, P. J. (2002). Gammadelta T cells: functional plasticity and
heterogeneity. Nat Rev Immunol 2, 336-345.
Caron, G., Duluc, D., Fremaux, I., Jeannin, P., David, C., Gascan, H., and Delneste, Y.
(2005). Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R848 up-regulate proliferation and IFN-gamma production by memory CD4+ T cells.
J Immunol 175, 1551-1557.
Cattaneo, R., Will, H., and Schaller, H. (1984). Hepatitis B virus transcription in the
infected liver. Embo J 3, 2191-2196.
Cerdan, C., Martin, Y., Courcoul, M., Mawas, C., Birg, F., and Olive, D. (1995). CD28
costimulation regulates long-term expression of the three genes (alpha, beta,
gamma) encoding the high-affinity IL2 receptor. Res Immunol 146, 164-168.
Chisari, F. V. (1995). Hepatitis B virus transgenic mice: insights into the virus and the
disease. Hepatology 22, 1316-1325.
Chisari, F. V., and Ferrari, C. (1995a). Hepatitis B virus immunopathogenesis. Annu
Rev Immunol 13, 29-60.
Chisari, F. V., and Ferrari, C. (1995b). Hepatitis B virus immunopathology. Springer
Semin Immunopathol 17, 261-281.
115
Literatur
Chisari, F. V., Pinkert, C. A., Milich, D. R., Filippi, P., McLachlan, A., Palmiter, R. D.,
and Brinster, R. L. (1985). A transgenic mouse model of the chronic hepatitis B
surface antigen carrier state. Science 230, 1157-1160.
Chu, C. M., and Liaw, Y. F. (1995). Membrane staining for hepatitis B surface antigen
on hepatocytes: a sensitive and specific marker of active viral replication in
hepatitis B. J Clin Pathol 48, 470-473.
Cole, D. J., Weil, D. P., Shilyansky, J., Custer, M., Kawakami, Y., Rosenberg, S. A.,
and Nishimura, M. I. (1995). Characterization of the functional specificity of a
cloned T-cell receptor heterodimer recognizing the MART-1 melanoma antigen.
Cancer Res 55, 748-752.
Comans-Bitter, W. M., de Groot, R., van den Beemd, R., Neijens, H. J., Hop, W. C.,
Groeneveld, K., Hooijkaas, H., and van Dongen, J. J. (1997). Immunophenotyping
of blood lymphocytes in childhood. Reference values for lymphocyte
subpopulations. J Pediatr 130, 388-393.
Cooper, A., Paran, N., and Shaul, Y. (2003). The earliest steps in hepatitis B virus
infection. Biochim Biophys Acta 1614, 89-96.
Cooper, A., Tal, G., Lider, O., and Shaul, Y. (2005). Cytokine induction by the hepatitis
B virus capsid in macrophages is facilitated by membrane heparan sulfate and
involves TLR2. J Immunol 175, 3165-3176.
Dandri, M., Burda, M. R., Zuckerman, D. M., Wursthorn, K., Matschl, U., Pollok, J. M.,
Rogiers, X., Gocht, A., Kock, J., Blum, H. E., et al. (2005). Chronic infection with
hepatitis B viruses and antiviral drug evaluation in uPA mice after liver
repopulation with tupaia hepatocytes. J Hepatol 42, 54-60.
Dane, D. S., Cameron, C. H., and Briggs, M. (1970). Virus-like particles in serum of
patients with Australia-antigen-associated hepatitis. Lancet 1, 695-698.
Darcy, P. K., Kershaw, M. H., Trapani, J. A., and Smyth, M. J. (1998). Expression in
cytotoxic T lymphocytes of a single-chain anti-carcinoembryonic antigen antibody.
Redirected Fas ligand-mediated lysis of colon carcinoma. Eur J Immunol 28, 16631672.
Delenda, C. (2004). Lentiviral vectors: optimization of packaging, transduction and
gene expression. J Gene Med 6 Suppl 1, S125-138.
Dong, L., Ma, Q., and Whitlock, J. P., Jr. (1997). Down-regulation of major
histocompatibility complex Q1b gene expression by 2,3,7,8-tetrachlorodibenzo-pdioxin. J Biol Chem 272, 29614-29619.
Duh, E. J., Maury, W. J., Folks, T. M., Fauci, A. S., and Rabson, A. B. (1989). Tumor
necrosis factor alpha activates human immunodeficiency virus type 1 through
induction of nuclear factor binding to the NF-kappa B sites in the long terminal
repeat. Proc Natl Acad Sci U S A 86, 5974-5978.
Dumortier, J., Schonig, K., Oberwinkler, H., Low, R., Giese, T., Bujard, H.,
Schirmacher, P., and Protzer, U. (2005). Liver-specific expression of interferon
gamma following adenoviral gene transfer controls hepatitis B virus replication in
mice. Gene Ther 12, 668-677.
Dustin, M. L. (2001). Role of adhesion molecules in activation signaling in T
lymphocytes. J Clin Immunol 21, 258-263.
Dustin, M. L., and Cooper, J. A. (2000). The immunological synapse and the actin
cytoskeleton: molecular hardware for T cell signaling. Nat Immunol 1, 23-29.
116
Literatur
Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata, S.
(1998). A caspase-activated DNase that degrades DNA during apoptosis, and its
inhibitor ICAD. Nature 391, 43-50.
Engvall, E., and Perlman, P. (1971). Enzyme-linked immunosorbent assay (ELISA).
Quantitative assay of immunoglobulin G. Immunochemistry 8, 871-874.
Eshhar, Z. (1997). Tumor-specific T-bodies: towards clinical application. Cancer
Immunol Immunother 45, 131-136.
Eshhar, Z., Waks, T., Gross, G., and Schindler, D. G. (1993). Specific activation and
targeting of cytotoxic lymphocytes through chimeric single chains consisting of
antibody-binding domains and the gamma or zeta subunits of the immunoglobulin
and T-cell receptors. Proc Natl Acad Sci U S A 90, 720-724.
Falkenburg, J. H., and Kluin-Nelemans, H. C. (1999). Mismatched transplants for
refractory lymphoma? Lancet 353, 1725-1726.
Follenzi, A., Sabatino, G., Lombardo, A., Boccaccio, C., and Naldini, L. (2002). Efficient
gene delivery and targeted expression to hepatocytes in vivo by improved lentiviral
vectors. Hum Gene Ther 13, 243-260.
Friedl, P., den Boer, A. T., and Gunzer, M. (2005). Tuning immune responses: diversity
and adaptation of the immunological synapse. Nat Rev Immunol 5, 532-545.
Gale, R. P., Horowitz, M. M., Ash, R. C., Champlin, R. E., Goldman, J. M., Rimm, A. A.,
Ringden, O., Stone, J. A., and Bortin, M. M. (1994). Identical-twin bone marrow
transplants for leukemia. Ann Intern Med 120, 646-652.
Ganem, D. (1982). Persistent infection of humans with hepatitis B virus: mechanisms
and consequences. Rev Infect Dis 4, 1026-1047.
Ganem, D., Pollack, J. R., and Tavis, J. (1994). Hepatitis B virus reverse transcriptase
and its many roles in hepadnaviral genomic replication. Infect Agents Dis 3, 85-93.
Ganem, D., and Prince, A. M. (2004). Hepatitis B virus infection--natural history and
clinical consequences. N Engl J Med 350, 1118-1129.
Ganem, D., and Schneider, R. (2001). Hepadnaviridae The viruses and their
replication. In Field´s Virology (Philadelphia, Lipincott-Raven).
Garcia-Calvo, M., Peterson, E. P., Leiting, B., Ruel, R., Nicholson, D. W., and
Thornberry, N. A. (1998). Inhibition of human caspases by peptide-based and
macromolecular inhibitors. J Biol Chem 273, 32608-32613.
Gilbert, R. J., Beales, L., Blond, D., Simon, M. N., Lin, B. Y., Chisari, F. V., Stuart, D. I.,
and Rowlands, D. J. (2005). Hepatitis B small surface antigen particles are
octahedral. Proc Natl Acad Sci U S A 102, 14783-14788.
Gonzalo, J. A., Delaney, T., Corcoran, J., Goodearl, A., Gutierrez-Ramos, J. C., and
Coyle, A. J. (2001). Cutting edge: the related molecules CD28 and inducible
costimulator deliver both unique and complementary signals required for optimal T
cell activation. J Immunol 166, 1-5.
Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characteristics of a
human cell line transformed by DNA from human adenovirus type 5. J Gen Virol
36, 59-74.
Graham, F. L., and van der Eb, A. J. (1973). A new technique for the assay of
infectivity of human adenovirus 5 DNA. Virology 52, 456-467.
Gross, G., and Eshhar, Z. (1992). Endowing T cells with antibody specificity using
chimeric T cell receptors. Faseb J 6, 3370-3378.
117
Literatur
Gross, G., Waks, T., and Eshhar, Z. (1989). Expression of immunoglobulin-T-cell
receptor chimeric molecules as functional receptors with antibody-type specificity.
Proc Natl Acad Sci U S A 86, 10024-10028.
Guest, R. D., Hawkins, R. E., Kirillova, N., Cheadle, E. J., Arnold, J., O'Neill, A., Irlam,
J., Chester, K. A., Kemshead, J. T., Shaw, D. M., et al. (2005). The role of
extracellular spacer regions in the optimal design of chimeric immune receptors:
evaluation of four different scFvs and antigens. J Immunother 28, 203-211.
Guidotti, L. G., Ishikawa, T., Hobbs, M. V., Matzke, B., Schreiber, R., and Chisari, F. V.
(1996). Intracellular inactivation of the hepatitis B virus by cytotoxic T lymphocytes.
Immunity 4, 25-36.
Guidotti, L. G., Matzke, B., Schaller, H., and Chisari, F. V. (1995). High-level hepatitis B
virus replication in transgenic mice. J Virol 69, 6158-6169.
Hannet, I., Erkeller-Yuksel, F., Lydyard, P., Deneys, V., and DeBruyere, M. (1992).
Developmental and maturational changes in human blood lymphocyte
subpopulations. Immunol Today 13, 215, 218.
Heermann, K. H., and Gerlich, W. H. (1991). Surface proteins of hepatitis B viruses. In
Molecular biology of the hepatitis B virus, A. McLachlan, ed. (Boca Raton, Florida,
CRC Press), pp. 109-144.
Hege, K. M., Cooke, K. S., Finer, M. H., Zsebo, K. M., and Roberts, M. R. (1996).
Systemic T cell-independent tumor immunity after transplantation of universal
receptor-modified bone marrow into SCID mice. J Exp Med 184, 2261-2269.
Hirata, Y., Kondo, K., and Yamanishi, K. (2001). Human herpesvirus 6 downregulates
major histocompatibility complex class I in dendritic cells. J Med Virol 65, 576-583.
Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P.,
Mann, N., Mudd, S., et al. (2003). Identification of Lps2 as a key transducer of
MyD88-independent TIR signalling. Nature 424, 743-748.
Hombach, A., Heuser, C., and Abken, H. (2002). The recombinant T cell receptor
strategy: insights into structure and function of recombinant immunoreceptors on
the way towards an optimal receptor design for cellular immunotherapy. Curr Gene
Ther 2, 211-226.
Hombach, A., Heuser, C., Gerken, M., Fischer, B., Lewalter, K., Diehl, V., Pohl, C., and
Abken, H. (2000). T cell activation by recombinant FcepsilonRI gamma-chain
immune receptors: an extracellular spacer domain impairs antigen-dependent T
cell activation but not antigen recognition. Gene Ther 7, 1067-1075.
Hombach, A., Koch, D., Sircar, R., Heuser, C., Diehl, V., Kruis, W., Pohl, C., and
Abken, H. (1999). A chimeric receptor that selectively targets membrane-bound
carcinoembryonic antigen (mCEA) in the presence of soluble CEA. Gene Ther 6,
300-304.
Hombach, A., Mathas, S., Jensen, M., Tillmann, T., Menges, M., Diehl, V., Kruis, W.,
and Pohl, C. (1997). Activation of resting T cells against the CA 72-4 tumor
antigen with an anti-CD3/CA 72-4 bispecific antibody in combination with a
costimulatory anti-CD28 antibody. Anticancer Res 17, 2025-2032.
Hombach, A., Pohl, C., Heuser, C., Sircar, R., Diehl, V., and Abken, H. (1998). Isolation
of single chain antibody fragments with specificity for cell surface antigens by
phage display utilizing internal image anti-idiotypic antibodies. J Immunol Methods
218, 53-61.
118
Literatur
Hombach, A., Schlimper, C., Sievers, E., Frank, S., Schild, H. H., Sauerbruch, T.,
Schmidt-Wolf, I. G., and Abken, H. (2005). A recombinant anti-CEA
immunoreceptor with combined CD3zeta - CD28 signalling targets T cells from
colorectal cancer patients against their tumour cells. Gut.
Hombach, A., Schlimper, C., Sievers, E., Frank, S., Schild, H. H., Sauerbruch, T.,
Schmidt-Wolf, I. G., and Abken, H. (2006). A recombinant anti-carcinoembryonic
antigen immunoreceptor with combined CD3zeta-CD28 signalling targets T cells
from colorectal cancer patients against their tumour cells. Gut 55, 1156-1164.
Hombach, A., Sent, D., Schneider, C., Heuser, C., Koch, D., Pohl, C., Seliger, B., and
Abken, H. (2001a). T-cell activation by recombinant receptors: CD28 costimulation
is required for interleukin 2 secretion and receptor-mediated T-cell proliferation but
does not affect receptor-mediated target cell lysis. Cancer Res 61, 1976-1982.
Hombach, A., Wieczarkowiecz, A., Marquardt, T., Heuser, C., Usai, L., Pohl, C.,
Seliger, B., and Abken, H. (2001b). Tumor-specific T cell activation by
recombinant immunoreceptors: CD3 zeta signaling and CD28 costimulation are
simultaneously required for efficient IL-2 secretion and can be integrated into one
combined CD28/CD3 zeta signaling receptor molecule. J Immunol 167, 61236131.
Hoofnagle, J. H. (1981). Serologic markers of hepatitis B virus infection. Annu Rev Med
32, 1-11.
Horowitz, M. M., Gale, R. P., Sondel, P. M., Goldman, J. M., Kersey, J., Kolb, H. J.,
Rimm, A. A., Ringden, O., Rozman, C., Speck, B., and et al. (1990). Graft-versusleukemia reactions after bone marrow transplantation. Blood 75, 555-562.
Huovila, A. P., Eder, A. M., and Fuller, S. D. (1992). Hepatitis B surface antigen
assembles in a post-ER, pre-Golgi compartment. J Cell Biol 118, 1305-1320.
Inohara, N., Ogura, Y., Chen, F. F., Muto, A., and Nunez, G. (2001). Human Nod1
confers responsiveness to bacterial lipopolysaccharides. J Biol Chem 276, 25512554.
Inoue, H., Nojima, H., and Okayama, H. (1990). High efficiency transformation of
Escherichia coli with plasmids. Gene 96, 23-28.
Isogawa, M., Furuichi, Y., and Chisari, F. V. (2005a). Oscillating CD8(+) T cell effector
functions after antigen recognition in the liver. Immunity 23, 53-63.
Isogawa, M., Kakimi, K., Kamamoto, H., Protzer, U., and Chisari, F. V. (2005b).
Differential dynamics of the peripheral and intrahepatic cytotoxic T lymphocyte
response to hepatitis B surface antigen. Virology 333, 293-300.
Isogawa, M., Robek, M. D., Furuichi, Y., and Chisari, F. V. (2005c). Toll-like receptor
signaling inhibits hepatitis B virus replication in vivo. J Virol 79, 7269-7272.
Jamieson, C., McCaffrey, P. G., Rao, A., and Sen, R. (1991). Physiologic activation of
T cells via the T cell receptor induces NF-kappa B. J Immunol 147, 416-420.
Janeway, A. J., Travers, P., Walport, M., and Shlomchik, M. (2004). Immunobiology
The Immune System in Health and Disease, 6 edn (New York, Garland
Publishing).
Jean-Jean, O., Levrero, M., Will, H., Perricaudet, M., and Rossignol, J. M. (1989).
Expression mechanism of the hepatitis B virus (HBV) C gene and biosynthesis of
HBe antigen. Virology 170, 99-106.
Jensen, M., Tan, G., Forman, S., Wu, A. M., and Raubitschek, A. (1998). CD20 is a
molecular target for scFvFc:zeta receptor redirected T cells: implications for
119
Literatur
cellular immunotherapy of CD20+ malignancy. Biol Blood Marrow Transplant 4,
75-83.
Kajino, K., Jilbert, A. R., Saputelli, J., Aldrich, C. E., Cullen, J., and Mason, W. S.
(1994). Woodchuck hepatitis virus infections: very rapid recovery after a prolonged
viremia and infection of virtually every hepatocyte. J Virol 68, 5792-5803.
Kavanaugh, M. P., Miller, D. G., Zhang, W., Law, W., Kozak, S. L., Kabat, D., and
Miller, A. D. (1994). Cell-surface receptors for gibbon ape leukemia virus and
amphotropic murine retrovirus are inducible sodium-dependent phosphate
symporters. Proc Natl Acad Sci U S A 91, 7071-7075.
Kennedy, N. J., Kataoka, T., Tschopp, J., and Budd, R. C. (1999). Caspase activation
is required for T cell proliferation. J Exp Med 190, 1891-1896.
Kim, V. N., Mitrophanous, K., Kingsman, S. M., and Kingsman, A. J. (1998). Minimal
requirement for a lentivirus vector based on human immunodeficiency virus type 1.
J Virol 72, 811-816.
Klenerman, P., and Hill, A. (2005). T cells and viral persistence: lessons from diverse
infections. Nat Immunol 6, 873-879.
Kock, J., and Schlicht, H. J. (1993). Analysis of the earliest steps of hepadnavirus
replication: genome repair after infectious entry into hepatocytes does not depend
on viral polymerase activity. J Virol 67, 4867-4874.
Kolanus, W., Romeo, C., and Seed, B. (1993). T cell activation by clustered tyrosine
kinases. Cell 74, 171-183.
Kolb, H. J., Mittermuller, J., Clemm, C., Holler, E., Ledderose, G., Brehm, G., Heim, M.,
and Wilmanns, W. (1990). Donor leukocyte transfusions for treatment of recurrent
chronic myelogenous leukemia in marrow transplant patients. Blood 76, 24622465.
Kolb, H. J., Schattenberg, A., Goldman, J. M., Hertenstein, B., Jacobsen, N., Arcese,
W., Ljungman, P., Ferrant, A., Verdonck, L., Niederwieser, D., et al. (1995). Graftversus-leukemia effect of donor lymphocyte transfusions in marrow grafted
patients. Blood 86, 2041-2050.
Kotwal, G. J. (1997). Microorganisms and their interaction with the immune system. J
Leukoc Biol 62, 415-429.
Krause, A., Guo, H. F., Latouche, J. B., Tan, C., Cheung, N. K., and Sadelain, M.
(1998). Antigen-dependent CD28 signaling selectively enhances survival and
proliferation in genetically modified activated human primary T lymphocytes. J Exp
Med 188, 619-626.
Kruppa, G., Thoma, B., Machleidt, T., Wiegmann, K., and Kronke, M. (1992). Inhibition
of tumor necrosis factor (TNF)-mediated NF-kappa B activation by selective
blockade of the human 55-kDa TNF receptor. J Immunol 148, 3152-3157.
Kuerschner, T. (2000). Construction and screening of antibody libraries against surface
antigens. PhD Thesis, Ruprecht-Karls-Universität, Heidelberg, Germany.
Kurt-Jones, E. A., Popova, L., Kwinn, L., Haynes, L. M., Jones, L. P., Tripp, R. A.,
Walsh, E. E., Freeman, M. W., Golenbock, D. T., Anderson, L. J., and Finberg, R.
W. (2000). Pattern recognition receptors TLR4 and CD14 mediate response to
respiratory syncytial virus. Nat Immunol 1, 398-401.
Kurts, C. (2000). Cross-presentation: inducing CD8 T cell immunity and tolerance. J
Mol Med 78, 326-332.
120
Literatur
Kuwana, Y., Asakura, Y., Utsunomiya, N., Nakanishi, M., Arata, Y., Itoh, S., Nagase,
F., and Kurosawa, Y. (1987). Expression of chimeric receptor composed of
immunoglobulin-derived V regions and T-cell receptor-derived C regions. Biochem
Biophys Res Commun 149, 960-968.
Lam, J. S., Reeves, M. E., Cowherd, R., Rosenberg, S. A., and Hwu, P. (1996).
Improved gene transfer into human lymphocytes using retroviruses with the gibbon
ape leukemia virus envelope. Hum Gene Ther 7, 1415-1422.
Landau, N. R., and Littman, D. R. (1992). Packaging system for rapid production of
murine leukemia virus vectors with variable tropism. J Virol 66, 5110-5113.
Lanford, R. E., Chavez, D., Brasky, K. M., Burns, R. B., 3rd, and Rico-Hesse, R.
(1998). Isolation of a hepadnavirus from the woolly monkey, a New World primate.
Proc Natl Acad Sci U S A 95, 5757-5761.
Lee, S. H., Shin, M. S., Lee, H. S., Bae, J. H., Lee, H. K., Kim, H. S., Kim, S. Y., Jang,
J. J., Joo, M., Kang, Y. K., et al. (2001). Expression of Fas and Fas-related
molecules in human hepatocellular carcinoma. Hum Pathol 32, 250-256.
Lieberman, J. (2003). The ABCs of granule-mediated cytotoxicity: new weapons in the
arsenal. Nat Rev Immunol 3, 361-370.
Lien, J. M., Aldrich, C. E., and Mason, W. S. (1986). Evidence that a capped
oligoribonucleotide is the primer for duck hepatitis B virus plus-strand DNA
synthesis. J Virol 57, 229-236.
Lien, J. M., Petcu, D. J., Aldrich, C. E., and Mason, W. S. (1987). Initiation and
termination of duck hepatitis B virus DNA synthesis during virus maturation. J Virol
61, 3832-3840.
Linette, G. P., and Korsmeyer, S. J. (1994). Differentiation and cell death: lessons from
the immune system. Curr Opin Cell Biol 6, 809-815.
Liu, H., Komai-Koma, M., Xu, D., and Liew, F. Y. (2006). Toll-like receptor 2 signaling
modulates the functions of CD4+ CD25+ regulatory T cells. Proc Natl Acad Sci U
S A 103, 7048-7053.
Liu, Y. J., Zhang, J., Lane, P. J., Chan, E. Y., and MacLennan, I. C. (1991). Sites of
specific B cell activation in primary and secondary responses to T cell-dependent
and T cell-independent antigens. Eur J Immunol 21, 2951-2962.
Lustgarten, J., and Eshhar, Z. (1995). Specific elimination of IgE production using T cell
lines expressing chimeric T cell receptor genes. Eur J Immunol 25, 2985-2991.
Lustgarten, J., Waks, T., and Eshhar, Z. (1991). CD4 and CD8 accessory molecules
function through interactions with major histocompatibility complex molecules
which are not directly associated with the T cell receptor-antigen complex. Eur J
Immunol 21, 2507-2515.
Mangold, C. M., and Streeck, R. E. (1993). Mutational analysis of the cysteine residues
in the hepatitis B virus small envelope protein. J Virol 67, 4588-4597.
Maraninchi, D., Vernant, J. P., Gluckman, E., Bordigoni, A., Fiere, D., Freycon, M.,
Gratecos, N., Harousseau, J. L., Flesch, M., Leblond-Missenard, V., and et al.
(1986). [Allogenic bone marrow grafts in acute myeloid leukemias. A retrospective
study in 111 grafted patients in first complete remission]. Presse Med 15, 20932096.
Marion, P. L., Oshiro, L. S., Regnery, D. C., Scullard, G. H., and Robinson, W. S.
(1980). A virus in Beechey ground squirrels that is related to hepatitis B virus of
humans. Proc Natl Acad Sci U S A 77, 2941-2945.
121
Literatur
Masiero, S., Del Vecchio, C., Gavioli, R., Mattiuzzo, G., Cusi, M. G., Micheli, L.,
Gennari, F., Siccardi, A., Marasco, W. A., Palu, G., and Parolin, C. (2005). T-cell
engineering by a chimeric T-cell receptor with antibody-type specificity for the HIV1 gp120. Gene Ther 12, 299-310.
Mason, W. S., Seal, G., and Summers, J. (1980). Virus of Pekin ducks with structural
and biological relatedness to human hepatitis B virus. J Virol 36, 829-836.
McCafferty, J., Griffiths, A. D., Winter, G., and Chiswell, D. J. (1990). Phage antibodies:
filamentous phage displaying antibody variable domains. Nature 348, 552-554.
Medana, I. M., Gallimore, A., Oxenius, A., Martinic, M. M., Wekerle, H., and Neumann,
H. (2000). MHC class I-restricted killing of neurons by virus-specific CD8+ T
lymphocytes is effected through the Fas/FasL, but not the perforin pathway. Eur J
Immunol 30, 3623-3633.
Mels, G. C., Bellati, G., Leandro, G., Brunetto, M. R., Vicari, O., Borzio, M., Piantino,
P., Fornaciari, G., Scudeller, G., Angeli, G., and et al. (1994). Fluctuations in
viremia, aminotransferases and IgM antibody to hepatitis B core antigen in chronic
hepatitis B patients with disease exacerbations. Liver 14, 175-181.
Meuleman, P., Libbrecht, L., De Vos, R., de Hemptinne, B., Gevaert, K.,
Vandekerckhove, J., Roskams, T., and Leroux-Roels, G. (2005). Morphological
and biochemical characterization of a human liver in a uPA-SCID mouse chimera.
Hepatology 41, 847-856.
Michael, N., Martin, T. E., Nicolae, D., Kim, N., Padjen, K., Zhan, P., Nguyen, H.,
Pinkert, C., and Storb, U. (2002). Effects of sequence and structure on the
hypermutability of immunoglobulin genes. Immunity 16, 123-134.
Milich, D. R., Jones, J., Hughes, J., and Maruyama, T. (1993). Role of T-cell tolerance
in the persistence of hepatitis B virus infection. J Immunother 14, 226-233.
Miller, D. G., Adam, M. A., and Miller, A. D. (1990). Gene transfer by retrovirus vectors
occurs only in cells that are actively replicating at the time of infection. Mol Cell
Biol 10, 4239-4242.
Minami, Y., Kono, T., Miyazaki, T., and Taniguchi, T. (1993). The IL-2 receptor
complex: its structure, function, and target genes. Annu Rev Immunol 11, 245-268.
Mitsuyasu, R. T., Anton, P. A., Deeks, S. G., Scadden, D. T., Connick, E., Downs, M.
T., Bakker, A., Roberts, M. R., June, C. H., Jalali, S., et al. (2000). Prolonged
survival and tissue trafficking following adoptive transfer of CD4zeta gene-modified
autologous CD4(+) and CD8(+) T cells in human immunodeficiency virus-infected
subjects. Blood 96, 785-793.
Moeller, M., Haynes, N. M., Trapani, J. A., Teng, M. W., Jackson, J. T., Tanner, J. E.,
Cerutti, L., Jane, S. M., Kershaw, M. H., Smyth, M. J., and Darcy, P. K. (2004). A
functional role for CD28 costimulation in tumor recognition by single-chain
receptor-modified T cells. Cancer Gene Ther 11, 371-379.
Moraleda, G., Saputelli, J., Aldrich, C. E., Averett, D., Condreay, L., and Mason, W. S.
(1997). Lack of effect of antiviral therapy in nondividing hepatocyte cultures on the
closed circular DNA of woodchuck hepatitis virus. J Virol 71, 9392-9399.
Morgan, R. A., Dudley, M. E., Wunderlich, J. R., Hughes, M. S., Yang, J. C., Sherry, R.
M., Royal, R. E., Topalian, S. L., Kammula, U. S., Restifo, N. P., et al. (2006).
Cancer Regression in Patients After Transfer of Genetically Engineered
Lymphocytes. Science.
122
Literatur
Moritz, D., Wels, W., Mattern, J., and Groner, B. (1994). Cytotoxic T lymphocytes with
a grafted recognition specificity for ERBB2-expressing tumor cells. Proc Natl Acad
Sci U S A 91, 4318-4322.
Muhlebach, M. D., Schmitt, I., Steidl, S., Stitz, J., Schweizer, M., Blankenstein, T.,
Cichutek, K., and Uckert, W. (2003). Transduction efficiency of MLV but not of
HIV-1 vectors is pseudotype dependent on human primary T lymphocytes. J Mol
Med 81, 801-810.
Mullbacher, A., Lobigs, M., Hla, R. T., Tran, T., Stehle, T., and Simon, M. M. (2002).
Antigen-dependent release of IFN-gamma by cytotoxic T cells up-regulates Fas on
target cells and facilitates exocytosis-independent specific target cell lysis. J
Immunol 169, 145-150.
Neurath, A. R., Kent, S. B., Strick, N., Taylor, P., and Stevens, C. E. (1985). Hepatitis B
virus contains pre-S gene-encoded domains. Nature 315, 154-156.
Nicholson, D. W., Ali, A., Thornberry, N. A., Vaillancourt, J. P., Ding, C. K., Gallant, M.,
Gareau, Y., Griffin, P. R., Labelle, M., Lazebnik, Y. A., and et al. (1995).
Identification and inhibition of the ICE/CED-3 protease necessary for mammalian
apoptosis. Nature 376, 37-43.
O'Connell, J., O'Sullivan, G. C., Collins, J. K., and Shanahan, F. (1996). The Fas
counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas
ligand. J Exp Med 184, 1075-1082.
Pan, Q., Gollapudi, A. S., and Dave, V. P. (2004). Biochemical evidence for the
presence of a single CD3delta and CD3gamma chain in the surface T cell
receptor/CD3 complex. J Biol Chem 279, 51068-51074.
Patzer, E. J., Nakamura, G. R., Simonsen, C. C., Levinson, A. D., and Brands, R.
(1986). Intracellular assembly and packaging of hepatitis B surface antigen
particles occur in the endoplasmic reticulum. J Virol 58, 884-892.
Peng, G., Guo, Z., Kiniwa, Y., Voo, K. S., Peng, W., Fu, T., Wang, D. Y., Li, Y., Wang,
H. Y., and Wang, R. F. (2005). Toll-like receptor 8-mediated reversal of CD4+
regulatory T cell function. Science 309, 1380-1384.
Penna, A., Artini, M., Cavalli, A., Levrero, M., Bertoletti, A., Pilli, M., Chisari, F. V.,
Rehermann, B., Del Prete, G., Fiaccadori, F., and Ferrari, C. (1996). Long-lasting
memory T cell responses following self-limited acute hepatitis B. J Clin Invest 98,
1185-1194.
Penna, A., Chisari, F. V., Bertoletti, A., Missale, G., Fowler, P., Giuberti, T., Fiaccadori,
F., and Ferrari, C. (1991). Cytotoxic T lymphocytes recognize an HLA-A2restricted epitope within the hepatitis B virus nucleocapsid antigen. J Exp Med
174, 1565-1570.
Peters, P. J., Borst, J., Oorschot, V., Fukuda, M., Krahenbuhl, O., Tschopp, J., Slot, J.
W., and Geuze, H. J. (1991). Cytotoxic T lymphocyte granules are secretory
lysosomes, containing both perforin and granzymes. J Exp Med 173, 1099-1109.
Pizarro, J. C., Vulliez-le Normand, B., Riottot, M. M., Budkowska, A., and Bentley, G. A.
(2001). Structural and functional characterization of a monoclonal antibody specific
for the preS1 region of hepatitis B virus. FEBS Lett 509, 463-468.
Pollack, J. R., and Ganem, D. (1994). Site-specific RNA binding by a hepatitis B virus
reverse transcriptase initiates two distinct reactions: RNA packaging and DNA
synthesis. J Virol 68, 5579-5587.
123
Literatur
Protzer, U., Nassal, M., Chiang, P. W., Kirschfink, M., and Schaller, H. (1999).
Interferon gene transfer by a hepatitis B virus vector efficiently suppresses wildtype virus infection. Proc Natl Acad Sci U S A 96, 10818-10823.
Protzer, U., and Schaller, H. (2000). Immune escape by hepatitis B viruses. Virus
Genes 21, 27-37.
Pule, M. A., Straathof, K. C., Dotti, G., Heslop, H. E., Rooney, C. M., and Brenner, M.
K. (2005). A chimeric T cell antigen receptor that augments cytokine release and
supports clonal expansion of primary human T cells. Mol Ther 12, 933-941.
Rehermann, B. (2000). Intrahepatic T cells in hepatitis B: viral control versus liver cell
injury. J Exp Med 191, 1263-1268.
Rehermann, B., Ferrari, C., Pasquinelli, C., and Chisari, F. V. (1996a). The hepatitis B
virus persists for decades after patients' recovery from acute viral hepatitis despite
active maintenance of a cytotoxic T-lymphocyte response. Nat Med 2, 1104-1108.
Rehermann, B., Fowler, P., Sidney, J., Person, J., Redeker, A., Brown, M., Moss, B.,
Sette, A., and Chisari, F. V. (1995). The cytotoxic T lymphocyte response to
multiple hepatitis B virus polymerase epitopes during and after acute viral
hepatitis. J Exp Med 181, 1047-1058.
Rehermann, B., Lau, D., Hoofnagle, J. H., and Chisari, F. V. (1996b). Cytotoxic T
lymphocyte responsiveness after resolution of chronic hepatitis B virus infection. J
Clin Invest 97, 1655-1665.
Rehermann, B., and Nascimbeni, M. (2005). Immunology of hepatitis B virus and
hepatitis C virus infection. Nat Rev Immunol 5, 215-229.
Ren, S., and Nassal, M. (2001). Hepatitis B virus (HBV) virion and covalently closed
circular DNA formation in primary tupaia hepatocytes and human hepatoma cell
lines upon HBV genome transduction with replication-defective adenovirus
vectors. J Virol 75, 1104-1116.
Ribeiro, R. M., Lo, A., and Perelson, A. S. (2002). Dynamics of hepatitis B virus
infection. Microbes Infect 4, 829-835.
Rijntjes, P. J., Moshage, H. J., and Yap, S. H. (1988). In vitro infection of primary
cultures of cryopreserved adult human hepatocytes with hepatitis B virus. Virus
Res 10, 95-109.
Riordan, S. M., Skinner, N., Kurtovic, J., Locarnini, S., and Visvanathan, K. (2006).
Reduced expression of toll-like receptor 2 on peripheral monocytes in patients with
chronic hepatitis B. Clin Vaccine Immunol 13, 972-974.
Roberts, M. R., Qin, L., Zhang, D., Smith, D. H., Tran, A. C., Dull, T. J., Groopman, J.
E., Capon, D. J., Byrn, R. A., and Finer, M. H. (1994). Targeting of human
immunodeficiency virus-infected cells by CD8+ T lymphocytes armed with
universal T-cell receptors. Blood 84, 2878-2889.
Robinson, W. S. (1996). Biology of human hepatitis viruses. In, D. Zakim, and T. D.
Boyer, eds. (Philadelphia, W.B. Saunders Company), pp. 1171-1174.
Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998). A
family of human receptors structurally related to Drosophila Toll. Proc Natl Acad
Sci U S A 95, 588-593.
Roe, T., Reynolds, T. C., Yu, G., and Brown, P. O. (1993). Integration of murine
leukemia virus DNA depends on mitosis. Embo J 12, 2099-2108.
124
Literatur
Rooney, C. M., Smith, C. A., Ng, C. Y., Loftin, S., Li, C., Krance, R. A., Brenner, M. K.,
and Heslop, H. E. (1995). Use of gene-modified virus-specific T lymphocytes to
control Epstein-Barr-virus-related lymphoproliferation. Lancet 345, 9-13.
Rossner, M. T. (1992). Review: hepatitis B virus X-gene product: a promiscuous
transcriptional activator. J Med Virol 36, 101-117.
Satoh, O., Imai, H., Yoneyama, T., Miyamura, T., Utsumi, H., Inoue, K., and Umeda, M.
(2000). Membrane structure of the hepatitis B virus surface antigen particle. J
Biochem (Tokyo) 127, 543-550.
Schettler, C. H. (1971). Goose virus hepatitis in the Canada Goose and Snow Goose. J
Wildl Dis 7, 147-148.
Schlienger, K., Craighead, N., Lee, K. P., Levine, B. L., and June, C. H. (2000).
Efficient priming of protein antigen-specific human CD4(+) T cells by monocytederived dendritic cells. Blood 96, 3490-3498.
Schulze-Bergkamen, H., Untergasser, A., Dax, A., Vogel, H., Buchler, P., Klar, E.,
Lehnert, T., Friess, H., Buchler, M. W., Kirschfink, M., et al. (2003). Primary human
hepatocytes--a valuable tool for investigation of apoptosis and hepatitis B virus
infection. J Hepatol 38, 736-744.
Schwartz, R. H. (2003). T cell anergy. Annu Rev Immunol 21, 305-334.
Screpanti, V., Wallin, R. P., Grandien, A., and Ljunggren, H. G. (2005). Impact of
FASL-induced apoptosis in the elimination of tumor cells by NK cells. Mol Immunol
42, 495-499.
Scudiero, D. A., Shoemaker, R. H., Paull, K. D., Monks, A., Tierney, S., Nofziger, T. H.,
Currens, M. J., Seniff, D., and Boyd, M. R. (1988). Evaluation of a soluble
tetrazolium/formazan assay for cell growth and drug sensitivity in culture using
human and other tumor cell lines. Cancer Res 48, 4827-4833.
Seglen, P. O. (1976). Preparation of isolated rat liver cells. Methods Cell Biol 13, 29-83.
Sells, M. A., Chen, M. L., and Acs, G. (1987). Production of hepatitis B virus particles in
Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc Natl Acad Sci U
S A 84, 1005-1009.
Sigal, L. J., Crotty, S., Andino, R., and Rock, K. L. (1999). Cytotoxic T-cell immunity to
virus-infected non-haematopoietic cells requires presentation of exogenous
antigen. Nature 398, 77-80.
Sinn, P. L., Sauter, S. L., and McCray, P. B., Jr. (2005). Gene therapy progress and
prospects: development of improved lentiviral and retroviral vectors--design,
biosafety, and production. Gene Ther 12, 1089-1098.
Slavin, S., Naparstek, E., Nagler, A., Kapelushnik, Y., Ackerstein, A., and Or, R.
(1996). Allogeneic cell therapy: the treatment of choice for all hematologic
malignancies relapsing post BMT. Blood 87, 4011-4013.
Sprengel, R., Kaleta, E. F., and Will, H. (1988). Isolation and characterization of a
hepatitis B virus endemic in herons. J Virol 62, 3832-3839.
Sprinzl, M. F., Oberwinkler, H., Schaller, H., and Protzer, U. (2001). Transfer of
hepatitis B virus genome by adenovirus vectors into cultured cells and mice:
crossing the species barrier. J Virol 75, 5108-5118.
Stancovski, I., Schindler, D. G., Waks, T., Yarden, Y., Sela, M., and Eshhar, Z. (1993).
Targeting of T lymphocytes to Neu/HER2-expressing cells using chimeric single
chain Fv receptors. J Immunol 151, 6577-6582.
125
Literatur
Stevens, C. E., Beasley, R. P., Tsui, J., and Lee, W. C. (1975). Vertical transmission of
hepatitis B antigen in Taiwan. N Engl J Med 292, 771-774.
Stoeckl, L., Funk, A., Kopitzki, A., Brandenburg, B., Oess, S., Will, H., Sirma, H., and
Hildt, E. (2006). Identification of a structural motif crucial for infectivity of hepatitis
B viruses. Proc Natl Acad Sci U S A 103, 6730-6734.
Stoop, J. N., van der Molen, R. G., Baan, C. C., van der Laan, L. J., Kuipers, E. J.,
Kusters, J. G., and Janssen, H. L. (2005). Regulatory T cells contribute to the
impaired immune response in patients with chronic hepatitis B virus infection.
Hepatology 41, 771-778.
Summers, J., Smolec, J. M., and Snyder, R. (1978). A virus similar to human hepatitis
B virus associated with hepatitis and hepatoma in woodchucks. Proc Natl Acad Sci
U S A 75, 4533-4537.
Sureau, C., Eichberg, J. W., Hubbard, G. B., Romet-Lemonne, J. L., and Essex, M.
(1988). A molecularly cloned hepatitis B virus produced in vitro is infectious in a
chimpanzee. J Virol 62, 3064-3067.
Sureau, C., Romet-Lemonne, J. L., Mullins, J. I., and Essex, M. (1986). Production of
hepatitis B virus by a differentiated human hepatoma cell line after transfection
with cloned circular HBV DNA. Cell 47, 37-47.
Sutton, R. E., Reitsma, M. J., Uchida, N., and Brown, P. O. (1999). Transduction of
human progenitor hematopoietic stem cells by human immunodeficiency virus type
1-based vectors is cell cycle dependent. J Virol 73, 3649-3660.
Suvas, S., Azkur, A. K., Kim, B. S., Kumaraguru, U., and Rouse, B. T. (2004).
CD4+CD25+ regulatory T cells control the severity of viral immunoinflammatory
lesions. J Immunol 172, 4123-4132.
Suzuki, I., and Fink, P. J. (2000). The dual functions of fas ligand in the regulation of
peripheral CD8+ and CD4+ T cells. Proc Natl Acad Sci U S A 97, 1707-1712.
Tong-Starkesen, S. E., Luciw, P. A., and Peterlin, B. M. (1989). Signaling through T
lymphocyte surface proteins, TCR/CD3 and CD28, activates the HIV-1 long
terminal repeat. J Immunol 142, 702-707.
Trambas, C. M., and Griffiths, G. M. (2003). Delivering the kiss of death. Nat Immunol
4, 399-403.
Tran, A. C., Zhang, D., Byrn, R., and Roberts, M. R. (1995). Chimeric zeta-receptors
direct human natural killer (NK) effector function to permit killing of NK-resistant
tumor cells and HIV-infected T lymphocytes. J Immunol 155, 1000-1009.
Tuttleman, J. S., Pourcel, C., and Summers, J. (1986). Formation of the pool of
covalently closed circular viral DNA in hepadnavirus-infected cells. Cell 47, 451460.
Untergasser, A., Zedler, U., Langenkamp, A., Hosel, M., Quasdorff, M., Esser, K.,
Dienes, H. P., Tappertzhofen, B., Kolanus, W., and Protzer, U. (2006). Dendritic
cells take up viral antigens but do not support the early steps of hepatitis B virus
infection. Hepatology 43, 539-547.
Vigna, E., and Naldini, L. (2000). Lentiviral vectors: excellent tools for experimental
gene transfer and promising candidates for gene therapy. J Gene Med 2, 308-316.
Volkmann, M., Schiff, J. H., Hajjar, Y., Otto, G., Stilgenbauer, F., Fiehn, W., Galle, P.
R., and Hofmann, W. J. (2001). Loss of CD95 expression is linked to most but not
all p53 mutants in European hepatocellular carcinoma. J Mol Med 79, 594-600.
126
Literatur
Walter, E., Keist, R., Niederost, B., Pult, I., and Blum, H. E. (1996). Hepatitis B virus
infection of tupaia hepatocytes in vitro and in vivo. Hepatology 24, 1-5.
Walter, E. A., Greenberg, P. D., Gilbert, M. J., Finch, R. J., Watanabe, K. S., Thomas,
E. D., and Riddell, S. R. (1995). Reconstitution of cellular immunity against
cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell
clones from the donor. N Engl J Med 333, 1038-1044.
Walton, C. M., Wu, C. H., and Wu, G. Y. (2001). A ribonuclease H-oligo DNA conjugate
that specifically cleaves hepatitis B viral messenger RNA. Bioconjug Chem 12,
770-775.
Wang, G. H., and Seeger, C. (1992). The reverse transcriptase of hepatitis B virus acts
as a protein primer for viral DNA synthesis. Cell 71, 663-670.
Weigert, M., Perry, R., Kelley, D., Hunkapiller, T., Schilling, J., and Hood, L. (1980).
The joining of V and J gene segments creates antibody diversity. Nature 283, 497499.
Weigert, M. G., Cesari, I. M., Yonkovich, S. J., and Cohn, M. (1970). Variability in the
lambda light chain sequences of mouse antibody. Nature 228, 1045-1047.
Weijtens, M. E., Willemsen, R. A., Hart, E. H., and Bolhuis, R. L. (1998a). A retroviral
vector system 'STITCH' in combination with an optimized single chain antibody
chimeric receptor gene structure allows efficient gene transduction and expression
in human T lymphocytes. Gene Ther 5, 1195-1203.
Weijtens, M. E., Willemsen, R. A., Valerio, D., Stam, K., and Bolhuis, R. L. (1996).
Single chain Ig/gamma gene-redirected human T lymphocytes produce cytokines,
specifically lyse tumor cells, and recycle lytic capacity. J Immunol 157, 836-843.
Weijtens, M. E., Willemsen, R. A., van Krimpen, B. A., and Bolhuis, R. L. (1998b).
Chimeric scFv/gamma receptor-mediated T-cell lysis of tumor cells is coregulated
by adhesion and accessory molecules. Int J Cancer 77, 181-187.
Weislow, O. S., Kiser, R., Fine, D. L., Bader, J., Shoemaker, R. H., and Boyd, M. R.
(1989). New soluble-formazan assay for HIV-1 cytopathic effects: application to
high-flux screening of synthetic and natural products for AIDS-antiviral activity. J
Natl Cancer Inst 81, 577-586.
Werle-Lapostolle, B., Bowden, S., Locarnini, S., Wursthorn, K., Petersen, J., Lau, G.,
Trepo, C., Marcellin, P., Goodman, Z., Delaney, W. E. t., et al. (2004). Persistence
of cccDNA during the natural history of chronic hepatitis B and decline during
adefovir dipivoxil therapy. Gastroenterology 126, 1750-1758.
Wiegers, G. J., Stec, I. E., Klinkert, W. E., Linthorst, A. C., and Reul, J. M. (2001).
Bidirectional effects of corticosterone on splenic T-cell activation: critical role of cell
density and culture time. Neuroendocrinology 73, 139-148.
Wieland, S., Thimme, R., Purcell, R. H., and Chisari, F. V. (2004). Genomic analysis of
the host response to hepatitis B virus infection. Proc Natl Acad Sci U S A 101,
6669-6674.
Willemsen, R. A., Weijtens, M. E., Ronteltap, C., Eshhar, Z., Gratama, J. W., Chames,
P., and Bolhuis, R. L. (2000). Grafting primary human T lymphocytes with cancerspecific chimeric single chain and two chain TCR. Gene Ther 7, 1369-1377.
Woodland, D. L., and Dutton, R. W. (2003). Heterogeneity of CD4(+) and CD8(+) T
cells. Curr Opin Immunol 15, 336-342.
Wursthorn, K., Lutgehetmann, M., Dandri, M., Volz, T., Buggisch, P., Zollner, B.,
Longerich, T., Schirmacher, P., Metzler, F., Zankel, M., et al. (2006). Peginterferon
127
Literatur
alpha-2b plus adefovir induce strong cccDNA decline and HBsAg reduction in
patients with chronic hepatitis B. Hepatology 44, 675-684.
Xu, D., Komai-Koma, M., and Liew, F. Y. (2005). Expression and function of Toll-like
receptor on T cells. Cell Immunol 233, 85-89.
Yan, R. Q., Su, J. J., Huang, D. R., Gan, Y. C., Yang, C., and Huang, G. H. (1996).
Human hepatitis B virus and hepatocellular carcinoma. I. Experimental infection of
tree shrews with hepatitis B virus. J Cancer Res Clin Oncol 122, 283-288.
Yang, O. O., Tran, A. C., Kalams, S. A., Johnson, R. P., Roberts, M. R., and Walker, B.
D. (1997). Lysis of HIV-1-infected cells and inhibition of viral replication by
universal receptor T cells. Proc Natl Acad Sci U S A 94, 11478-11483.
Yang, Y., Xiang, Z., Ertl, H. C., and Wilson, J. M. (1995). Upregulation of class I major
histocompatibility complex antigens by interferon gamma is necessary for T-cellmediated elimination of recombinant adenovirus-infected hepatocytes in vivo. Proc
Natl Acad Sci U S A 92, 7257-7261.
Yoneyama, M., Kikuchi, M., Matsumoto, K., Imaizumi, T., Miyagishi, M., Taira, K., Foy,
E., Loo, Y. M., Gale, M., Jr., Akira, S., et al. (2005). Shared and unique functions
of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity.
J Immunol 175, 2851-2858.
Zhang, Y. Y., Zhang, B. H., Theele, D., Litwin, S., Toll, E., and Summers, J. (2003).
Single-cell analysis of covalently closed circular DNA copy numbers in a
hepadnavirus-infected liver. Proc Natl Acad Sci U S A 100, 12372-12377.
Zoulim, F., and Seeger, C. (1994). Reverse transcription in hepatitis B viruses is
primed by a tyrosine residue of the polymerase. J Virol 68, 6-13.
128
Abkürzungsverzeichnis
6 Abkürzungsverzeichnis
A
Adenin
AK
Antikörper
AP
alkalische Phosphatase
APS
Ammoniumpersulfat
Amp
Ampicillin
AmpR
Ampicillin-Resistenz
As
Aminosäure
bp
Basenpaare
BSA
Bovine serum albumin
C
Cytosin
cccDNA
kovalent geschlossene zirkuläre (covalently closed circular) DNA
cDNA
zur mRNA komplementäre DNA (copyDNA)
CMV
Zytomegalievirus (Cytomegalovirus)
CMV-Promotor
CMV-IE-Promotor
cTCR
chimärer T-Zellrezeptor (chimeric T-cell receptor)
ddH2O
doppelt destilliertes Wasser
DMSO
Dimethylsulfoxid
DNA
Desoxyribonukleinsäure
ds
doppelsträngig
EDTA
Ethylendiamintetraessigsäure
EtBr
Ethidiumbromid
ELISA
Enzyme linked immunosorbent assay
Enh
Verstärkerelement (Enhancer)
FCS
fetales Kälberserum
Fc
konstante Domäne eines Antikörpers
Fv
Bindungsdomäne eines Antikörpers
G
Guanin
GFP
grün fluoreszierendes Protein (green fluorescent protein)
HBsAg
S-Antigen von HBV
HBV
Hepatitis B Virus
HRP
Meerrettichperoxidase (horse radish peroxidase)
Ig
Immunglobulin
IMAC
Metall Chelat Affinitätschromatographie
IPTG
Isopropyl-b-D-Thiogalactosid
IR
intergene Region
kb
Kilobase
129
Abkürzungsverzeichnis
kDa
Kilodalton
mA
Milli-Ampere
MOI
Infektionsverhältnis in Viren pro Zelle (multiplicity of infection)
µM
Mikromolar
mM
Millimolar
mRNA
messenger RNA
nM
Nanomolar
N-Terminal
Amino-terminal
nt
Nukleotide
OD
optische Dichte
ori
Startpunkt der Replikation
ORF
offenes Leseraster
PAA
Polyacrylamid
PAGE
Polyacrylamidgelelektrophorese
PBS
Phosphate buffered saline
PCR
Polymerasekettenreation
pelB
Signalsequenz der Pectatlyase
präS1
C-terminale Domäne des L-Proteins
präS2
C-terminale Domäne des M-Proteins
rcDNA
partiell doppelsträngiges HBV-Genom (relaxed circular DNA)
RNA
Ribonukleinsäure
scFv
Einzelkettenantikörperfragment (single chain fragment of the
variable region)
SDS
Sodiumdodecylsulfat
ss
einzelsträngig
T
Thymin
TAE
Tris-Acetat-EDTA Puffer
TBS
Tris buffered saline
TCR
T-Zellrezeptor (T-cell receptor)
TEMED
N,N,N’,N’-Tetramethylethylendiamin
TMB
Tetramethylbenzidin
Tween 20
Polyoxyethylensorbitanmonolaurat
VH
variable Domäne der schweren Kette
VL
Variable Domäne der leichten Kette
w/v
weight per volume
130
Sequenzen
7 Sequenzen
7.1 pBULLET-αS-C8
scFv (unterstrichen); cTZR (fett)
ATCGATGGGCTAGAGTCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG
ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGG
TAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGG
CCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT
ATTACCATGCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG
TCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTC
CGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGGCG
CCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGT
CTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTCCG
GGATCGGGAGACCCCTGCCCAGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATTCTGTGTCTGTC
CGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGAC
CCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTTGGGGGCCGTTTTTG
TGGCCCGACCTGAGTCCTAAAATCCCGATCGTTTAGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTC
TGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCGT
CTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATATGGGCCCGGGC
TAGCCTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTA
GATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGC
ACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGGTC
CCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCG
CCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCA
GCCCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTC
CCTGACCCTGACATGACAAGAGTTACTAACAGCCCCTCTCTCCAACTCACTTACAGGCTCTCTACTTAGTCCAGCACG
AAGTCTGGAGACCTCTGGCGGCAGCCTACCAAGAACAACTGGACCGACCGGTGGTACCTCACCCTTACCGAGTCGGCG
ACACAGTGTGGGTCCGCCGACACCAGACTAAGAACCTAGAACCTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCA
CCCCACCGCCCTCAAAGTAGACGGCATCGGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTG
GACCATCCTCTAGACTGCCATGGATTTTGAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATGTC
TAGAATGGCGGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGCTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGC
AGCCTCTGGATTCACCTTTAGCGGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTC
ATCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTC
CAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCCTATATTACTGTGCGAAACCACCTGG
GCGCCAGGAGTACTATGGTTCGAGTATTTATTATTTCCCCCTTGGCAACTGGGGCCAGGGAACCCTGGTCACCGTCTC
CTCAGCCTCCACCAAGGGCCCAAAGCTTGAAGAAGGTGAATTTTCAGAAGCACGCGTACAGTCTGCGCTGACTCAGCC
GGCCTCGGTGTCAGTGGCCCCAGGACAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGCA
CTGGTACCAGCAGAAGCCAGgCCAGGCCCCTGTGCTGGTCGTCTATGATGATAGCGACCGGCCCTCAGGGATCCCTGA
GCGATTCTCTGGCTCCAACTCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTA
TTACTGTCAGGTGTGGGATAGTAGTAGTGATCTTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCC
CAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGCGGCCGCTGGAGATCCCGCCGAGCCCAAATCTCCTGA
CAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACC
CAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGT
CAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC
GTACCGGGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAA
CAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCT
GCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACAT
CGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTC
CTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCA
TGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAAAAAGATCCCAAATTTTGGGTGCT
GGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAA
GAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCC
CTATGCCCCCCCACGCGACTTCGCAGCCTATCGCTCCCTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTA
CCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACG
TGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGA
TAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCA
GGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAATCCTCGAGAGA
TCCGGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTG
AAGCCTATAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGAATGAAAGACCCCACC
TGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTC
AGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGC
TCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCA
GGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGC
131
Sequenzen
CCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCT
GCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTA
CCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGT
GATTGACTACCCGTCAGCGGGGGTCTTTCACACCATGCAGCATGTATCAAAATTAATTTGGTTTTTTTTCTTAAGTAT
TTACATTAAATGGCCATAGTCTGCTCGATCGAGGAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAAGCCTCTTCACTAC
TTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAATAGAAATTAGTCAGCCATGCATGGGGC
GGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTG
CTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGAC
TCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA
GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCG
TTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGA
CTATAAAGATACCAAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATA
CCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGT
CGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCT
TGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGT
AGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCT
GCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTT
TTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGA
CGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTT
AAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAG
TGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGAT
ACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGC
AATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG
TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGT
GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTT
GTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGT
TATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAA
GTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAG
CAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATC
CAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAA
AACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCA
ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAA
AAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCC
GGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGG
GTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATTCGACGCTCTCCCTTATGCG
ACTCCTGCATAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTCTGGCTTATCG
AAATTAATACGACTCACTATAGGGAGACCGGAATTCCCATCGAT
7.2 pBULLET-αS-C9
scFv (unterstrichen); cTZR (fett)
ATCGATGGGCTAGAGTCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG
ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGG
TAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGG
CCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT
ATTACCATGCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG
TCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTC
CGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGGCG
CCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGT
CTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTCCG
GGATCGGGAGACCCCTGCCCAGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATTCTGTGTCTGTC
CGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGAC
CCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTTGGGGGCCGTTTTTG
TGGCCCGACCTGAGTCCTAAAATCCCGATCGTTTAGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTC
TGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCGT
CTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATATGGGCCCGGGC
TAGCCTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTA
GATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGC
ACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGGTC
CCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCG
CCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCA
GCCCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTC
CCTGACCCTGACATGACAAGAGTTACTAACAGCCCCTCTCTCCAACTCACTTACAGGCTCTCTACTTAGTCCAGCACG
132
Sequenzen
AAGTCTGGAGACCTCTGGCGGCAGCCTACCAAGAACAACTGGACCGACCGGTGGTACCTCACCCTTACCGAGTCGGCG
ACACAGTGTGGGTCCGCCGACACCAGACTAAGAACCTAGAACCTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCA
CCCCACCGCCCTCAAAGTAGACGGCATCGGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTG
GACCATCCTCTAGACTGCCATGGATTTTGAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATGTC
TAGAATGGCGCAGGTACAGCTGCAGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGC
AGCCTCTGGATTCTCCTTCAGTAATTATGGCATACACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGC
ACTTATATCATATGATGGAAATAAGAAATTCTATGCAGACTCCGTGAAGGGCCGATTCGCCATCTCCAGAGACACTTc
TAAGAATACGGTGGATCTGCAAATGACCAGCCTGAGACCTGAGGACACGGCTGTATATTACTGTGCGAAATCTGGGGG
TATTGCCTTGTACTGGGGGGAATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCCTCCACCAAGGG
CCCAAAGCTTGAAGAAGGTGAATTTTCAGAAGCACGCGTATCCTATGAACTGACTCAGCCACCCTCGGTGTCAGTGGC
CCCAGGACAGACGGCCATGATTACCTGTGGGGGAAACaACATTGGAAGTACAACCGTGCACTGGTATCAGCAGAAGCC
AGGCCAGGCCCCTGTGCTGGTCGTCTATGATGATAACGAGCGACCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAA
CTCTGGGAGCACGGCCACCCTGACCATCAACAGGGTCGAAGCCGGGGATGAGGCCGACTATTATTGTCAAGTGTGGGA
TAGTGGTAGTGATCATGTGGTATTCGGCGGAGGGACGAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGT
CACTCTGTTCCCGCCCTCCTCTGCGGCCGCTGGAGATCCCGCCGAGCCCAAATCTCCTGACAAAACTCACACATGCCC
ACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGAT
CTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGT
GGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGGGTGGTCAGCGT
CCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCC
CATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGA
GCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAG
CAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAA
GCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCA
CTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAAAAAGATCCCAAATTTTGGGTGCTGGTGGTGGTTGGTGGAGT
CCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCA
CAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCCCCACGCGA
CTTCGCAGCCTATCGCTCCCTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCA
GCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGAT
GGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTA
CAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCAC
CAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAATCCTCGAGAGATCCGGATTAGTCCAATTT
GTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGTACGAGCC
ATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTA
GCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACA
GATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGAT
GGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGT
CCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGA
CCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAA
AAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAAC
CCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGC
GGGGGTCTTTCACACCATGCAGCATGTATCAAAATTAATTTGGTTTTTTTTCTTAAGTATTTACATTAAATGGCCATA
GTCTGCTCGATCGAGGAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAAGCCTCTTCACTACTTCTGGAATAGCTCAGAG
GCCGAGGCGGCCTCGGCCTCTGCATAAATAAAATAGAAATTAGTCAGCCATGCATGGGGCGGAGAATGGGCGGAACTG
GGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGCTGCATTAATGAATCGGC
CAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTT
CGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
AACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC
CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAAGGC
GTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCC
TTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGG
CTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAG
ACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTT
CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT
CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA
GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAA
CTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT
TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGC
GATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATC
TGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGG
AAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGT
AAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGG
TATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAG
CTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA
TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTG
TATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCT
CATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCAC
TCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGC
CGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA
TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT
133
Sequenzen
TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAG
GCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTG
TCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAA
CTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATTCGACGCTCTCCCTTATGCGACTCCTGCATAGGAAGCA
GCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTCTGGCTTATCGAAATTAATACGACTCACT
ATAGGGAGACCGGAATTCCCATCGAT
7.3 pBULLET-αL-5a19
scFv (unterstrichen); cTZR (fett)
ATCGATGGGCTAGAGTCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG
ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGG
TAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGG
CCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT
ATTACCATGCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG
TCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTC
CGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGGCG
CCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGT
CTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTCCG
GGATCGGGAGACCCCTGCCCAGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATTCTGTGTCTGTC
CGATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGAC
CCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTTGGGGGCCGTTTTTG
TGGCCCGACCTGAGTCCTAAAATCCCGATCGTTTAGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTC
TGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCGT
CTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATATGGGCCCGGGC
TAGCCTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTA
GATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGC
ACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCAGGTC
CCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCG
CCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCA
GCCCTCACTCCTTCTCTAGGCGCCCCCATATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTC
CCTGACCCTGACATGACAAGAGTTACTAACAGCCCCTCTCTCCAACTCACTTACAGGCTCTCTACTTAGTCCAGCACG
AAGTCTGGAGACCTCTGGCGGCAGCCTACCAAGAACAACTGGACCGACCGGTGGTACCTCACCCTTACCGAGTCGGCG
ACACAGTGTGGGTCCGCCGACACCAGACTAAGAACCTAGAACCTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCA
CCCCACCGCCCTCAAAGTAGACGGCATCGGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTG
GACCATCCTCTAGACTGCCATGGATTTTGAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATGTC
TAGAATGGCGCAGGTGCAGCTGAAGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGC
AGCCTCTGGATTCACTTTCAGTAGTTATGCCATGTCTTGGGTTCGCCAGTCTCCAGAGAAGAGGCTGGAGTGGGTCGC
AGAAGTTAGCAGTGATGGTAGTTACGCCTACTATCCAGACACTTTGACGGGCCGATTCACCATCTCCAGAGACAATGC
CAAGAACACCCTGTACCTGGAAATGACCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGTTTTAACTG
GGACGTCGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCAAAACGACACCCAAGCTTGAAGAAGGTGA
ATTTTCAGAAGCACGCGTAGACATTGTGATGACCCAGTCTCCATCCTCCCTGGCTGTGTCAGTAGGAGAGAAGGTCAC
TATGAGCTGCAGATCCAGTCAGAGTCTGCTCAACACTAGAACCCGAAAGAGCTACTTGGCTTGGTTCCAGCAGAAACC
AGGGCAGTCTCCTAAAATGTTGATCTACTGGGCATCCACTAGGGAATCTGGGGTCCCTGATCGCTTCACAGGCAGTGG
ATCTGGGACAGATTTCACTCTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGCAAACAATCTTA
TAGTCTGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAATGGGCTGATGCTGCACCAACTGTATCCGCGGCCGC
TGGAGATCCCGCCGAGCCCAAATCTCCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGG
ACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGT
GGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGAC
AAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGGGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAA
TGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGG
GCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTG
CCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGAC
CACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCA
GGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCC
GGGTAAAAAAGATCCCAAATTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGT
GGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCG
CCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCCCCACGCGACTTCGCAGCCTATCGCTCCCTGAGAGTGAA
GTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAG
AGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCA
GGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCG
GAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCA
GGCCCTGCCCCCTCGCTAATCCTCGAGAGATCCGGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCT
CTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCT
CCAGAAAAAGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGG
134
Sequenzen
AAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGG
ATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATA
TCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTT
CTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAG
TTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGGGCGCC
AGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCT
CGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCACACCATGCAGCATGTATC
AAAATTAATTTGGTTTTTTTTCTTAAGTATTTACATTAAATGGCCATAGTCTGCTCGATCGAGGAGCTTTTTGCAAAA
GCCTAGGCCTCCAAAAAGCCTCTTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATA
AAATAGAAATTAGTCAGCCATGCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTT
AGGGGCGGGACTATGGTTGCTGACTAATTGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATT
GGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCA
AAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCC
AGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTC
TCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTC
ACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGA
CCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACAC
TAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGG
CAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA
AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATT
ATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAAC
TTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGC
CTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGA
CCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAAC
TTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAA
CGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACG
ATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAG
TAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATG
CTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGC
GTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAA
ACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT
TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA
ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT
ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGA
AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGA
CGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGC
CCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAG
AGTGCACCATTCGACGCTCTCCCTTATGCGACTCCTGCATAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCAC
CGCCGCCGCAAGGAATGGTCTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCGGAATTCCCATCGAT
135
Danksagung
Besonders bedanken möchte ich mich bei Frau PD Dr. Ulla Protzer für die kompetente
Betreuung
meiner
Arbeit,
die
vielen
Ideen,
Anregungen
und
konstruktiven
Diskussionen. Außerdem für die höchst spannende Einführung in ein für mich neues
Thema und die Möglichkeit an vielen Kongressen im In- und Ausland teilzunehmen.
Herrn Prof. Dr. Jens C. Brüning danke ich für die Übernahme des Erstreferates und die
Begleitung dieser Arbeit als Betreuer der mathematisch naturwissenschaftlichen
Fakultät.
Bei Herrn Prof. Dr. Hinrich Abken möchte ich mich für die Übernahme des Koreferates,
die erfolgreiche Kooperation und viele hilfreiche Diskussionen bedanken.
Herrn Prof. Dr. Helmut W. Klein möchte ich ganz herzlich für die Übernahme des
Prüfungsvorsitzes danken.
Herrn Prof. Dr. Martin Krönke danke ich für die Möglichkeit, diese Arbeit an seinem
Institut durchführen zu können und die angeregten Diskussionen im kleinen und auch
im großen Kreis.
Ganz besonders bedanke ich mich bei meinem Freund Frank Herrmann und meiner
Lieblingsdiplomandin Eva Gückel für lustige Zeiten und Hilfe bei manchen
Problemchen.
Ein herzliches Dankeschön auch an die FG Protzer, die Kashkars und alle IMMIH’ler
und Ehemaligen für die super Atmosphäre im Labor. Es hat immer Spaß gemacht zur
Arbeit zu kommen.
Mein größter Dank gilt meiner Frau, Ulrike Brandt-Bohne und meiner ganzen Familie
für deren uneingeschränkte Unterstützung und Geduld im Umgang mit einem
manchmal schwierigen Zeitgenossen.
136
Erklärung
Ich versichere, daß ich die von mir vorgelegte Dissertation selbständig angefertigt, die
benutzten Quellen und Hilfsmittel vollständig angegeben und die Stellen der Arbeit einschließlich Tabellen, Karten und Abbildungen -, die anderen Werken im Wortlaut
oder dem Sinn nach entnommen sind, in jedem Einzelfall als Entlehnung kenntlich
gemacht habe; daß diese Dissertation noch keiner anderen Fakultät oder Universität
zur Prüfung vorgelegen hat; daß sie - abgesehen von unten angegebenen
Teilpublikationen - noch nicht veröffentlicht worden ist sowie, daß ich eine solche
Veröffentlichung vor Abschluß des Promotionsverfahrens nicht vornehmen werde. Die
Bestimmungen dieser Promotionsordnung sind mir bekannt. Die von mir vorgelegte
Dissertation ist von Prof. Jens C. Brüning betreut worden.
Köln, 25. September 2006
(Felix Bohne)
Eingereichte Teilpublikation:
T-cells redirected against Hepatitis B Virus surface proteins eliminate HBV
infected hepatocytes
Felix Bohne, Eva Gückel, Markus Chmielewski, Katja Wiegmann, Timo Kürschner, Andreas
Schulze, Stefan Urban, Martin Krönke, Hinrich Abken, Ulrike Protzer
137
Lebenslauf
Felix Bohne
02.06.1973 Geboren in Stuttgart
Staatsangehörigkeit: deutsch; Familienstand: verheiratet
Rathenauplatz 5, 50674 Köln
mail: [email protected]; tel: 0179/2073179
Schulische Ausbildung:
1979
Besuch der Heusteig Grundschule in Stuttgart
1983-1992
Besuch des Schickhardt-Gymnasium in Stuttgart, Abschluss: Abitur
1992-1993
Zivildienst Jugendlichenbetreuung, Caritas in Stuttgart
1994-1996
Ausbildung zum Schreiner
Akademische Ausbildung:
1996-2002
Biologiestudium an der Universität Konstanz, Diplom (Note: sehr gut)
2002
Publikation der Ergebnisse aus der Diplomarbeit:
Bohne F and Linden H; Regulation of carotenoid biosynthesis genes in
response to light in Chlamydomonas reinhardtii.
Biochim Biophys Acta. 2002 Nov 13;1579(1):26-34.
1999
Zoologische Exkursion in Südafrika mit Seminarreihe
2001
Meeresbiologisches Praktikum, Perth, West-Australien
Seit 2003
Promotion am Institut für Genetik; Externe Doktorarbeit am Institut für
medizinische Mikrobiologie, Immunologie und Hygiene in Köln; Molekulare
Infektiologie, Forschungsgruppe der Medizinischen Fakultät, PD Dr. U. Protzer
Kongresse:
2004
Jahrestagung der deutschen Gesellschaft für Gentherapy in Frankfurt,
Deutschland: Poster Präsentation
2004
International Meeting on the Molecular Biology of Hepatitis B Viruses in
Woodshole, Massachusetts, USA: Vortrag, Travel Award
2005
International Meeting on the Molecular Biology of Hepatitis B Viruses in
Heidelberg, Deutschland: Poster Presentation, Travel Award
2006
Jahrestagung der Deutschen Gesellschaft für Virologie, München, Deutschland:
Vortrag
2006
Jahrestagung der deutschen Gesellschaft für Gentherapy in Düsseldorf,
Deutschland: Vortrag
2006
International Meeting on the Molecular Biology of Hepatitis B Viruses in
Vancouver, Kanada: Vortrag, Travel Award
Köln, den 25.09.2006
_______________
138
Herunterladen
Explore flashcards