Materialien:
Werbung
Paktikum Genkurs, 2. Teil: DNA Shuffling 1 TAG 1: MITTWOCH, 7.3.07 Uridin-Austausch PCR Bei dieser PCR wird durch spezifische Primer das Gen für das Enyzm ChloramphenicolAcetyltransferase (CAT) amplifiziert. Durch eine Mischung von dTTP und dUTP erfolgt ein statistische verteilter Einbau von Uridin. 1. Jede Person setzt 100μl PCR Reaktion nach folgendem Pipettierschema an: Template R7-K2 (6.25 ng/ul) Template R7-K3 (6.25 ng/ul) Template R7-K7 (6.25 ng/ul) Template R7-K9 (6.25 ng/ul) Forward primer (20 pmol/ul): Reverse primer (20 pmol/ul): dATP (10 mM) dGTP (10 mM) dCTP (10 mM) dTTP (10 mM) dUTP (10 mM) Taq (5 U/ul) 10x PCR buffer 25 ng 25 ng 25 ng 25 ng 200 pmol 200 pmol 0.4 mM 0.4 mM 0.4 mM 0.267 mM 0.133 mM 10 U 4μl 4μl 4μl 4μl 10μl 10μl 4μl 4μl 4μl 26.7μl 13.3μl 2μl 10μl 2. Verteilen der Reaktion (je 50μl) auf zwei 0.5μl PCR-Gefäße. 3. Starten des PCR Programms “KMUDG”. Wichtig, am Anfang des Programms wird das Volumen und die Größe des PCR Gefäßes abgefragt. Die Einstellung muss auf 0.5 ml Gefäß und 50μl Volumen geändert werden! PCR Programm: 1) 94°C 2) 92°C 3) 60°C 4) 72°C 5) goto 2, 30x 6) 72°C 7) 6°C 3 min 1 min 1 min 1 min 7 min hold Das Programm läuft ca. 2 h 10 min. Reinigung des PCR Produkts über ein präparatives Agarose Gel Dieser Schritt dient der Abtrennung des Templates vom PCR Produkt. Die präparativen Agarose-Gele (1% w/v) wurden von den Betreuern vorbereitet. In den Agarosegelen ist Ethidiumbromid enthalten, das sich in DNA einlagert, so dass diese unter UV Licht Paktikum Genkurs, 2. Teil: DNA Shuffling 2 visualisert werden kann. Die DNA Bande wird ausgeschnitten, und anschliessend wird die DNA mit Hilfe des “Gel extraction kit” (Amersham) aus dem Gel isoliert. Achtung! Ethidiumbromid ist cancerogen und teratogen, so dass sämtliche Sachen, die mit Ethidiumbromid in Berührung kommen nur mit Handschuhen angefasst werden sollen. Gleichzeitig ist darauf zu achten, dass keine “sauberen” Gegenstände mit Ethidiumbromid verunreinigt werden. 1. Jede Person vereinigt den Inhalt der beiden PCR-Gefäße (= 100μl) und gibt 20μl DNA-Auftragspuffer dazu. 2. Laden der Probe auf das Gel. 3. Elektrophorese bei 130 V für ca. 60 min. 4. Ausschneiden der Gelbande (1 Bande pro Person) auf dem UV Tisch, zerkleinern durch mehrmaliges Zerschneiden und Überführen des Gelstücks in ein 2 ml Reaktionsgefäß. Achtung! Weder Haut noch Augen dürfen dem UV direkt ausgesetzt sein! Einfrieren des Gelstücks über Nacht. DNA Marker, 100 bp Plus, Fermentas TAG 2: DONNERSTAG, 8.3.07 5. Reinigung der DNA aus dem Gelfragment gemäß untenstehender Anleitung (GFX PCR DNA and Gel Band Purification Kit, Amersham) mit folgenden Vereinfachungen: a. Auf das Auswiegen der Gelbande kann verzichtet werden, stattdessen wird 1ml capture buffer zum Gelstück zugegeben (Punkt 2.3). b. Das aufgelöste Gelstück wird auf eine Säule geladen (max. 700μl), inkubiert und zentrifugiert (Punkt 2.7-2.10). Dieser Vorgang wird solange wiederholt (23x) bis das ganze Material auf die Säule geladen wurde. c. Elution mit 50μl Elutionspuffer EB. 6. Überführen von 43μl der Elution in ein beschriftetes 0.5μl PCR Gefäß für die anschliessende Fragmentierung. Die Proben werden am Ende eingesammelt und über Nacht bei -18°C gelagert. Paktikum Genkurs, 2. Teil: DNA Shuffling 3 7. Die restlichen ca. 5μl der Elution werden ebenfalls bei -18°C für späteres analytisches Agarose Gel aufgehoben. Bitte das Gefäß wie folgt beschriften: Gruppen-Nr., UTP-PCR. Auszug aus der Anleitung zum GFX PCR DNA and Gel Band Purification Kit: Purification of DNA from gel bands 2.1 Weigh an empty 1.5 ml microcentrifuge tube to the nearest 10 mg and record the weight. 2.2 Using a clean razor blade or scalpel, excise the slice of agarose containing the DNA band to be purified. Cut as close to the DNA band as possible. Cut the slice into several smaller pieces and transfer them to the pre-weighed 1.5 ml microcentrifuge tube. 2.3 Weigh the tube containing the agarose slice to the nearest 10 mg, and subtract the weight of the empty tube to determine the weight of the slice. 2.4 To the gel slice add 10 µl of capture buffer for each 10 mg of gel slice (maximum column capacity is 300 µl of capture buffer added to a 300 mg gel slice). 2.5 Close the tube and mix by vortexing vigorously. Incubate at 60 °C until the agarose is completely dissolved (5–15 min). 2.6 During the incubation, place one GFX column in a collection tube for each purification to be performed. 2.7 After the agarose is completely dissolved, centrifuge briefly to collect the sample at the bottom of the tube. 2.8 Transfer the sample to the GFX column. Incubate at room temperature for 1 min. 2.9 Centrifuge in a microcentrifuge at full speed for 30 s. 2.10 Discard the flow-through by emptying the collection tube. Place the GFX column back inside the collection tube. 2.11 Add 500 µl of wash buffer to the column. Centrifuge at full speed for 30 s. 2.12 Discard the collection tube and transfer the GFX column to a fresh 1.5 ml microcentrifuge tube (i.e. NOT a collection tube). 2.13 Apply 50 µl of elution buffer (10 mM Tris-HCl pH 8.0, TE pH 8.0 or autoclaved doubledistilled water) directly to the top of the glass fiber matrix in the GFX column. To elute DNA in a more concentrated form reduce the elution volume to no less than 10 µl. Note: Using low elution volumes to concentrate the DNA sample will reduce recovery (see page 7). 2.14 Incubate the sample at room temperature for 1 min. 2.15 Centrifuge at full speed for 1 min to recover the purified DNA. Note: For 50 µl elutions, the actual volume of sample recovered will range from 40 to 50 µl. For a 10 µl elution, the recovered volume will range from 5 to 7 µl. Paktikum Genkurs, 2. Teil: DNA Shuffling 4 Fragmentierung der DNA durch UDG-Verdau und NaOH-Spaltung Die in der Uridin-Austausch-PCR eingebaute Base Uracil wird durch das Enzym Uracil-DNAGlycosylase (UDG) herausgeschnitten. Anschliessend wird die DNA durch basenkatalysierte Hydrolyse an den “basenfreien” Stellen gespalten. 1. 2. 3. 4. 5. Auftauen der eingefrorenen DNA vom Vortag (43μl in 0.5 ml PCR Reaktionsgefäß). Zugabe von 5μl 10x UDG-Puffer und 2μl UDG (1 U/ul). Inkubation für 1 h bei 37°C im PCR Gerät. Zugabe von 5.5μl 5 M NaOH Lösung. Inkubation für 30 min bei 90°C im PCR Gerät. Aufreinigung der DNA Fragmente Die fragmentierte DNA wird neutralisiert und mithilfe des QIAexII Kit (Qiagen) gemäß untenstehender Anleitung gereinigt. Folgende Punkte sind zu beachten!!! 1. Zufügen von 400μl QX1 Puffer (siehe Punkt 1 der QIAexII Vorschrift). 2. Neutralisation mit ~20μl 3 M Na-Acetat, pH 5.2 (siehe Punkt 2 der QIAexII Vorschrift). 3. 2x Waschen gemäß Vorschrift. Hierbei sollte wie auch bei den Schritten zuvor durch Vortexen gründlich gemischt werden. 4. Zum schnelleren Trocknen der Matrix wird ein Luftstrom darüber geleitet (Schritt 7 der QIAexII Vorschrift). Ist die Matrix trocken, hat sie eine schnee-weisse Farbe. 5. Für die Elution werden die Matrices von beiden Personen einer Gruppe vereinigt. Elution mit 25μl 10 mM Tris, pH 8.0 (Punkt 8 der QIAexII Vorschrift). 6. Wiederholen der Elution mit weiteren 25μl 10 mM Tris, pH 8.0 (Punkt 8 und 9 der QIAexII Vorschrift). 7. Die Elution (ca. 50μl) wird zur vollständigen Abtrennung der Matrix nochmals zentrifugiert, der Überstand abgenommen und die Prozedur ein weiteres Mal wiederholt. (Verbleibende Reste der Matrix würden die nachfolgende PCR durch Bindung der DNA verhindern). 8. Jede Person überführt 20μl der Elution in ein eindeutig beschriftetes 0.5 ml PCR Gefäß für die Reassemblierungs-PCR. 9. Wegfrieren des verbleibenden Rests (ca. 7μl) DNA Fragmente (beschriftet mit Gruppen-Nr., DNA-Frag.) für späteres analytisches Agarose Gel. Paktikum Genkurs, 2. Teil: DNA Shuffling 5 Auszug aus der Anleitung zum QIAEX II Protokoll: QIAEX II Protocol for Desalting and Concentrating DNA Solutions QIAEX II Gel Extraction Kit can be used to purify and concentrate DNA fragments from 40 bp to 50 kb from aqueous solutions without phenol extraction or ethanol precipitation. Enzymes such as phosphatases, restriction endonucleases, polymerases, as well as dNTPs, and salts are removed. For direct purification from PCR reactions, use the QIAquick PCR Purification Kit (see ordering information, page 21) to recover PCR products and efficiently remove primers. Notes: • The yellow color of Buffer QXI indicates a pH ≤7.5. • Add ethanol (96–100%) to Buffer PE before use (see bottle label for volume). • All centrifugation steps are at maximum speed (≥10,000 x g, ~13,000 rpm) in a conventional table-top microcentrifuge. • For DNA fragments larger than 10 kb, mix by gently flicking the tube to avoid shearing the DNA. Do not vortex the tube. 1. Transfer the sample to a colorless tube. Add 3 volumes of Buffer QX1 to 1 volume of sample. For DNA fragments 100 bp – 4 kb; otherwise follow the table below. DNA fragments <100 bp Add 6 volumes of Buffer QX1 DNA fragments >4 kb Add 3 volumes of Buffer QX1 plus 2 volumes of H2O 2. Check that the color of the sample mixture is yellow. If the color of the mixture is orange or purple, add 10 µl 3M sodium acetate, pH 5.0, and mix. The color should now be yellow. The adsorption of DNA to QIAEX II particles is only efficient at pH ≤7.5. Buffer QX1 now contains a pH indicator which is yellow at pH ≤7.5, and orange or violet at higher pH, allowing easy determination of the optimal pH for DNA-binding. 3. Resuspend QIAEX II by vortexing 30 sec. 4. Add 10 µl of QIAEX II per 5 µg of DNA and mix. Incubate at room temperature for 10 min. Mix every 2 min to keep QIAEX II in suspension. 5. Centrifuge the sample for 30 sec and remove supernatant. 6. Wash the pellet twice with 500 µl of Buffer PE. 7. Air-dry the pellet for 10–15 min or until the pellet becomes white. Do not vacuum dry, as this may cause overdrying. Overdrying the QIAEX II pellet may result in decreased elution efficiency. Paktikum Genkurs, 2. Teil: DNA Shuffling 6 8. To elute DNA, add 20 µl of 10 mM Tris·Cl, pH 8.5, or H2O and resuspend the pellet by vortexing. Incubate according to the table below. DNA fragments ≤4 kb Incubate at room temp. for 5 min DNA fragments 4–10 kb Incubate at 50°C for 5 min DNA fragments >10 kb Incubate at 50°C for 10 min Elution efficiency is dependent on pH. The maximum elution efficiency is achieved between pH 7.0 and 8.5. When using water for elution, make sure that the pH is within this range, and store DNA at –20°C as DNA may degrade in the absence of a buffering agent. The purified DNA can also be eluted in TE buffer (10 mM Tris·Cl, 1 mM EDTA, pH 8.0) but the EDTA may inhibit subsequent enzymatic reactions. 9. Centrifuge for 30 sec. Carefully transfer the supernatant into a clean tube. The supernatant now contains pure DNA. 10. Optional: repeat steps 8 and 9 and combine the eluates. A second elution step will increase the yield by approximately 10–15%. Reassemblierungs-PCR In dieser PCR werden die DNA Stücke wieder zu dem CAT Gen zusammengesetzt. Hierbei fungieren die einzelnen Fragmente gleichzeitig als Primer und Template. Da die Reassemblierungs-PCR sehr lange dauert (ca. 4 h), wird im Vergleich zu den anderen PCRs die doppelte Menge an dNTP’s genommen sowie die Polymerase Vent statt Taq, da Vent bei hohen Temperaturen eine längere Lebensdauer besitzt. 1. Die PCR wird nach folgendem Schema zu den 20μl gereinigten DNA Fragmenten (0.5 ml PCR Gefäß) pipettiert. 6μl 10x Vent Puffer mit MgSO4 4μl dNTP’s [10 mM] 1μl Vent [2 U] 19μl H2O (ad 50μl) 2. Starten des Programms: BieneSHF PCR Programm: 1) 94°C 3 min 2) 92°C 30 sec 3) 30°C 60 sec + 1°C/cycle ramp 1°C/s 4) 72°C 1 min, 4 sec 5) goto 2, 36x 6) 72°C 3 min 7) 6°C hold Das PCR Programm läuft ca. 4 h (über Nacht). Paktikum Genkurs, 2. Teil: DNA Shuffling 7 TAG 3: FREITAG, 9.3.07 Amplifikations-PCR Hierbei wird die Reassemblierungs-PCR durch Verwendung der äußeren Primer Pr_Nshuffle und Pr_Cshuffle vervielfältigt. Die Reaktion ist identisch zu der ersten durchgeführten UridinPCR mit der einzigen Ausnahme, dass in diesem Fall keine dUTP’s verwendet werden. 1. Die PCR wird nach folgendem Schema in einem 0.5 ml PCR Gefäß pipettiert. 10μl Reassemblierungs-PCR 2μl 10 mM dNTP’s 10μl Pr_Nshuffle [20 pmol/ul] 10μl Pr_Cshuffle [20 pmol/ul] 5μl Taq-Puffer 1μl Tag 12μl H2O (ad 50μl) 2. Starten des Programms KMUDG (siehe 1. Tag). Das Programm läuft ca. 2 h 10 min. Aufreinigung der PCR Die Aufreinigung der PCR erfolgt mit Hilfe des GFX PCR DNA and Gel Band Purification Kit (Amersham) gemäß untenstehender Anleitung. Folgende Punkte sind hierbei zu beachten: 1. Jede Person reinigt 45μl ihres PCR Produktes über eine Säule auf. 2. Die restlichen 5μl verbleiben im PCR Gefäß (beschriftet mit Gruppen-Nr. und Amplif.) und werden für ein späteres analytisches Gel bei -18°C gelagert. 3. Die Elution erfolgt mit 50μl Elutionspuffer. Auszug aus der Anleitung zum GFX PCR DNA and Gel Band Purification Kit: Purification of DNA from solution The maximum volume of PCR reaction/DNA solution that can be processed with the following protocol is 100 µl. 1.1 Place one GFX column in a collection tube for each purification to be performed. 1.2 Add 500 µl of capture buffer to the GFX column. 1.3 Transfer the DNA solution (up to 100 µl) to the GFX column. 1.4 Mix thoroughly by pipetting the sample up and down 4–6 times. 1.5 Centrifuge in a microcentrifuge at full speed for 30 s. 1.6 Discard the flow-through by emptying the collection tube. Place the GFX column back inside the collection tube. 1.7 Add 500 µl of wash buffer to the column. Centrifuge at full speed for 30 s. 1.8 Discard the collection tube and transfer the GFX column to a fresh 1.5 ml microcentrifuge tube (i.e. NOT a collection tube). 1.9 Apply 50 µl of elution buffer (10 mM Tris-HCl pH 8.0, TE pH 8.0 or autoclaved doubledistilled water) directly to the top of the glass fiber matrix in the GFX Column. To elute DNA in a more concentrated form reduce the elution Paktikum Genkurs, 2. Teil: DNA Shuffling 8 volume to no less than 10 µl. Note: Using low elution volumes to concentrate the DNA sample will reduce recovery (see page 7). 1.10 Incubate the sample at room temperature for 1 min. 1.11 Centrifuge at full speed for 1 min to recover the purified DNA. Note: For 50 µl elutions, the actual volume of sample recovered will range from 40 to 50 µl. For a 10 µl elution, the recovered volume will range from 5 to 7 µl. Verdau des DNA Fragments mit XbaI und HindIII Die fragmentierte und wieder zusammengefügte DNA wird nun in das Plasmid pLisc_SAF11 kloniert. Hierzu werden die Enden des DNA Fragments mit den Restriktionsenzymen XbaI und HindIII verdaut. Nach dem Verdau werden die abgeschnittenen Enden sowie die Enzyme vom DNA Fragment mit Hilfe des Nucleotid Removal Kits (Qiagen) abgetrennt. Das Plasmid pLisc_SAF11 wurde mit denselben Enzymen behandelt und wird bereits geschnitten und aufgereinigt zur Verfügung gestellt. 1. Der Verdau wird nach folgendem Schema in einem 1.5 ml Reaktionsgefäß pipettiert. 50μl DNA 2μl HindIII [20 U/ul] 3μl XbaI [10 U/ul] 6μl NEB-Puffer 2 mit BSA 2. Anschliessend wird der Verdau über Nacht bei 37°C inkubiert und dann von den Betreuern über das Wochenende eingefroren. TAG 4: MONTAG, 12.3.07 Reinigung des Verdaus Die Reinigung des Verdaus erfolgt mit Hilfe des QIAquick Nucleotid Removal Kits (Qiagen) gemäß untenstehender Anleitung. WICHTIG!!! Die Elution erfolgt mit 50μl 10 mM Tris, pH 8.0. QIAquick Nucleotide Removal Kit Protocol using a microcentrifuge. This protocol is designed for cleanup of radioactive-, biotin-, or DIG-labeled DNA fragments and oligonucleotides ≥17 nucleotides from enzymatic reactions. The protocol ensures removal of primers <10 bases, enzymes, salts, and unincorporated nucleotides. 1. Add 10 volumes of Buffer PN to 1 volume of the reaction sample and mix. For example, add 500 µl Buffer PN to a 50 µl reaction sample. For DNA fragments ≥100 bp, only 5 volumes of Buffer PN are required. Paktikum Genkurs, 2. Teil: DNA Shuffling 9 2. Place a QIAquick spin column in a provided 2 ml collection tube. 3. To bind DNA, apply the sample to the QIAquick column and centrifuge for 1 min at 6000 rpm. 4. Discard the flow-through and place QIAquick column back into the same tube. Collection tubes are re-used to reduce plastic waste. 5. To wash QIAquick column, add 750 µl of Buffer PE and centrifuge for 1 min at 6000 rpm. 6. Discard the flow-through and place the QIAquick column back in the same tube, which should be empty. Centrifuge for an additional 1 min at 13,000 rpm (~17,900 x g). IMPORTANT: Residual ethanol from Buffer PE will not be completely removed unless the flow-through is discarded before this additional centrifuge. 7. Place the QIAquick column in a clean 1.5 ml microcentrifuge tube. 8. To elute DNA, add 100–200 µl of Buffer EB (10 mM Tris·Cl, pH 8.5) or H2O to the center of the QIAquick membrane and centrifuge the column for 1 min at 13,000 rpm (~17,900 x g). Alternatively, for increased DNA concentration, add 30–50 µl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge. IMPORTANT: Ensure that the elution buffer is dispensed directly onto the QIAquick membrane for complete elution of bound DNA. Elution efficiency is dependent on pH. The maximum elution efficiency is achieved between pH 7.0 and 8.5. When using water, make sure that the pH value is within this range, and store DNA at –20°C as DNA may degrade in the absence of a buffering agent. The purified DNA can also be eluted in TE (10 mM Tris·Cl, 1 mM EDTA, pH 8.0), but the EDTA may inhibit subsequent enzymatic reactions. Ligation des DNA Fragments mit dem Plasmid-Fragment Das DNA Fragment und das Plasmid haben jetzt aufgrund des Verdaus mit XbaI und HindIII dieselben Überhänge und können sich zusammenlagern. Mithilfe von Ligase werden die DNA Stränge verbunden (ligiert). Die Ligation wird nach folgendem Schema in einem 1.5 ml Reaktionsgefäß pipettiert. 1 μl Plasmid-Fragment 6 μl DNA-Fragment 2 μl 5x Ligase Puffer 1 μl Ligase (wird von den Betreuern ausgegeben) Die Ligation wird bei Raumtemperatur für mehrere Stunden inkubiert. Paktikum Genkurs, 2. Teil: DNA Shuffling 10 Transformation der Ligation in den E. coli Stamm RV308 Die Ligationsreaktion wird in kompetente E. coli Zellen transformiert. 1. Die kompetente Zellen (100 μl) durch Erwärmen des Reaktionsgefäßes in der Hand auftauen, anschließend sofort auf Eis stellen und 10μl der Ligation dazugeben. 2. DNA und Zellen durch vorsichtiges Klopfen an das Reaktionsgefäß sanft mischen. 3. 15-30 min auf Eis inkubieren. 4. Hitzeschock im Wasserbad oder Heizblock bei 42°C für 40 s. 5. Anschliessend die Zellen auf Eis abkühlen (ca. 1-10 min). 6. 900μl steriles 2YT Medium zu den Zellen geben. 7. Zellen bei 37°C für 60-70 min auf Schüttler inkubieren. 8. Zellen auf zwei 2YT-Agar-Platten ausplattieren. Die eine Hälfte des Kurses plattiert auf Platten mit Ampicillin aus (Resistenzmarker des Plasmids), die andere Hälfte des Kurses plattiert auf Platten mit Ampicillin und Chloramphenicol aus (zusätzliche Selektion auf Enzymaktivität): a. 1. Platte: 50μl der Zellen ausplattieren. b. 2. Platte: Rest der Zellen sanft bei 1000xg für 2 min pelletieren, dekantieren, in dem verbleibenden Medium resuspendieren und ausplattieren. 9. Platten bei 37°C über Nacht inkubieren. TAG 5: DIENSTAG, 13.3.07 Analytisches Gel der einzelnen Schritte des NExT Shuffling Die wichtigsten Schritte der Shuffling Prozedur sollen auf einem analytischen Gel kontrolliert werden. Hierzu dienen die eingefrorenen Proben UTP-PCR (1 pro Person), DNAFrag (1 pro Gruppe), Amplif (1 pro Person). 1. 1% (w/v) Agarose in 150 ml 1x TAE Puffer aufkochen, auf ca. 50°C abkühlen lassen. 2. Gelschlitten in Gießschiene setzen. 3. Zugabe von 2μl Ethidiumbromid (Achtung mutagen, terratogen). 4. Agaroselösung in den Gelschlitten giessen und aushärten lassen (ca. 30 min). 5. Nach vollständiger Härtung des Gels den Schlitten in die Laufkammer stellen. 6. Laufkammer mit 1x TAE Puffer füllen bis das Gel bedeckt ist. 7. Vorsichtiges Herausziehen des Kamms. 8. Probe mit 1/5 Volumen Ladepuffer versehen und in die Geltasche laden. Längenmarker wird von den Betreuern dazu gegeben. 9. Deckel der Apparatur schliessen, auf richtige Polung achten! 10. Das Gel läuft bei ca. 100 V für ca. 60 min 11. Sichtbarmachen der Banden unter UV Licht. DNA Marker, Ultra low Range, Fermentas Paktikum Genkurs, 2. Teil: DNA Shuffling 11 Protein-Konzentrationsbestimmung nach Bradford Es werden jeweils zwei Proben von drei verschiedenen CAT Mutanten (A, B oder C) ausgegeben, deren Konzentration bestimmt werden soll. Als Eichprotein dient BSA. Die Messung soll selbstständig anhand der ausgegebenen Anleitung von Bio-Rad geplant und in Mikrotiter-Platten durchgeführt werden. Das Auslesen der Platten erfolgt gemeinsam im Labor im 4. Stock. Kultur ansetzen für Plasmid Präparation Zur Plasmid Isolierung werden einzelne Klone von den Platten gepickt und in einer Flüssigkultur angezogen. 1. Jede Gruppe versetzt 25 ml steriles 2YT-Medium mit 25μl Ampicillin-Lösung [100 μg/ml]. 2. Jede Person füllt 5-6 ml des Medium in jeweils 2 sterile, beschriftete Reagensgläser. 3. Jede Person pickt mit einem sterilen Zahnstocher (Abflammen der Pinzette nicht vergessen) zwei einzelne Kolonien von einer der Agar-Platten und impft damit das vorbereitete Medium in den Reagenzgläsern an (1 Klon pro Reagenzglas). 4. Die Reagenzgläser werden über Nacht bei 37°C geschüttelt. TAG 6: MITTWOCH, 14.3.07 Plasmid Präparation Die Plasmide werden aus den E. coli Zellen mit Hilfe des DNA Miniprep Kits (Amersham) extrahiert. Jede Person präpariert einen ihre zwei Klone. 1. Präparation gemäß untenstehender Anleitung. a. Jede Person zentrifugiert 2x2 ml in einem 2 ml Reaktionsgefäß (Schritt 1der Anleitung). b. Der optionale Waschschritt (Schritt 7) ist für diesen E. coli Stamm (RV308) sehr wichtig, und sollte deshalb 2x durchgeführt werden! c. Der PE Waschschritt (Schritt 8) sollte ebenfalls wiederholt werden. d. Elution in 50μl 10 mM Tris, pH 8.0. Plasmid DNA Purification Using the QIAprep Spin Miniprep Kit and a Microcentrifuge This protocol is designed for purification of up to 20 µg of high-copy plasmid DNA from 1–5 ml overnight cultures of E. coli in LB (Luria-Bertani) medium. Paktikum Genkurs, 2. Teil: DNA Shuffling 12 1. Resuspend pelleted bacterial cells in 250 µl Buffer P1 and transfer to a microcentrifuge tube. No cell clumps should be visible after resuspension of the pellet. If LyseBlue reagent has been added to Buffer P1, vigorously shake the buffer bottle to ensure LyseBlue particles are completely dissolved. The bacteria should be resuspended completely by vortexing or pipetting up and down until no cell clumps remain. 2. Add 250 µl Buffer P2 and mix thoroughly by inverting the tube 4–6 times. Mix gently by inverting the tube. Do not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the tube until the solution becomes viscous and slightly clear. Do not allow the lysis reaction to proceed for more than 5 min. If LyseBlue has been added to Buffer P1 the cell suspension will turn blue after addition of Buffer P2. Mixing should result in a homogeneously colored suspension. If the suspension contains localized colorless regions or if brownish cell clumps are still visible, continue mixing the solution until a homogeneously colored suspension is achieved. 3. Add 350 µl Buffer N3 and mix immediately and thoroughly by inverting the tube 4–6 times. To avoid localized precipitation, mix the solution thoroughly, immediately after addition of Buffer N3. Large culture volumes (e.g. ≥5 ml) may require inverting up to 10 times. The solution should become cloudy. If LyseBlue reagent has been used, the suspension should be mixed until all trace of blue has gone and the suspension is colorless. A homogeneous colorless suspension indicates that the SDS has been effectively precipitated. 4. Centrifuge for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge. A compact white pellet will form. 5. Apply the supernatants from step 4 to the QIAprep spin column by decanting or pipetting. 6. Centrifuge for 30–60 s. Discard the flow-through. 7. Recommended: Wash the QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30–60 s. Discard the flow-through. This step is necessary to remove trace nuclease activity when using endA+ strains such as the JM series, HB101 and its derivatives, or any wild-type strain, which have high levels of nuclease activity or high carbohydrate content. Host strains such as XL-1 Blue and DH5α™ do not require this additional wash step. 8. Wash QIAprep spin column by adding 0.75 ml Buffer PE and centrifuging for 30–60 s. 9. Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer. Paktikum Genkurs, 2. Teil: DNA Shuffling 13 Important: Residual wash buffer will not be completely removed unless the flow-through is discarded before this additional centrifugation. Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions. 10. Place the QIAprep column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 50 µl Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of each QIAprep spin column, let stand for 1 min, and centrifuge for 1 min. Konzentrationsbestimmung der DNA Die Konzentration der präparierten Plasmid DNA wird photometrisch durch Messung der Absorption bei 260 nm bestimmt. 1. 10μl Plasmid DNA mit 250μl EB Puffer verdünnen. 2. Referenzspektrum von reinem EB Puffer von 220 bis 350 nm aufnehmen. 3. Spektrum von 220 bis 350 nm aufnehmen. Es sollte sich ein Peak bei 260 nm ergeben. Das Verhältnis der Absorbtion bei 260/280 nm sollte ca. 1.8 betragen. 4. Berechnung der DNA Konzentration aus der Absorption bei 260 nm abzüglich des Streulichts bei 320 nm. (50 μg/ml DNA liefern in einer Küvette mit 1 cm Schichtdicke eine Absorbtion von 1 bei 260 nm.) Wichtig! Verdünnungsfaktor beachten. 5. Für die Sequenzierung wird eine DNA Konzentration von 30–100 ng/μl und ein Volumen von 30 μl benötigt. Bitte protokollieren, welche Konzentration abgegeben wurde. Sequenzierung Jede Person sollte einen Klon sequenzieren. Die Sequenzierung erfolgt durch Bindung des Sequenzierprimers an die DNA und anschliessende Verlängerung. Da sich in der Reaktion nicht nur dNTP’s sondern auch ddNTP’s befinden, bricht die Verlängerung des Primers nach Abbau eines dNTP’s ab. Hierdurch entstehen unterschiedlich lange Fragmente Die ddNTP’s sind fluoreszenzmarkiert, jeweils einer Farbe pro Nukleotid. Dieses wird bei der Sequenzierung mittels eines Lasers ausgelesen. Die Sequenzierung erfolgt durch die Firma GATC in Konstanz (www.GATC.com). Hierfür muss die DNA (30-100 ng/μl in 30 μl) in einem Reaktionsgefäß mit einem Barcode versehen werden. Bitte den Barcode ungedingt auf die Vorderseite des Reaktionsgefäßes gemäß des Fotos anbringen WICHTIG!!! Jede Gruppe sollte die Probe mit Genkurs_[Gruppennummer] benennen und sich die Barcode Nummer aufschreiben, damit sie später ihre Sequenz vom Server herunterladen kann! Paktikum Genkurs, 2. Teil: DNA Shuffling 14 TAG 7: DONNERSTAG, 15.3.07 Darstellung der Struktur von CAT am Computer Die Struktur von CAT soll mithilfe des Swiss pdb viewers wie folgt visualisiert werden: 1. Farbliche Abgrenzung des Trimers 2. Darstellung der Sekundärstruktur (z.B. im Bändermodell) 3. Markieren der fehlenden Aminosäuren am N-terminus 4. Hervorheben der Aminosäuren, die in den Mutanten verändert sind 5. Gibt es Ideen, warum sich diese Mutationen in der Selektion durchsetzten? Dieses Bild soll in das Protokoll mit eingebunden werden, und mögliche Vor- und Nachteile der Mutationen sollen diskutiert werden. TAG 8: FREITAG, 16.3.07 Auswertung der Sequenzierergebnisse Die Sequenzen sollen mithilfe des GCG Programms ausgewertet werden. Hierbei soll geprüft werden, welche Mutationen der CAT Klone in dem neu zusammengesetzten Gen nach dem DNA Shuffling auftauchen. Anhand dieser Mutationen soll bestimmt werden, von welchem Klon (Klone R7_K2, R7_K3, R7_K7, R7_K9) das jeweilige Fragment stammt. Dies muss nicht immer eindeutig sein, da manche Mutationen in mehreren Klonen vorhanden sind. Hierdurch soll die minimale Anzahl unterschiedlicher Fragmente bestimmt werden, um eine Aussage über die mittlere Fragmentlänge zu machen. Folgende Punkte sollen im Protokoll aufgeführt werden: 1. 2. 3. 4. Qualität der Sequenzierung (Länge, Signal, Eindeutigkeit der Sequenz). Sequenz des CAT Gens als Genkarte mit Hervorhebung der Mutationen. Analyse, welche Mutation aus welchem Klon kommt. Bestimmung der mittleren Fragmentlänge des Shuffling-Experiments. Paktikum Genkurs, 2. Teil: DNA Shuffling Anhang: Genkarte des CAT Wildtyp Enzyms Genkarte der verkürzten CAT Mutante Nd10 Übersicht über die Mutationen auf Gen- und Aminosäure Ebene 15 Paktikum Genkurs, 2. Teil: DNA Shuffling 16 Auszug aus der Plasmid-Karte: CAT Wildtyp Gen Mutationen der Klone R7_K2, R7_K3, R7_K7, R7_K9 sind fett markiert und unterstrichen, die 10 fehlenden Aminosäuren am N-Terminus sind kursiv dargestellt. lacO1-> mRNA_lac-> -35lac-| -10lac-| | -35lac-> | -10lac-> | | lacO1-| S/DI-> lacZ'-> | | | | | | | | AGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTA 1201 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1300 b - b lacZ-| CAT-> XbaI| NdeI | || | | CGAATTTctagataacgagggcaacatATGGAGaaaaaaATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCAT 1301 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1400 10 20 M E K K I T G Y T T V D I S Q W H R K E H F E A F - b TTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGC 1401 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1500 30 40 50 Q S V A Q C T Y N Q T V Q L D I T A F L K T V K K N K H K F Y P A - b BspEI BsmI | | | CTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAgTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGT 1501 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1600 60 70 80 90 F I H I L A R L M N A H P E F R M A M K D G E L V I W D S V H P C - b TACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGG 1601 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1700 100 110 120 Y T V F H E Q T E T F S S L W S E Y H D D F R Q F L H I Y S Q D V A - b PasI BsmBI PflMI | | CGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTT 1701 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1800 130 140 150 C Y G E N L A Y F P K G F I E N M F F V S A N P W V S F T S F D L - b BtgI NcoI MscI StyI | | AAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTT 1801 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1900 160 170 180 190 N V A N M D N F F A P V F T M G K Y Y T Q G D K V L M P L A I Q V - b ScaI | HindIII BsmI TatI | CAT-| | | | | | | CATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGtgaaagcttGACCTGT 1901 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 2000 200 210 219 H H A V C D G F H V G R M L N E L Q Q Y C D E W Q G G A * f1-ori-| BstAPI f1ori_IG5'| lpp-> DraIII lpp-| BamHI || | | | | || GAAGTGAAAAATGGCGCACATTGTGCGACATTTTTTTTGTCTGCCGTTTACCGCTACTGCGTCACGGATCCCCACGCGCCCTGTAGCGGCGCATTAAGCG 2001 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 2100 b - Paktikum Genkurs, 2. Teil: DNA Shuffling 17 Auszug aus der Plasmid-Karte: CAT_Nd10 lacO1-> mRNA_lac-> -35lac-| -10lac-| | -35lac-> | -10lac-> | | lacO1-| S/DI-> lacZ'-> | | | | | | | | AGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTA 1201 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1300 TCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTACTAAT b lacZ-| CATdel11-> XbaI| NdeI| || || CGAATTTctagataacgagggcaacatATGGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACC 1301 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1400 GCTTAAAgatctattgctcccgttgtaTACCTATATAGGGTTACCGTAGCATTTCTTGTAAAACTCCGTAAAGTCAGTCAACGAGTTACATGGATATTGG b M D I S Q W H R K E H F E A F Q S V A Q C T Y N Q - AGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAA 1401 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1500 TCTGGCAAGTCGACCTATAATGCCGGAAAAATTTCTGGCATTTCTTTTTATTCGTGTTCAAAATAGGCCGGAAATAAGTGTAAGAACGGGCGGACTACTT b T V Q L D I T A F L K T V K K N K H K F Y P A F I H I L A R L M N - BspEI BsmI | | | TGCTCATCCGGAgTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACG 1501 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1600 ACGAGTAGGCCTcAAGGCATACCGTTACTTTCTGCCACTCGACCACTATACCCTATCACAAGTGGGAACAATGTGGCAAAAGGTACTCGTTTGACTTTGC b A H P E F R M A M K D G E L V I W D S V H P C Y T V F H E Q T E T - TTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCC 1601 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1700 AAAAGTAGCGAGACCTCACTTATGGTGCTGCTAAAGGCCGTCAAAGATGTGTATATAAGCGTTCTACACCGCACAATGCCACTTTTGGACCGGATAAAGG b F S S L W S E Y H D D F R Q F L H I Y S Q D V A C Y G E N L A Y F P - PasI BsmBI PflMI MscI | | | CTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGC 1701 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1800 GATTTCCCAAATAACTCTTATACAAAAAGCAGAGTCGGTTAGGGACCCACTCAAAGTGGTCAAAACTAAATTTGCACCGGTTATACCTGTTGAAGAAGCG b K G F I E N M F F V S A N P W V S F T S F D L N V A N M D N F F A - BtgI NcoI StyI | CCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTC 1801 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 1900 GGGGCAAAAGTGGTACCCGTTTATAATATGCGTTCCGCTGTTCCACGACTACGGCGACCGCTAAGTCCAAGTAGTACGGCAGACACTACCGAAGGTACAG b P V F T M G K Y Y T Q G D K V L M P L A I Q V H H A V C D G F H V - ScaI | HindIII BstAPI BsmI TatI | CAT-| | lpp-> DraIII | | | | | | | GGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGtgaaagcttGACCTGTGAAGTGAAAAATGGCGCACATTGTGCGACA 1901 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 2000 CCGTCTTACGAATTACTTAATGTTGTCATGACGCTACTCACCGTCCCGCCCCGCactttcgaaCTGGACACTTCACTTTTTACCGCGTGTAACACGCTGT b G R M L N E L Q Q Y C D E W Q G G A * - f1-ori-| f1ori_IG5'| lpp-| BamHI || | | || TTTTTTTTGTCTGCCGTTTACCGCTACTGCGTCACGGATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGA 2001 ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ 2100 AAAAAAAACAGACGGCAAATGGCGATGACGCAGTGCCTAGGGGTGCGCGGGACATCGCCGCGTAATTCGCGCCGCCCACACCACCAATGCGCGTCGCACT b - Paktikum Genkurs, 2. Teil: DNA Shuffling 18
