Molekulare Typisierung CF

Werbung
Winterschool Obergurgl
Molekulare Typisierung
CF-relevanter Erreger
Barbara C. Kahl
Institut für
Medizinische Mikrobiologie
Universitätsklinikum Münster
Warum Typisierung?
• Individueller Patient
– Persistierende Infektion – Neuinfektion
• Epidemiologie
– Ausbruch – verschiedene Klone - Ursprung
• Populationsstruktur
– Weltweite Vergleiche von Isolaten
Methoden
• Pulsfeldgel-Elektorphorese
Dendrogram
Indviduelle Klone
7
9
8
Pat. 1 2 3 3 3 4 4 4 5 5 6 7 8 8 M
Prävalenter Klon B
M 1 2 3 4 5 6 7 8 9
6
3
4
1
5
2
Kahl et al, J Clin Microbiol 2003
Marker
clone C
clone G
clone A
clone D
clone E
clone B
Marker
Die 6 weit verbreiteten S. aureus Klone
B
A
E
D
G
C
Klon
A
B
C
D
E
G
Patienten
12
9
7
4
3
3
38
Sequenzbasierte Typisierungs-Methoden
• Vorteil
– Hohe Diskriminierung
– Sehr gute Reproduzierbarkeit
– Daten transportierbar, gute Vergleichbarkeit zwischen
verschiedenen Laboratorien
• Epidemiologische und populationsbiologische Studien möglich
– High-through-put Analyse
• Nachteil
– Besonderes Equipment
– Pflege offener Datenbanken
– Kosten
Sequenzbasierte Typisierungsmethoden
• Single-locus sequencing Methoden
– spa-Typisierung von S. aureus (VNTR)
• Multi-locus sequence typing (MLST)
– S. aureus, P. aeruginosa
• Whole-genome Sequencing
– P. aeruginosa
spa-Typsierung: VNTR Region von Protein A von S. aureus
Protein A
Signal
IgG binding
VNTR
LPXTG
•
Region von Protein A mit einer unterschiedlichen Anzahl variabler tandem
repeats (21 to 27 bp) „variable number of tandem repeats“
•
Als Typisierungsmethode fürS. aureus
Methode:
•
Primer der flankierenden konservierten Region, um die repeat Region zu
amplifizieren
•
Amplicons werden sequenziert
•
Software Programm zur Analyse
–
www.spaServer/ridom.de; (Ridom StaphType )
spa-repeats und -Typen
•spa Typen, abhängig von der Zusammensetzung und der Anzahl der repeats
Repeat Code
Sequence Repeat
SpaType
Repeat Succession
r01
GAGGAAGACAACAACAAGCCTAGC
t001
r26r30r17r34r17r20r17r12r17r16
r02
AAAGAAGACAACAAAAAACCTGGC
t002
r26r23r17r34r17r20r17r12r17r16
r03
GAGGAAGACAATAACAAACCTGGT
t003
r26r17r20r17r12r17r17r16
r04
GAGGAAGACAATAACAAGCCTGGT
t004
r09r02r16r13r13r17r34r16r34
r05
AAAGAAGACAACAAAAAGCCTGGC
t005
r26r23r13r23r31r05r17r25r17r25r16r28
r06
AAAGAAGACGGCAAAAAACCTGGC
t006
r26r23r13r23r31r05r17r17r25r16r28
r07
GAGGAAGACAACAACAAACCTGGT
t007
r15r12r16r16r16r16r02r25r17
r08
GAGGAAGACAACAACAAGCCTGGT
t008
r11r19r12r21r17r34r24r34r22r25
Sequenzierung von spa
• Typisierung von MRSA und MSSA
• Shopsin et al. JCM 1999, introduction of spa-typing
– Tang et al. JCM 2000, comparison of PFGE and spa-typing
– Oliveira et al. JCM 2001, comparison of PFGE, other molecular
typing techniques and spa-typing
• Als Marker für Micro - und Macrovariation
• Koreen et al. JCM 2004
verglichen zur DNA Array Analyse
CF Isolate
• 155 konsekutive S. aureus Isolate von 10 Patienten
• Isogene Isolate eines jeden Patienten (6-25 Isolate)
• mediane S. aureus Persistenz: 56 Monate
(Streuung 41 bis 75 Monate)
• PFGE Charakteristiken:
-Isolate von 4 Patienten identisch
-Isolate von 6 Patienten mit leichten
Unterschieden im Bandenmuster
Kahl B et al, J Clin Microbiol 2003
Identische PFGE Bandenmuster
Patient 3
11/11/98
05/22/98
11/20/97
10/01/97
06/04/97
04/19/97
12/20/95
10/31/95
06/14/95
Spa
types repeats
t072
t071
t072
t072
t071
t071
t071
t002
t071
r26r23r23r17r12r17r16
.
r26r23r23r17r34r17r20r17r12r17r16
r26r23r23r17r12r17r16
r34r17r20r17 an Pos 5 Del
r26r23r23r17r12r17r16
r26r23r23r17r34r17r20r17r12r17r16
r26r23r23r17r34r17r20r17r12r17r16
r26r23r23r17r34r17r20r17r12r17r16
r26r23r17r34r17r20r17r12r17r16
r23 an Pos 3 Del
r26r23r23r17r34r17r20r17r12r17r16
t071
r26r23r23r17r34r17r20r17r12r17r16
t071
r26r23r23r17r34r17r20r17r12r17r16
Die Isolate von 2 von 4 Patienten mit identischen PFGE Bandenmustern
wiesen unterschiedliche spa Typen auf
Kahl B et al, J Clin Microbiol 2003
Unterschiedliche PFGE Bandenmuster
Patient 9
Date of isolation
01/15/99
01/15/99
01/15/99
01/15/99
08/05/98
07/28/98
08/21/97
02/27/97
06/19/96
01/18/95
Spa
types repeats
t009
t009
t009
t009
t009
t009
t009
t009
t009
t009 r11r12r21r17r34r24r34r22r24r34r22r33r25
Die Isolate von 2 von 6 Patienten mit unterschiedlichen PFGE Bandenmustern
hatten denselben spa Typen
Kahl B et al, J Clin Microbiol 2003
Ergebnisse der spa Typisierung
• 142 Isolate von 10 Patienten:
– 16 unterschiedliche spa Typen
• Isolate von 5 Patienten identische spa Typen
• Isolate von 5 Patienten variierende spa Typen
– Deletionen (9 Isolate von 4 Patienten)
– Duplikationen (2 Isolate von 2 Patienten)
– Punktmutationen (4 Isolate von 2 Patienten)
⇒ zum ersten Mal überzeugender Nachweis von
Evolution der VNTR während Langzeitpersistenz
⇒ wichtige Bedeutung für spa Typisierung
Multi-locus sequence typing (MLST)
¾ 7 Haushaltsgene
¾ Länge der Amplikons ca. 400-600bp
¾ jedes neue Allel erhält eine neue Nummer
¾ die Kombination der verschiedenen Allele
ergibt den Sequenztypen (ST)
¾ Jeder neue Sequenztyp erhält eine neue
Nummer
Curran et al J Clin Microbiol 2004
MLST Ergebnisse – Pseudomonas aeruginosa
• 143 Isolate, klinische und Umwelt-Isolate
• 139 verschiedene Sequenztypen
• 10 Linien oder „clonal complexes“
– Identische STs, oder STs, die an einem (single-, SLV) oder
zwei (double-locus variants, DLV) loci variierten
• Zu jedem CC gibt es ein „founder“ Isolat (Ursprungs.)
• Umweltisolate nicht verwandt, ordnen sich zu den
Gruppen der klinischen Isolate
Curran et al J Clin Microbiol 2004
Clonal complexes
- 61 Isolate ernster ambulant erworbener S. aureus Infektionen
- 179 Isolate gesunder nasaler Träger
- 94 Isolate nosokomialer Isolate
- Oxford und Umgebung, 1997 - 1998
Day et al, Science 2001
MLST Analyse
• eBURST
– Algorythmus, der große MLST Datensets in nichtüberlappende oder verwandte STs und CC unterteilt
– Diversifizierung von Klonen
– Entstehung epidemischer Klone
⇒P. aeruginosa hat keine
Populationsstruktur
klonale epidemiologische
Populationsstruktur
⇒ Auswirkungen für die Auswahl
der besten Typisierungsmethode
⇒ Bedeutung für Vakzinierungsstrategien
Streptococcus pneumoniae (1638 Isolate)
MLST Ergebnisse von P. aeruginosa Isolaten
Curran et al J Clin Microbiol 2004
Whole genome sequencing
Whole genome sequencing von CF-Isolaten
• P. aeruginosa, frühes Isolat
• P. aeruginosa, isogenes Isolat 7,5 Jahre später
– shot gun sequencing, 97 % des Genoms sequenziert
viele „loss-of function“ Mutationen
Smith EE et al., PNAS 2006
Mutationen im Spät-Isolat
Funktionen
Anzahl mutierter Gene
¾Virulenzfaktoren, Virulenzregulatoren
13
¾Transporter, Resistenzfaktoren
12
¾Eisenaufnahme
5
¾DNA-Replikation, Zellteilung, Transkription
¾Translation
5
¾Quorum sensing
3
¾Fettstoffwechsel
3
¾DNA-mismatch Reparatursysteme
1
¾Anaerober Metabolismus
1
Smith et al., PNAS 2006
Mutationen in weiteren CF-Isolaten
•
•
•
•
29 weitere Paare von CF-Patienten untersucht
Mindestens 2 isogene Isolate
Mindestens 5 Jahre Zeitunterschied
24 Gene, die im ersten Patienten mutiert waren,
sequenziert
– Die meisten Gene sind nicht mutiert
– Jedoch finden sich einige der Mutationen bei vielen SpätIsolaten
Häufige Mutationen
– Positive Selektion überwiegt:
• Nicht-synonyme Mutationen (n=103) überwiegen die synonymen
Mutationen (n=5)
– Häufigste Mutationen betreffen „multi-drug-efflux“ Pumpen
– Mutationen von Virulenzregulatoren, insbes. lasR
• Vfr, ein Regulator, der lasR reguliert
• exsA, TypIII-Sekretionssystem
Ergebnisse
¾Konzept der Virulenz
¾Virulenzgene für akute und chronische Infektion
¾Invasive Faktoren und Faktoren, die für die Persistenz bedeutend sind
¾„immune evasion“ oder „immune escape“
ÖVirulenzgene der chronischen Infektion als zukünftige Targets der Behandlung
chronischer Infektionen
Herunterladen
Random flashcards
Literaturepochen

2 Karten oauth2_google_55780ed8-d9a3-433e-81ef-5cfc413e35b4

Erstellen Lernkarten