- TUprints

Werbung
Entwicklung einer T-Zelltherapie für chronisch-entzündliche
Erkrankungen basierend auf Chemokinrezeptor-Antagonisten
Vom Fachbereich Biologie der Technischen Universität Darmstadt
zur
Erlangung des akademischen Grades
eines Doctor rerum naturalium
genehmigte Dissertation
von
Dipl.-Biol. Nadine Ogrissek
aus Wolfen
1. Referentin:
Prof. Dr. Beatrix Süß
2. Referent:
Prof. Dr. Heinfried H. Radeke
3. Referent:
Prof. Dr. Ralf Galuske
Tag der Einreichung: 01.04.2015
Tag der mündlichen Prüfung: 01.06.2015
Darmstadt 2015
D17
Inhaltsverzeichnis
1. .... Einleitung
1.1.
T-Zellmigration
1.1.1. T-Zellen
1.1.2. Extravasation von Leukozyten
1.2.
Chemokine und Chemokinrezeptoren
1.2.1. Chemokine im Überblick
1.2.2. Signaltransduktion von Chemokinrezeptoren
1.2.3. Chemokinrezeptoren CXCR3, CXCR4 und CXCR7
1.3.
Die Rolle von Chemokinrezeptoren und ihren Liganden bei chronischen Entzündungen
1.3.1. Autoimmunerkrankungen im Überblick
1.3.2. CXCR3 und seine Liganden CXCL9/10/11
1.3.3. CXCR4 und sein Ligand CXCL12
1.4.
Therapie von chronischen Entzündungen
1.4.1. Aktuelle therapeutische Ansätze
1.4.2. Einsatz von Chemokinrezeptor-Antagonisten
1
1
1
3
7
7
11
13
16
16
17
19
19
20
22
2. .... Zusammenfassung
26
3. .... Material und Methoden
3.1.
Molekularbiologische Methoden
3.1.1. RNA Isolierung
3.1.2. Polymerase-Kettenreaktion (PCR)
3.1.3. Gelelektrophoretische Auftrennung von Nukleinsäuren
3.2.
Mikrobiologische Methoden
3.2.1. Kultivierung von E.coli
3.2.2. Klonierung
3.3.
Zellbiologische Methoden
3.3.1. Kultivierung von murinen und humanen Zelllinien
3.3.2. Isolierung muriner Milzzellen
3.3.3. Magnetische Aufreinigung von T-Zellen
3.3.4. Kultivierung von primären T-Zellen
3.3.5. Zellstimulierung für T-Zellaktivierung
3.3.6. Einfrieren und Auftauen von Zellen
3.3.7. Lentivirale Transduktion von T-Zellen
3.3.8. Chemotaxis-Assay
3.4.
Immunologische Methoden
3.4.1. ELISA
3.4.2. Western Blot Analyse
3.4.3. Durchflusszytometrie
3.5.
Statistik
28
28
28
28
30
31
31
31
35
35
36
36
37
37
38
38
39
41
41
41
42
42
4. .... Ergebnisse
4.1.
Klonierung der verwendeten lentiviralen Konstrukte
4.1.1. Chemokinrezeptor-Antagonisten CXCL11(4-79), CXCL12(P2G29) und vMIP-II
43
43
43
4.1.2.
4.1.3.
4.2.
4.2.1.
4.2.2.
4.2.3.
4.3.
4.3.1.
4.3.2.
4.4.
Klonierung der auf pCDH1-MCS1-EF1-copGFP basierenden Konstrukte
Klonierung weiterer lentiviraler Konstrukte
Transduktion von T-Zellen mit den generierten Konstrukten
Optimierung der Transduktion von T-Zellen
Transduktion von murinen und humanen Zelllinien
Transduktion von primären T-Zellen
Nachweis der Expression und Sekretion der Chemokinrezeptor-Antagonisten
Expression der Chemokinrezeptor-Antagonisten auf RNA-Ebene
Expression der Chemokinrezeptor-Antagonisten auf Proteinebene
Untersuchung der Effizienz der von T-Zellen produzierten Chemokinrezeptor-Agonisten in
vitro mittels Chemotaxis-Assay
Expression von CXCR3, CXCR4 und CXCR7 auf murinen Th1-Zellen
EC50-Werte der CXCL9/10/11/12 vermittelten Th1-Zellmigration im Chemotaxis-Assay
Untersuchung der Wirkung der produzierten Chemokinrezeptor-Antagonisten auf die
Zellmigration im Chemotaxis-Assay
Die differentielle Wirkung von vMIP-II auf die durch CCL2/4/5 sowie CXCL9/10/11/12
vermittelte Th1-Migration
45
46
48
48
49
54
55
55
57
5. .... Diskussion
5.1.
Klonierung geeigneter lentiviraler Konstrukte für die Integration der ChemokinrezeptorAntagonisten in T-Zellen
5.2.
Etablierung der Transduktion von T-Zellen mit pCDH1-MCS1-EF1-copGFP-Konstrukten
5.3.
Nachweis der Expression und Sekretion der Chemokinrezeptor-Antagonisten von
transduzierten T-Zellen
5.4.
Untersuchung der Effizienz der von T-Zellen produzierten Chemokinrezeptor-Agonisten in
vitro mittels Chemotaxis-Assay
5.4.1. Hemmung der CXCL10 vermittelten Zellmigration durch Einsatz von CXCL11(4-79)
5.4.2. Wirksamkeit der weiteren untersuchten Antagonisten CXCL12(P2G2) und vMIP-II
5.5.
Ausblick auf das Potential dieser auf Chemokinrezeptor-Antagonisten basierenden TZelltherapie für chronische Entzündungen
79
6. .... Literaturverzeichnis
92
4.4.1.
4.4.2.
4.4.3.
4.4.4.
62
62
68
70
77
79
81
82
84
85
87
89
7. .... Abkürzungsverzeichnis
106
8. .... Abbildungsverzeichnis
108
9. .... Tabellenverzeichnis
109
10... Kongresse und Publikationen
110
11... Danksagung
111
12... Lebenslauf
112
13. .. Ehrenwörtliche Erklärung
113
EINLEITUNG
1. Einleitung
1.1. T-Zellmigration
1.1.1. T-Zellen
Der Begriff „Leukozyt“ stammt von dem griechischen Wort leukós für „weiß“ ab und
bezeichnet alle weißen Blutzellen als Abgrenzung von den Hämoglobin-haltigen, roten
Blutzellen. Zu den Leukozyten gehören alle Knochenmark-entstammenden Zellen der
myeloiden oder lymphoiden Reihe, im einzelnen zählen Granulozyten, Monozyten,
Makrophagen, dendritische Zellen und Lymphozyten dazu. T-Zellen bilden neben B-Zellen
und natürlichen Killerzellen eine Untergruppe der Lymphozyten und zählen zur adaptiven
Immunantwort. Alle Lymphozyten werden aus lymphoiden Vorläuferzellen im Knochenmark
gebildet, wobei einzig die T-Zellen zunächst im Thymus ausreifen und schließlich weiter als
naive T-Zellen in die sekundären Lymphorgane (Milz, Lymphknoten, Schleimhaut-assoziiertes
lymphatisches Gewebe) wandern sowie in Blut und Lymphflüssigkeit bis zur Exposition mit
dem entsprechenden Antigen zirkulieren. Die Exposition mit dem entsprechenden Antigen
erfolgt in den sekundären lymphatischen Organen über Antigen-präsentierende Zellen, in
diesem Fall den dendritischen Zellen.
Die Besonderheit von T-Zellen ist, dass jede gebildete T-Zelle eine einzigartige Variation des
T-Zellrezeptors besitzt, welcher ein bestimmtes Antigen binden kann. Somit kann die
Gesamtheit der im Körper zirkulierenden T-Zellen auf eine immense Anzahl verschiedener
Antigene reagieren. Diese Variationsbreite wird durch die V(D)J-Rekombination, bei welcher
verschiedene Gen-Segmente in unterschiedlichster Reihenfolge zusammengelagert werden,
erreicht. Der T-Zellrezeptor ist strukturell den Immunglobulinen oder Antikörpern ähnlich und
besteht aus einem Proteinkomplex, der die Zellmembran durchspannt. Neben einem
Heterodimer aus α- und β-Kette, vervollständigen verschiedene Ko-Rezeptoren den TZellrezeptorkomplex. Darunter befinden sich der CD3-Komplex aus CD3γ, CD3δ und CD3ε,
eine ζ-Kette, sowie der CD4- oder CD8 Ko-Rezeptor. Der T-Zellrezeptor bindet allerdings nicht
direkt an das Antigen, sondern erst nachdem es von der Antigen präsentierenden Zelle
prozessiert und gespalten wurde. Diese Peptide werden dann im Komplex mit MHCMolekülen an der Zelloberfläche präsentiert und von dem T-Zellrezeptor-Heterodimer der
Zelle erkannt. MHC-Moleküle werden von einer Gruppe von Genen, dem
Haupthistokompatibilitätskomplex, kodiert. Es wird zwischen zwei Klassen von MHCMolekülen unterschieden, wobei MHC-Klasse-I an CD8 exprimierende zytotoxische T-Zellen
bindet, MHC-Klasse-II hingegen an CD4 positive T-Helferzellen.
Zusätzlich zur Aktivierung des T-Zellrezeptors mit dem Antigen ist ein zweites Signal zur TZellaktivierung notwendig. Dieses kann über aktivierte dendritische Zellen, Makrophagen
oder B-Zellen vermittelt werden. Ein solches ko-stimulierendes Molekül muss an einen kostimulierenden Rezeptor auf der T-Zelloberfläche binden, wovon CD28 bisher am besten
untersucht wurde. CD28 wird von naiven T-Zellen exprimiert und kann von den Liganden
CD80 und CD86 gebunden werden. Um unnötige Immunreaktionen zu verhindern, muss
sowohl das Antigen als auch das ko-stimulierende Signal von einer einzigen Antigen-
1
EINLEITUNG
präsentierenden Zelle stammen. Zur weiteren Kontrolle erfolgt die Expression der kostimulierenden Moleküle erst nach Infektion.
Infolge der Bindung des Antigens an den passenden T-Zellrezeptor kommt es zur
Phosphorylierung der im Komplex vorhandenen ITAM-Motive (immunoreceptor tyrosinebased activation motivs) durch Tyrosinkinasen der Src-Familie, wodurch eine weitere
Tyrosinkinase, bekannt als ZAP-70, rekrutiert wird. Diese Kinase phosphoryliert das
Gerüstprotein LAT (linker of activated T cells), sowie das Adapterprotein SLP-76, welche
ihrerseits wiederum weitere Proteine zum Komplex rekrutieren und aktivieren. Darunter
befindet sich die Phospholipase C-γ, die Inositoltrisphosphat (IP3) und Diacylglycerol (DAG)
generiert und somit die intrazelluläre Calcium-Konzentration erhöht als auch Proteinkinase Cθ und das G-Protein Ras innerhalb der weiteren Signalkaskade aktiviert. Zusammen mit dem
Signal des ko-stimulierenden Rezeptors CD28 erfolgt im weiteren Verlauf die Aktivierung der
Transkriptionsfaktoren AP-1 (activator protein 1), NFAT (nuclear factor of activated T cells)
und NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells), welche schließlich
zur Transkription des Wachstumsfaktors Interleukin-2 (IL-2) führen. Die Expression dieses
Zytokins ist entscheidend für die folgende Proliferation und Differenzierung der naiven TZelle.
Sobald eine T-Zelle aktiviert wird, beginnt sie stark zu proliferieren und eine Vielzahl
identischer Klone zu bilden, sowie in Effektor-T-Zellen verschiedener Art zu differenzieren,
wodurch verschiedene Funktionen ausgeführt werden können. Naive CD8+ T-Zellen werden
zu zytotoxischen T-Zellen und sind in der Lage, infizierte Zellen zur Apoptose anzuregen.
Dabei werden besonders Viren und einige intrazelluläre Bakterien bekämpft. Im Gegensatz
dazu besitzen CD4+ Zellen ein breiteres Repertoire an Effektor-Zelltypen. Zum einen können
sie in T-Helferzellen verschiedener Art differenzieren und weitere Immunzellen aktivieren.
Zum anderen können sie als Regulatorische T-Zellen die Aktivität anderer Lymphozyten
unterdrücken, um die Immunantwort in Schach zu halten.
Die wichtigsten Subtypen von T-Helferzellen sind Th1-, Th2-, Th17-, Th22- und Th9-Zellen.
Daneben existieren auch verschiedene Subtypen von regulatorischen T-Zellen, worauf hier
allerdings nicht weiter eingegangen werden soll. Die differentielle Wirkung von T-Helferzellen
wird durch die Expression unterschiedlicher Zytokine gewährleistet. So produzieren Th1Zellen vor allem IL-2, Th2-Zellen hingegen vorwiegend IL-4, IL-5 sowie IL-13, Th17-Zellen
Zytokine der IL-17-Familie, Th22-Zellen IL-22 und Th9-Zellen besonders IL-9. Um die TZellproliferation zu inhibieren produzieren regulatorische T-Zellen unter anderem IL-10 und
TGF-β (Raphael et al. 2014).
Th1-Zellen sind unentbehrlich bei der zellvermittelten Endzündung und bei hypersensitiven
Reaktionen. Die Aktivierung von Makrophagen und B-Zellen initiiert die Bekämpfung
intrazellulärer Bakterien. Zu den Faktoren, welche die Differenzierung zu Th1 besonders
begünstigen, gehören IFNγ/STAT1-, IL-2/STAT5- und IL-12/STAT4-abhängige Signalwege als
auch starke Signale ausgehend vom T-Zellrezeptor. Th1-Effektorzellen exprimieren zudem
stets den Transkriptionsfaktor T-bet. Th2-Zellen besitzen eine wichtige Rolle in der
parasitären Immunabwehr und stimulieren ebenfalls B-Zellen zur Antikörperproduktion,
jedoch regen sie zusätzlich einen Isotypen-Wechsel hin zur IgE-Synthese an. Da sie zudem
2
EINLEITUNG
eosinophile Granulozyten und Mastzellen aktivieren, ist, im Laufe von allergischen
Reaktionen, typischerweise eine erhöhte Anzahl von Th2-Zellen vorhanden. Th17-Zellen
hingegen sind wichtig bei Infektionen mit extrazellulären Bakterien, Pilzen oder anderen
eukaryotischen Pathogenen und unterstützen die Rekrutierung von Neutrophilen zum Ort der
Infektion. Zudem sind sie bei der Verstärkung von Entzündungen wesentlich beteiligt. Bei
Th22-Zellen handelt es sich um eine neu definierte Schwester-Gruppe der Th17-Zellen. Sie
wurden bisher vorwiegend bei der Pathogenese von autoimmunen Hauterkrankungen
beschrieben. Der Subtyp Th9 wurde bisher vorwiegend als pathogen beschrieben. Da Th9Zellen neben IL-9 auch den anti-entzündlichen Faktor IL-10 produzieren, könnten sie
allerdings auch immunregulatorische Funktionen besitzen. Insgesamt veranschaulicht allein
diese Bandbreite an T-Helferzellsubpopulationen und -funktionen die enorme Feinmechanik
unseres Immunsystems (Raphael et al. 2014).
Nach Aktivierung der naiven T-Zelle dauert es 4 bis 6 Tage bis die Antigen-spezifischen
Effektor-T-Zellen das sekundär lymphatische Organ verlassen und über die Blutgefäße zum
Zielort gelangen. Der Vorgang des Übertritts vom Blutstrom in das umliegende Gewebe wird
im folgenden Abschnitt näher erläutert. Bei einer erneuten Infektion mit dem gleichen Antigen
kann die adaptive Immunantwort beschleunigt ablaufen, da ein immunologisches Gedächtnis
vorhanden ist. Sowohl B- als auch T-Zellen besitzen die Fähigkeit nach Kontakt mit dem
Antigen in Gedächtnis-Zellen zu differenzieren und in geringer Anzahl über Jahre hinweg im
Körper zu verbleiben. Bei Infektion mit einem bereits bekannten Antigen beginnen
Gedächtnis-Zellen wieder in Effektor-Zellen zu differenzieren. In diesem Zusammenhang sind
besonders die Zytokine IL-7 und IL-15 von Bedeutung. Diese außergewöhnliche Fähigkeit des
Immunsystems wird heute standardmäßig bei Schutzimpfungen gegen Infektionskrankheiten
ausgenutzt.
1.1.2. Extravasation von Leukozyten
In Folge der Entzündungsreaktion, welche durch die angeborene Immunantwort ausgelöst
wird, migrieren Leukozyten aus dem Blutgefäß und durch das angrenzende Endothel in das
umliegende Gewebe zum Entzündungsherd. Dieser Prozess wird als Extravasation oder
Leukodiapedese bezeichnet und ist für die lokale Funktion von Leukozyten unvermeidlich. Die
einzelnen Schritte beinhalten I) das Rollen der Immunzellen entlang der Gefäßinnenwand, II)
die ersten Kontakte zu den Endothelzellen, III) eine festere Bindung und langsames Kriechen
entlang des Endothels und IV) die para- oder transzelluläre Migration (Abbildung 1.1). An
diesem komplexen Vorgang sind zahlreiche Proteine beteiligt, und trotz jahrelanger
Untersuchungen sind noch lange nicht alle Details bekannt. Untersuchungen über die
Extravasation von Leukozyten gibt es für Neutrophile, Monozyten und Lymphozyten, wobei
der Fokus der meisten Studien auf der Migration von Neutrophilen liegt.
Zunächst müssen die Leukozyten entgegen der Scherkraft, der Strömung innerhalb der
Blutgefäße, ihre Geschwindigkeit verlangsamen. Diese Phase des ersten Kontaktes mit der
Endothelschicht wird als „Rollen“ der Immunzellen bezeichnet. Dabei sind insbesondere
Wechselwirkungen mit Selektinen wichtig, einer Glykoproteinfamilie aus einzelsträngigen
3
EINLEITUNG
Transmembranmolekülen mit drei verschiedenen Mitgliedern: E („endothel“)-Selektin, P
(„platelet“)-Selektin und L („leukocyte“)-Selektin (Vestweber und Blanks 1999). E-Selektin
wird ausschließlich von Endothelzellen exprimiert, vor allem nach Kontakt mit
Entzündungssignalen, wie IL-1 oder TNF-α. P-Selektin hingegen wird von Thrombozyten,
Leukozyten und Endothelzellen produziert (Ley 2003). Das von Leukozyten exprimierte LSelektin ist besonders wichtig für das „Homing“ in sekundäre Lymphorgane und wird durch
Protolyse von Proteasen streng reguliert (Ivetic und Ridley 2004; Condon et al. 2001). Alle
Selektine besitzen eine vergleichbare Struktur und sind Calcium-abhängig. Als
Adhäsionsproteine bilden sie heterophile Verbindungen mit Zuckerresten anderer Proteine aus
(Sperandio 2006). Aufgrund der Strömung im Blutgefäß handelt es sich dabei um temporäre,
sich immer wieder lösende Interaktionen zwischen den beteiligten Rezeptoren, wodurch das
charakteristische „Rollen“ der Leukozyten entsteht (Lawrence et al. 1997). Der bekannteste
Ligand, welcher alle Selektine unter entzündlichen Bedingungen bindet, ist PSGL-1 (P-selectin
glycoprotein ligand 1) und ist besonders für ein erstes Erfassen der Leukozyten im Blutstrom
wichtig (Sperandio et al. 2003; Xia et al. 2002). Dagegen sind die E-Selektin-Liganden ESL-1
und CD44 für das langsame Rollen entlang des Endothels verantwortlich (Hidalgo et al.
2007).
Durch den Kontakt mit dem Endothel können die Leukozyten weitere Entzündungssignale
wahrnehmen. Dabei spielen Signalproteine wie Chemokine, welche in Abschnitt 2 betrachtet
werden, eine entscheidende Rolle. Die von Selektinen und Chemokinen angeschalteten
Signalwege
resultieren
in
der
Aktivierung
einer
weiteren
Familie
von
Transmembranproteinen, den Integrinen. Integrine sind Adhäsionsmoleküle und zählen
ebenfalls zu den Glykoproteinen. Strukturell handelt es sich um heterodimere Rezeptoren,
welche aus einer α- und einer β-Untereinheit aufgebaut sind und die Zellmembran
durchspannen. Eine Besonderheit der Integrine ist die Ausprägung verschiedener
Konformationen je nach Aktivierungsstatus, sowie die Fähigkeit einer bidirektionalen
Signalweiterleitung. Neben ihrer Funktion bei der Leukozyten-Migration, sind sie auch bei
Entwicklungsprozessen, der Hämostase und dem Zellzyklus von Bedeutung. Von den derzeit
24 bekannten Integrinen bei Säugetieren, exprimieren Leukozyten α4β1 (VLA-4/ very late
antigen 4), α4β7 (LPAM), αLβ2 (LFA-1/ lymphocyte function-associated antigen-1) und αMβ2
(Mac-1/ macrophage antigen-1) (Hynes 2002; Ginsberg et al. 2005).
Nach und nach werden mehr Integrine aktiviert, was zu einer beständigen Verbindung
zwischen Leukozyt und Endothel führt. Daraufhin erfolgt eine Umstrukturierung des
Zytoskeletts der Immunzelle, wodurch sie beginnt, Zellfortsätze auszubilden und intraluminal
am Endothel entlang zu kriechen. Dabei wird ein geeigneter Bereich gesucht, um para- oder
transzellulär durch die Endothelschicht zu transmigrieren. Der parazelluläre Weg führt durch
endotheliale Zell-Zell-Verbindungen, der transzelluläre Pfad hingegen direkt durch die
Endothelzelle hindurch (Carman et al. 2007; Vestweber 2007). Vermutlich wird dabei
häufiger der parazelluläre Weg bestritten (Vestweber 2012). Verschiedene Adhäsionsmoleküle
der Endothelzellen unterstützen sowohl die para- als auch die transzelluläre Migration.
Darunter befinden sich PECAM1 (platelet/ endothelial cell adhesion molecule-1), ICAM-1 und -2
(intercellular adhesion molecule-1, -2), VCAM-1 (vascular cell adhesion molecule-1) JAM-A, -B
4
EINLEITUNG
and -C (junctional adhesion molecule-A, -B, -C), ESAM (endothelial cell-selective adhesion
molecule) und CD99 (cluster of differentiation 99) (Muller 2003, 2011; Vestweber 2002;
Carman und Springer 2004). ICAM-1 und -2 sind Liganden des Integrins αLβ2, PECAM1 und
CD99 formen Homodimere mit Molekülen der benachbarten Zellen und die verschiedenen
JAM-Proteine sind in der Lage sowohl mit Integrinen als auch mit sich zu interagieren. Durch
den Kontakt der migrierenden Zelle mit den Adhäsionsmolekülen werden in den
angrenzenden Endothelzellen Signalwege aktiviert (Muller 2011; Vestweber 2012; Woodfin et
al. 2011). Daraufhin steigt der Ca2+-Spiegel im Zellinneren an und führt über eine Aktivierung
der MLC-Kinase (myosin light chain kinase) zur Zellkontraktion. Folglich öffnen sich lokal ZellZell-Verbindungen im Endothel und ermöglichen so das parazelluläre Hindurchgleiten der
Leukozyten an definierten Stellen (Huang et al. 1993; Muller 2003).
Im Laufe beider Wege kommt es zudem zur Ausbildung von Zellausläufern auf der Oberfläche
der Leukozyten um die transendotheliale Migration zu erleichtern (Carman und Springer
2004; Phillipson et al. 2008; Petri et al. 2011). Für den transzellulären Weg fusionieren diese
Zellausläufer mit der apikalen Membran der Endothelzelle, wodurch ein Kanal durch die
Zellen gebildet wird. Diese Porenbildung wird durch vesikuläre Strukturen bis hin zur basalen
Membran unterstützt (Feng et al. 2002; Millán et al. 2006; Rahman und Fazal 2009). Zudem
konnte gezeigt werden, dass die Leukozyten beim Zelldurchtritt von Adhäsionsmolekülen, wie
beispielsweise ICAM-1 oder VCAM-1, umgeben sind (Carman et al. 2007; Wittchen 2009;
Mamdouh et al. 2009).
Nach Durchdringen der Endothelschicht, muss auf dem Weg ins Bindegewebe, zunächst noch
eine weitere Schicht überwunden werden: die Basalmembran. Diese faserige Schicht ist eine
spezialisierte Form der extrazellulären Matrix und besteht vor allem aus Kollagenen und
anderen Glykoproteinen (Hallmann et al. 2005). Die Basalmembran wird dabei, als Weg des
geringsten Widerstandes, an möglichst Protein-armen Bereichen von den Leukozyten
durchquert (Wang et al. 2006). Zudem sind Leukozyten in der Lage Matrix-Metalloproteasen,
welche die Spaltung von Peptid-Bindungen katalysieren, zu produzieren und sich dadurch
zusätzlich aktiv den Weg zu erleichtern (Stefanidakis und Koivunen 2006; Madri und Graesser
2000).
In Folge von Gendefekten innerhalb der Sequenzen beteiligter Proteine kommt es zur
Ausbildung von Adhäsionsdefiziten, wodurch die beschriebene Rekrutierung von Leukozyten
ins entzündete Gewebe nicht mehr korrekt ablaufen kann. Aufgrund dieser seltenen
autosomal rezessiv vererbten Erkrankungen sind die Träger auch besonders anfällig für
Infektionen (Hanna und Etzioni 2012).
5
EINLEITUNG
Abbildung 1.1 Extravasation von Leukozyten aus Blutgefäßen ins entzündete Gebiet. Die Migration
von T-Zellen erfolgt entlang eines Konzentrationsgradienten von Chemokinen. Der Prozess kann in die
folgenden Schritte unterteilt werden: I) „Rollen“ der Zellen entlang der Gefäßwand inklusive erster
Kontakte zu Adhäsionsmolekülen, insbesondere Selektine; II) Aktivierung intrazellulärer Signalwege
durch Chemokine und feste, permanente Bindung der Zelle an die Endothelschicht durch Integrine;
III) Bildung von Zellfortsätzen und Entlangkriechen der Zellen auf der Suche nach günstigen
Eintrittsstellen; IV) Para- oder transzelluläre Migration in das umliegende Gewebe.
6
EINLEITUNG
1.2. Chemokine und Chemokinrezeptoren
1.2.1. Chemokine im Überblick
Seit über 20 Jahren sind Chemokine als Gruppe von chemotaktisch aktiven Zytokinen bekannt
und sind von zentraler Bedeutung für die Koordinierung von Immunzellen. Im Detail handelt
es sich um Sekretionsproteine mit einem Molekulargewicht von nur 8-10 kDa, welche von
Leukozyten, Endothelzellen und Neuronen exprimiert werden können. Die Besonderheit
dieser Proteine ist, dass sie nach ihrer Sekretion einen lokalen Konzentrationsgradienten
ausbilden, welcher die gerichtete Zellmigration von Lymphozyten steuert (Baggiolini 2001).
Es gibt etwa 50 verschiedene humane Chemokine, welche nach ihrer Struktur in 4
verschiedene Klassen eingeteilt werden. Diese Nomenklatur wurde im Jahr 2000 eingeführt
und bezieht sich auf die Position und Anzahl invarianter Cysteine (C) in ihrer
Aminosäuresequenz. Es wird zwischen CXCL, CCL, CX 3CL und XCL („L“ für Ligand)
unterschieden, wobei die meisten Chemokine in die ersten beiden Gruppen fallen (Murphy et
al. 2000; Bacon et al. 2002). Da die einzelnen Chemokine zu diesem Zeitpunkt bereits
bekannt waren, besitzen sie mind. zwei verschiedene wissenschaftliche Bezeichnungen. In
dieser Arbeit wird ausschließlich die neue Nomenklatur verwendet.
Anhand seiner Funktion kann jedes Chemokin in drei Domänen unterteilt werden. Am CTerminus befindet sich die Matrix-bindende Domäne, welche für die Bindung an
Glukosaminoglykane (GAG) der extrazellulären Matrix, wie z.B. Heparine, verantwortlich ist.
Durch die Bindung an diese Zuckerreste von Endothelzellen wird der chemotaktische Gradient
ausgebildet. Im Anschluss daran liegt die docking-Domäne für die Bindung an die
entsprechenden Rezeptoren. Für die Aktivierung des Rezeptors dient die triggering-Domäne
am N-Terminus des Proteins und beinhaltet nur ein paar wenige Aminosäuren bis zum ersten
Cystein (Baggiolini et al. 1997). Eine einzelne Mutation dieser N-Terminalen Domäne kann
schon zum Verlust der Rezeptoraktivierung führen (Proudfoot et al. 1999; Weber et al. 1996).
Da es sich bei Chemokinen um Sekretionsproteine handelt, besitzen sie zudem eine
Signalsequenz von 20-25 Aminosäuren am N-terminus, welche beim Ausschleusen aus der
Zelle entfernt wird (Baggiolini 2001). Ein weiteres Strukturmerkmal ist, dass einige
Chemokine dafür bekannt sind Di- oder Tetramere bilden zu können (Wang et al. 2013).
Innerhalb dieser Proteinfamilie wird zwischen homöostatischen und pro-entzündlichen
Chemokinen unterschieden. Homöostatische Chemokine wie CXCL12 oder CCL21 werden
konstitutiv und gewebespezifisch exprimiert. Daher sind sie für die Differenzierung, die
Zirkulation und das „Homing“ von Immunzellen verantwortlich. Im Gegensatz dazu werden
pro-entzündliche Chemokine, wie beispielsweise CXCL9, CXCL10 oder CCL5, erst im Verlauf
einer Immunantwort exprimiert und sind besonders wichtig für die Rekrutierung von
Immunzellen in das infizierte bzw. entzündete Gewebe (Campbell et al. 2003; Baggiolini
2001).
Chemokine aktivieren ausschließlich eine spezifische Familie von Chemokinrezeptoren, was
sie deutlich von anderen Zytokinen unterscheidet (Murphy 1994). Insgesamt sind etwa 20
humane Chemokinrezeptoren bekannt, was gleichzeitig bedeutet, dass ein Rezeptor oft durch
verschiedene Chemokine aktiviert werden kann. So besitzt beispielsweise CCR8 nur 1
7
EINLEITUNG
Liganden, CCR1 hingegen kann sogar von 9 verschiedenen Chemokinen aktiviert werden.
Zudem sind einige Chemokine in der Lage mit hoher Affinität an verschiedene dieser
Rezeptoren zu binden. Die Nomenklatur ist mit CXCR, CCR, CX 3CR und XCR („R“ für
Rezeptor) an die der dazugehören Liganden angepasst. Des Weiteren werden
Chemokinrezeptoren in zwei Gruppen unterteilt. Der Großteil zählt zu den G-Proteingekoppelten Chemokinrezeptoren, welche das Signal über die Aktivierung von G-Proteinen
weiterleiten. Daneben existiert eine wesentlich geringere Anzahl an atypischen
Chemokinrezeptoren, welche über G-Protein-unabhängige Art und Weise Signale übermitteln.
Ein Strukturmerkmal, welches einige dieser Rezeptoren mit ihren Liganden gemeinsam haben,
ist die Bildung von Homo- und Heterodimeren. Homodimere sind für CXCR1, CXCR2, CXCR3,
CXCR4, CCR2 sowie CCR5 bekannt und Heterodimere können z.B. von CCR2 mit CCR5 und
CXCR4 oder CXCR1 mit CXCR2 gebildet werden (Murphy et al. 2000; Wang und Norcross
2008; Kramp et al. 2011; Bachelerie et al. 2014). Einen aktuellen Überblick über die
Chemokine mit ihren zugehörigen G-Protein-gekoppelten und atypischen Rezeptoren bietet
Abbildung 1.2, welche nach Bachelerie et al. (2014) erstellt wurde.
Für eine spezifische Migration besitzen die einzelnen Zelltypen unterschiedliche
Expressionsmuster von Chemokinrezeptoren. Dabei können alle Leukozyten als auch
verschiedene nicht-hämatopoetische Zellen, darunter auch Krebszellen, ein bestimmtes
Repertoire dieser Rezeptoren bilden. So sind bei den phagozytierenden Leukozyten vorrangig
CCR1, CCR2, CCR3, CCR5 sowie CXCR1, CXCR2 und CXCR4 von Bedeutung, wobei z.B.
CXCR1 und CXCR2 nur von Neutrophilen exprimiert werden. T-Lymphozyten hingegen
können fast alle bekannten Chemokinrezeptoren produzieren, jedoch wird ihre Expression
häufig von bestimmten Zytokinen und anderen Signalstoffen reguliert. Nach Stimulierung von
T-Zellen mit IL-2 wird vermehrt CCR1, CCR2, CCR5 und CXCR3 exprimiert. Werden T-Zellen
mit Antikörpern gegen CD3 und CD28 aktiviert, werden CCR7 und CCR8 exprimiert. Neben
der Art der Stimulierung ist das Vorkommen verschiedener Chemokinrezeptoren auch von
dem jeweiligen Entwicklungsstatus der T-Zelle abhängig. Zentrale Gedächtnis-T-Zellen sind,
im Gegensatz zu Effektor-Gedächtnis-T-Zellen, positiv für CCR7. Ein Chemokinrezeptor,
welcher konstitutiv von T-Lymphozyten exprimiert wird, ist CXCR4, dessen Wirkung
permanent für die Zirkulation innerhalb der Gefäße notwendig ist (Abbildung 1.3). Auch
dendritische Zellen besitzen ein variables Expressionsmuster von Chemokinrezeptoren, je nach
Entwicklungsstatus, Aktivierung oder Einsatzort. Über die Rezeptoren CCR1, CCR2 und CCR5
werden naive dendritische Zellen zum Entzündungsherd gelockt (Baggiolini 2001).
Die von Chemokinrezeptoren ausgehende Signalkaskade führt zur Polymerisierung/
Depolymerisierung der Aktinfilamente des Zytoskeletts, Aktivierung von Adhäsionsmolekülen
wie den Integrinen oder zur Freisetzung von Proteasen, Histaminen oder weiteren
Komponenten. Insgesamt betrachtet wird besonders die Zellmigration und die Interaktion mit
anderen Zellen über Chemokine gesteuert (Baggiolini 2001). Einen detaillierteren Überblick
der ablaufenden Signalwege liefert der folgende Abschnitt. Für den Abbau des
Konzentrationsgradienten werden Chemokine von Proteasen abgebaut.
8
EINLEITUNG
Abbildung 1.2 Chemokine und Chemokinrezeptoren nach Bachelerie et al. (Bachelerie et al. 2014).
Aktuelle Darstellung der Chemokinrezeptoren, unterteilt in G-Protein-gekoppelte und atypische
Chemokinrezeptoren, mit ihrer Verteilung sowie ihren Liganden. (Abkürzungen: Ba, basophil; Ca,
Krebsgeschwür; CD4RM, residente CD4+ Gedächtnis-T-Zelle; EC, Endothelzelle; Eo, eosinophil; Fb,
Fibroblast; iDC, unreife dendritische Zelle; MC, Mastzelle; Me, Melanozyt; MG, Mikroglia; Mo,
Monozyt; MФ, Makrophage; N, Neutrophile; NHC, hämatopoetische Stammzelle; PC, Plasmazelle;
pDC, plasmazytoide dendritische Zelle; Tcm, zentrale Gedächtnis-T-Zelle; Th1, Th1-Helferzelle; Tn,
naive T-Zelle; eff/mem, Effektor-/Gedächtnis-Zelle; thym, Thymozyt)
9
EINLEITUNG
Abbildung 1.3 Differentielle Expression von Chemokinrezeptoren auf T-Zellen nach Baggiolini
(Baggiolini 2001). Während CXCR4 konstitutiv exprimiert wird, sind CCR5 und CXCR3
charakteristische Rezeptoren für Th1-Zellen, CCR3 und CCR4 hingegen für Th2-Zellen. Nach
Stimulierung mit IL-2 und IL-4 werden zudem CXCR1 und CXCR2 exprimiert. Durch T-Zellaktivierung
produziert die Zelle CCR4, CCR7 und CCR8.
10
EINLEITUNG
1.2.2. Signaltransduktion von Chemokinrezeptoren
Infolge der Aktivierung von Chemokinrezeptoren und der daraus resultierenden
Signalkaskade kommt es insbesondere zur Beeinflussung der Zirkulation von Immunzellen im
Körper. Dabei werden konkret vor allem die Zellmigration sowie die Zelladhäsion gesteuert.
Durch die bereits erwähnten Überschneidungen können verschiedene Chemokinrezeptoren
und Liganden für diese Funktion von Bedeutung sein. So wird z.B. CCR5 zwar in manchen
Individuen nicht exprimiert, aber dessen Funktion kann durch andere Rezeptoren
ausgeglichen werden. Daneben gibt es allerdings auch lebensnotwendige ChemokinrezeptorSignale, wie von CXCR4, welche essentiell für die Embryogenese und Organentwicklung sind.
Demzufolge scheinen auch Rezeptor- und Ligand-spezifische Signalkaskaden zu existieren,
was die Komplexität dieses Systems verdeutlicht. Dieses vollständig zu entschlüsseln bedarf
noch weitergehender Forschung. Im Folgenden wird auf allgemeine Signalkomponenten
eigegangen, welche wichtig für die Migration von Leukozyten sind.
Chemokinrezeptoren besitzen 7 Transmembrandomänen, einen extrazellulären N- und einen
intrazellulären C-Terminus. Die Verteilung von Chemokinrezeptoren auf der Plasmamembran
scheint gleichmäßig zu sein und sich nicht auf bestimmte Bereiche zu konzentrieren (Servant
et al. 1999; Xiao et al. 1997). Die meisten Chemokinrezeptoren zählen, wie bereits erwähnt,
zu den G-Protein-gekoppelten Rezeptoren. Bei der Signalweiterleitung der atypischen
Chemokinrezeptoren scheinen hingegen Arrestine, welche bekanntermaßen die
Signaltransduktion von Rezeptoren beeinflussen können, eine entscheidende Rolle zu besitzen
(Bachelerie et al. 2014). Im Folgenden wird auf allgemeine Aspekte der Signaltransduktion
der G-Protein-abhängigen Chemokinrezeptoren näher eingegangen. Die entsprechenden
Liganden binden außerhalb der Zelle mit ihrer docking-Domäne am Rezeptor und aktivieren
diesen über ihre N-terminale triggering-Domäne. Auf der zytosolischen Seite sind
Chemokinrezeptoren mit heterotrimeren Gi-Proteinen (Guanin-bindende Proteine) assoziiert,
welche aus den Untereinheiten Gαi, Gβi und Gγi aufgebaut sind (Thelen et al. 1988). In der
inaktiven Form ist GDP an die α-Untereinheit gebunden. Nach Rezeptoraktivierung wird GDP
durch GTP ausgetauscht, wobei die α-Untereinheit von der βγ-Untereinheit dissoziiert und
verschiedene Funktionen übernommen werden können. Da Chemokinrezeptoren über GiProteine wirken und zudem durch das Pertussis-Toxin des Bakteriums Bordetella pertussis
blockiert werden können, wurde gezeigt, dass diese Rezeptoren anderen, bereits bekannten GProtein-gekoppelten Rezeptoren gleichen.
Für die Zellmigration ist die Freisetzung der βγ-Untereinheit vom Gαβγ-Rezeptorkomplex
essentiell, die α-Untereinheit hingegen scheint für diesen Zusammenhang keine notwendige
Funktion zu besitzen (Neptune et al. 1999). Allgemein aktiviert die Gαi-Untereinheit die
Adenylatzyklase, welche zu den Lyasen gehört und die Bildung von cAMP aus ATP katalysiert,
sowie verschiedene Src-Kinasen (Thelen 2001). Über die βγ-Untereinheit werden unverzüglich
die Phospholipase C (PLC)-Isoformen PLC-β2 und PLC-β3 aktiviert. Dadurch wird IP3
produziert und vorübergehend die intrazelluläre Ca2+-Konzentration erhöht (Baggiolini et al.
1997). Neben IP3 wird auch DAG produziert und im Anschluss Proteinkinase C (PKC) aktiviert
(Li et al. 2000). Die von der PKC ausgehenden Signale sind zum einen für die Induktion der
11
EINLEITUNG
Migration wichtig, zum anderen induzieren sie die Phosphorylierung des Chemokinrezeptors
und tragen somit zur Desensitivierung bei (Marchese 2014).
Ein weiteres Ziel der βγ-Untereinheit des G-Proteins ist die Phosphatidylinositol-3-Kinase γ
(PI3Kγ) (Stephens et al. 1994). PI3Kγ katalysiert die Synthese von IP3 und wird anschließend
zu Phosphatidylinositol-3,4-bisphosphat (IP2) dephosphoryliert (Tilton et al. 2000). IP3 ist in
ruhenden Zellen kaum vorhanden, wird aber nach Produktion an der Plasmamembran
angereichert und besitzt Andockstellen für Proteine, welche sogenannte Pleckstrin-Homologie
(PH)-Domänen enthalten (Bottomley et al. 1998). Der am besten beschriebene Effektor der
P13K ist die Proteinkinase B (PKB) oder Akt (Burgering und Coffer 1995), welche über ihre
PH-Domäne zur Plasmamembran rekrutiert wird. Weitere Signalwege, die ebenfalls eine Rolle
spielen und über P13K laufen können, werden über Mitogen-aktivierte Protein- (MAP)
Kinasen vermittelt. Die dadurch angeschaltete Transkription beinhaltet Gene für
Zellwachstum und Proliferation (Sotsios et al. 1999; Tilton et al. 2000).
Über die βγ-Untereinheit werden außerdem Rac GTPasen aktiviert, deren Signalweiterleitung
ebenfalls Zellmigration und Adhäsion induziert. Generell spielen Rac GTPasen auch in
anderen Signalwegen eine Rolle, doch in diesem Zusammenhang ist die Polymerisation von
Aktinfilamenten und somit die Bildung von Lamellipodien, also welche im Laufe der
Zellmigration ausgebildet werden, besonders wichtig. Daneben wird die durch Integrine
vermittelte Zelladhäsion und somit auch die Transmigration der Leukozyten vom Blutgefäß
ins umliegende Gewebe beeinflusst. T-Lymphozyten exprimieren die beiden Isoformen Rac1
und Rac2 (Faroudi et al. 2010; Tybulewicz, Victor L J und Henderson 2009; García-Bernal et
al. 2005).
Allgemein lässt sich an dieser Stelle zusammenfassen, dass nach Liganden-Bindung
verschiedene Signalwege aktiviert und über Kinasen wie PKB, PKC, PI3K oder MAPK
weitergeleitet werden. Die daraus resultierende Genexpression wirkt sich auf Proliferation,
Überleben, Adhäsion, Zellform und Migrationsverhalten der Zellen aus. Zudem kann die von
Chemokinrezeptoren ausgehende Signaltransduktion in der Zelle nicht isoliert betrachtet
werden, da zahlreiche Überschneidungen und Wechselwirkungen, zum Beispiel mit
Komponenten stromabwärts des T-Zellrezeptors, existieren (Molon et al. 2005). Daher ist in
diesem Abschnitt nur ein allgemeiner Abriss der von Chemokinrezeptoren ausgehenden
Signale gezeigt.
Um die Signaldauer zu regulieren, werden Chemokinrezeptoren nach Ligandenbindung
internalisiert und gelangen entweder über einen Recycling-Prozess wieder zurück an die
Zelloberfläche oder in Lysosomen zum Abbau. Werden die Rezeptoren recycelt, handelt es
sich nur um eine kurze Desensitivierung der Liganden-induzierten Signalübertragung. Der
zugrundeliegende Mechanismus beinhaltet die Phosphorylierung durch G-Protein-gekoppelte
Rezeptorkinasen (GRK) sowie die Bindung an ß-Arrestin. Infolgedessen wird der Rezeptor
vom G-Protein-gekoppelten Komplex gelöst und über Clathrin-beschichtete Vesikel endozytiert
(Neel et al. 2005). Untereinheiten dieser Vesikel erkennen bestimmte Leucin-haltige Motive
innerhalb des C-Terminus des Rezeptors, was zumindest für CXCR2 und CXCR4 nachgewiesen
werden konnte (Bonifacino und Traub 2003; Fan et al. 2001; Orsini et al. 1999). Des
Weiteren könnte diese vorübergehende Endozytose dazu verwendet werden, die gebundenen
12
EINLEITUNG
Chemokine dem lysosomalen Abbau zuzuführen (Otero et al. 2006). Wird der Rezeptor
hingegen abgebaut, kommt es zu einer dauerhaften Abschwächung der Chemokin-induzierten
Signalwege. Dabei werden die Chemokinrezeptoren ebenfalls zunächst endozytiert, im
Anschluss aber durch Fusion mit Lysosomen abgebaut. Um diesen Weg beschreiten zu können,
werden die Rezeptoren, induziert durch die Bindung an den entsprechenden Liganden, an Cterminalen Lysin-Resten ubiquitiniert. Ein solcher Abbau-Prozess konnte zum Beispiel für
CXCR4 gezeigt werden (Marchese und Benovic 2001).
1.2.3. Chemokinrezeptoren CXCR3, CXCR4 und CXCR7
In dieser Arbeit nehmen die Chemokinrezeptoren CXCR3 und CXCR4 eine zentrale Rolle ein,
weshalb diese Rezeptoren noch weiter im Detail betrachtet werden. Daneben soll auch auf
den noch recht unbekannten Rezeptor CXCR7 eingegangen werden, da CXCR7 mit CXCR3 als
auch CXCR4 gemeinsame Liganden besitzt.
Der Chemokinrezeptor CXCR3 wird durch CXCL9, CXCL10 und CXCL11 aktiviert und wird auf
T-Zellen, Monozyten, Granulozyten sowie B-Zellen exprimiert (Loetscher et al. 1996; Trentin
et al. 1999). Der murine und der humane Rezeptor besitzen 86% Übereinstimmung in ihrer
Sequenz (Lu et al. 1999). CXCR3 und seine Liganden spielen eine wichtige Rolle bei der
Immunantwort, besonders in Bezug auf aktivierte- und Gedächtnis- Th1-Zellen, und lenken
dabei Zellmigration, Proliferation als auch Apoptose. Besonders stark wird die Expression der
CXCR3-Liganden durch die Anwesenheit des Zytokins Interferon-γ (IFN-γ) induziert, was
ebenfalls auf eine Th1-gerichtete Immunantwort deutet. Da widersprüchliche Beobachtungen
hinsichtlich der Induktion oder Hemmung von Migration und Proliferation beschrieben
wurden, war es keine Überraschung, als verschiedene Spleißvarianten des auf dem XChromosom codierten Rezeptors entdeckt worden sind. Die identifizierten Spleißvarianten
CXCR3-A und CXCR-B scheinen wechselseitige Funktionen zu besitzen. CXCR3-A wird von
Endothelzellen exprimiert und fördert Zellproliferation, CXCR3-B hingegen wird von
Fibroblasten, Endothel- und Epithelzellen produziert und inhibiert Zellmigration und
Apoptose. Eine dritte Spleißvariante, CXCR3-alt, besitzt einen verkürzten C-Terminus und
kann ausschließlich über CXCL11 aktiviert werden (Datta et al. 2006; Lasagni et al. 2003;
Ehlert et al. 2004; Korniejewska et al. 2011).
CXCR3 und seine Liganden wurden bereits vielfach im Zusammenhang mit
Autoimmunerkrankungen und chronischen Entzündungen beschrieben, worauf in Abschnitt
3.2 genauer eingegangen wird. Weitere Studien gibt es im Bereich der Abstoßungsreaktion
von Transplantaten sowie in der Krebsforschung (Hancock et al. 2000; Melter et al. 2001). So
wurde ein Einfluss der CXCL10-induzierten Migration von Lymphozyten bei Melanomen und
der CXCL11-gesteuerten Migration bei Brustkrebs und T-Zell Lymphomen festgestellt
(Hensbergen et al. 2005; Wenzel et al. 2005; Chu et al. 2007). Insgesamt scheint die von
CXCR3 ausgehende Signalkaskade Tumorzellwachstum, -überleben und -metastasierung
positiv zu beeinflussen (Singh et al. 2013).
CXCR4 hingegen besitzt mit CXCL12 nur einen Liganden und konnte bei T-Zellen,
Neutrophilen, Mastzellen, Granulozyten, Monozyten, Makrophagen, dendritischen Zellen
13
EINLEITUNG
sowie B-Zellen nachgewiesen werden. Damit ist CXCR4 weiter verbreitet als CXCR3 (Caruz et
al. 1998; Nagasawa et al. 1998). Da CXCR4 neben der Zirkulation, dem „Homing“ und der
Homöostase von Immunzellen auch bei der Embryogenese, der Organentwicklung und der
Vaskularisation eine wichtige Rolle spielt, ist es verständlich, dass ein Fehlen der codierenden
Gene für CXCR4 und CXCL12 letal ist (Caruz et al. 1998; Ma et al. 1998; Tachibana et al.
1998).
Nach seiner Identifizierung war CXCR4 besonders interessant aufgrund seiner Funktion als
Ko-Rezeptor für den Zelleintritt von HIV in CD4+ T-Zellen (Feng et al. 1996). Heute gibt es
zudem
auch
Studien
auf
dem
Gebiet
chronischer
Entzündungen
und
Autoimmunerkrankungen (Abschnitt 3.3), sowie in der Tumorforschung. Beispiele für den
Einfluss von CXCR4 bei chronischen Entzündungen sind die Darmerkrankungen Colitis
ulcerosa und Morbus Crohn, wobei eine erhöhte CXCR4-Expression mit dem fortschreitenden
Krankheitsverlauf korreliert werden konnte (Mikami et al. 2008; Dotan et al. 2010). Daneben
existiert eine große Variationsbreite von Veröffentlichungen zu Krebs, einschließlich
Brustkrebs, Melanome, Leukämie, Gliome, Bauchspeicheldrüsenkrebs und Prostatakrebs.
Besonderes betont wird dabei die Rolle von CXCR4 bei der Metastasierung von Tumoren.
Aufgrund seiner Überexpression wird CXCR4 auch als prognostischer Biomarker verwendet
(Müller et al. 2001; Ben-Baruch 2008; Furusato et al. 2010; Hermann et al. 2007; Miki et al.
2007). Ein Defekt innerhalb des Gens von CXCR4 ist verantwortlich für die Ausprägung des
WHIM (Warzen-Hypogammaglobulinämie-Immundefizienz-Myelokathexis) -Syndroms, einer
Immunschwächekrankheit, bei welcher die Homöostase der Neutrophilen gestört ist und diese
im Knochenmark zurückgehalten werden (Hernandez et al. 2003).
In vorangegangenen Studien dieser Arbeitsgruppe wurde bereits die Cross-Regulierung von
CXCR3 und CXCR4 untersucht. Dabei konnte gezeigt werden, dass durch eine KoStimulierung mit dem CXCR3-Liganden CXCL9 die vom CXCR4-Liganden CXCL12 induzierte
Migration von Gedächtnis Th1-Zellen in vitro desensitiviert wird. Dieser Effekt, mit einer
Migrationshemmung von bis zu 50%, konnte in primären Th1-Zellen, sowie in verschiedenen
T-Zelllinien murinen und humanen Ursprungs gezeigt werden. Für den Nachweis wurden
Chemotaxis-Assays und dynamische Flusskammersysteme eingesetzt. Auf molekularer Ebene
konnte die Beeinflussung der Proteinkinase Akt gezeigt werden (Giegold et al. 2013). Für die
CXCL12/CXCR4-vermittelte Chemotaxis konnte bisher nur eine Cross-Regulation mit CCR5
beschrieben werden (Hecht et al. 2003). Im Gegensatz dazu wurde gezeigt, dass die
CXCR3/4-Liganden CXCL9 und CXCL12 in der Lage sind Komplexe zu bilden, welche die
CXCR4-vermittelte Chemotaxis von CD8+ T-Zellen erhöhen (Venetz et al. 2010). Diese
Ergebnisse zeigen deutlich, wie fein die CXCR3- und CXCR4-vermittelten Signalwege
miteinander verschachtelt sind, um die Migration von Lymphozyten sowohl in gesundem als
auch entzündetem Gewebe differentiell zu steuern.
Der noch recht unbekannte und erst vor einigen Jahren beschriebene Chemokinrezeptor
CXCR7 bindet CXCL11 sowie CXCL12 mit hoher Affinität. Hinsichtlich der Expression von
CXCR7 gibt es kontroverse Angaben, meist wird jedoch von einer starken Expression in
Monozyten und B-Zellen gesprochen (Infantino et al. 2006; Berahovich et al. 2010). Ob
14
EINLEITUNG
CXCR7 auch bei T-Zellen eine Bedeutung besitzt, ist noch nicht vollständig geklärt, obwohl
auch hierfür Hinweise existieren (Balabanian et al. 2005).
Erstaunlich ist, dass über CXCR7 keine typische G-Protein-induzierte Signalkaskade induziert
wird, obwohl CXCR7 mit ß-Arrestin und den dazugehörigen Signalwegen assoziiert ist
(Rajagopal et al. 2010; Burns et al. 2006; Levoye et al. 2009). Nach Aktivierung wird CXCR7
unverzüglich internalisiert und recycelt, dessen Liganden allerdings werden in Lysosomen
abgebaut (Luker et al. 2010; Mahabaleshwar et al. 2012). Serin- und Threonin-Reste am CTerminus des Rezeptors sind wichtig für die Rekrutierung von ß-Arrestin, was wichtig für die
Endozytose ist, aber vermutlich auch eine Bedeutung bei der initialen Rezeptoraktivierung
besitzt (Ray et al. 2012; Canals et al. 2012). So könnte CXCR7 einen wichtigen Mechanismus
für die Regulierung der Menge an verfügbarem CXCL11 und CXCL12 bereitstellen und damit
indirekt Einfluss auf CXCR3- und CXCR4-induzierte Signalwege und Funktionen nehmen. Dies
wird besonders durch Untersuchungen von CXCR7 und CXCR4 im Bereich neuronaler
Zellmigration bestätigt (Boldajipour et al. 2008; Busillo und Benovic 2007; Sánchez-Alcañiz et
al. 2011; Naumann et al. 2010). Zudem wurde gezeigt, dass CXCR7 durch
Heterodimerisierung mit CXCR4 direkten Einfluss auf die Signaltransduktion von CXCR4
nimmt (Levoye et al. 2009). Interessant und gegensätzlich zu anderen Chemokinrezeptoren ist
zudem, dass CXCR7 konstitutiv ubiquitiniert ist und erst nach Ligandenbindung
deubiquitiniert wird (Canals et al. 2012).
Gerade durch seine starke Verbindung zur CXCL12-CXCR4-Achse, aber auch zu CXCL11 und
dessen anderen Rezeptor CXCR3, existieren für CXCR7 bereits zahlreiche Studien im Bereich
der Tumorforschung (Singh et al. 2013). Auch für chronische Entzündungen und
Autoimmunerkrankungen sind erste Untersuchungen veröffentlicht. Im Mausversuch für
experimentelle autoimmune Neuritis (EAN) konnte die T-Zellinfiltration durch gleichzeitige
Hemmung von CXCR4 und CXCR7 vermindert und der Krankheitsverlauf somit abgeschwächt
werden (Brunn et al. 2013). Bei der Experimentellen autoimmunen Enzephalomyelitis (EAE),
einem Tiermodell für Multiple Sklerose (MS), zog die Blockade von CXCR7 eine
Verminderung im Schweregrad der Erkrankung als auch eine Verbesserung der Regeneration
der Axone nach sich (Cruz-Orengo et al. 2011). Erste Studien gibt es zudem für chronischentzündliche Darmerkrankungen (Werner et al. 2013), rheumatoide Arthritis (Villalvilla et al.
2014) und Neuroinflammation (Timotijević et al. 2012).
15
EINLEITUNG
1.3. Die Rolle von Chemokinrezeptoren und ihren Liganden bei chronischen Entzündungen
1.3.1. Autoimmunerkrankungen im Überblick
Das erste Mal wurde dieses Thema zu Beginn des vorigen Jahrhunderts von Paul Ehrlich
angesprochen und definiert. Wenn sich die Immunantwort gegen ein körpereigenes Antigen
richtet, wird von Autoimmunität gesprochen. Dies kann zu Autoimmunerkrankungen führen,
wobei das eigene Gewebe durch das Immunsystem als fremd angesehen und zerstört wird.
Normalerweise werden stark autoreaktive Lymphozyten mit Hilfe zentraler und peripherer
Toleranzmechanismen aussortiert. Von großer Bedeutung sind hierbei auch regulatorische TZellen. Sie sind in der Lage, die Immunantwort durch Hemmung der Proliferation von TZellen sowie der Funktion Antigen-präsentierender Zellen zu unterdrücken. Da unzählige
Proteine im Körper existieren, gibt es zudem verschiedene Anhaltspunkte, die den
Lymphozyten helfen, zwischen „körpereigen“ und „körperfremd“ zu unterscheiden. Dies sind
ein Zusammentreffen zwischen Lymphozyt und Ligand noch während seiner Reifungsphase,
eine dauerhafte und gleichbleibende Konzentration des Liganden sowie eine Ligandenbindung
in Abwesenheit jeglicher pro-entzündlicher Signale von Zytokinen und ko-stimulatorischen
Signalen. Ein gewisser Grad an Autoreaktivität der Lymphozyten ist allerdings auch unbedingt
notwendig, um eine funktionsfähige Immunabwehr zu gewährleisten. So helfen Autoantigene
dabei, dass benötigte Repertoire an reifen Lymphozyten auszubilden und auch das Überleben
von naiven T- und B-Zellen in der Peripherie ist an einen gewissen Grundpegel der Exposition
zu Autoantigenen gebunden. All diese Mechanismen tragen dazu bei, eine Balance zwischen
Schutzfunktion und Autoimmunität zu wahren. So können einzelne Fehler schnell beseitigt
werden, doch in sehr seltenen Fällen kann dieses System auch versagen. Ein solches Scheitern
des Immunsystems beinhaltet die Ausbildung von Effektorzellen und Molekülen, die
schließlich das körpereigene Gewebe zerstören.
Die spezifischen Ursachen der meisten Autoimmunerkrankungen sind noch immer ungeklärt.
Bei der Ausbildung von Autoimmunität aber spielt bekanntermaßen, neben einer fehlerhaften
Immunabwehr, auch genetische Prädisposition und der Einfluss von Umweltfaktoren eine
entscheidende Rolle. Genetische Risikofaktoren sind zum Beispiel bestimmte Varianzen in den
Sequenzen der MHC-Klasse-II Moleküle, wobei dies allein keinesfalls eine Garantie für den
Ausbruch der Krankheit darstellt. Bestimmte Toxine und Wirkstoffe, aber auch Bakterien und
Viren können autoimmune Syndrome induzieren. Dabei können Pathogene durch
unspezifische Entzündungen und Gewebeschädigungen Autoimmunität fördern oder durch
molekulare Mimikry sogar hervorrufen.
In den westlichen Staaten sind etwa 5% der Bevölkerung von Autoimmunerkrankungen
betroffen. Es ist schwierig diese Erkrankungen zu klassifizieren, doch aus klinischer Sicht ist
eine Unterteilung in Organ-spezifische und systemische Autoimmunerkrankungen durchaus
sinnvoll. Innerhalb dieser Einteilung gibt es wiederum verschiedene Cluster von
Erkrankungen, welche oft gemeinsam bei einer Person oder innerhalb einer Familie gehäuft
auftreten. Für beide Gruppen ist, mit wenigen Ausnahmen, ein chronischer Krankheitsverlauf
typisch, da die Autoantigene im Körper verbleiben und die Autoimmunreaktion deshalb nicht
gestoppt werden kann. Bei den verschiedenen Erkrankungen wird die Pathogenese von einem
16
EINLEITUNG
der beiden Effektorwege, entweder durch Autoantikörper oder aktivierte autoreaktive TZellen, dominiert.
Typische Beispiele für Organ-spezifische Autoimmunerkrankungen sind Typ-1-Diabetes, MS
und Psoriasis, wobei entweder der Pankreas, das zentrale Nervensystem oder die Haut
betroffen ist. Ein Cluster würde hier neben Multipler Sklerose und Psoriasis noch zusätzlich
Morbus Crohn, eine chronisch-entzündliche Darmerkrankung, enthalten. Bei jeder dieser
Erkrankungen wird ein bestimmtes Organ-spezifisches Autoantigen von Effektorzellen als
„fremd“ erkannt, wie es im Falle von Typ-1-Diabetes die Insulin-produzierenden Beta-Zellen
betrifft. Rheumatoide Arthritis, systemische Sklerose und systemischer Lupus Erythematodes
zählen hingegen zu den Formen, bei welchen verschiedene Gewebe innerhalb des gesamten
Körpers betroffen sind. Die Ursache dafür ist, dass die betroffenen Autoantigene in jeder
Körperzelle vorhanden sind, wie zum Beispiel Chromatin und Ribonukleoproteine im Falle
von systemischem Lupus Erythematodes.
In den folgenden zwei Abschnitten wird im Detail auf die Rolle der Chemokinrezeptoren
CXCR3 und CXCR4 bei Autoimmunerkrankungen und chronischen Entzündungen
eingegangen. Sie sind besonders bei Th1-getriebenen Autoimmunerkrankungen von
Bedeutung. Da für CXCR7 noch nicht viele Studien in diesem Forschungsgebiet existieren, soll
hier der Überblick in Abschnitt 2.3 genügen.
1.3.2. CXCR3 und seine Liganden CXCL9/10/11
Der Chemokinrezeptor CXCR3 und seine Liganden CXCL9, CXCL10 und CXCL11 scheinen an
der Pathogenese zahlreicher Autoimmunerkrankungen, sowohl organspezifische als auch
systemische Erkrankungen, beteiligt zu sein. Da diese Chemokine vermehrt unter dem Einfluss
von IFN-γ von verschiedenen Zelltypen, einschließlich T-Lymphozyten, Endothelzellen,
Fibroblasten, Keratinozyten, Thyreozyten und Präadipozyten sekretiert werden, sind CXCR3Liganden Marker für Th1-vermittelte Immunantworten. Durch die erhöhte ChemokinKonzentration kommt es zur Rekrutierung von CXCR3-positiven Th1-Zellen, welche IFN-γ und
TNF-α produzieren und dies wiederum regt die Produktion von CXCR3-Liganden an. Diese
Rückkopplungsschleife hält die Immunreaktion aufrecht und fördert somit Autoimmunität.
Zudem konnte bei verschiedenen Autoimmunerkrankungen eine erhöhte Menge an CXCR3Liganden in Serum- und Gewebe-Proben, sowie Körperflüssigkeiten von Patienten im
Vergleich zu gesunden Probanden gemessen werden (Lacotte et al. 2009; Antonelli et al.
2014). Im folgenden Abschnitt wird der Einfluss von CXCR3 und seinen Liganden auf die
Pathogenese von Autoimmunerkrankungen beispielhaft an Typ-1-Diabetes, MS und
rheumatoide Arthritis näher beleuchtet. Ähnliche Zusammenhänge wurden zudem für
chronisch-entzündliche Erkrankungen der Schilddrüse, wie Morbus Basedow, oder
Bindegewebserkrankungen, wie zum Beispiel systemischer Lupus Erythematodes beschrieben
(Lacotte et al. 2009; Antonelli et al. 2014).
Im Fall von Typ-1-Diabetes ist die genaue Krankheitsentstehung noch immer unklar, jedoch
konnte die Beteiligung der Th1-vermittelten Immunantwort bei der Zerstörung der Insulinproduzierenden Beta-Zellen im Pankreas bestätigt werden (Lo und Clare-Salzler 2006). Bei
17
EINLEITUNG
zahlreichen Studien konnte in den Serum-Proben von neu diagnostizierten Patienten ein
hoher CXCL10-Wert festgestellt werden (Shimada et al. 2001; Nicoletti et al. 2002; Nakagawa
et al. 2003; Gabbay et al. 2012). Im Serum von Patienten mit bereits fortschreitendem
Krankheitsverlauf war die Menge an CXCL10 wieder signifikant reduziert (Antonelli et al.
2008). Die infiltrierenden Lymphozyten produzieren im Pankreas CXCL10 und die Beta-Zellen
sekretieren, unter dem Einfluss von IFN-γ und TNF-α, CXCL9, CXCL10 und CXCL11. Wie
bereits beschrieben, wird dadurch die Autoimmunreaktion gefördert und die Entzündung setzt
sich fest (Frigerio et al. 2002; Roep et al. 2010; Uno et al. 2010). Aus diesen Gründen ist bei
Typ-1-Diabetes besonders eine Blockade von CXCR3 oder CXCL10 aussichtsreich.
Auch bei Multipler Sklerose (MS) sind Chemokinrezeptoren und ihre Liganden in die
Pathogenese involviert und bieten Angriffsstellen für Medikamente. Es handelt sich bei dieser
Erkrankung um eine Demyelinisation der Nervenfasern des zentralen Nervensystems, wobei
die Oligodendrozyten zerstört und die Axone geschädigt werden. Bisher ist die Ätiologie
dieser Erkrankung noch unbekannt, wobei sowohl Umweltfaktoren, genetische Prädisposition
als auch Autoimmunität eine Bedeutung zu haben scheinen. Der Krankheitsverlauf ist sehr
variabel und verläuft häufig in Schüben (Hickey 1999; Lucchinetti et al. 2000; McDonald et
al. 2001). Im Tiermodell (EAE) sind T-Zellen, welche ins Entzündungsgebiet einwandern,
stark CXCR3-positiv und zudem konnte eine hohe Konzentration von CXCL10 nachgewiesen
werden (Narumi et al. 2002; Klein et al. 2004). Ein Großteil der T-Zellen in der
Cerebrospinalflüssigkeit von Patienten, aber auch gesunden Kontrollen, exprimieren CXCR3.
Daher scheint dieser Chemokinrezeptor eine generelle Rolle bei der T-Zellmigration innerhalb
des zentralen Nervensystems zu besitzen (Sørensen et al. 2002). Jedoch ist die Expression von
CXCR3 als auch CXCL9 und CXCL10 während der Dauer von MS-Schüben in der
Cerebrospinalflüssigkeit erhöht (Misu et al. 2001; Franciotta et al. 2001). Zudem konnte
während dieser Schübe eine erhöhte Anzahl von CXCR3-positiven CD4+ T-Zellen im Blut
nachgewiesen werden, was einen Zusammenhang zwischen CXCR3 und seinen Liganden mit
akuten Entzündungsphasen bei MS bestätigt (Mahad et al. 2003). Außerdem konnte gezeigt
werden, dass CXCR3 auch vermehrt von Astrozyten in der umliegenden Umgebung von MSLäsionen exprimiert wird (Omari et al. 2005). Hier sind jedoch weitere Studien notwendig,
um einen direkten Einfluss auf die Rekrutierung von Oligodendrozyten bei der Pathogenese
nachweisen zu können. Neben CXCR3 und seinen Liganden scheinen auch andere Chemokine
und Chemokinrezeptoren eine Rolle zu spielen. Darunter befinden sich zum Beispiel CCR1
und CCL3, CCL4 und CCL5 sowie CCR2 und CCL2 (Szczuciński und Losy 2007).
Rheumatoide Arthritis ist durch eine chronische Entzündung der Gelenke, beginnend bei den
Fingern und Zehen, gekennzeichnet. Bei fortschreitendem Verlauf kommt es schließlich zu
irreversiblen Schäden an Knorpel und Knochen. Als Ursache wird eine Verschiebung des
Gleichgewichts zwischen Th1- zu Th2-assoziierten Zytokinen in Richtung Th1-Antwort
vermutet (Yin et al. 1999; Lee et al. 2013). Auch diese Autoimmunerkrankung verläuft meist
schubweise. CXCL10 konnte im Serum, in der Synovialflüssigkeit und dem synovialen Gewebe
der betroffenen Gelenke bei Patienten nachgewiesen werden (Hanaoka et al. 2003). Dabei
wird CXCL10 vorwiegend von infiltrierenden Makrophagen-ähnlichen Zellen und
Fibroblasten-artigen Zellen innerhalb des entzündeten Gelenks exprimiert (Kwak et al. 2008).
18
EINLEITUNG
Der dazugehörige Rezeptor CXCR3 konnte, bei in das Entzündungsgebiet infiltrierenden
CD4+ T-Zellen, aber auch auf Endothelzellen und dendritischen Zellen im synovialen
Gewebe, nachgewiesen werden (Wedderburn et al. 2000; Ruth et al. 2001).
1.3.3. CXCR4 und sein Ligand CXCL12
Im Vergleich zu CXCR3, wurde diesem Rezeptor bisher wenig Aufmerksamkeit im Bereich der
Autoimmunerkrankungen geschenkt. Zumeist wird seine Rolle bei HIV oder Krebs untersucht
und diskutiert (Horuk 2009). Doch seit einiger Zeit rücken auch CXCR4 und sein Ligand
CXCL12 ins Blickfeld dieses Forschungsgebietes.
Neben CXCR3 und seinen Liganden spielt auch die CXCR4/CXCL12-vermittelte Migration eine
Rolle bei rheumatoider Arthritis. Bei dieser Erkrankung besitzt CXCL12 eine
entzündungsfördernde Funktion. In infiltrierenden CD4+ Gedächtnis-T-Zellen konnte eine
erhöhte CXCR4-Expression und zudem eine besonders hohe Konzentration von CXCL12 in den
entzündeten Gelenken von Patienten festgestellt werden. In diesem Zusammenhang wurde
gezeigt, dass die synovialen Epithelzellen tatsächlich CXCL12 vor Ort exprimieren (Nanki et
al. 2000; Chung et al. 2010).
Zudem konnte ein Zusammenhang zwischen CXCL12 und MS hergestellt werden, indem
CXCL12 auf Astrozyten und Blutgefäßen in Gebieten von aktiven und inaktiven MS-Läsionen
nachgewiesen wurde. CXCL12 ist in der Cerebrospinalflüssigkeit von Patienten mit schubweise
verlaufender MS erhöht (Krumbholz et al. 2006). Im Gegensatz dazu wurde erst kürzlich im
EAE-Modell gezeigt, dass die Expression von CXCL12 durch die Entzündung und den
ansteigenden Gehalt des Glykosaminoglykans Hyaluronan in den Läsionen unterdrückt wird.
Hierbei wird betont, dass CXCL12 eine positive, schützende Funktion gegenüber den
infiltrierenden
entzündungstreibenden
Zellen
besitzt
und
eine
verringerte
Chemokinkonzentration die Autoimmunreaktion im zentralen Nervensystem verstärkt
(Mueller et al. 2014). Vielleicht erklären Unterschiede zwischen EAE-Tiermodell und MS beim
Patienten diese widersprüchlichen Daten, doch auf jeden Fall scheinen CXCR4 und sein
Ligand CXCL12 in die Pathogenese dieser Erkrankung involviert zu sein.
Auch im Fall von systemischem Lupus Erythematodes wurde eine Überexpression von CXCR4
und CXCL12 nachgewiesen. Dabei ist CXCR4 sowohl im Tiermodell als auch in
Patientenproben bei Monozyten, Neutrophilen und B-Zellen signifikant hochreguliert. CXCL12
wurde besonders in Haut und Nieren detektiert, wo sich die CXCR4-positiven Immunzellen
letztendlich anreichern (Wang et al. 2009; Wang et al. 2010; Chong und Mohan 2009).
Die interstitielle Lungenerkrankung ist ein Sammelbegriff für Lungenleiden, die meist mit
einer Fibrose verbunden sind, und ist hier interessant, da sie in Folge von
Autoimmunerkrankungen wie rheumatoider Arthritis oder systemischem Lupus
Erythematodes auftreten kann. Auch hier werden CXCR4 und CXCL12 vermehrt exprimiert,
was zur Rekrutierung von Fibroblasten und Vorläuferzellen aus dem Knochenmark in die
Lunge führt (Song et al. 2010).
19
EINLEITUNG
1.4. Therapie von chronischen Entzündungen
1.4.1. Aktuelle therapeutische Ansätze
Eine beständige und unkontrollierte Entzündung führt zu Gewebezerstörung und ist an der
Pathogenese von chronischen Entzündungen und Autoimmunerkrankungen beteiligt. Aktuelle
pharmakologische Therapien konzentrieren sich meist auf die Aufbauphase der
Immunantwort und zielen, in der Regel, auf eine Inhibierung der Infiltrierung von
Immunzellen ab. Wirkstoffe sind hierbei oft Inhibitoren, welche die Produktion oder Funktion
pro-entzündlicher Mediatoren behindern. Demzufolge handelt es sich hierbei um eine
Vorbeugung oder Abschwächung der Entzündung.
Ein aussichtsreicher Ansatz dafür ist, wie bereits erwähnt, die Beeinflussung des Netzwerkes
aus Chemokinrezeptoren und ihren Liganden. Eine Blockade des Rezeptors oder ein
anderweitiges Verhindern der Bindung des Liganden an den Rezeptor scheint daher eine
attraktive Möglichkeit die unnötige Immunantwort zu unterdrücken. Problematisch ist hier
allerdings die Komplexität, da ein Rezeptor oft verschiedene Liganden besitzt und ein Ligand
verschiedene Rezeptoren binden kann. Antikörper können die Funktion von Chemokinen
behindern, indem sie entweder den Rezeptor blockieren, den Liganden neutralisieren oder die
GAG-Interaktion des Chemokins, also die Bindung zur extrazellulären Matrix, verhindern. Da
G-Protein-gekoppelte Rezeptoren generell die am besten zu blockierenden Rezeptoren in der
Pharmakologie repräsentieren, existieren zahlreiche weitere Peptide oder kleine Moleküle zur
Inhibierung. Besitzt ein Chemokinrezeptor allerdings mehrere Liganden, welche
unterschiedliche Bindungsstellen besitzen können, sind kleine Moleküle als konkurrierende
Inhibitoren ungeeignet. Das Recycling des Rezeptors zu verhindern ist auch eine Möglichkeit,
um die Aktivierung des Rezeptors zu unterbinden. Eine weitere Strategie beinhaltet die
Mutation des N-Terminus von Chemokinen, so dass diese den Rezeptor noch binden, aber
nicht mehr aktivieren können. Solche Chemokinrezeptor-Antagonisten werden als Muteine
bezeichnet. Das Chemokin kann ebenso in seiner Matrix-Bindedomäne modifiziert werden, so
dass es nicht mehr an GAG binden kann (Johnson et al. 2005).
Nicht nur Chemokine, sondern auch andere pro-entzündliche Zytokine wie etwa TNF-α, sind
Ziele für Wirkstoffe und können über Antikörper neutralisiert werden. Die Unterbindung der
Rekrutierung von Leukozyten kann zudem über die Neutralisierung von Adhäsionsmolekülen
wie LFA-1 oder VLA-4 erreicht werden. Dies verhindert die Transmigration von Immunzellen
vom Blutgefäß ins entzündete Gewebe (Johnson et al. 2005). Die Blockade intrazellulärer
Signalkomponenten, beispielsweise Kinasen wie PI3K, ist ein Angriffspunkt für kleine
Moleküle und Inhibitoren wie Cyclosporin oder Steroide, da diese leicht in die Zelle gelangen
können (Johnson et al. 2004).
Neben den soeben genannten anti-entzündlichen Therapieansätzen, gibt es momentan auch
große Bemühungen das Abklingen der Immunantwort bewusst zu beschleunigen. Die
Beendigung der Immunantwort ist ein aktiver Prozess, welcher auf der Produktion und
Aktivierung immunmodulatorischer und anti-entzündlicher Mediatoren und Signalwege
beruht. Diese Mediatoren beinhalten Lipoxine, Resolvine, Protectine und Maresine, und
werden unter der Bezeichnung „SPM“ (pro-resolving mediators) zusammengefasst. Dabei
20
EINLEITUNG
kommt zur Verringerung der Rekrutierung von Immunzellen, zur Apoptose oder Umschaltung
von Effektor- in Gedächtnistyp der nicht mehr benötigten Immunzellen, sowie zur Aktivierung
von Aufräumarbeiten durch Makrophagen. Wirkstoffe, die hierfür entwickelt werden, können
vollkommen gegensätzlich zu jenen Wirkstoffen für die Bekämpfung der akuten
Entzündungsreaktion wirken. So werden hier meist Substanzen eingesetzt, die eine
induzierende Wirkung besitzen, beispielsweise die Apoptose von Immunzellen, die Produktion
anti-entzündlicher Moleküle oder die Rekrutierung von Makrophagen anregen (Sousa et al.
2013; Alessandri et al. 2013).
Beispiele für solche Wirkstoffe sind synthetische SPMs oder Glukokortikoide, welche die
Akkumulation von Immunzellen hemmen, allerdings auch gleichzeitig Apoptose oder
Phagozytose fördern (Vago et al. 2012; Chiang et al. 2012). Auch synthetische Lipide von
Omega-3-Fettsäuren
besitzen
sowohl
eine
anti-entzündliche
als
auch
eine
entzündungsauflösende Wirkung. Sie limitieren die Zell-Akkumulation im Entzündungsgebiet,
verstärken aber gleichzeitig auch die Bildung von SPMs und die Funktion von Makrophagen
(Serhan 2014). Weitere Substanzen sind Inhibitoren der beteiligten Signalwege und hemmen
unter anderem Komponenten wie PI3K, NF-κB oder ERK1/2. Noch ein Ansatzpunkt ist die
Modulation des intrazellulären H2O2- oder cAMP-Gehalts genannt, was ebenfalls eine
hemmende Wirkung auf die Immunantwort besitzt (Bystrom et al. 2008; Lopes et al. 2011).
Ein Nachteil der Induktion von Apoptose und Phagozytose solcher Substanzen ist allerdings,
dass ein fehlerhafter Eingriff sehr weitreichende negative Folgen haben kann und die
Wirkstoffe deshalb gezielt eingesetzt werden müssen.
In der Regel erfolgt die Verabreichung aller genannten Wirkstoffe systemisch und kann
deshalb auch außerhalb des Zielortes wirken und zu Nebenwirkungen führen. Zudem wird die
Substanz nicht vom Körper produziert und muss ständig neu aufgenommen werden, was
gerade bei chronischen Erkrankungen lange Zeiträume in Anspruch nehmen kann. Eine
Möglichkeit für eine möglichst spezifische und langfristige Wirkstoffzugabe bieten
Zelltherapien. T-Lymphozyten und dendritische Zellen sind wichtige Mediatoren der
Pathogenese von Autoimmunerkrankungen und deshalb ideale Kandidaten dafür. Von großem
Vorteil ist ihre antigenspezifische Migration zum Zielort sowie ihre „Homing“- und
Gedächtnis-Fähigkeit. Im besten Fall erfolgt sogar eine Art Selbstregulation der verabreichten
Zellen, durch Zellproliferation und Wirkstoffabgabe während akuten Entzündungsphasen und
eine Abschwächung zu entzündungsfreien Zeiten. Die Zellen können ex vivo retroviral
transduziert und anschließend intravenös wieder zugegeben werden. Immunregulatorische
Proteine, welche in dieser Form verabreicht werden, können Zytokine (z.B. IL-4, IL-10, IL-12),
Antikörper (z.B. anti-TNF), lösliche Rezeptoren (z.B. TNF-Rezeptoren) oder Antagonisten
(z.B. Chemokinrezeptor-Antagonisten) sein (Kim et al. 2001; Costa et al. 2001; Tarner et al.
2003).
Weitere Methoden für den Transport und die Zugabe von Substanzen sind Nanopartikel,
Liposomen oder die direkte Verabreichung „nackter“ DNA oder viraler Vektoren. Die Nachteile
sind meist, dass die Verabreichung nicht Gewebe-spezifisch ist und ständig erneuert werden
muss. Bei der Verwendung viraler Vektoren wird das Zielprotein zwar dauerhaft ins Genom
integriert, jedoch können Immunreaktionen starke Probleme für den Patienten mit sich
21
EINLEITUNG
bringen. Die Zelltherapie bietet daher die Möglichkeit einer dauerhaften, spezifischen und
besser regulierbaren Alternative (Balicki und Beutler 2002; Tarner et al. 2003).
Nach diesem Überblick zu therapeutischen Ansätzen zur Behandlung chronischer
Entzündungen, wird im folgenden Abschnitt im Detail auf den Einsatz von ChemokinrezeptorAntagonisten eingegangen, da bei dieser Wirkstoffgruppe der Schwerpunkt dieser Arbeit liegt.
Generell ist für die Behandlung von Autoimmunerkrankungen noch nennenswert, dass häufig
eine Kombination verschiedener genannter Wirkstoffe nötig ist, um dauerhaft einen Erfolg zu
erzielen.
1.4.2. Einsatz von Chemokinrezeptor-Antagonisten
In dieser Arbeit liegt der Fokus auf CXCR3 und CXCR4, aber auch andere
Chemokinrezeptoren, wie CCR2 oder CCR5, sind interessante Ziele. Daher ist es keine
Überraschung, dass bisher schon zahlreiche Untersuchungen und klinische Studien
unternommen wurden, um Chemokinrezeptor-Antagonisten als Therapie einzusetzen. Leider
wurde der Enthusiasmus in diesem Forschungsgebiet in den letzten Jahren durch einige
Fehlschläge getrübt. Eine aktuelle Aufstellung klinischer Studien unter Verwendung von
Chemokinrezeptor-Antagonisten als anti-entzündliche und anti-virale Wirkstoffe befindet sich
in Tabelle 1.1 (Bachelerie et al. 2014). Im Bereich der HIV-Behandlung gibt es erfolgreiche
klinische Studien aus Phase II und III mit CCR5-Antagonisten, wobei besonders der Inhibitor
Maraviroc von Pfizer erwähnenswert ist (Fätkenheuer et al. 2005; Dorr et al. 2005). Im
Gegensatz dazu waren die erfolgten Studien zu Autoimmunerkrankungen eher enttäuschend.
So entwickelte Pfizer einen CCR1-Inhibitor für rheumatoide Arthritis (Brown et al. 2007),
Berlex/Schering einen CCR1-Antagonisten für MS und Psoriasis (Zipp et al. 2006), Merck
einen CCR2-Inhibitor für rheumatoide Arthritis und MS (Braddock 2007a, 2007b) sowie
Amgen/ Tularik einen CXCR3-Antagonisten für die Behandlung von Psoriasis (Johnson et al.
2007). Keine dieser Studien schaffte es bis in die Phase III klinischer Studien.
Es existieren mehrere mögliche Gründe für das Scheitern dieser ChemokinrezeptorAntagonisten bei der Behandlung chronischer Entzündungen von Autoimmunerkrankungen.
Eine denkbare Ursache ist die Schwierigkeit, eine ausreichend hohe Konzentration des
Wirkstoffes im Plasma für eine Inhibierung des Rezeptors zu haben. Beispielsweise konnte für
den CCR1-Antagonisten BX471 in der klinischen Studie Phase II für MS keine signifikante
Wirkung gezeigt werden, trotz einer Rezeptor-Blockierung von 90% (Zipp et al. 2006). Diese
Tatsache könnte damit erklärt werden, dass bereits die Aktvierung einiger weniger
Immunzellen ausreichend ist, um die Pathogenese voranzutreiben. Zudem könnten vor allem
Wirkstoffe von geringer Größe andere Proteine im Blutplasma binden und damit ihre
Wirksamkeit verlieren. Dies konnte für den CXCR3-Antagonisten AMG-487 gezeigt werden
und könnte den Misserfolg klinischer Studien zumindest teilweise erklären (Li et al. 2008).
Um die Wirkstoffkonzentration am Wirkungsort besser dosieren und zudem Nebenwirkungen
vermeiden zu können, wäre die Möglichkeit einer lokalen Applikationen sicher von Vorteil.
Für diesen Zweck könnten Zelltherapien möglicherweise sehr hilfreich sein.
22
EINLEITUNG
Von besonderer Bedeutung ist mit Sicherheit auch, dass die verwendeten Tiermodelle nicht zu
100% den humanen Gegebenheiten entsprechen. Ein Beispiel dafür ist der Unterschied
zwischen MS beim Menschen und EAE bei Nagetieren (Ransohoff 2006; Steinman und Zamvil
2005). Unter anderem fehlt hier die Rolle von Myelin-spezifischen CD8+ Zellen, welche in der
humanen Pathogenese von Bedeutung sind (Steinman 2001). Zudem ist CCR1 im humanen
System vorwiegend bei Monozyten und aktivierten T-Zellen zu finden, beim Tiermodell wird
dieser Rezeptor allerdings konstitutiv von Neutrophilen exprimiert (Levine und Saltzman
1989). Für die Untersuchung von Psoriasis fehlt ebenfalls ein vergleichbares Tiermodell, was
zu Diskrepanzen in der Wirksamkeit von Medikamenten führt (Boehncke und Schön 2007).
Schwierigkeiten bereitet zudem die Heterogenität der zu therapierenden Erkrankungen. Zum
Beispiel gibt es bei MS allein mind. vier verschiedene Demethylierungs-Muster die auftreten
können (Lassmann et al. 2001). Zudem können die Chemokinrezeptoren CCR1, CCR2, CCR5
und CXCR3 in verschiedenem Ausmaß an der Pathogenese beteiligt sein, was wiederum eine
individuelle Therapie fordert (Charo und Ransohoff 2006). Ebenso konnte für rheumatoide
Arthritis eine Beteiligung von CCR1, CCR2, CCR5, CXCR2 sowie CXCR3 nachgewiesen werden
(Szekanecz et al. 2006). Diese Beispiele zeigen deutlich, dass die Blockade eines
Chemokinrezeptors oft unzureichend ist. Daher ist die gleichzeitige Blockade mehrerer
Chemokinrezeptoren aussichtsreicher, um mögliche Kompensationsmechanismen vermeiden
zu können. Für eine solche Kombinationstherapie können verschiedene Wirkstoffe neben
einander oder sogenannte „duale Chemokinrezeptor-Antagonisten“ eingesetzt werden, welche
gleichzeitig zwei verschiedene Rezeptoren inhibieren können. So existieren zum Beispiel
Strukturen für eine Bindung an CCR1 als auch CCR3 (Naya et al. 2003). Auch im Bereich der
Organtransplantation konnte gezeigt werden, dass eine gleichzeitige Hemmung von CCR5 und
CXCR3 die Abstoßungsreaktion von Transplantaten signifikant vermindert (Schnickel et al.
2008).
Für eine gleichzeitige Blockade verschiedener Chemokinrezeptoren ist auch der Einsatz des
viralen Proteins vMIP-II denkbar. Dieses stammt aus dem humanen Herpes Virus Typ 8 und
besitzt die Besonderheit, gleichzeitig die Chemokinrezeptoren CXCR3, CXCR4 sowie CCR1,
CCR2, CCR5 und CX3CR1 zu blockieren. Es besitzt zudem auch agonistische Funktion für
CCR3 und CCR8. (Kledal et al. 1997; Weber et al. 2001; Rubant et al. 2006). Diese
Rezeptorspezifitäten ermöglichen eine bevorzugte Blockade der Th1-vermittelten Entzündung,
bei gleichzeitiger Aktivierung der Th2-vermittelten Immunantwort, um das humane
Immunsystem nach Möglichkeit zu umgehen (Sozzani et al. 1998; Weber et al. 2001).
Aufgrund seiner Entzündungs-hemmenden Wirkung, wurde vMIP-II erfolgreich nach
Verletzungen im Gehirn und Rückenmark oder bei Transplantationen einsetzt. Aufgrund der
erwähnten Rezeptorspezifitäten ist ein weiterer Einsatzbereich die HIV-Forschung (Weber et
al. 2001; Takami et al. 2001; Pillai et al. 2008).
Ein weiteres Problem ist, dass vor allem kleine Moleküle mit anderen G-Protein-gekoppelten
Rezeptoren kreuzreagieren können. So konnte bei einem CCR1-Antagonisten eine zusätzliche
Aktivierung
von
Adrenozeptoren,
Adenosinrezeptoren,
Dopaminrezeptoren
und
Muskarinrezeptoren nachgewiesen werden (Hesselgesser et al. 1998). Auch hier spielen
Unterschiede zwischen humanen Chemokinrezeptoren und den vergleichbaren Rezeptoren im
23
EINLEITUNG
Tiermodell eine Rolle. Antagonisten, welche eine hohe Affinität zu humanen Rezeptoren
aufweisen, können eine viel geringer Affinität in anderen Spezies besitzen, was eine
Untersuchung im Tiermodell deutlich erschwert. Diese Problematik trat z.B. sehr deutlich
beim CCR1-Antagonisten CP-481,715 auf (Gladue et al. 2003). Eine Lösung hierfür könnte die
Verwendung transgener Tiere mit humanen Rezeptoren sein.
Letztendlich sind Chemokinrezeptor-Antagonisten noch immer erfolgversprechende
Wirkstoffe, allerdings sollte ihr Einsatz effektiver, aber gleichzeitig auch besser reguliert
ablaufen. Wichtig dabei ist sowohl mögliche Kompensationsmechanismen durch gleichzeitige
Hemmung verschiedener Rezeptoren zu berücksichtigen, als auch die chronische Entzündung
möglichst spezifisch und lokal zu bekämpfen.
24
EINLEITUNG
Tabelle 1.1 Auswahl an Klinischen Studien mit Einsatz von Chemokinrezeptor-Antagonisten nach
Bachelerie et al. (Bachelerie et al. 2014). (Alle Programme mit Peptiden sind extra mit ‡
gekennzeichnet; COPD = chronisch atemwegs-verengende Lungenkrankheit; IBD =
Reizdarmsyndrom; MS = Multiple Sklerose; NHL = Non-Hodgkin-Lymphom; RA = Rheumatoide
Arthritis)
Rezeptor
Firma
Klin. Studie
Antagonist
II
BX 471
II
Einsatz
aktueller Stand
CCR1
Schering AG/
Berlex
Millennium
CCR1
Millennium
II
MLN 3897
RA
keine Effizienz
CCR1
Pfizer
ChemoCentryx/
GSK
II
CP 481,715
RA
keine Effizienz
II
CCX354
RA
laufende Studie
CCR2
Millennium
II
MLN 1202‡
Atherosklerose,
MS, RA
keine Effizienz in RA,
laufende Studie bei
Atherosklerose und MS
CCR2
Incyte
I
INCB8696
CCR2
Incyte
II
INCB3284
CCR2
ChemoCentryx
I
CCX915
MS, Lupus
RA, Typ 2
Diabetes
MS
Studie beendet
CCR2
Merck
II
MK-0812
RA, MS
keine Effizienz
CCR3
Dupont
I
DPC168
Asthma
Studie unterbrochen
CCR3
GlaxoSmithKline
II
GSK766994
Asthma,
allergische
Rhinitis
keine Effizienz
CCR3
BMS
I
BMS-639623
Asthma
laufende Studie
CCR4
Amgen
II
KW-0761‡
Onkologie
laufende Studie
CCR4
GSK
I
GSK2239633
Asthma
laufende Studie
CCR5
Pfizer
zugelassen
Maraviroc
HIV
zugelassen
CCR5
Pfizer
II
Maraviroc
RA
keine Effizienz
CCR5
Schering-Plough
II
Sch-C
RA
keine Effizienz
CCR5
Schering-Plough
II
Sch-D
HIV
Studie unterbrochen
CCR5
GlaxoSmithKline
III
GW2239633
HIV
Studie unterbrochen
CCR5
Incyte
II
INCB9471
HIV
Studie unterbrochen
HIV
IBD, Morbus
Crohn
laufende Studie
COPD
laufende Studie
CCR1
CCR1
CCR5
keine Meldung
‡
II
Pro 140
III
CCX-282
Schering–Plough
II
SCH 527123
Dompé
III
Reparixin
CXCR2
GlaxoSmithKline
I
SB 656933
CXCR3
Amgen
II
AMG487
CXCR4
Genzyme/
Sanofi-Aventis
zugelassen
Plerixafor
CCR9
CXCR1/
CXCR2
CXCR1/
CXCR2
Progenics
ChemoCentryx/
GSK
MLN 3701
MS, Psoriasis,
Endometriose
MS
Reperfusionsschäden
COPD, zystische
Fibrose
Psoriasis
Multiples
Mylom, NHL
keine Effizenz
keine Meldung
keine Meldung
Studie beendet
laufende Studie
laufende Studie
keine Effizienz
zugelassen
25
ZUSAMMENFASSUNG
2. Zusammenfassung
Die Pathogenese von Autoimmunerkrankungen ist mit einer Verstärkung der T-Zellmigration
in das chronisch entzündete Gewebe assoziiert. Dabei spielt die veränderte Expression von
Chemokinen eine entscheidende Rolle, was die Zellinfiltration und somit die
Gewebezerstörung fördert. Von besonderem Interesse sind dabei die Chemokinrezeptoren
CXCR3 und CXCR4 sowie ihre Liganden CXCL9, CXCL10, CXCL11 und CXCL12, was unter
anderem bei Typ-1-Diabetes (Christen und Herrath 2004; Rhode et al. 2005), rheumatoider
Arthritis (Burman et al. 2005) und MS (Elyaman et al. 2008; Moll et al. 2009) nachgewiesen
werden konnte. Ein therapeutischer Ansatz für die Behandlung chronischer Entzündungen ist
daher der Einsatz von Chemokinrezeptor-Antagonisten. Bisher konnten solche Antagonisten
im Bereich HIV und Transplantationen (Jamjian und McNicholl 2004; Flomenberg et al. 2010)
erfolgreich getestet werden. Doch aufgrund von systemischen Nebeneffekten und
Kompensationsmechanismen innerhalb der Chemokinrezeptor-Familie war der positive Effekt
bei der Handlung von chronischen Entzündungen bisher leider begrenzt (Proudfoot et al.
2010).
Aufgrund solcher Rückschläge wurde in dieser Arbeit ein neuer therapeutischer Ansatz
entwickelt. Dabei handelt es sich um eine Zelltherapie, welche eine spezifischere
Verabreichung von Chemokinrezeptor-Antagonisten ermöglicht. Es sollen insbesondere die
beiden Chemokinrezeptoren CXCR3 und CXCR4 gehemmt werden. Die Inhibierung der TZellinfiltration erfolgt über die Blockade von CXCR3 durch den ChemokinrezeptorAntagonisten CXCL11(4-79), von CXCR4 durch CXCL12(P2G2) sowie durch das virale vMIPII, welches in der Lage ist, beide Rezeptoren zu blockieren. Der Fokus wurde während der
gesamten Arbeit auf den CXCR3-Antagonisten CXCL11(4-79) gelegt. Im Detail sollen
entzündliche T-Zellen diese Antagonisten lokal am Entzündungsort nach Antigen-spezifischer
Zellaktivierung exprimieren, um somit einer weiteren T-Zellinfiltration entgegen zu wirken. In
Abbildung 2.1 Ist ein Überblick dieses Konzeptes dargestellt.
Um diesen Therapieansatz zu untersuchen, wurden die Antagonisten zunächst in lentivirale
Konstrukte inseriert und anschließend in murine und humane T-Zellen mit Hilfe von
lentiviralen Partikeln transduziert. Als Zielzellen wurden verschiedene T-Zelllinien sowie
primäre CD4+ und CD8+ T-Zellen verwendet. Im folgenden Schritt wurde die Expression und
Sekretion der Antagonisten mittels PCR auf mRNA-Ebene sowie Western Blot und ELISA auf
Protein-Ebene nachgewiesen. Dabei konnte gezeigt werden, dass die Antagonisten von den
verschiedenen T-Zellen produziert werden können. Bei dem erfolgreichen Nachweis der
Proteinexpression und -sekretion wurde sich auf die Muteine CXCL11(4-79) und
CXCL12(P2G2) konzentriert. Allerdings wurde hier gezeigt, dass die Expressionsrate des
CXCR3-Antagonists deutlich höher im Vergleich zum CXCR4-Antagonisten ist. Für eine
gezieltere Antagonist-Expression innerhalb des entzündeten Gewebes wurden zusätzlich
Konstrukte mit einem IL-2 Promoterelement vor der Antagonist-Sequenz generiert. Diese
Promotersequenz enthält Bindungsstellen für die Transkriptionsfaktoren NFAT und AP-1,
welche erst nach Aktivierung der T-Zelle exprimiert werden. In Folge dieser Signalkaskade
wird der Wachstumsfaktor IL-2 produziert, was die T-Zellproliferation noch weiter verstärkt.
26
ZUSAMMENFASSUNG
Durch den Einsatz von Antigen-spezifischen T-Zellen kann somit eine gezielte AntagonistProduktion im Entzündungsherd erfolgen. In diesem Zusammenhang konnte mittels ELISA
gezeigt werden, dass eine Expression der Antagonisten mit diesen Konstrukten erst nach
Aktivierung der T-Zellen stattfindet.
Im Anschluss an diese umfangreichen Vorversuche sollte schließlich die biologische Effizienz
der von den T-Zellen sekretierten Antagonisten demonstriert werden. Dazu wurde ein
Migrations-Assay eingesetzt, um die Hemmung der Chemokin-induzierten Zellmigration
aufzeigen zu können. Nach Vorinkubation der für die Migration eingesetzten T-Zellen mit den
Antagonisten CXCL11(4-79), konnte tatsächlich eine deutliche Hemmung der Zellmigration
beobachtet werden. In zukünftigen Versuchen müsste auch die Wirkung der anderen
Antagonisten untersucht werden. Außerdem wäre ein weiterer Schritt, diese Zelltherapie in
relevanten Mausmodellen zu testen.
Zusammenfassend zeigt diese Arbeit die ersten Ansätze für die Entwicklung einer neuen TZell-basierten Therapie mit einem spezifischeren Einsatz von Chemokinrezeptor-Antagonisten
für die Behandlung chronischer Entzündungen von Autoimmunerkrankungen. Durch den
Einsatz verschiedener Antagonisten und durch die lokale Anwendung könnten bisherige
Komplikationen besser vermieden werden, was eine Alternative zu den bisherigen Therapien
in diesem Bereich bietet.
Abbildung 2.1 Schematische Darstellung der T-Zell-basierten Therapie für den Einsatz von
Chemokinrezeptor-Antagonisten. Nach lentiviraler Transduktion inflammatorischer T-Zellen, werden
diese ins Entzündungsgebiet rekrutiert. Vor Ort erfolgt nach Antigen-spezifischer Expansion die
Produktion der Antagonisten, welche die weitere T-Zell-Infiltration inhibieren.
27
MATERIAL UND METHODEN
3. Material und Methoden
3.1. Molekularbiologische Methoden
3.1.1. RNA Isolierung
Die Gesamt-RNA proliferierender Zellen wurde durch Verwendung des RNA-Isolations-Kits
(Peqlab) nach Angaben des Herstellers isoliert. Die RNA wurde in sterilem H 2O aufgenommen
und die Konzentration am NanoDrop (Thermo Scientific) bei einer Wellenlänge von 260nm
und 280nm gemessen. Für eine längere Aufbewahrung wurde RNA bei -80°C eingefroren.
3.1.2. Polymerase-Kettenreaktion (PCR)
Die PCR (polymerase chain reaction) ist eine in vitro-Anwendung zur selektiven,
enzymatischen Amplifizierung einer DNA-Sequenz mit Hilfe einer temperaturstabilen DNAPolymerase.
Standard-PCR:
Tabelle 3.1 Standard-PCR.
Puffer (10X)
Taq-Poymerase (5 U/μl)
Primer (10 pmol/μl)
MgCl2 (50 mM)
dNTPs (10mM)
cDNA
dest. H2O
2,5 μl
0,5 μl
je 0,5 μl
0,75 μl
0,5 μl
1 μl
18,75 μl
Im Allgemeinen wurde die Standard-PCR in einem Gesamtvolumen von 25μl pro Probe mit
einer finalen Konzentration an 0,2 mM dNTPs, 1,5 mM MgCl 2, 0,5 μM pro Primer, 1X PCRPuffer und 5 U der Platinum Taq Polymerase (Invitrogen) in PCR-Cyclern von Biometra
durchgeführt.
Die PCR für den Nachweis der Chemokinrezeptor-Antagonisten mRNA wurde mit den Primern
CXCL11_fw/rv, CXCL12_fw/rv sowie vMIP-II_fw/rv, bei 5 min 94°C mit anschließend 35
Zyklen (30 s 94°C, 30 s 56°C, 30 s 72°C) und einer finalen Verlängerung von 5 min bei 72°C
durchgeführt.
Für die Vervielfältigung des IL-2-Promoterelements aus dem Plasmid IL-2 promoter luciferase
(Plasmid 12194) von Addgene wurden die Primer MluI_fw und NheI_rv eingesetzt. Die PCR
verlief für 2 min bei 94°C, anschließend über 25 Zyklen (30 s 94°C, 40 s 60°C, 30 s 72°C) und
endete einer DNA-Polymerisation von 10 min bei 72°C.
28
MATERIAL UND METHODEN
Tabelle 3.2 Auflistung der verwendeten Oligonukleotide.
Name
CXCL11_fw
CXCL11_rv
CXCL12_fw
CXCL12_rv
vMIP-II_fw
vMIP-II_rv
pCDH1_fw
pCDH1_rv
MluI_fw
NheI_rv
M13-TOPO_fw
M13-TOPO_rv
GAPDH_fw
GAPDH_rv
Sequenz (5'  3')
GAACAGGAAGGTCACAGCCAT
CAAGACAGCAGAGGGTCAGG
GCATCAGTGACGGTAAACCA
CTCCAGGTACTCTTGGATCCA
GCCTTGCTTTGTTTGCAATCTG
TAATTGCTGCATCAGCTTCTTCAC
GTGTACGGTGGGAGGTCTA
AACTTCTCGGGGACTGTGG
ACGCGTATCTATCACCCTGTGTGCAATTAGC
GCTAGCTAGGCAGCTCTTCAGCATGGGA
GTAAAACGACGGCCAG
CAGGAAACAGCTATGAC
ACCACAGTCCATGCCATCAC
TCCACCACCCTGTTGCTGTA
Reverse Transkriptase (RT)-PCR:
Tabelle 3.3 RT-PCR.
RT Puffer (10X)
Reverse Transkriptase (50 U/ml)
Random Primers (10X)
dNTPs (25X, 100mM)
RNA
dest. H2O
2 μl
1 μl
2 μl
0,8 μl
1-2 μg
x
Die RT-PCR dient zur Amplifikation von RNA-Templates, welche in cDNA (copy-DNA)
umgeschrieben werden. In dieser Arbeit wurde die RT-PCR zum Nachweis der Expression der
Chemokinrezeptor-Antagonisten auf RNA-Ebene eingesetzt. Für die Durchführung RT-PCR
wurde das „High-Capacity cDNA Reverse Transription Kit“ von Applied verwendet. Die RT-PCR
erfolgte bei 10 min 25°C, 120 min 37°C und 5 min 85°C in einem Gesamtvolumen von 20 μl.
29
MATERIAL UND METHODEN
3.1.3. Gelelektrophoretische Auftrennung von Nukleinsäuren
In der vorliegenden Arbeit wurde eine horizontale Gelelektrophorese mit dem Sub-Cell GT
Agarose Gel Electrophoresis System (Bio-Rad) für den Nachweis von PCR-Produkten und
Plasmiden durchgeführt. Für eine gewünschte Gelkonzentration wurde Agarose mit 1x TAE
Puffer versetzt und in der Mikrowelle aufgekocht, bis sich die Agarose vollständig löste. Die
Agarose wurde auf etwa 80°C abgekühlt, mit GelRed (Biotium) versetzt, welches in den
Doppelstrang interkaliert, und die Lösung in die vorgesehene Gelkammer gegossen. Ein
Plastikkamm sorgte für die gewünschte Zahl an freibleibenden Taschen, in die nachher die
Proben eingefüllt wurden. Das auspolymerisierte Gel wurde nach 20 Minuten mit TAE-Puffer
überschichtet, der Kamm herausgezogen, die mit Ladepuffer versetzten DNA-Proben auf das
Gel aufgetragen und die DNA bei einer Spannung von 75-100 V aufgetrennt. Als
Größenstandard dienten HyperLadder II (Bioline) und 1 kb DNA Ladder (Invitrogen). Die
Auswertung der Fragmente fand unter UV-Licht eines LTF Geldokumentationssystems statt.
30
MATERIAL UND METHODEN
3.2. Mikrobiologische Methoden
3.2.1. Kultivierung von E.coli
Für die Plasmidpräparation wurden die entsprechenden E.coli-Klone über Nacht bei 37°C in
Antibiotikahaltigem LB-Medium (Roth) herangezogen. Dafür wurde das LB-Medium angesetzt
und autoklaviert. Für die Herstellung von LB-Agarplatten wurde LB-Agar (Roth) ansesetzt,
autoklviert, nach dem Abkühlen auf etwa 60°C mit 100μg/ml Ampicillin (Invitrogen) versetzt
und anschließend die Lösung in sterile Platten gegossen. Bis zur Verwendung wurden die
Platten bei 4°C gelagert.
3.2.2. Klonierung
Für die Transduktion von T-Zellen mit den Chemokinrezeptor-Antagonisten wurde der
lentivirale Expressionsvektor pCDH1-MCS1-EF1-copGFP von System Biosciences verwendet.
Als potentielles Trägerplasmid für weiterführende Versuche wurde zudem der Vektor pTRIPZ
eingesetzt. Die Sequenzen der Antagonisten wurden von Geneart der Firma Life Technologies
synthetisiert und in dem Plasmid 11AADO2P_11xxx_12P2G2_vMIP_pMA-RG geliefert, das IL2-Promoterelement wurde in dem Plasmid IL-2 promoter luciferase (Plasmid 12194) von
Addgene bestellt (Sequenz in Abbildung 4.1 D).
Vektorverdau:
Für den Verdau wurden jeweils 18 μg vom Vektor oder 10 μg vom Insert eingesetzt. Dabei
wurden Restiktionsenzyme der Firma NEB verwendet. Die von den einzelnen Enzymen
eingesetzten Mengen und Puffer-Bedingungen wurden von den Angaben des Herstellers,
welche
auch
auf
der
Homepage
angegeben
werden,
übernommen
(http://www.neb.com/nebecomm/DoubleDigestCalculator.asp#.T5kEjtkrvGg). Generell erfolgte
der Verdau in einer Gesamtmenge von 50 μl für 4 h bei 37°C.
Gelaufreinigung:
Im Anschluss an den Verdau wurde der Ansatz auf ein Agarosegel entsprechender Dichte
aufgetragen und die Banden der korrekten Größe unter UV-Licht heraus geschnitten. Die
Isolierung der DNA aus dem Gel erfolgte mit einem Gelextraktions-Kit (GenElute Gel
Extraction Kit, Sigma-Aldrich). Nach der Elution in H2O konnte die DNA-Konzentration für
den weiteren Einsatz gemessen werden.
Ligation:
In der Regel erfolgte die Ligation von Vektor und Insert in einem Verhältnis von 1:3 oder 1:5.
Dabei wurden meist 100 ng des Vektors eingesetzt. Die Berechnung der Menge des Inserts
erfolgte anhand folgender Gleichung, wobei hier von einem 1:3-Verhältnis ausgegangen wird:
3 × 𝑉𝑒𝑘𝑡𝑜𝑟 [𝑛𝑔] × 𝑉𝑒𝑘𝑡𝑜𝑟𝑙ä𝑛𝑔𝑒 [𝑏𝑝]
= 𝐼𝑛𝑠𝑒𝑟𝑡 [𝑛𝑔]
𝐼𝑛𝑠𝑒𝑟𝑡𝑙ä𝑛𝑔𝑒 [𝑏𝑝]
31
MATERIAL UND METHODEN
Der Ansatz erfolgte in einem Gesamtvolumen von 20 μl mit der T4 DNA Ligase und dem
entsprechenden Puffer der Firma Fermentas bei 37°C für 3 h. Für die anschließende
Transformation wurde der Ligationsansatz 1:5 in dest. H2O verdünnt.
Transformation von E.coli:
50 μl kompetente E.coli-Zellen (TOP10, Invitrogen Life Technologies) pro Ansatz wurden auf
Eis aufgetaut, mit 1 μl Plasmid-DNA oder 4 μl Ligationsansatz versetzt und für 30 Minuten auf
Eis inkubiert. Die Zellen wurden für 30 s einem Hitzeschock bei 42°C ausgesetzt, 2 Minuten
auf Eis abgekühlt, in 250 μl SOC-Medium aufgenommen und für eine Stunde bei 225rpm und
37°C im Schüttler inkubiert. Anschließend wurden 20-200 μl auf Ampicillin-haltigen Platten
ausplattiert und bei 37°C über Nacht herangezogen.
Kolonie-PCR:
Die Kolonie-PCR wird für den Nachweis einer erfolgreichen Ligation eingesetzt. Der Ansatz
und die Primer entsprechen der Standard-PCR, anstatt der cDNA dient die E.coli-Kolonie als
Ausgangs-DNA. Für die Identifizierung positiver Klone erfolgte eine Gelektrophorese der PCRProdukte.
Plasmidpräparation:
Für die Isolierung der Plasmid-DNA aus der positiven E.coli-Kolonie wurden
Plasmidpräparations-Kits eingesetzt. Wurde nur eine geringe DNA-Menge benötigt, wurde das
Mini-Präparations-Kit (GenElute Plasmid Miniprep Kit, Sigma-Aldrich), bei größerer Menge
das Maxi-Präparations-Kit (JetStar2.0 Plasmid Maxiprep Kit, Genomed) verwendet. Die
Durchführung erfolgte nach den Protokollen der Hersteller. Im Anschluss wurde die DNAMenge gemessen und das Plasmid sequenziert.
Sequenzierung:
Die DNA-Sequenzierung wurde für die Überprüfung einer erfolgreichen Klonierung
verwendet. Dafür wurden 750-1500 ng Plasmid-DNA, 15 pmol Primer und dest. Wasser in
einem Gesamtvolumen von 15 μl bei der Firma MWG eingeschickt. Für die Sequenzierung der
pCDH1-MCS1-EF1-copGFP Konstrukte wurden folgende Oligonukliotide eingesetzt:
CXCL11_fw/rv, CXCL12_fw/rv, vMIP-II_fw/rv, MluI_fw, NheI_rv und pCDH1_fw/rv. Die
Oligonukleotide M13-TOPO_fw und M13-TOPO_rv dienten zur Sequenzierung des Vektors
pCR2.1-TOPO.
32
MATERIAL UND METHODEN
A)
B)
C)
Abbildung 3.1 Ausgangsvektoren für die Klonierung der Chemokinrezeptor-Antagonisten (CRA)exprimierenden Konstrukte. (A) Das Trägerplasmid pCDH1-MCS1-EF1-copGFP stammt von System
Biosciences. Die einzelnen Abkürzungen sind in Tabelle 3.4 erklärt. (B) Vektorkarte des lentiviralen
Trägerplasmids pTRIPZ von Thermo Scientific Open Biosystems. Die einzelnen Abkürzungen sind in
Tabelle 3.5 erklärt. (C) Die Sequenzen der CRA wurden bei Geneart der Firma Life Technologies
synthetisiert und in dem Plasmid 11AADO2P_11xxx_12P2G2_vMIP_pMA-RG, getrennt durch
verschiedene Restriktions-schnittstellen, in einem Plasmid geliefert.
33
MATERIAL UND METHODEN
Tabelle 3.4 Auflistung der einzelnen Bestandteile des Trägerplasmids pCDH1-MCS1-EF1-copGFP mit
der jeweiligen Funktion.
Abkürzung
Funktion
3' ΔLTR
SV40 Poly-A
SV40 Ori
pUC Ori
Ermöglichung der viralen Verpackung und Transkription
(hybrid RSV promoter-R/U5 long terminal repeat)
Verpackungssignal
Beteiligung an Verpackung viraler Transkripte (rev response element)
Beteiligung bei nukleärer Translokation und Integration ins Genom
Konstititiver Promoter des Cytomegalovirus (CMV) für cDNA-Insert
Konstitutiver Promoter für Reportergen (elongation factor 1α promoter)
Fluoreszenz-Reportergen (copepod green fluorescent protein)
Erhöhung der Transkript-Stabilität (woodchuck hepetitis virus
posttranscriptional regulatory element)
Ermöglichung der viralen reversen Transkription
Beendigung der Transkription und Signal für Polyadenylierung
Ermöglichung der episomalen Replikation in eukaryotischen Zellen
Ermöglichung einer hohen Kopienzahl in E.coli
AmpR
Ampicillin-Resistenz für Selektion in E.coli
RSV/5'LTR
gag
RRE
cPPT
CMV
EF1
copGFP
WPRE
Tabelle 3.5 Auflistung der einzelnen Bestandteile des Trägerplasmids TRIPZ mit der jeweiligen
Funktion.
Abkürzung
Funktion
shRNAmir
Position für die einzusetzende mikro-RNA
TRE
Tetrazyklin-induzierbarer Promoter
rtTA3
Reverser Tetrazyklin-Transaktivator
UBC promoter
Konstitutiver Promoter für die Expression von rtTA3 und IRES-Puro
cPPT
Beteiligung bei nukleärer Translokation und Integration ins Genom
WRE
Erhöhung der Transkript-Stabilität und -Translation
turbo RFP
Fluoreszenz-Reportergen (turbo red fluorescent protein)
Puror
Puromycin-Resistenz für Selektion in eukaryotischen Zellen
r
AMP
Ampicillin-Resistenz für Selektion in E.coli
5'LTR
Ermöglichung der viralen Verpackung und Transkription (5' long terminal
repeat )
pUC ori
Ermöglichung einer hohen Kopienzahl in E.coli
SIN-LTR
Verhinderung der unkontrollierten Virus-Amplifikation (3' Self inactivating long
terminal repeat)
RRE
Beteiligung an Verpackung viraler Transkripte (rev response element)
ZEOr
Zeomycin-Resistenz für Selektion in E.coli
34
MATERIAL UND METHODEN
3.3. Zellbiologische Methoden
3.3.1. Kultivierung von murinen und humanen Zelllinien
Tabelle 3.6 Kulturmedium für murine und humane Zelllinien
IF12:
RPMI 1640 (Glutamax)
1% Penicillin/ Streptomycin
1% nicht-essentielle Aminosäuren
10% Fötales Kälberserum (FCS)
20 U/ml rekombinantes humanes IL-2
Jurkat:
RPMI 1640 (Glutamax)
1% Penicillin/ Straptomycin
10% Fötales Kälberserum (FCS)
EL-4:
RPMI 1640 (Glutamax)
1% Penicillin/ Straptomycin
5% Fötales Kälberserum (FCS)
K562:
RPMI 1640 (Glutamax)
1% Penicillin/ Straptomycin
10% Fötales Kälberserum (FCS)
HEK293T:
DMEM (high glucose)
1% Penicillin/ Straptomycin
10% Fötales Kälberserum (FCS)
Der Th1-Zellklon IF12 wurde in Balb/c Mäusen generiert, die subkutan mit „Komplettes
Freunds Adjuvans“/Ovalbumin immunisiert wurden. Nach Extraktion der regionalen
Lymphknoten und Vereinzelung der Zellen wurde dieser durch klonale Expansion
weitergeführt. Charakterisiert wurde der Klon als Th1-Gedächtniszelle vom central memory
Typ.
Jurkat-Zellen sind eine Leukämie-Zelllinie menschlicher T-Zellen, bei K562 handelt es sich um
eine humane myeloische Leukämie-Zelllinie und EL-4 sind eine murine Thymus Lymphom
Zelllinie.
Bei HEK293 handelt es sich um eine Zelllinie menschlicher embryonaler Nierenzellen
("Human Embryonic Kidney"). Die Linie HEK293T exprimiert zusätzlich das "SV40 large TAntigen", welches die DNA-Replikation bestimmter Retroviren ermöglicht.
35
MATERIAL UND METHODEN
3.3.2. Isolierung muriner Milzzellen
Tabelle 3.7 Kulturmedium für murine Milzzellen.
Iscove Basal Medium
1% Penicillin/ Straptomycin
1% nicht-essentielle Aminosäuren
2 mM Glutamin
1 mM Natrium-Pyruvat
50 μM ß-Mercaptoethanol
5% Fötales Kälberserum (FCS)
Tabelle 3.8 ACK-Puffer
0,5 M NH4Cl
10 mM KHCO3
0,1 mM Na2EDTA
Weibliche C57BL/6 Mäuse wurden nach Narkotisierung mit Isofluran durch zervikale
Dislokation getötet. Anschließend wurde die Milz unter sterilen Bedingungen entnommen und
in serumfreien Medium aufgenommen. In einem Potter wurden die Milzzellen durch
vorsichtige Drehbewegungen des Pistills isoliert und danach filtriert (70μm). Nach
Zentrifugation bei 1500 U/min für 10 min wurde das Pellet für 3 min bei 37°C in 2 ml ACKPuffer inkubiert um die Erythrozyten zu entfernen. Durch Zugabe von 5 ml serumhaltiges
Medium wurde die Reaktion gestoppt, das Pellet im Anschluss zweimal in serumfreien
Medium gewaschen und die Milzzellen bis zur weiteren Verwendung in Milzmedium bei 4
Mio. Zellen/ml kultiviert. Die Zellzahl wurde mit Hilfe einer Neubauer-Zählkammer ermittelt.
3.3.3. Magnetische Aufreinigung von T-Zellen
Tabelle 3.9 Medium für T-Zellaufreinigung
PBS
1mM EDTA
2% Fötales Kälberserum (FCS)
Die zytotoxischen T-Zellen wurden mittels Negativselektion aus den isolierten Milzzellen,
unter Verwendung des “EasySep® Mouse CD8+ T Cell Isolation Kit” (STEMCELL
Technologies), nach dem mitgelieferten Protokoll gewonnen. Die Zellanreicherung erfolgte
durch Isolierung aller übrigen Zelltypen anhand magnetischer Antikörper-Komplexe für CD4,
CD11b, CD11c, CD19, CD45R/B220, CD49b, TCRγ/δ und TER119.
36
MATERIAL UND METHODEN
3.3.4. Kultivierung von primären T-Zellen
Tabelle 3.10 Kulturmedium für primäre murine T-Zellen
RPMI 1640 (Glutamax)
1% Penicillin/ Straptomycin
1% nicht-essentielle Aminosäuren
2 mM Glutamin
1 mM Natrium-Pyruvat
50 μM ß-Mercaptoethanol
10% Fötales Kälberserum (FCS)
Die primären zytotoxischen T-Zellen wurden bis zur Weiterverwendung im oben genannten
Medium kuktiviert.
3.3.5. Zellstimulierung für T-Zellaktivierung
Die T-Zellaktivierung erfolgte durch Stimulierung mit Anti-CD3/28 oder PMA/Ionomycin für
4-72 h. Eine Behandlung mit Anti-CD3/28 wurde entweder mit löslichem Anti-CD3 (1 μg/ml,
BD) und Anti-CD28 (2,5 μg/ml, eBioscience) oder mit Anti-CD3/28-gekoppelten
magnetischen Kügelchen durchgeführt. Die PMA/Ionomycin-Stimulierung erfolgte durch
Zugabe von 1 nM PMA (Sigma) und 1 μM Ionomycin (LC Laboratories) ins Zellkulturmedium.
Für die Stimulierung der primären Zytotoxischen T-Zellen wurden ausschließlich AntiCD3/28-gekoppelte magnetische Kügelchen eingesetzt. Dafür wurden zunächst „M-450 Epoxy
Dynabeads“ (Invitrogen) mit Anti-CD3 (Klon: 145-2C11) und Anti-CD28 (Klon: 37.51)
gekoppelt. 1 ml der magnetischen Kügelchen wurde 3-5x mit PBS im Magnetständer
gewaschen und in 1 ml PBS aufgenommen. Nach Zugabe von je 60 μg Anti-CD3/28 wurde die
Lösung für 16-24 h bei 37°C im Rotator inkubiert. Die Antikörper-gekoppelten Kügelchen
wurden dreimal in 0,1% MSA (Maus Serum Albumin, Calbiochem) in PBS für 5 min bei RT im
Rotator gewaschen und geblockt, die Inkubation beim letzten Waschschritt betrug 16-24 h bei
2-8°C. Nach Aufnahme in 1 ml frischem 0,1% MSA/PBS konnten die magnetischen Kügelchen
bei 4°C gelagert werden.
Für die Stimulierung von 5x106 Zellen wurden 15x106 Kügelchen eingesetzt. Die benötigte
Menge wurde zweimal in PBS gewaschen und im Anschluss daran die magnetischen
Kügelchen in der Zellsuspension aufgenommen. Die Zellstimulierung erfolgte für 24 h in
Kulturmedium für primäre murine T-Zellen.
37
MATERIAL UND METHODEN
3.3.6. Einfrieren und Auftauen von Zellen
Zur Inkulturnahme der Zellen wurden zunächst die Kryoröhrchen aus dem Stickstofftank
genommen und im Wasserbad bei 37 °C kurz aufgetaut bis nur noch eine erbsengroße Menge
gefroren war. Anschließend wurde das Kryoröhrchen mit 80%igem Ethanol desinfiziert und
die Zellen rasch in ein 50 ml Falconröhrchen mit 5 ml FCS pipettiert. Die Zellen wurden für 3
min bei 1200 U/min zentrifugiert. Danach wurde das Pellet in 20-30 ml des entsprechenden
Mediums resuspendiert und in eine Zellkulturflasche (T75) überführt. Die Zellen wurden bei
37 °C und 5% CO2 im Brutschrank kultiviert und alle 3-4 Tage gesplittet.
Zum Wegfrieren wurden die Zellen pelletiert und in Gefriermedium (jeweiliges
Zellkulturmedium mit 20% FCS und 10% DMSO) aufgenommen und in sterile
Gefrierröhrchen abgefüllt. In speziellen Isopropanol-haltigen Einfrierboxen wurden die Zellen
langsam im Gefrierschrank auf -80°C abgekühlt und nach mind. 24 Stunden in den
Stickstofftank überführt.
3.3.7. Lentivirale Transduktion von T-Zellen
Virusproduktion:
Für die Virusproduktion wurden HEK293T Zellen verwendet. Zunächst wurden 6x10 6 Zellen
in 8 ml Zellkulturmedium pro Zellkulturschale (Ø 10cm) ausgesät. Am darauffolgenden Tag
erfolgte die Transfektion des Trägerplasmids, sowie der zwei lentiviralen
Verpackungsplasmide M334 und pMD2.VSV.G (Plasmid Factory) mittels Polyethylenimin
(PEI). Für jede Zellkulturschale wurden zum einen 7,5 μg M334, 3 μg pMD2.VSV.G und 10 μg
des Trägerplasmids und zum anderen 25 μg PEI in jeweils einem Gesamtvolumen von 525 μl
DMEM Medium gemischt. Anschließend wurden DNA- und PEI-Mischung vereint, 20-30 min
bei RT inkubiert, mit 3,95 ml DMEM Medium aufgefüllt und die 5 ml vorsichtig zu den Zellen
gegeben. Nach ca. 16 h wurde das Transfektionsmedium entfernt und 5 ml Zellkulturmedium
zugegeben. Der Zellüberstand mit den produzierten Viruspartikeln wurde nun nach 24 und 48
h gesammelt, filtriert (45 μm) und für die Transduktion eingesetzt.
Transduktion von T-Zelllinien (für IF12 optimiert):
Da die Zelllinien beliebig vermehrt werden können, erfolgte die Transduktion mit geringer
Zellzahl in 96-Loch-Platten. Um eine möglichst hohe Viruskonzentration zu erhalten, wurde
der Virusüberstand einkonzentriert. Dazu wurde der Zellüberstand mit den Viruspartikeln für
90 min bei 23000 rpm und 4°C zentrifugiert, das Pellet in 250 μl RPMI 1640 Medium
aufgenommen, 10 min inkubiert und 50-100 Mal auf- und abpipettiert. Der einkonzentrierte
Virusüberstand wurde unverdünnt, 1:5- und 1:25-verdünnt eingesetzt.
Die Zielzellen wurden mit je 2x104 Zellen in 200 μl Zellkulturmedium ausgesät. Nach Zugabe
von je 50 μl des Virusüberstands, wurde die Platte für 90 min bei 1500 rpm und 32-34°C
zentrifugiert und schließlich über Nacht im Brutschrank inkubiert. Die Überprüfung der
Transduktionseffizienz erfolgte nach 2-3 Tagen mittels FACS-Messung GFP-positiver Zellen.
38
MATERIAL UND METHODEN
Transduktion von primären T-Zellen:
Um möglichst viele primäre T-Zellen auf einmal transduzieren zu können, erfolgte die
Transduktion in 24-Loch-Platten. Zudem wurde der Virusüberstand nicht einkonzentriert,
damit kein Verlust entsteht. Die Zielzellen wurden mit je 5x10 5 Zellen in 500 μl
Zellkulturmedium ausgesät und mit je 500 μl Virusüberstand für 90 min bei 1500 rpm und 3234°C zentrifugiert. Am darauffolgenden Tag wurden die Zellen abzentrifugiert und erneut in
je 500 μl Zellkulturmedium und Viruspartikel-enthaltendem Überstand für 60 min bei 1500
rpm und 32-34°C zentrifugiert. Die Überprüfung der Transduktionseffizienz erfolgte 1-2 Tage
nach der Transduktion durch FACS-Messung GFP-positiver Zellen. Je nach Notwendigkeit
wurden die GFP-positiven Zellen mittels FACS von der restlichen Zellpopulation getrennt und
weiterverwendet.
3.3.8. Chemotaxis-Assay
Tabelle 3.11 Chemotaxismedium.
RPMI 1640 (Glutamax)
1% Penicillin/ Streptomycin
1% nicht-essentielle Aminosäuren
0,5% BSA
Der Chemotaxis-Assay ist die Standardmethode für die Untersuchung von Chemokininduzierter Zellmigration. Für den durchgeführten Migrationsassay wurde das sterile 96Transwellsystem von Corning verwendet. Dieses besteht aus einer 96-Loch-Mikrotiterplatte,
einer 96-Loch-Einsatzplatte und einem Deckel. Die Böden der Einsatzplatte bestehen aus einer
zellpermeablen Polycarbonatmembran (3,0 μm Poren), welche 1 h vor dem Versuch auf der
unteren Seite mit jeweils 10 μl Fibronektinlösung beschichtet wurden. Im ersten Schritt des
Experiments wurden die unteren Vertiefungen der Mikrotiterplatte mit 235 μl
Chemotaxismedium befüllt. Danach wurde die Einsatzplatte in die Mikrotiterplatte eingesetzt,
und jeweils 75 μl einer Zellsuspension des Th1-Zellklons IF12 in die Vertiefungen der
Einsatzplatte pipettiert. Die Zellen wurden auf eine Konzentration von 2x10 5 Zellen/75μl in
Chemotaixsmedium eingestellt.
Je nach Versuchsaufbau wurden Chemokine und Chemokinrezeptor-Antagonisten der unteren
bzw. der oberen Kammer zugesetzt. Nach dem vollständigen Befüllen des Einsatzes wurde das
System mit dem Deckel abgeschlossen und für 2 h in den Zellkulturschrank bei 37°C und 5%
CO2 gestellt. Nach der Inkubationszeit wurde die komplette Einheit für 2 min bei 700 U/min
zentrifugiert und der Einsatz aus der unteren Platte vorsichtig entnommen. Für die Färbung
der Zellen wurden die Zellsuspensionen der unteren Platte mit einer Mehrkanalpipette in eine
96er-Mikrotiterplatte (V-Boden) transferiert. Die 96er-Mikrotiterplatten (V-Boden) wurden für
2 min bei 1600 U/min zentrifugiert und der Überstand abgeschüttet. Nach dem Verwerfen des
Überstandes wurden die Zellpellets durch leichtes Anschlagen der Platte an eine Tischkante
39
MATERIAL UND METHODEN
aufgelockert. Die Zellen wurden zweimal mit 175 μl 2mM EDTA in PBS pro Vertiefung
gewaschen und für 2 min bei 1.600 U/min zentrifugiert.
Für die Messung am Durchflusszytometer wurden die aufgelockerten Zellpellets mit je 175 μl
FACS-Fixierpuffer versetzt. Der FACS-Fixierpuffer enthält zudem pro 175 μl 1x104 mit
Carboxyfluorescein-Succinimidyl Ester (CFSE) gefärbte IF12-Zellen, die der Probe als interner
Standard dienen. Die Proben wurden anschließend aus der 96-V-Bottom-Mikrotiterplatte in 5
ml-Röhrchen (BD) pipettiert und bei 4°C bis zur FACS Messung gelagert. Für die Auswertung
wurde zunächst ein Gate 1 in einem Dot Blot für Vorwärts- (FSC) und Seitwärtsstreulicht
(SSC) so gesetzt, so dass alle intakten Zellen - jedoch keine toten Zellen bzw. Zellfragmente von diesem erfasst wurden. Als nächstes wurde ein Gate 2 in einem Histogramm für den
Fluoreszenzkanal 1 so definiert, dass alle CFSE-gefärbten Zellen, aber keine ungefärbten
Zellen in diesem Gate lagen. Die Analyse stoppte automatisch nach dem Erfassen von 2000
Zellen innerhalb von Gate 2.
Die Daten der Messungen wurden als .fsc-Dateien gespeichert und mit dem Analyseprogramm
FlowJo 7.6 ausgewertet. Hierfür wurde die Anzahl der nicht CFSE-gefärbten intakten Zellen
im Verhältnis zum gefärbten Standard bestimmt. Aus den Werten gleicher Proben wurde der
Mittelwert berechnet, und die Mittelwerte aus mehreren Experimenten statistisch ausgewertet
und zur graphischen Darstellung verwendet.
40
MATERIAL UND METHODEN
3.4. Immunologische Methoden
3.4.1. ELISA
ELISA (Enzyme-Linked Immunosorbent Assay) wurde für den Nachweis von CXCL11, CXCL12
und IL-2 im Zellkulturüberstand verwendet. Alle durchgeführten Versuche erfolgen mit den
ELISA-Kits von Raybiotech (Mouse I-TAC ELISA, Mouse SDF-1 alpha ELISA) und R&D (Mouse
CXCL11/I-TAC DuoSet, Mouse CXCL12/SDF-1 DuoSet, Mouse IL-2 DuoSet) nach Angaben des
Herstellers.
3.4.2. Western Blot Analyse
Tabelle 3.12 Lysispuffer.
10 mM Hepes (pH-Wert = 7,9)
10 mM KCL
0,1 mM EDTA
dest. Wasser
Th1-Zellen wurden für 4 min bei 1200 U/min abzentrifugiert, in eiskaltem PBS gewaschen
und die Zellen auf Eis gestellt. Anschließend wurde das Zellpellet in 100-250 μl Lysispuffer
resuspendiert und für 15 min auf Eis inkubiert. Nach Zugabe einer 10%igen NP40-Lösung (6,6
μl/ 100 μl Lysispuffer) wurden die lysierten Zellen bei 13000 g für 15 min zentrifugiert, die
Überstände gesammelt und die Proteinkonzentration nach Herstellerprotokoll mittels BCA
(Bicinchoninsäure; Thermo Scientific, Rockford, USA) bestimmt.
Für jede Probe wurden 10-50 μg Protein mit Laemlipuffer gemischt, auf einem 15 %-igen SDSPolyacrylamidgel (SDS = Natriumdodecylsulfat) elektrophoretisch aufgetrennt (SDS-PAGE)
und auf eine PVDF-Membran (Polyvinylidenfluorid) geblottet. Die Blots wurden mit 2,5%
Milchpulver oder 5% BSA in Tris-buffered saline (TBS)-Tween 20 Puffer geblockt und
sequentiell mit Anti-CXCL11, Anti-CXCL12, Anti-vMIP-II (R&D Systems) oder Anti-ß-Tubulin
(Santa Cruz) über Nacht bei 4 °C inkubiert. Am nächsten Tag wurden die Membranen für 1h
mit Meerrettichperoxidase-konjugiertem Esel Anti-Kaninchen IgG (GE-Healthcare) oder Esel
Anti-Ziege IgG (Santa Cruz) inkubiert, umgehend mit Chemolumineszenzreagenz (ECL kit,
GE-Healthcare) versetzt und fotografische Aufnahmen erstellt. Um die Membranen ein
weiteres Mal verwenden zu können, wurden sie mit stripping-Puffer (GE-Healthcare)
behandelt.
41
MATERIAL UND METHODEN
3.4.3. Durchflusszytometrie
Tabelle 3.13 FACS-Puffer
PBS
1% FCS
0,1% NaN3
+ 1% PFA (FACS-Fixierpuffer)
Die zu färbenden Zellen wurden zweimal mit PBS gewaschen, umgehend mit einem FcRezeptor-Antikörper (Becton Dickinson) für 5 min bei 4 °C inkubiert und danach mit den
folgenden Antikörpern (konjugiert mit Fluorochromen) für 30 min bei 4 °C gefärbt: Ratte
Anti-Maus CXCR3-APC, Ratte Anti-Maus CXCR4-FITC, Ratte IgG2a-APC, Ratte IgG2b-FITC
(R&D Systems), Anti-Maus CD4-PE, Anti-Maus CD8-APC-Cy7. Nach zweifachem Waschen
FACS-Puffer wurden die Zellen mit FACS-Fixierpuffer fixiert. Die Messungen erfolgten an
einem FACS-Canto II Gerät (Becton Dickinson) und die dabei erhaltenen .fsc-Datein wurden
mit dem Programm FlowJo (Tree Star) ausgewertet.
3.5. Statistik
Für die Darstellung der Ergebnisse und die Untersuchung der statistischen Signifikanz der
wurde das Programm GraphPad Prism 5 (GraphPad Software Inc., USA) verwendet. Die
Mittelwerte der Versuche wurden in ± SD dargestellt. Für die Chemotaxis-Assays wurde 2way
ANOVA zur Berechnung der Signifikanzen eingesetzt (*P < 0.05; **P < 0.01 and ***P <
0.001).
42
ERGEBNISSE
4. Ergebnisse
4.1. Klonierung der verwendeten lentiviralen Konstrukte
4.1.1. Chemokinrezeptor-Antagonisten CXCL11(4-79), CXCL12(P2G29) und vMIP-II
In diesem Projekt wurde mit drei verschiedenen Chemokinrezeptor-Antagonisten gearbeitet.
Darunter befinden sich die Muteine CXCL11(4-79) und CXCL12(P2G2), sowie das virale
Protein vMIP-II. Die beiden Muteine besitzen Mutationen innerhalb ihrer N-terminalen
triggering-Domäne, so dass CXCL11(4-79) insbesondere den Rezeptor CXCR3 und
CXCL12(P2G2) den Rezeptor CXCR4 noch binden, jedoch nicht mehr aktivieren kann. Beide
Muteine besitzen zudem CXCR7 als Rezeptor, wobei dessen Bedeutung bei T-Zellen und
chronischen Entzündungen noch unzureichend bekannt ist. CXCL11(4-79) enthält eine
Deletion der ersten drei Aminosäuren, CXCL12(P2G2) besitzt eine Punktmutation, indem die
Aminosäure Prolin an Position zwei gegen Glycin ausgetauscht wurde. Das vom humanen
Herpes Virus Typ 8 (HHV8) stammende vMIP-II besitzt ein breiteres Spektrum an
Angriffszielen. So kann es CXCR3 und CXCR4 als auch CCR1, CCR2, CCR5 und CX 3CR1
blockieren. Zudem besitzt es agonistische Funktion für die Rezeptoren CCR3 und CCR8. Die
Wirksamkeit dieser Antagonisten konnte bereits in unserer Arbeitsgruppe, sowie auch von
anderen Laboren demonstriert werden (Rubant et al. 2006; Kohler et al. 2008). Eine
Übersicht der verwendeten Antagonisten und ihren Rezeptorspezifitäten befindet sich in
Tabelle 4.1.
Die Sequenzen der Antagonisten wurden von „Geneart“ (life technologies) synthetisiert und
die murinen Signalpeptide für das Ausschleusen aus der Zelle am N-Terminus ergänzt. Das
verwendete IL-2-Promoterelement stammt von der Firma „Addgene“ (Plasmid 12194: IL-2
promoter luciferase). Diese Sequenzen sind in Abbildung 4.1 dargestellt und wurden für die
Klonierung der lentiviralen Konstrukte verwendet.
Tabelle 4.1 Übersicht der eingesetzten Chemokinrezeptor-Antagonisten, ihrer Herkunft und
Rezeptorspezifitäten.
Bezeichnung
Herkunft
antagonistische Wirkung
agonistische Wirkung
CXCL11(4-79)
CXCL12(P2G2)
murines CXCL11
murines CXCL12
CXCR3 (CXCR7)
CXCR4 (CXCR7)
-
vMIP-II
HHV8
CXCR3/4, CCR1/2/5, CX3CR1
CCR3/8
43
ERGEBNISSE
A)
CXCL11(4-79) + Signalpeptid:
B)
CXCL12(P2G2) + Signalpeptid:
C)
vMIPII + Signalpeptid:
D)
IL-2-Promoterelement
Abbildung 4.1 Nukleotidsequenzen der verwendeten Chemokinrezeptor-Antagonisten (A) CXCL11(479), (B) CXCL12(P2G2) und (C) vMIP-II mit ihren entsprechenden Signalpeptiden (unterstrichen). (D)
Sequenz
des
eingesetzten
IL-2-Promoterelements,
welches
Bindungsstellen
für
die
Transkriptionsfaktoren NFAT (GGAAAA) und AP-1 (TGTTTCA) enthält.
44
ERGEBNISSE
4.1.2. Klonierung der auf pCDH1-MCS1-EF1-copGFP basierenden Konstrukte
Für die Untersuchungen der Antagonist-Produktion durch T-Zellen wurde das lentivirale
Trägerplasmid pCDH1-MCS1-EF1-copGFP der Firma System Bioscience, dessen Karte und
Bestandteile in Abbildung 3.1 A dargestellt sind, verwendet. Die Sequenzen der
Chemokinrezeptor-Antagonisten CXCL11(4-79), CXCL12(P2G2) und vMIP-II wurden im
Plasmid 11AADO2P_11xxx_12P2G2_vMIP_pMA-RG erhalten und sind in diesem durch
verschiedene Restriktionsschnittstellen voneinander getrennt und konnten daher einzeln
herausgeschnitten werden (Abbildung 3.1 C). Jede Antagonist-Sequenz ist zusätzlich von den
Restriktionsschnittstellen für EcoRI und BamHI flankiert und wurde über diese Schnittstellen
in den Expressionsvektor pCDH1-MCS1-EF1-copGFP ligiert.
Die Sequenz des IL-2-Promoterelements wurde über PCR aus dem Plasmid „IL-2 promoter
luciferase“ (Plasmid 12194) von „Addgene“ mit den Primern MluI_fw und NheI_rv
vervielfältigt. Dieses PCR-Produkt wurde unter Verwendung des TOPO TA Cloning-Kits
(Invitrogen) in den Vektor pCR2.1-TOPO inseriert (IL-2-promoter_CR2.1-Topo). Nach dem
Verdau von pCDH1-MCS1-EF1-copGFP mit ClaI und IL-2-promoter_CR2.1-Topo mit MluI
erfolgte eine Auffüll-Reaktion mit der T4-DNA Polymerase, um ein „glattes Ende“ am DNADoppelstrang zu erhalten. Im Anschluss daran wurden beide Ansätze mit dem Enzym NheI
verdaut und mittels Ligation zusammengefügt.
Im Anschluss an jeden Verdau wurde das DNA-Fragment bzw. der Vektor über ein AgaroseGel aufgereinigt. Jede Ligation erfolgte für 3h bei RT mit einem DNA-Fragment zu VektorVerhältnis von 3:1 oder 5:1 bei 100 ng Vektor-DNA. Nach der Transformation wurden positive
Klone über Kolonie-PCR ermittelt und nach einer Mini-Plasmidpräparation sequenziert. Im
Fall einer korrekten Sequenz wurde das Plasmid über Maxi- Plasmidpräparation vervielfältigt
und nach erneuter Sequenzierung für die Transduktion eingesetzt.
Nach diesen Klonierungsschritten standen Konstrukte für konstitutive (Abbildung 4.2 B) als
auch für induzierbare (Abbildung 4.2 C) Expression der Antagonisten zur Verfügung. Durch
Insertion des IL-2-Promoterelements (IL-2p) soll die Expression der Zielsequenz ausschließlich
nach vorangegangener T-Zellaktivierung erfolgen, wobei die Transkriptionsfaktoren NFAT
und AP-1 an der Promotersequenz binden. Zusätzlich enthalten die Konstrukte das
fluoreszierende Markerprotein copGFP. Dieses ermöglicht anhand Fluoreszenzmikroskopie
oder FASC-Messung eine leichte Identifizierung derjenigen Zellen, welche das Konstrukt
erfolgreich aufgenommen haben.
45
ERGEBNISSE
A)
B)
C)
Abbildung 4.2 Lentivirale Konstrukte des Trägerplasmids pCDH1-MCS1-EF1-copGFP. (A) Ausschnitt
der Sequenz des Ursprungsvektors. (B) Die verschiedenen Chemokinrezeptor-Antagonisten (CRA)
wurden in den Ursprungsvektor eingefügt, (C) sowie bei den induzierbaren Konstrukten der CMVPromoter gegen ein IL-2 Promoterelement (IL-2p) ausgetauscht.
4.1.3. Klonierung weiterer lentiviraler Konstrukte
Als weiterer Ausgangsvektor für Chemokinrezeptor-Antagonist enthaltende Konstrukte diente
pTRIPZ (Abbildung 3.1 B). Dieser enthält ebenfalls ein fluoreszierendes Markergen (tRFP) für
die Überprüfung der Transduktionseffizienz, sowie ein induzierbares Kontrollsystem. Durch
Verwendung eines Tetrazyklin-induzierbaren Promoters (TRE) und des reversen TetrazyklinTransaktivators (rtTA3) können Sequenzen, welche sich stromabwärts des TRE befinden,
ausschließlich nach externer Zugabe von Tetrazyklin abgelesen werden. Dieses Kontrollsystem
ist von Vorteil, da es eine unnötige Expression des Wirkstoffs vermeiden kann. Allerdings ist
dieser Vektor mit 13320bp sehr groß und deshalb oft schwer in Zielzellen zu integrieren.
Abbildung 4.3 veranschaulicht die vorgenommenen Veränderungen an pTRIPZ. Zunächst
wurde die interne ribosomale Eintrittsstelle (IRES) aufgrund ihrer Größe durch ein kleineres
T2A-Peptid ausgetauscht, wodurch ebenfalls die Expression mehrerer Proteine nach einem
Promoter ermöglicht wird. Unter Verwendung des TOPO TA Cloning-Kits wurde die T2ASequenz über die Restriktionsschnittstellen für XcmI und BsiWI eingefügt. Zudem wurde die
shRNA-mir-Region über ClaI und MluI entfernt, da in diesem Fall kein Gen-Silencing
notwendig ist. Um an dieser Stelle die Zielsequenz einfügen zu können, wurde zuerst ein
Polylinker (MCS, multiple cloning site) mit den Schnittstellen für die Restriktionsenzyme
EcoRI, NotI und XhoI inseriert. Im Anschluss daran wurde über einen Zwischenschritt mit dem
46
ERGEBNISSE
Vektor pCR2.1-TOPO (TOPO TA Cloning-Kit) eine zusätzliche IRES zwischen den
Schnittstellen NotI und XhoI eingefügt. Schlussendlich konnten nun die Sequenzen des
jeweiligen Antagonisten über NotI und EcoRI ergänzt werden. Ebenso wie bei den pCDH1MCS1-EF1-copGFP-Konstrukten wurde auch bei pTRIPZ, zusätzlich zu den genannten
Veränderungen, der konstitutive UBC-Promoter gegen das induzierbare IL-2-Promoterelement
(IL-2p) ausgetauscht.
A)
B)
C)
Abbildung 4.3 Lentivirale Konstrukte des Trägerplasmids pTRIPZ. (A) Schematische Darstellung des
relevanten Ausschnitts des Ursprungsvektors. (B) Umklonierung des Ursprungsvektors pTRIPZ. Dabei
wurde die shRNA-mir entfernt und die IRES- durch eine T2A-Sequenz ersetzt. Nach Einfügen einer
zusätzlichen MCS (schwarz hinterlegter Bereich), konnten zudem eine IRES-Sequenz sowie jeweils
einer der Chemokinrezeptor-Antagonisten (CRA) inseriert werden. (C) Für eine induzierbare
Expression wurde der UBC-Promoter durch ein IL-2 Promoterelement (IL-2p) ersetzt.
47
ERGEBNISSE
4.2. Transduktion von T-Zellen mit den generierten Konstrukten
4.2.1. Optimierung der Transduktion von T-Zellen
Da die natürlichen Eigenschaften von T-Zellen, Antigen-spezifisch in das Entzündungsgebiet
einzuwandern sowie sich selbst in Anzahl und Modus (Effektor- oder Gedächtniszelle) zu
regulieren, für diese Zelltherapie ausgenutzt werden sollen, wurde ausschließlich mit T-Zellen
gearbeitet. Insbesondere mit dem murinen Th1-Gedächtniszellklon IF12 wurde gearbeitet. Des
Weiteren fanden zwischenzeitlich auch Untersuchungen mit primären T-Zellen aus der Milz
statt, um einen Unterschied zwischen Zelllinie und primären Zellen möglichst ausschließen zu
können und näher an der in vivo-Situation zu sein. Da T-Zellen, insbesondere primäre TZellen, schwer zu transduzieren sind, wurden weitere Zelllinien als Kontrollen hinzugezogen.
Hierzu zählen die Zelllinien JURKAT, EL-4 und K562, wobei es sich um murine und humane
Krebszelllinien aus T-Zellen oder anderen Blutzellen handelt.
Im Methoden-Abschnitt stehen die Protokolle, welche letztendlich für die Transduktion von
primären T-Zellen und der Linie IF12 verwendet worden. Für primäre T-Zellen bestand die
größte Schwierigkeit darin, die Konstrukte erfolgreich aufzunehmen. Doch auch für die Th1Zelllinie IF12 waren bereits Optimierungsmaßnahmen notwendig, um eine ausreichend hohe
Transduktionseffizienz zu erreichen. Die Zelllinien JURKAT, EL-4 und K562 hatten unter
gleichen Bedingungen stets eine wesentlich höhere Transduktionseffizienz. Sie wurden daher
parallel als Kontrolllinie verwendet, um andere Fehlerquellen bei der Optimierung
ausschließen zu können.
Zunächst wurde vorrangig mit IF12 gearbeitet, da im Falle einer Zelllinie auch mit geringen
Zellmengen gearbeitet und sie bei Erfolg problemlos vermehrt und weiterkultiviert werden
kann. Zu Beginn wurden verschiedene Mengen und Verhältnisse der Vektoren zueinander,
unterschiedliche Transfektionsmethoden für die Virus-produzierenden Zellen sowie
Transduktionsbedingungen für die Zielzellen ausgetestet. Dabei erwies sich ein Verhältnis von
7,5 μg : 3 μg : 10 μg zwischen Verpackungs-, Hüll- und Trägerplasmid pro Platte (Ø 10cm) am
effektivsten. Zudem wurde die Transfektion der HEK293T-Zellen mit Polyethylenimin
gegenüber Kalziumchlorid bevorzugt, da mit dieser Methode die Virusproduktion bei jedem
Durchgang zuverlässiger funktionierte. Die Effizienz der Transfektion lag bei beiden Methoden
in der Regel über 90%. Sobald die Virus-produzierenden HEK293T kein Fluoreszenz-Signal
zeigten, wurde der Durchgang abgebrochen. Um die Konzentration der pseudoviralen Partikel
zu erhöhen, wurde der Zellüberstand mittels Ultrazentrifugation um den Faktor 80
einkonzentriert. Darüber hinaus wurde eine Transduktionseffizienz von bis zu 90% nur im 96Loch-Format mit 2x204 Zellen pro Well mit anschließender Zentrifugation bei 32-34°C und
1500 rpm für 90 min erreicht. Wurden 24-well-Platten oder nicht-einkonzentrierter
Viruspartikel-enthaltender Zellüberstand eingesetzt, war die Effizienz deutlich geringer. Für
einen Teil der Versuche wurden von den transduzierten IF12 zusätzlich mittels FACS die GFPnegativen Zellen aussortiert, um 100% GFP-positive Th1-Zellen zu erhalten.
Für die primären Zellen war dieses Protokoll allerdings ungeeignet, da hier die
Transduktionseffizienz unter 10% lag und zudem die Zellen kaum überlebten. Ein weiterer
Nachteil war die geringe Zellzahl im 96-Loch-Format und das sich primäre Zellen kaum
48
ERGEBNISSE
vermehren und deshalb nur für eine begrenzte Zeit lang für Versuche verwendet werden
können. Somit war es zum einen notwendig die T-Zellen für 24h mit anti-CD3/28
gekoppelten Beads zu stimulieren, wonach die Zellen wesentlich empfänglicher und robuster
waren. Zum anderen wurden 24-Loch-Platten mit 5x105 Zellen pro Well eingesetzt und
Virusüberstand an zwei aufeinanderfolgenden Tagen zugegeben mit anschließender
Zentrifugation. Mit diesem Protokoll wurde eine Effizienz von bis zu 20% erreicht, was sich
als ausreichend erwies, um die Expression der Chemokinrezeptor-Antagonisten nachweisen zu
können.
4.2.2. Transduktion von murinen und humanen Zelllinien
Aufgrund der geringeren Größe wurden fast ausschließlich die auf dem Vektor pCDH1-MCS1EF1-copGFP basierenden Konstrukte für die anschließenden Versuche verwendet. Zum
Nachweis der Transduktionseffizienz wurde der Anteil GFP-positiver Zellen mittels FACSAnalyse gemessen und im Vergleich zu nicht-transduzierten und mit Isotypen-Kontrollen
gefärbten Zellen bestimmt. Die Auswertung und Erstellung der Graphen erfolgte mit dem
Programm „FlowJo“.
Nach der im vorrangegangenen Abschnitt beschriebenen Optimierung der Transduktion von
IF12-Zellen, betrug die Effizienz der konstitutiven pCDH1-MCS1-EF1-copGFP -Konstrukte für
den Leervektor, CXCL11(4-79) und CXCL12(P2G2) jeweils 89% sowie für vMIP-II 67%
(Abbildung 4.4 A, durchgezogene Kurven im Vergleich zu den gepunkteten Kurven). Um für
den Nachweis der Antagonisten bessere Voraussetzungen zu schaffen, wurden die IF12 nach
Transduktion mit den konstitutiven Konstrukten zusätzlich, mit Hilfe von FACS, in GFPpositive und negative Populationen unterteilt. Dadurch bestand nun die Möglichkeit mit 100%
GFP-positiven IF12 zu arbeiten (Abbildung 4.4 A, schwarze gefüllte Kurven). In Tabelle 4.2
sind, zusätzlich zu den bereits genannten Transduktionseffizienzen von IF12, die Werte für die
weiteren mit den konstitutiven pCDH1-MCS1-EF1-copGFP -Konstrukten getesteten Zelllinien
K562 und JURKAT aufgeführt. Im Vergleich zu den K562- und JURKAT-Zellen, weisen IF12Zellen stets eine geringere Transduktionseffizienz auf. So wurden bei der Zelllinie K562 für
alle Konstrukte 100% GFP-positive Zellen ermittelt. Für JURKAT-Zellen lag die Effizienz mit
75-98% etwas geringer, wobei nur das CXCL12(P2G2) enthaltende Konstrukt mit unter 90%
etwas rausfällt. Besonders die Linie K562 zeigte schon bereits ohne Einkonzentrierung der
Viruspartikel eine vergleichbar gute Transduktionseffizienz.
Vergleichbare Werte wurden auch nach der Transduktion der Zelllinen mit den pCDH1-MCS1EF1-copGFP -Konstrukten für induzierbare Expression der Antagonisten gemessen. In
Abbildung 4.4 B sind die Ergebnisse der FACS-Messung für die Linie IF12 graphisch
dargestellt. Dabei sind die Kurven der transduzierten Zellen (durchgezogene Kurven) im
Vergleich zu nicht-transduzierten Zellen (gepunktete Kurven) aufgetragen. Die Effizienz für
den Leervektor beträgt 89%, für CXCL11(4-79) 90%, für CXCL12(P2G2) 96% und für vMIP-II
97%. Für die beiden anderen verwendeten T-Zelllinien, EL-4 und JURKAT, betrug die
Effizienz durchgehend mindestens 96% (Tabelle 4.3)
49
ERGEBNISSE
Die optimierten Transduktionsbedingungen wurden auch für das größere lentivirale
Trägerplasmid pTRIPZ getestet. Dabei wurde auch hier der Anteil RFP-positiver Zellen mittels
FASC-Analyse gemessen. Leider konnten für den Leervektor bei IF12 nur vereinzelte
fluoreszierende Zellen nachgewiesen werden, welche maximal 1% der transduzierten Zellen
betrugen. Auch bei den anderen Zelllinien war die Transduktionseffizienz, im Vergleich zu
den pCDH1-MCS1-EF1-copGFP -Konstrukten, deutlich geringer. Bei der JURKAT-Zelllinie
wurden 25% und bei K562 84% RFP-positive Zellen ermittelt. Daher erfolgten die Versuche
für den Nachweis der Expression der Antagonisten mit den auf pCDH1-MCS1-EF1-copGFP basierenden Konstrukten.
A)
Konstitutive Konstrukte (IF12):
50
ERGEBNISSE
B)
Induzierbare Konstrukte (IF12):
Abbildung 4.4 Transduktion von IF12 mit den pCDH1-MCS1-EF1-copGFP -Konstrukten für (A)
konstitutive und (B) induzierbare CRA-Expression. (A) Analyse der Transduktionseffizienz durch FACSMessung des GFP-Fluoreszenz-Signals vor (nicht-gefüllte Kurve) und nach (gefüllte Kurve) ZellSortierung im Vergleich zur Negativkontrolle (gepunktete Kurve). (B) FACS-Analyse des GFPFluoreszenz-Signals transduzierter Zellen (gefüllte Kurve) im Vergleich zur Negativkontrolle
(gepunktete Kurve).
51
ERGEBNISSE
Tabelle 4.2 Auflistung der Transduktionseffizienz der pCDH1-Konstrukte für konstitutive CRAExpression bei verschiedenen Zelllinien. Die Bestimmung erfolgte mittels FACS-Messung des Anteils
GFP-positiver Zellen
Zelllinie
IF12
K562
JURKAT
Konstrukt
Transduktionseffizienz
Leervektor
89%
CXCL11(4-79)
89%
CXCL12(P2G2)
89%
vMIP-II
67%
Leervektor
CXCL11(4-79)
CXCL12(P2G2)
100%
100%
100%
vMIP-II
100%
Leervektor
98%
CXCL11(4-79)
93%
CXCL12(P2G2)
75%
vMIP-II
96%
Tabelle 4.3 Auflistung der Transduktionseffizienz der pCDH1-Konstrukte für induzierbare CRAExpression bei verschiedenen Zelllinien. Die Bestimmung erfolgte mittels FACS-Messung des Anteils
GFP-positiver Zellen.
Zelllinie
IF12
EL-4
JURKAT
Konstrukt
Transduktionseffizienz
Leervektor
89%
CXCL11(4-79)
90%
CXCL12(P2G2)
96%
vMIP-II
97%
Leervektor
CXCL11(4-79)
CXCL12(P2G2)
98%
96%
99%
vMIP-II
96%
Leervektor
99%
CXCL11(4-79)
98%
CXCL12(P2G2)
99%
vMIP-II
99%
52
ERGEBNISSE
Abbildung 4.5 Transduktion von JURKAT- und K562-Zellen mit dem Leervektor pTRIPZ. Analyse der
Transduktionseffizienz mittels FACS-Messung des RFP-Fluoreszenzsignals transduzierter Zellen
(gefüllte Kurve) im Vergleich zur Negativkontrolle (gepunktete Kurve).
53
ERGEBNISSE
4.2.3. Transduktion von primären T-Zellen
Für einen Vergleich zwischen Zelllinie und primären Zellen innerhalb der T-Zellen, wurden
murine Milzzellen aus weiblichen C57BL/6 Mäusen isoliert. Pro Milz wurden in der Regel
zwischen 8x106 und 12x107 Milzzellen erhalten. Im Anschluss daran wurden CD4+ THelferzellen oder CD8+ zytotoxische T-Zellen (CTLs) mittels negativ-Aufreinigung gewonnen.
Dabei betrug der Anteil CD4+ bzw. CD8+ T-Zellen jeweils etwa 10% des Milzzellpools. Für
eine bessere Aufnahme der Konstrukte wurden die T-Zellen zunächst für 24h mit antiCD3/28-gekoppelten Beads stimuliert und anschließend transduziert.
Für die Transduktion der primären T-Zellen wurden die induzierbaren pCDH1-MCS1-EF1copGFP -Konstrukte eingesetzt. In Abbildung 4.6 ist beispielhaft die Transduktion von CTLs
nach FACS-Messung dargestellt. Ein GFP-Signal des Leervektors als auch des Konstrukts mit
CXCL11(4-79) konnten in 20% der Zellen nachgewiesen werden (gefüllte Kurve). Als
Kontrolle sind hier nicht-transduzierte CTLs mit aufgetragen (gepunktete Linie). Auch für
CD4+ T-Zellen wurden vergleichbare Ergebnisse erzielt. Bei den besten der getesteten
Bedingungen in 24-Loch-Platten überlebten in der Regel etwa 50-75% der Zellen den Stress
während der Transduktion. Im 96-Well-Format konnte zwar eine höhere Effizienz erreicht
werden, doch war hier der Anteil von mehr als 50% toten Zellen zu hoch.
Abbildung 4.6 Transduktion von primären CTLs mit den pCDH1-MCS1-EF1-copGFP -Konstrukten für
induzierbare CRA-Expression. Analyse der Transduktionseffizienz anhand der Messung des Anteils
GFP-positiver Zellen mittels FACS. Die mit Leervektor oder CXCL11(4-79) transduzierten Zellen
(gefüllte Kurve) sind im Vergleich zur Negativkontrolle (gepunktete Kurve) aufgetragen.
54
ERGEBNISSE
4.3. Nachweis der Expression und Sekretion der Chemokinrezeptor-Antagonisten
4.3.1. Expression der Chemokinrezeptor-Antagonisten auf RNA-Ebene
Da die Antagonisten über einen anderen Promoter (CMV-Promoter bzw. IL-2Promoterelement) als der Fluoreszenzmarker GFP (EF1-Promoter) reguliert werden, kann
aufgrund des Nachweises von GFP nicht unmittelbar auf die Expression der Antagonisten
geschlossen werden. Daher ist hier der direkte Nachweis der Produktion von CXCL11(4-79),
CXCL12(P2G2) und vMIP-II unbedingt notwendig.
Für den Nachweis der Transkription wurde RNA isoliert, durch reverse Transkription in cDNA
umgeschrieben und mit Hilfe entsprechender Primer durch PCR vervielfältigt. In Abbildung
4.7 sind die Ergebnisse der Agarose-Gele nach der PCR für sämtliche pCDH1-MCS1-EF1copGFP -Konstrukte dargestellt. Dazu wurden die pCDH1- und GAPDH-Primer aus Tabelle 3.2
eingesetzt. Die Expression der konstitutiven Konstrukte ist für die Zelllinien IF12 sowie K562
(Abbildung 4.7 A) gezeigt, für die induzierbaren Konstrukte sind IF12- und EL-4-Zellen
(Abbildung 4.7 B) dargestellt. Die Länge von CXCL11(4-79) beträgt 312 bp, von
CXCL12(P2G2) 288 bp und von vMIP-II 303 bp. In den Abbildungen kann man gut erkennen,
dass, im Vergleich zum Leervektor, die Antagonist enthaltenden Proben etwa 300 bp größer
sind. Proben von nicht-transduzierten Zellen (-) dienen als Negativ-Kontrollen, wo keine
Banden nachgewiesen werden können. GAPDH, was ebenfalls als Kontrolle eingesetzt wurde,
wird hingegen in allen Proben bei 500 bp detektiert. Dieses Ergebnis lässt auf eine
erfolgreiche Expression der Antagonisten auf RNA-Ebene schließen.
A)
Konstitutive Konstrukte:
55
ERGEBNISSE
B)
Induzierbare Konstrukte:
Abbildung 4.7 Nachweis der CRA-Expression nach Transduktion verschiedener T-Zelllinien mit
pCDH1-MCS1-EF1-copGFP -Konstrukten für (A) konstitutive und (B) induzierbare CRA-Expression auf
RNA-Ebene mittels PCR. Mit den pCDH1-Primern kann gezeigt werden, dass CRA in IF12 (A+B), K562
(A) und EL-4 (B) transkribiert werden (ca. 500 bp), nur der Leervektor (LV) zeigt eine Negativ-Bande
(ca. 200 bp) sowie nicht-transduzierte Zellen (-) keine Bande. Die Kontrolle GAPDH kann in allen
Proben detektiert werden (ca. 500 bp).
56
ERGEBNISSE
4.3.2. Expression der Chemokinrezeptor-Antagonisten auf Proteinebene
pCDH1-Konstrukte für konstitutive Antagonist-Expression:
Für den Nachweis der Expression der Antagonisten auf Proteinebene wurden WB und ELISA
verwendet. Da für das virale Protein vMIP-II leider kein geeigneter Antikörper gefunden
wurde, konnte die Bestätigung der RNA-Daten auf Translationsebene leider nicht erfolgen. Mit
einer Länge von 104 AS für CXCL11(4-79), 96 AS für CXCL12(P2G2) und 101 AS für vMIP-II,
besitzen diese Proteine eine Masse von etwa 8-9 kDa.
CXCL11(4-79) und CXCL12(P2G2) konnten sowohl im Lysat als auch im Zellüberstand der
transduzierten IF12-Zellen nachgewiesen werden. In den jeweils anderen Proben konnte kein
Signal detektiert werden, was dafür spricht, dass die Signale spezifisch für die künstlich
integrieren Muteine sind und CXCL11 bzw. CXCL12 nicht natürlich vorkommen. Als Kontrolle
dienen die jeweiligen murinen rekombinanten Chemokine CXCL11 (10ng) und CXCL12 (1ng)
sowie das Zytoskelett-Protein ß-Tubulin, was nur in den Lysaten detektiert werden kann
(Abbildung 4.8). Diese Ergebnisse zeigen, dass die Muteine sowohl auf Proteinebene
exprimiert, als auch aus der Zelle in den Überstand geschleust werden können. Vergleichbare
WB-Ergebnisse wurden auch für transduzierte K562-Zellen erhalten.
Um die sekretierten Proteine nachweisen zu können, wurden auch ELISA-Messungen
durchgeführt. Dafür wurden je 5x106 Zellen der Linie IF12 für 24h oder 72h in 10ml Medium
inkubiert. Als Medium wurde Vollmedium mit 10% FCS, Medium mit 0,5% BSA anstatt FCS
sowie Medium ohne FCS und BSA verwendet. Das Medium mit 0,5% BSA sollte mit dem
Standardmedium für die Kultivierung von IF12-Zellen verglichen werden, da dieses für den
noch folgenden Chemotaxis-Assay verwendet wird. Die Ergebnisse der ELISA-Messung sind in
Abbildung 4.9 dargestellt. Zunächst ist erkennbar, dass beide Muteine mit der Zeit im
Zellkulturüberstand angereichert werden, da die Konzentration nach 72h höher als nach 24h
ist. Ein deutlicher Unterschied besteht allerdings in der Menge des vorhandenen Antagonisten.
CXCL11(4-79) (Abbildung 4.9 A) wurde in einem Bereich von bis zu 5 nM gemessen, der
Gehalt an CXCL12(P2G2) (Abbildung 4.9 B) allerdings liegt um den Faktor 100 niedriger bei
bis zu 30 pM. Die geeignetste Bedingung für die Anreicherung von CXCL11(4-79) ist
tendenziell das Medium ohne Zusatz, wobei aber keine signifikanten Unterschiede vorhanden
sind. Für CXCL12(P2G2) ist Medium mit dem Zusatz von 0,5% BSA die beste Wahl.
57
ERGEBNISSE
Abbildung 4.8 Nachweis der CRA-Expression und -Sekretion nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für konstitutive CRA-Expression auf Protein-Ebene mittels Western
Blot-Analyse. CXCL11(4-79) und CXCL12(P2G2) können im Zelllysat sowie im Zellüberstand detektiert
werden. Je 2x107 transduzierte, 100% GFP-positive Zellen wurden für 24h in 10ml Serum-freien
Medium für 24h inkubiert und anschließend lysiert. Der Zellüberstand wurde vor Verwendung 8-fach
einkonzentriert. Die mit dem Leervektor (LV) transduzierten Zellen, die murinen rekombinanten (rek.)
Proteine CXCL11 (10ng) und CXCL12 (1ng) sowie die Detektion von ß-Tubulin in allen Lysaten dienen
als Kontrollen.
A)
CXCL11-ELISA
B)
CXCL12-ELISA
Abbildung 4.9 Nachweis der CRA-Expression und -Sekretion nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für konstitutive CRA-Expression auf Protein-Ebene mittels ELISA.
Dabei wurden je 5x106 Zellen der Linie IF12 in 10 ml Medium (10% FCS, 0,5% BSA oder ohne Zusatz)
für 24h oder 72h inkubiert. (A) CXCL11(4-79) und (B) CXCL12(P2G2) reichern sich an, wobei
CXCL11(4-79) in allen Medien eine ähnliche Menge, CXCL12(P2G2) hingegen in Medium mit 0,5%
BSA die höchste Menge aufweist. n=2
58
ERGEBNISSE
pCDH1-Konstrukte für induzierbare Antagonist-Expression:
Auch für den Nachweis der Antagonist-Translation der induzierbaren Konstrukte wurden WBund ELISA-Messungen herangezogen. Vor der Durchführung der Versuche mussten die TZellen aktiviert werden, da die Expression an das IL-2-Promoterelement gebunden ist. Die TZellaktivierung erfolgte durch Stimulierung mit PMA und Ionomycin oder mit anti-CD3 und
anti-CD28. Innerhalb der verwendeten Chemokinrezeptor-Antagonisten wurde hier vorrangig
mit CXCL11(4-79) gearbeitet, da dieser Antagonist bereits bei den konstitutiven Konstrukten
die höchste Expressionsrate zeigte (Abbildung 4.9).
Für die WB-Analyse wurden je 3x106 IF12-Zellen in 2ml Serum-freien Medium für 24h mit
oder ohne PMA/Ionomycin-Stimulierung inkubiert. Wie in Abbildung 4.10 zu erkennen, kann
CXCL11 in keiner der unstimulierten Proben detektiert werden. Nach erfolgter TZellaktivierung durch Zugabe von PMA und Ionomycin, ist eine Bande bei CXCL11(4-79) zu
sehen. In nicht-transduzierten sowie mit Leervektor (LV+IL-2p) oder CXCL12(P2G2)
transduzierten Th1-Zellen ist kein CXCL11 detektierbar. Auch für EL-4-Zellen konnte die
induzierbare Expression von CXCL11(4-79) gezeigt werden.
Mit Hilfe von ELISA-Messungen wurde die Konzentration der Antagonisten in den
Zellüberständen ermittelt. Dabei wurden ebenfalls zunächst je 5x105 nicht-transduzierte, mit
Leervektor und CXCL11(4-79) transduzierte IF12-Zellen, welche für 24h mit oder ohne antiCD3/28 in 220µl Serum-freiem Medium inkubiert wurden, untersucht. Parallel zu CXCL11
wurde hier auch IL-2 gemessen, um die T-Zellaktivierung zu zeigen. In Abbildung 4.11 A sind
die Ergebnisse der ELISA-Messungen nach 24h dargestellt. IL-2 wird ausschließlich nach antiCD3/28-Stimulierung exprimiert und CXCL11 nur in mit CXCL11(4-79) transduzierten Zellen
sowie ebenfalls nur nach T-Zellaktivierung. Zudem wurde die Stimulierung mit PMA und
Ionomycin mit anti-CD3/28 verglichen. Da nach anti-CD3/28-Zugabe eine höhere
Konzentration an CXCL11(4-79) gemessen werden konnte, wurde im weiteren Verlauf nur
noch diese Stimulierung für die T-Zellaktivierung eingesetzt.
In weiteren Versuchen wurde die Anreicherung im Zellüberstand nach 4-, 24-, 48- und 72stündiger Stimulierung mit anti-CD3/28 untersucht. Mit zunehmender Dauer steigt die
CXCL11-Menge im Zellüberstand an, was die Anreicherung von CXCL11(4-79) bestätigt. Die
Menge an IL-2 hingegen steigt bis 24h und stagniert dann bis zu 72h (Abbildung 4.11 B).
Auch für CXCL12(P2G2) fanden vergleichbare ELISA-Messungen statt. CXCL12(P2G2) wird
im Zellüberstand angereichert, wobei die Menge wiederum etwa 100-fach geringer ist im
Vergleich zu CXCL11(4-79).
Um die Funktionalität der induzierbaren Konstrukte auch bei primären T-Zellen zu zeigen,
wurde der CXCL11-Gehalt des Zellüberstands von transduzierten (Leervektor und CXCL11(479)) murinen CLTs aus der Milz gemessen. CXCL11 wurde nach 72h bestimmt und konnte nur
in den Zellen detektiert werden, welche den Antagonisten enthalten (Abbildung 4.11 C). Die
Konzentration an produziertem CXCL11(4-79) ist mit ca. 900 pg/ml in etwa vergleichbar mit
den Ergebnissen der T-Zelllinie IF12 (Abbildung 4.11 B).
59
ERGEBNISSE
Abbildung 4.10 Nachweis der CXCL11(4-79)-Expression nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für induzierbare CRA-Expression auf Protein-Ebene mittels Western
Blot-Analyse. CXCL11(4-79) kann nur nach T-Zellaktivierung mit PMA/ Ionomycin-Stimulierung
detektiert werden. Je 3x106 transduzierte Th1-Zellen wurden in 2ml Serum-freien Medium
±PMA/Ionomycin-Stimulierung für 24h inkubiert und anschließend lysiert. Die mit Leervektor (LV),
Leervektor mit IL-2-Promoterelement (LV + IL-2p) und CXCL12(P2G2) transduzieren Zellen dienen als
Negativkontrollen. Die Detektion von ß-Tubulin dient ebenfalls als Kontrolle.
A)
IF12:
CXCL11-ELISA
IL2-ELISA
60
ERGEBNISSE
B)
C)
IF12:
CXCL11-ELISA
IL2-ELISA
prim. CTLs:
CXCL11-ELISA
Abbildung 4.11 Nachweis der CRA-Expression und -Sekretion von T-Zellen nach Transduktion mit
pCDH1-MCS1-EF1-copGFP -Konstrukten für induzierbare CRA-Expression auf Protein-Ebene mittels
ELISA. Je 5x105 Zellen wurden für 4-72h in 220µl Serum-freien Medium ±anti-CD3/28 inkubiert. (A)
IF12-Zellen wurden für 24h ± antiCD3/28 inkubiert. Nur nach Stimulierung kann CXCL11(4-79)
detektiert werden. (B) IF12-Zellen wurden für 4h, 24h, 48h und 72h mit antiCD3/28 inkubiert.
CXCL11(4-79) wird mit der Zeit im Zellüberstand angereichert und kann ausschließlich in Zellen,
welche den Antagonist exprimieren, detektiert werden. (A+B) Die Expression von IL-2 zeigt die TZellaktivierung nach antiCD3/28-Stimulierung. (C) Je 5x105 primäre CD8+ T-Zellen wurden für 72h
in 220µl Serum-freien Medium ± anti-CD3/28 inkubiert. Nur in Zellen, welche den Antagonist
exprimieren, kann CXCL11(4-79) detektiert werden. n=2
61
ERGEBNISSE
4.4. Untersuchung der Effizienz der von T-Zellen produzierten Chemokinrezeptor-Agonisten
in vitro mittels Chemotaxis-Assay
4.4.1. Expression von CXCR3, CXCR4 und CXCR7 auf murinen Th1-Zellen
Im Anschluss an den Nachweis der Expression und Sekretion folgt in diesem Abschnitt der
Nachweis der Funktionalität der Antagonisten, insbesondere CXCL11(4-79). Zunächst wurde
jedoch die Expression von CXCR3, CXCR4 und CXCR7 auf der Zelloberfläche von
transduzierten und nicht-transduzierten IF12-Zellen unter verschiedenen Bedingungen näher
betrachtet. Die transduzierten T-Zellen enthalten stets die konstitutiven pCDH1-MCS1-EF1copGFP -Konstrukte. Für die durchgeführten Versuche wurden die Zellen mit Fluoreszenzgekoppelten Antikörpern gefärbt und der Anteil CXCR3-, CXCR4- und CXCR7-positiver Zellen
mit Hilfe von FACS-Messungen ermittelt.
In Abbildung 4.12 ist der CXCR3-Gehalt von nicht-transduzierten sowie mit Leervektor,
CXCL11(4-79) oder CXCL12(P2G2) transduzierten Zellen dargestellt. Die Gesamtheit der
Kontrollzellen (Abbildung 4.12 A, schwarze Kurve) als auch der Leervektor- (Abbildung 4.12
B, schwarze Kurve) und CXCL12(P2G2)- (Abbildung 4.12 D, schwarze Kurve) enthaltenden
IF12-Zellen besitzen CXCR3 auf ihrer Zelloberfläche. Nur die mit CXCL11(4-79)
transduzierten Zellen enthalten mit 66% einen geringeren Anteil von CXCR3-positiven Zellen
(Abbildung 4.12 C, schwarze Kurve). Zusätzlich wurden die Zellen für 60 min mit den
Chemokinen CXCL11 oder CXCL12 stimuliert. Im Vergleich zu den unstimulierten Zellen
(schwarze Kurven) ist nach CXCL12-Stimulierung kein Unterschied zu erkennen (graue
Kurven). Nach Stimulierung mit dem CXCR3-Liganden CXCL11 (gefüllte Kurven) hingegen
besitzt ein geringerer Anteil der Zellen CXCR3 auf der Zelloberfläche. Bei nicht-transduzierten
und CXCL12(P2G2) exprimierenden Zellen (Abbildung 4.12 A, D) enthalten noch 86-87% der
Zellen CXCR3 auf der Zelloberfläche. Dabei ist auch die Stärke des Fluoreszenzsignals deutlich
geringer (X-Achse), was eine generelle Verringerung der Anzahl von CXCR3-Rezeptoren auf
allen Zellen anzeigt. Bei mit Leervektor und CXCL11(4-79) transduzierten Zellen beträgt der
Anteil CXCR3-positiver Zellen nach CXCL11-Stimulierung nur noch 38% bzw. 52%. Auch hier
ist eine Linksverschiebung der gesamten Kurve zu beobachten.
Des Weiteren wurden nicht-transduzierte, mit Leervektor oder mit CXCL11(4-79)
transduzierte IF12-Zellen vor der FACS-Färbung für 24h oder 48h mit anti-CD3/28 stimuliert.
In Abbildung 4.13 ist zu erkennen, dass nach 24 Stunden (schwarze Kurven) annähernd 100%
der Zellen CXCR3-positiv sind und kein Unterschied zwischen unstimulierten (gestrichelte
Linien) und mit anti-CD3/28 stimulierten (durchgehende Linie) Zellen zu erkennen ist. Nach
48h (graue Kurven) hingegen sind, besonders bei den stimulierten Zellen, weniger CXCR3positive Zellen vorhanden. Von den nicht-transduzierten Zellen enthalten nur noch 14%, von
den mit Leervektor-transduzierten und CXCL11(4-79) exprimierenden Zellen noch 15% der
Th1-Zellen den Rezeptor CXCR3 auf ihrer Oberfläche. Zwischen der Kontrolle (Abbildung
4.13 A), den Leervektor- (Abbildung 4.13 B) und CXCL11(4-79)- (Abbildung 4.13 C)
enthaltenden Zellen sind kaum Unterschiede erkennbar.
Neben CXCR3 wurden IF12-Zellen nach Stimulierung mit anti-CD3/28 nun zusätzlich auch
für CXCR4 und CXCR7 gefärbt. Dabei wurden ausschließlich nicht-transduzierte Zellen
62
ERGEBNISSE
eingesetzt, da in Abbildung 4.12 kein Einfluss der Konstrukte zu erkennen war. Wie bereits
gezeigt, besitzen nach Stimulierung mit anti-CD3/28 weniger Zellen CXCR3 auf ihrer
Zelloberfläche (Abbildung 4.14 A). Nach 24h sind noch 94% (schwarze Kurve) und nach 48h
noch 78% (graue Kurve) der Zellen CXCR3-positiv. Zudem ist das Fluoreszenz-Signal
schwächer, was zeigt, dass auch insgesamt weniger CXCR3-Rezeptoren pro Zelle auf der
Oberfläche vorhanden sind. Abbildung 4.14 B zeigt das Ergebnis der CXCR4-Färbung. In
unstimulierten IF12-Zellen kann CXCR4 auf der Zelloberfläche nicht detektiert werden, nach
24h und 48h ist ein geringer Anteil von 2-3% der Zellen CXCR4-positiv. Am Kurvenverlauf ist
zu sehen, dass sich die Kurve nach 24-stündiger Stimulierung mit anti-CD3/28 (schwarze
Kurve) etwas nach rechts verlagert. Nach 48-stündiger Stimulierung (graue Kurve) ist der
Kurvenverlauf mit den unstimulierten Zellen (gepunktete Kurve) vergleichbar. Das Ergebnis
der FACS-Färbung für CXCR7 zeigt kaum Unterschiede zwischen den verschiedenen
Bedingungen (Abbildung 4.14 C). Nach 24h und 48h enthält ein geringer Anteil von etwa 7%
der Zellen CXCR7 auf der Zelloberfläche. Der Kurvenverlauf der unstimulierten Probe gleicht
dem der Isotypen-Kontrolle.
Hinsichtlich der im folgenden Abschnitt vorhandenen Experimente zum Nachweis der
biologischen Aktivität der von den T-Zellen produzierten Antagonisten wurden IF12-Zellen im
Überstand von transduzierten Zellen inkubiert. Dies erfolgte für 4h in Zellüberstand von mit
Leervektor- oder CXCL11(4-79)-transduzierten IF12-Zellen. Der verwendete Zellüberstand
wurde nach 48-stündiger Inkubation von je 15x106 transduzierten Zellen in 15ml Th1Medium mit 0,5% BSA gesammelt und eingesetzt. In Abbildung 4.15 ist zu erkennen, dass
nach 4-stündiger Inkubation im Überstand der Leervektor-enthaltenden Zellen noch 99% der
Zellen CXCR3 exprimieren (schwarze Kurve). Allerdings besitzen nur noch 44% der in
CXCL11(4-79)-Überstand inkubierten Zellen CXCR3 auf ihrer Oberfläche (graue Kurve). Auch
die Anzahl der Rezeptoren pro Zelle ist verringert (Linksverschiebung der Kurve).
63
ERGEBNISSE
A)
B)
C)
D)
Abbildung 4.12 FACS-Färbung und -Messung von CXCR3 auf transduzierten IF12. (A) Nichttransduzierte sowie mit (B) Leervektor, (C) CXCL11(4-79) oder (D) CXCL12(P2G2) transduzierte Th1Zellen wurden mit CXCR3-APC gefärbt, entweder ohne Stimulierung (schwarze Kurven), nach 60 min
CXCL9 (gefüllte Kurven) oder 60 min CXCL12 (graue Kurven). Die entsprechende Isotypen-Kontrolle
ist jeweils als grau gepunktete Kurve markiert.
64
ERGEBNISSE
A)
B)
C)
Abbildung 4.13 FACS-Färbung und -Messung von CXCR3 bei transduzierten IF12 nach TZellaktivierung. (A) Nicht-transduzierte, (B) mit Leervektor oder (C) CXCL11(4-79) transduzierte Th1Zellen wurden mit CXCR3-APC gefärbt, entweder ohne Stimulierung (gestrichelte Linien) oder nach
24- (schwarze Kurven) oder 48-stündiger (graue Kurven) anti-CD3/28-Stimulierung (durchgezogene
Linien). Die entsprechende Isotypen-Kontrolle ist jeweils als grau gepunktete Kurve dargestellt.
65
ERGEBNISSE
A)
B)
C)
Abbildung 4.14 FACS-Färbung und -Messung von CXCR3, CXCR4 und CXCR7 bei IF12-Zellen. Th1Zellen wurden mit (A) CXCR3-APC, (B) CXCR4-FITC oder (C) CXCR7-PE gefärbt, entweder ohne
Stimulierung (gepunktete Kurven), nach 24- (schwarze Kurven) oder 48- (graue Kurven) stündiger
anti-CD3/28-Stimulierung. Die Färbung mit der jeweiligen Isotypen-Kontrolle (gefüllte gestrichelte
Kurve) ist ebenfalls zum Vergleich dargestellt.
66
ERGEBNISSE
Abbildung 4.15 FACS-Färbung und -Messung von CXCR3 bei IF12-Zellen nach Stimulierung mit
Zellüberstand ± CRA11. Th1-Zellen wurden mit dem Zellüberstand transduzierter Zellen für 4h
stimuliert. Nach Stimulierung mit Zellüberstand von Zellen, welche mit dem Leervektor (LV)
transduziert wurden, besitzen 99% der Zellen CXCR3 auf der Zelloberfläche (schwarze Kurve). Enthält
der Zellüberstand CXCL11(4-79) (graue Kurve), sind nur noch 44% der Zellen positiv für CXCR3. Als
Kontrolle ist die Färbung mit der Isotypen-Kontrolle gezeigt (gepunktete Kurve).
67
ERGEBNISSE
4.4.2. EC50-Werte der CXCL9/10/11/12 vermittelten Th1-Zellmigration im Chemotaxis-Assay
Beim Chemotaxis-Assay wird die durch ein spezifisches Chemokin induzierte Zellmigration
untersucht. In dem verwendeten Transwell-System werden IF12-Zellen in das obere, und das
Signalprotein in das untere Well gegeben und nach 2h die Anzahl der entlang des Gradienten
ins untere Well migrierenden Zellen ermittelt.
Für die für diese Arbeit interessantesten Chemokine CXCL9, CXCL10, CXCL11 und CXCL12
wurden zunächst die EC50-Werte ermittelt. EC50 beschreibt die mittlere effektive ChemokinKonzentration, bei welcher 50% der maximal möglichen Zellzahl transmigriert. Die
eingesetzten Konzentrationen reichen von 0,78 nM; 3 nM; 13 nM; 12,5 nM; 25 nM; 50 nM;
100 nM bis 200 nM. In Abbildung 4.16 sind diese Konzentrationen logarithmisch gegen die
Anzahl der migrierten Zellen aufgetragen. Dabei ist bei allen getesteten Chemokinen der
typische „S“-förmige Verlauf einer Dosis-Wirkung-Kurve erkennbar. Innerhalb der einzelnen
EC50-Werte existieren Unterschiede bis zu einen Faktor von 10. Mit 5,65 nM besitzt der
CXCR4-Ligand CXCL12 den geringsten Wert, was bedeutet, dass von diesem Chemokin die
geringste Konzentration für eine 50%ige Wirkung notwendig ist. Von den CXCR3-Liganden
besitzt CXCL10 mit 8,66 nM den geringsten und CXCL11 mit 54,37 nM den höchsten Wert.
Mit einer Konzentration von 21,8 nM liegt CXCL9 in der Mitte (Tabelle 4.4). In den folgenden
Versuchen wurden Chemokinkonzentrationen von 5-10 nM eingesetzt.
Zusätzlich zu den EC50-Werten sind auch die entsprechenden Determinationskoeffizienten
(R2) angegeben. Der Determinationskoeffizient dient der Statistik und gibt die Varianz der
untersuchten Variable an, in diesem Fall der Chemokin-Konzentration. Der Wert liegt immer
zwischen „0“ und „1“, wobei durch „1“ ein perfekter linearer Zusammenhang angegeben wird.
Die Determinationskoeffizienten betragen 0,84 für CXCL9; 0,85 für CXCL10 und 0,82 für
CXCL11 bei den CXCR3-Liganden. CXCL12 besitzt mit 0,65 einen geringeren Wert (Tabelle
4.4).
68
ERGEBNISSE
Abbildung 4.16 Chemotaxis-Assay zur Bestimmung der EC-50 Werte der CXCL9-, CXCL10-, CXCL11und CXCL12- induzierten IF12-Zellmigration. Dafür wurden je 2x105 Zellen mit ChemokinKonzentrationen von 0,78 nM; 3 nM; 13 nM; 12,5 nM; 25 nM; 50 nM; 100 nM und 200 nM für 2h in
einer Transwell-Platte inkubiert und im Anschluss die Anzahl migrierter Zellen bestimmt. Die
Kurvenverläufe zeigen die Anzahl migrierter Zellen bei steigender Chemokin-Konzentration.
Tabelle 4.4 EC50-Werte und Determinationskoeffizienten der CXCL9-, CXCL10-, CXCL11- und
CXCL12-induzierten Migration von IF12-Zellen.
Chemokin:
CXCL9
CXCL10
CXCL11
CXCL12
EC50-Wert [nM]:
21,80
8,66
54,37
5,65
0,8416
0,8516
0,8217
0,6530
2
R:
69
ERGEBNISSE
4.4.3. Untersuchung der Wirkung der produzierten Chemokinrezeptor-Antagonisten auf die
Zellmigration im Chemotaxis-Assay
Um die biologische Wirksamkeit der von den T-Zellen produzierten Antagonisten zu
untersuchen, wurden die mit den konstitutiven Konstrukten transduzierten IF12-Zellen für 2448h in 0,5% BSA-haltigem Medium inkubiert. Danach wurde der Zellüberstand inklusive der
sekretierten Antagonisten in den Chemotaxis-Assay eingesetzt.
In den ersten Versuchen wurde der Zellüberstand der transduzierten Zellen nach 24h
gesammelt. Parallel wurden die in den Assay einzusetzenden IF12-Zellen ebenfalls für ca. 20h
in BSA-haltigem Medium inkubiert. Anschließend wurden diese Zellen für 2h in der
Transwell-Platte im gesammelten Zellüberstand im Brutschrank stehen gelassen (Abbildung
4.17 A). In dieser Zeit konnten die Zellen in die unteren Wells, welche Chemokin-haltiges
Medium enthalten, transmigrieren. Eine Übersicht über die im oberen und unteren Well
eingesetzten Komponenten befindet sich in Abbildung 4.17 B. Die Anzahl der migrierten
Zellen wurden ausgewertet und in Abbildung 4.17 C graphisch dargestellt. Als Chemokine
wurden der CXCR3-Ligand CXCL9, der CXCR4-Ligand CXCL12 und für vMIP-II zusätzlich der
CCR1/3/5-Ligand CCL5 in einer Konzentration von 5nM eingesetzt. Als Kontrollen ohne
Antagonist wurden im oberen Well Medium (schwarze Säulen) und Zellüberstand von mit
Leervektor-transduzierten Zellen (weiße Säulen) verwendet. Als Kontrolle im unteren Well
dient Medium ohne Chemokin. Die verschiedenen Zellüberstände sind in unterschiedlichen
Mustern dargestellt. Ohne die Zugabe eines Signalproteins im unteren Well ist in allen Proben
nur eine sehr geringe Anzahl migrierter Zellen vorhanden. Dabei ist aber zu erkennen, dass
die Inkubation mit Zellüberstand eine erhöhte Zellmigration im Vergleich zum Medium
aufweist. Durch Einsatz der Chemokine wird die Zellmigration deutlich verstärkt. Dabei ist die
durch CXCL12 induzierte Migration am stärksten und die durch CCL5 induzierte Migration am
schwächsten ausgeprägt. Die CXCL9-induzierte Migration ist durch CXCL11(4-79) und vMIPII, die CXCL12-induzierte Migration durch sämtliche Antagonisten und die CCL5-induzierte
Migration durch CXCL11(4-79) leicht verringert (Abbildung 4.17 C).
A)
70
ERGEBNISSE
B)
C)
Abbildung 4.17 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung der CRA. Dafür wurden je
2x105 IF12 mit 5 nM CXCL9 oder CXCL12 in Kombination mit CRA-enthaltenden Zellüberstand (24h)
für 2h in einer Transwell-Platte inkubiert und im Anschluss die Anzahl migrierter Zellen bestimmt.
(A)+(B) Schematische Darstellung des Assay-Ablaufs und der im oberen und unteren Well
eingesetzten Komponenten. (C) Auswertung der Anzahl migrierter Zellen bei den verschiedenen
Versuchsbedingungen. n=1
71
ERGEBNISSE
Da der gewünschte Effekt nicht deutlich zu erkennen war, wurde das Protokoll für weitere
Versuche abgeändert. Zum einen wurde der Zellüberstand der transduzierten Zellen nun erst
nach 48h gesammelt. Zum anderen wurden die in den Assay einzusetzenden IF12-Zellen nach
den 20h in BSA-haltigem Medium für 4h im Zellüberstand der transduzierten Zellen inkubiert,
bevor sie schließlich in die Transwellplatte gegeben wurden (Abbildung 4.18 A). Eine weitere
Erneuerung ist, dass der CXCL11(4-79)-haltige Zellüberstand sowohl ins untere als auch obere
Well gegeben wurde. Bei diesen Durchgängen wurde ausschließlich mit CXCL11(4-79)
gearbeitet, weshalb die CXCR3-Liganden mit den geringeren EC50-Werten CXCL9, CXCL10
und als Kontrolle der CCR2/11-Ligand CCL2 als Signalstoffe eingesetzt wurden (Abbildung
4.18 B). Von den Chemokinen wurden Konzentrationen von 10 nM eingesetzt. In Abbildung
4.18 C ist zu sehen, dass nur sehr geringe Effekte von CXCL11(4-79) zu erkennen sind. Bei
CXCL10-induzierter Zellmigration ist eine leichte Reduktion zwischen in CXCL11(4-79)haltigen Zellüberstand (gestreifte Säulen) zu in Leervektor-Überstand (weiße Säulen) vorinkubierten IF12-Zellen zu erkennen.
Um die bereits beobachteten Effekte des Antagonisten deutlicher hervorzuheben, wurden die
transduzierten Zellen während der Inkubation in Serum-freiem Medium nun noch zusätzlich
mit anti-CD3/28 stimuliert. Im Anschluss daran erfolgte, wie bereits zuvor, die Vorinkubation
der IF12-Zellen im Zellüberstand der transduzierten Zellen (Abbildung 4.19 A). Auffällig an
der Auswertung der migrierten Zellen in Abbildung 4.19 B ist zunächst die deutlich geringere
Anzahl migrierter Zellen im Vergleich zu Abbildung 4.19 C. Dies trifft besonders auf die Zellen
zu, welche zuvor in dem Zellüberstand der transduzierten Zellen vor-inkubiert wurden (weiße
und gestreifte Säulen). Da innerhalb der Proben, bei welchen der Antagonist nur im unteren
Well zugegeben wurde (schwarze Säulen) kein Migrations-hemmender Effekt von CXCL11(479) zu sehen ist, wurden die restlichen Ergebnisse für eine bessere Übersicht nochmals in
Abbildung 4.19 C dargestellt. Die CXCL10-induzierte Zellmigration konnte durch VorInkubation mit CXCL11(4-79) signifikant reduziert werden. Die CXCL9- und CCL2-abhängige
Migration hingegen wurde zwar teilweise leicht, aber nicht signifikant, gehemmt. Ein
repräsentativer Ausschnitt dieser Abbildung wird nochmals getrennt in Abbildung 4.19 D
gezeigt. Hier ist die Bedeutung der Vor-Inkubation deutlich zu erkennen, weil sich hier im
unteren Well ausschließlich Medium mit CXCL9, CXCL10 oder CCL2 befindet. Der Antagonist
CXCL11(4-79) war nur im oberen Well mit den Zellen, welche 4h zuvor in den Zellüberstand
überführt wurden, vorhanden.
72
ERGEBNISSE
A)
B)
C)
Abbildung 4.18 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung des CRA CXCL11(4-79).
Dafür wurden IF12 zunächst in Medium (schwarz), Leervektor-Überstand (weiß) oder CRAenthaltenden Zellüberstand (grau gestreift) für 4h inkubiert. Der eingesetzte Zellüberstand stammt
73
ERGEBNISSE
von transduzierten IF12 (Leervektor (LV), CXCL11(4-79)) und wurde nach 48-stündiger
Inkubationszeit gewonnen. Im Anschluss wurden je 2x105 IF12 mit 10 nM CXCL9, CXCL10 oder CCL2
für 2h in einer Transwell-Platte inkubiert und im Anschluss die Anzahl migrierter Zellen bestimmt.
(A+B) Schematische Darstellung des Assay-Ablaufs und der im oberen und unteren Well eingesetzten
Komponenten. (C) Auswertung der Anzahl migrierter Zellen bei den verschiedenen
Versuchsbedingungen. n=2
A)
B)
74
ERGEBNISSE
C)
D)
75
ERGEBNISSE
Abbildung 4.19 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung des CRA CXCL11(4-79) nach
zusätzlicher Stimulierung mit anti-CD3/28. Dafür wurden IF12 zunächst in Medium (schwarz),
Leervektor-Überstand (weiß) oder CRA-enthaltenden Zellüberstand (grau gestreift) für 4h inkubiert.
Der eingesetzte Zellüberstand stammt von transduzierten IF12 (Leervektor (LV), CXCL11(4-79)) und
wurde nach 48-stündiger Inkubationszeit mit gleichzeitiger anti-CD3/28-Stimulierung gewonnen. Im
Anschluss wurden je 2x105 IF12 mit 10 nM CXCL9, CXCL10 oder CCL2 für 2h in einer Transwell-Platte
inkubiert und im Anschluss die Anzahl migrierter Zellen bestimmt. (A) Schematische Darstellung des
Assay-Ablaufs. (B)-(D) Auswertung der Anzahl migrierter Zellen bei den verschiedenen
Versuchsbedingungen, wobei die Ergebnisse der nur im Zellüberstand inkubierten IF12 in (C) sowie
der nur im oberen Well stimulierten IF12 in (D) nochmals herausgehoben wurden. n=4
76
ERGEBNISSE
4.4.4. Die differentielle Wirkung von vMIP-II auf die durch CCL2/4/5 sowie CXCL9/10/11/12
vermittelte Th1-Migration
Um die Wirksamkeit von vMIP-II zu überprüfen, wurde zusätzlich zu den vMIP-IIenthaltenden Zellüberständen als Kontrolle auch rekombinantes vMIP-II eingesetzt. In
Abbildung 4.20 A ist das Ergebnis dieses Assay dargestellt. Die Zellen, welche in den
Zellüberständen mit den produzierten Antagonisten inkubiert wurden, zeigen keine
verringerte Zellmigration, weder bei CXCL9, CXCL12 oder CCL5 (schwarze Säulen). Das
rekombinante Protein reduziert nur mäßig die CXCL12-induzierte Zellmigration, jedoch
deutlich die CCL5-induzierte Migration (gemusterte Säulen). Überraschenderweise besitzt
rekombinantes vMIP-II eine verstärkende Wirkung bei der CXCL9-induzierten Zellmigration.
Aufgrund dieses unerwarteten Ergebnisses wurde die Wirkung von vMIP-II auch auf die von
anderen Chemokinen induzierte Zellmigration untersucht. Getestet wurden CCL2, CCL4 und
CCL5 sowie alle CXCR3-Liganden (CXCL9, CXCL10 und CXCL11) und CXCL12. Abbildung
4.20 B zeigt, dass vMIP-II bei CCL2, CCL4, CCL5 als auch CXCL10 und CXCL12 die Migration
der IF12-Zellen hemmt. Allerdings ist bei CXCL9 und CXCL11 eine deutliche Erhöhung in der
Anzahl migrierter Zellen zu sehen. Für eine bessere Übersicht sind die Rezeptorspezifitäten
unter den jeweiligen Chemokinen mit aufgelistet.
A)
77
ERGEBNISSE
B)
Abbildung 4.20 Chemotaxis-Assays zur Bestimmung der in vitro-Wirkung von vMIP-II. (A) Dafür
wurden je 2x105 IF12 mit 10nM CXCL9, CXCL12 oder CCL5 in Kombination mit 100nM
rekombinanten (rek.) vMIP-II oder vMIP-II-enthaltenden Zellüberstand für 2h in einer Transwell-Platte
inkubiert und im Anschluss die Anzahl migrierter Zellen bestimmt. Ansätze mit Medium und
Zellüberstand von Zellen, welche mit dem Leervektor (LV) transduziert wurden, dienen als Kontrollen.
(B) Es wurden je 2x105 IF12 mit 10 nM CCL2, CCL4, CCL5, CXCL9, CXCL10, CXCL11 oder CXCL12 in
Kombination mit 100nM rekombinanten vMIP-II für 2h in einer Transwell-Platte inkubiert und im
Anschluss die Anzahl migrierter Zellen bestimmt. n=1
78
DISKUSSION
5. Diskussion
5.1. Klonierung
geeigneter lentiviraler Konstrukte
Chemokinrezeptor-Antagonisten in T-Zellen
für
die
Integration
der
Da eine einfache Transfektion für die Aufnahme von Plasmiden bei T-Zellen nicht
aussichtsreich ist, wurde für die Generierung der Chemokinrezeptor-Antagonist
produzierenden T-Zellen auf lentivirale Transduktion zurückgegriffen. Von Vorteil ist dabei,
neben einer höheren Effizienz, auch eine stabile Integration ins Genom aufgrund der
pseudoviralen Partikel. In den letzten Jahren wurde gerade die lentivirale Transduktion
wegen der Möglichkeit, sowohl sich teilende als auch nicht-teilungsfähige Zellen zu
transduzieren und auch große Sequenzen dauerhaft stabil in Zielzellen zu integrieren, immer
öfter in der Grundlagenforschung sowie auch bereits bei klinischen Studien eingesetzt. Dabei
liegt der Fokus auf HIV-basierten Vektoren, welche auch in dieser Arbeit eingesetzt wurden
(Picanco-Castro et al. 2012).
Für die Klonierung wurden die lentiviralen Trägerplasmide pCDH1-MCS1-EF1-copGFP
(Abbildung 3.1 A) und pTRIPZ (Abbildung 3.1 B) verwendet. Beide Plasmide enthalten
Fluoreszenz-Marker,
was
eine
einfache
Ermittlung
der
Transfektionsund
Transduktionseffizienz der Zellen sowie die Isolierung der GFP- bzw. RFP-positiven
Zellpopulation ermöglicht. Der Vorteil von pCDH1-MCS1-EF1-copGFP liegt mit 7544 bp, im
Vergleich zu pTRIPZ mit 13320 bp, in der wesentlich geringeren Größe. Je größer das
Plasmid, desto schwieriger ist die Zellaufnahme und Integration ins Genom. Hingegen liefert
pTRIPZ mit seinem Tetrazyklin-induzierbaren Promoter und reversen TetrazyklinTransaktivator die Möglichkeit einer kontrollierten Wirkstoffproduktion. Nur nach externer
Zugabe von Tetrazyklin wird der Wirkstoff, in diesem Fall ein Chemokinrezeptor-Antagonist,
von der Zelle gebildet und kann nur bei Bedarf wirken.
Da der Größenunterschied eine zu große Auswirkung auf die Transduktionseffizienz besitzt,
wurde für pCDH1-MCS1-EF1-copGFP ebenfalls nach einem Mechanismus für eine
induzierbare Expression gesucht und schließlich der CMV-Promoter gegen ein IL-2Promoterelement ausgetauscht (Abbildung 4.2 C). Diese Sequenz ermöglicht eine Expression
des Antagonisten, welche an den Funktionsstatus der T-Zelle gekoppelt ist. Befindet sich die
Zelle im Ruhezustand, wird der Wirkstoff nicht gebildet. Sobald die T-Zelle aktiviert ist,
werden die Transkriptionsfaktoren NFAT und AP-1 gebildet, binden an entsprechende
Bindungsstellen im IL-2-Promoterelement und aktivieren die Transkription des Antagonisten.
Für die von T-Zellen ausgehende Abgabe eines anti-entzündlichen Wirkstoffs ist dieser
Mechanismus optimal geeignet. Sobald die Entzündung aufflammt, werden die Antigenspezifischen transduzierten T-Zellen zum Entzündungsherd rekrutiert, dort aktiviert und
beginnen zu proliferieren. Zudem konnte die Funktionalität eines solchen Promoters bereits
erfolgreich bei aktivierten T-Zellen gezeigt werden (Jaalouk et al. 2006). Da die Verwendung
des IL-2-Promoterelements sowohl die ortsspezifische als auch die zeitspezifische
Verabreichung des Wirkstoffs begünstigt und zudem kein Aktivator extern hinzugegeben
werden muss, wurde diese Sequenz auch in das Plasmid pTRIPZ als zusätzlicher
Kontrollmechanismus eingefügt (Abbildung 4.3 C).
79
DISKUSSION
Bei den für diese Arbeit durchgeführten Versuchen wurde fast ausschließlich mit pCDH1MCS1-EF1-copGFP-Konstrukten gearbeitet. Ein Nachteil von pCDH1-MCS1-EF1-copGFP ist
jedoch, dass anhand der Detektion des GFP-Signals zwar auf eine Integration des Konstrukts
in die Zielzelle, jedoch nicht direkt auf die Expression des Antagonisten, geschlossen werden
kann. Da diese Sequenz von einem anderen Promoter gesteuert wird, muss die Bestätigung
der Expression des Wirkstoffs zusätzlich über andere Nachweise erfolgen.
Wie bereits in der Einleitung erläutert, werden Chemokinrezeptor-Antagonisten als antientzündliche Therapeutika bei der Behandlung von chronischen Entzündungen eingesetzt. Die
hier verwendeten und in die zuvor genannten Plasmide inserierten ChemokinrezeptorAntagonisten sind die beiden Muteine CXCL11(4-79) und CXCL12(P2G2) sowie das virale
Protein vMIP-II. Deren Sequenzen und Signalpeptide zur Sekretion sind in Abbildung 4.1
dargestellt und Rezeptorspezifitäten in Tabelle 4.1 aufgelistet. Die pCDH1-MCS1-EF1-copGFPKonstrukte für konstitutive und induzierbare Antagonist-Expression (Abbildung 4.2) sowie die
verschiedenen pTRIPZ-Konstrukte (Abbildung 4.3) enthalten je einen dieser drei
Chemokinrezeptor-Antagonisten.
Da diese Antagonisten bereits bekannt sind und in vorangegangenen Studien ihre
Wirksamkeit schon bestätigt wurde, liegt in dieser Arbeit der Fokus auf der Entwicklung einer
Zelltherapie für eine bessere Verabreichung dieser Wirkstoffe (Rubant et al. 2006; Kohler et
al. 2008). Dafür sollen T-Zellen, welche aufgrund ihrer Antigenspezifität gezielt ins
Entzündungsgebiet einwandern und dort lokal die Antagonisten produzieren könnten,
verwendet werden (Abbildung 2.1). Daraus ergeben sich folgende Schwerpunkte dieser
Doktorarbeit: 1) die Transduktion von T-Zellen mit den genannten Konstrukten, 2) die
Bestätigung der Expression und Sekretion der von den T-Zellen konstitutiv und nach
Aktivierung produzierten Antagonisten sowie 3) der Nachweis der Wirksamkeit der
exprimierten Proteine. Diese Punkte werden in den nächsten Abschnitten anhand der erzielten
Ergebnisse erläutert und die Anwendbarkeit dieser Zelltherapie für die Behandlung
chronischer Entzündungen diskutiert.
80
DISKUSSION
5.2. Etablierung der Transduktion von T-Zellen mit pCDH1-MCS1-EF1-copGFP-Konstrukten
Lentivirale Transduktion kann für die Integration von Zielsequenzen bei einer Vielzahl von
Zellen erfolgreich angewendet werden. Leider sind T-Zellen, insbesondere primäre T-Zellen,
schwer zu transduzieren. So müssen primäre T-Zellen zunächst aktiviert werden, da sonst
sowohl die reverse Transkription als auch die Integration der Zielsequenz ins Genom nicht
erfolgen kann (Cribbs et al. 2013; Zack et al. 2013).
Für eine erfolgreiche Transduktion der verwendeten T-Zelllinien und primären T-Zellen war
eine umfassende Optimierung der Versuchsbedingungen notwendig, welche auf Seite 58
erläutert sind. Dabei erwiesen sich bei der Th1-Zelllinie IF12, mit welcher vorrangig gearbeitet
wurde, besonders das Mengenverhältnis zwischen Verpackungs-, Hüll- und Trägerplasmid
sowie die Einkonzentrierung des Pseudoviruspartikel-enthaltenden Zellüberstands als
entscheidende Faktoren. Infolge dieser Verbesserungen konnte eine Transduktionseffizienz
von bis zu 97% bei den verschiedenen pCDH1-MCS1-EF1-copGFP-Konstrukten erzielt werden
(Abbildung 4.4). Da es sich bei IF12 um eine aus einem Zellklon, welcher Eigenschaften einer
entzündlichen Th1-Gedächtniszelle besitzt, generierte Zelllinie handelt, ist diese für die
durchgeführten Versuche besser als JURKAT, EL-4 oder K562 geeignet. Diese Krebszelllinien
sind, im Vergleich zu IF12-Zellen, allesamt besser in der Lage die Konstrukte aufnehmen
(Tabelle 4.2 und Tabelle 4.3). Daher dienten sie als Kontrollen für eine erfolgreiche
Transduktion und die anschließenden Nachweise zur Expression der Antagonisten.
Für die Versuche mit primären Zellen wurden murine CD8+ oder CD4+ T-Zellen aus der Milz
verwendet. Bei diesen Zellen war, wie bereits erwähnt, eine vorangegangene Aktivierung mit
antiCD3/28 unerlässlich. Ohne diesen Schritt konnten nach erfolgter Transduktion keine GFPpositiven Zellen detektiert werden. Da primäre T-Zellen nicht passagiert werden können, war
es zudem notwendig, eine größere Anzahl von Zellen zu transduzieren, um eine ausreichende
Menge für die nachfolgenden Experimente zu erhalten. Mit einer Transduktionseffizienz von
bis zu 20% lag diese deutlich unter den erreichten Werten für die T-Zelllinien (Abbildung
4.6). Dennoch erwies sich diese Effizienz für die ersten Folgeversuche zur Bestätigung der
Expression der Antagonisten in primären T-Zellen als ausreichend.
Das für pCDH1-MCS1-EF1-copGFP-Konstrukte optimierte Protokoll wurde auch für das
Plasmid pTRIPZ getestet. Wie erwartet war hier die Transduktionseffizienz bei allen
getesteten Zelllinien deutlich geringer (Abbildung 4.5), was sehr wahrscheinlich auf die
enorme Größe des Plasmids zurückzuführen ist. Da bei IF12-Zellen die Effizienz unter 1% lag,
wurde an dieser Stelle nicht weiter mit pTRIPZ gearbeitet, sondern für alle weiteren
dargestellten Ergebnisse wurden die mit den pCDH1-MCS1-EF1-copGFP-Konstrukten
transduzierten Zellen genutzt.
81
DISKUSSION
5.3. Nachweis der Expression und Sekretion der Chemokinrezeptor-Antagonisten von
transduzierten T-Zellen
Der Nachweis der Expression von CXCL11(4-79), CXCL12(P2G2) und vMIP-II erfolgte auf
Transkriptions- als auch auf Translationsebene. Erstgenanntes wurde für verschiedene
transduzierte T-Zelllinien, welche eine Transduktionseffizienz von mind. 67% besitzen
(Tabelle 4.2 und Tabelle 4.3), durchgeführt. Zusätzlich zu den Ergebnissen der IF12-Zellen
dienten K562-Zellen bei den konstitutiven Konstrukten und EL-4-Zellen bei den induzierbaren
Konstrukten als Bestätigung. Die Länge der Sequenzen der verschiedenen Antagonisten liegt
für CXCL11(4-79) bei 312 bp, für CXCL12(P2G2) bei 288 bp und für vMIP-II bei 303 bp. Da
die detektierten Signale für den Leervektor bei einer Größe von etwa 200 bp und für die
Antagonist-enthaltenden Konstrukte bei 500 bp liegen, kann von einer erfolgreichen
Integration der Zielsequenzen ins Genom der T-Zellen ausgegangen werden (Abbildung 4.7).
Dass beim Leervektor ein Signal detektiert werden kann, liegt daran, dass die Bindestellen für
die eingesetzten Oligonukleotide außerhalb der inserierten Zielsequenzen liegen. In
Abbildung 4.7 B sind zusätzlich auch Proben von nicht-transduzierten Zellen aufgetragen, wo
die Bande bei 200 bp erwartungsgemäß fehlt. Da für diese Proben bei der Kontrolle GAPDH
aber trotzdem Banden erkennbar sind, wird das Ergebnis bestätigt.
Wichtiger als der Nachweis auf RNA-Level ist der Beleg der Expression der Antagonisten auf
Proteinebene. Dafür wurden Western Blot und ELISA-Messungen genutzt. Im Folgenden
werden ausschließlich die Ergebnisse von IF12-Zellen diskutiert, obwohl auch hier
vergleichbare Ergebnisse bei den anderen Zelllinien erhalten wurden. Für beide
Nachweismethoden wurden für die Muteine CXCL11(4-79) und CXCL12(P2G2) Antikörper für
die murinen Proteine, welche standardmäßig verwendet werden, eingesetzt. Da in nichttransduzierten und mit Leervektor transduzierten Zellen weder CXCL11 noch CXCL12
detektiert werden konnten, ist bewiesen, dass IF12-Zellen diese Chemokine normalerweise
nicht exprimieren und es sich bei diesen Banden tatsächlich um die Muteine handelt
(Abbildung 4.8 und Abbildung 4.10). Zudem konnten beide Antagonisten sowohl im Lysat als
auch im Zellüberstand nachgewiesen werden, was für eine erfolgreiche Sekretion spricht
(Abbildung 4.8). Nur wenn die Muteine auch aus der Zelle geschleust werden, ist
gewährleistet, dass die Antagonisten ihre Zielzellen erreichen und deren Rezeptoren
blockieren. Des Weiteren konnte für CXCL11(4-79) als auch CXCL12(P2G2) eine zeitliche
Anreicherung des Antagonisten im Zellüberstand festgestellt werden. Dies wurde für
verschiedene Medien und bis zu einer Dauer von 72h gezeigt (Abbildung 4.9 und Abbildung
4.11).
Da es leider momentan keinen guten Antikörper für das virale Protein vMIP-II gibt, konnte
dieser Antagonist leider nicht auf Proteinebene nachgewiesen werden. Es existieren zwar
Antikörper für dieses Protein, doch konnte hiermit lediglich rekombinantes vMIP-II mittels
Western Blot detektiert werden. Vermutlich ist dieser Antikörper nicht sensitiv genug, um
vMIP-II in den vorhandenen geringen Mengen der Zellen und des Zellüberstands nachweisen
zu können.
Sowohl bei den Ergebnissen des Western Blots als auch bei den ELISA-Messungen ist zu
erkennen, dass CXCL11(4-79), im Vergleich zu CXCL12(P2G2), in wesentlich höherer Menge
82
DISKUSSION
von den Zellen exprimiert wird (Abbildung 4.8 und Abbildung 4.9). Dabei ist etwa ein
Unterschied von Faktor 10 vorhanden. Dieser Unterschied existiert sowohl bei Zellen, welche
den Antagonist konstitutiv produzieren, als auch bei Zellen mit dem IL-2-Promoterelement.
Daher scheint ein genereller Unterschied zwischen der Expression von CXCL11(4-79) und
CXCL12(P2G2) zu bestehen. Ob der Grund dafür bei dem Promoter oder an der
Zellmaschinerie während der Translation liegt, ist nicht erkennbar. Womöglich werden beide
Muteine sogar zunächst in vergleichbarer Menge produziert, aber CXCL12(P2G2) wieder
vermehrt abgebaut. Dass ein Unterschied bei der Sekretion vorhanden ist, kann aufgrund der
Tatsache, dass schon im Zelllysat unterschiedliche Mengen detektiert werden konnten,
ausgeschlossen werden. Ebenso ist ein Unterschied bei der Integration in das Zellgenom
unwahrscheinlich, da die verwendeten Zellen und Plasmide, bis auf die Sequenz des
Antagonisten, identisch sind.
Da CXCL11(4-79) der aussichtsreichere Kandidat zu sein schien, wurden alle Versuche stets
mit diesem Antagonisten durchgeführt. Auf CXCL12(P2G2) und vMIP-II hingegen wurde
aufgrund der geringen Konzentration bzw. fehlender Nachweisbarkeit teilweise verzichtet. So
ist für die mit den induzierbaren Konstrukten transduzierten Zellen nur die Expression von
CXCL11(4-79) gezeigt. Sowohl mit Western Blot als auch mit ELISA konnte CXCL11
ausschließlich nach erfolgter T-Zellaktivierung mit PMA und Ionomycin oder antiCD3 und
antiCD28 nachgewiesen werden (Abbildung 4.10 und Abbildung 4.11). Parallel wurde in den
Zellüberständen auch der Wachstumsfaktor IL-2 im Elisa gemessen, welcher in Folge der
NFAT und AP-1 beinhaltenden Signalkaskade gebildet und somit zuverlässig nach Aktivierung
von T-Zellen produziert wird. Erwartungsgemäß ist IL-2 in allen transduzierten und nichttransduzierten Zellen nach erfolgter Stimulierung messbar, CXCL11 allerdings nur in
transgenen Zellen mit CXCL11(4-79) im Genom (Abbildung 4.11 A, B).
Die bisher erzielten Ergebnisse konnten auch in primären T-Zellen, welche aussagekräftiger
für eine realistische in vivo-Situation sind, bestätigt werden. Der Antagonist CXCL11(4-79)
konnte nur in den entsprechenden Zellen nachgewiesen werden (Abbildung 4.11 C). Auch die
produzierten Mengen an CXCL11(4-79) entsprechen denen aus vergleichbaren Versuchen mit
IF12-Zellen (Abbildung 4.9 A, Abbildung 4.11 A, B).
Zusammenfassend konnte sowohl die Expression als auch die Sekretion der von den
transduzierten T-Zellen produzierten Chemokinrezeptor-Antagonisten, insbesondere des
Muteins CXCL11(4-79), erfolgreich demonstriert werden. Obwohl die Antagonisten in
geringen Mengen produziert werden und der Nachweis teilweise schwierig bis unmöglich war,
sollte im nächsten Schritt zunächst ihre biologische Wirksamkeit nachgewiesen werden. Mit
Sicherheit könnten die Konstrukte sowie das Protokoll für die Transduktion in Zukunft weiter
optimiert werden, um die Integrität und Expressionsrate zu verbessern.
83
DISKUSSION
5.4. Untersuchung der Effizienz der von T-Zellen produzierten Chemokinrezeptor-Agonisten
in vitro mittels Chemotaxis-Assay
Um die Wirksamkeit der von den T-Zellen produzierten Antagonisten nachweisen zu können,
wurden Chemotaxis-Assays durchgeführt. Diese Methode ermöglicht es, die von einem
bestimmten Chemokin vermittelte Zellmigration zu messen und dabei die Auswirkungen des
entsprechenden Antagonisten zu untersuchen. Es wurden verschiedene Protokolle getestet,
wobei sowohl die Konzentration der Agonisten und Antagonisten, die Verteilung der
Komponenten, als auch die Dauer der Stimulierung der Th1-Zellen variierte. Das Chemokin
wurde dabei aber stets in das untere Well pipettiert und die Migration der IF12-Zellen wurde
bei allen Versuch nach 2h gestoppt.
Als besonders wirkungsvoll erwies sich die 4-stündige Vorinkubation der IF12-Zellen im
Antagonist-haltigen Zellüberstand der transduzierten Zellen. So scheint es den hemmenden
Effekt zu begünstigen, wenn die für den Assay eingesetzten Th1-Zellen zuerst mit dem
Antagonisten und erst danach mit dem Agonisten in Kontakt treten können. Dass die
gleichzeitige Zugabe von Agonist und Antagonist weniger wirksam ist, liegt wahrscheinlich an
der viel geringeren Konzentration des Antagonisten. Diese 4-stündige Vorlaufzeit erhöht dabei
vermutlich den Anteil der von dem Antagonisten blockierten Rezeptoren. Gleichzeitig wird
durch diese Vorinkubation mit dem Antagonisten die Menge des Zielrezeptors auf der
Zelloberfläche verringert, was für CXCL1(4-79) in Abbildung 4.15 gezeigt ist. Die Mutation
am N-Terminus scheint die vom Chemokin üblicherweise ausgelöste Rezeptordesensitivierung
nicht zu beeinträchtigen. In Abbildung 4.12 ist gezeigt, dass bereits nach 60 minütiger
Stimulierung mit CXCL9 eine deutlich geringere Menge an CXCR3 auf der Zelloberfläche der
für den Assay verwendeten IF12-Zellen detektiert wird.
Am deutlichsten war der Effekt des Antagonisten CXCL11(4-79) zudem ausgeprägt, wenn die
transduzierten Zellen während der 48-stündigen Antagonist-Produktion zusätzlich mit antiCD3/28 stimuliert wurden. Nach dieser Stimulierung wurde im anschließenden Assay
beobachtet, dass insgesamt viel weniger Zellen vom oberen ins untere Well wandern. Die
Aktivierung der Antagonist-produzierenden Zellen mit anti-CD3/28 scheint die Chemokinvermittelte Migration der im Assay eingesetzten IF12 zu desensitivieren, zudem aber
gleichzeitig den Effekt des Antagonisten herauszuheben (Vergleich von Abbildung 4.18 und
Abbildung 4.19). Da die für den Assay verwendeten IF12 in dem kompletten Überstand der
transduzierten Zellen vorinkubiert und in die Platte gegeben werden, scheint sich etwas im
Überstand zu befinden, was die Zellmigration beeinträchtigt. Es ist anzunehmen, dass nach
antiCD3/28-Zugabe andere Substanzen in den Überstand abgegeben werden als ohne diese
Stimulierung. Die Ursache für den deutlicher hervortretenden Effekt könnte, zumindest
partiell, an einer Internalisierung der CXCR3-Rezeptoren der migrierenden Zellen liegen. 24h
nach T-Zellaktivierung wurde eine Abnahme von CXCR3-positiven Th1-Zellen sowie eine
geringere Menge an Rezeptoren pro Zelle auf der Zelloberfläche gemessen (Abbildung 4.13).
Schon frühere Arbeiten in dieser Arbeitsgruppe und auch andere Studien zeigen bereits diesen
Zusammenhang (Sallusto et al. 1999). Dabei wurde gezeigt, dass diese Internalisierung auch
schon wenige Stunden nach Stimulierung erfolgt, was sich mit diesen Versuchsergebnissen
deckt. Anhand dieses veränderten Expressionsmusters, was auch für andere
84
DISKUSSION
Chemokinrezeptoren gezeigt wurde, wird wieder deutlich, wie komplex das Zusammenspiel
verschiedenster Rezeptoren und Komponenten nach T-Zellaktivierung und während der
Chemokin-vermittelten Migration ist. Womöglich wird die Exposition von CXCR3 auf der
Zelloberfläche von aktivierten T-Zellen vermindert, da sie so anders auf vorhandene
Konzentrationen von CXCL9, CXCL10 und CXCL11 reagieren, um dadurch gezielt an ihren
Bestimmungsort zu verbleiben. Im Gegensatz dazu ist nach 24-stündiger T-Zellaktivierung
eine leicht erhöhte Menge an CXCR4 und CXCR7 auf der Zelloberfläche detektierbar. Bei den
verwendeten IF12-Zellen ist ohne Stimulierung CXCR4 überhaupt nicht und CXCR7 kaum
nachweisbar (Abbildung 4.15 B, C). Daran ist erkennbar, dass die Internalisierung von CXCR3
nicht der einzige Grund für eine verringerte Zellmigration sein kann. Die veränderten
Expressionsmuster von CXCR3, CXCR4 und CXCR7 24h nach der Stimulierung mit antiCD3/28 verdeutlichen die umfassenden Änderungen und Umstrukturierungen der T-Zelle
nach ihrer Aktivierung. Offensichtlich sinkt die Bereitschaft der Zellen nach CXCR3-Liganden
zu migrieren, dafür steigt sie für CXCR4- und CXCR7-Liganden.
Auch eine verlängerte Inkubation von 24h auf 48h der transduzierten Zellen im BSA-haltigen
Medium, um eine höhere Antagonist-Konzentration zu erhalten, erwies sich als sinnvoll. Als
unnötig erwies sich hingegen die Zugabe des Antagonisten im unteren Well. Dabei war kein
Unterschied im Vergleich zur Kontrolle ohne Antagonist zu erkennen. Offensichtlich unterliegt
der Antagonist in der vorhandenen Konzentration dem Agonisten in direkter Konkurrenz. Als
Kontrolle zu den Antagonist-enthaltenden Zellüberständen wurde stets Zellüberstand von
Zellen, welche nur mit dem Leervektor transduziert wurden, verwendet. Da die IF12-Zellen,
neben dem Antagonist, auch Zytokine und andere Signalstoffe produzieren, war diese
Kontrolle unbedingt notwendig. Es war auch zu erkennen, dass der Zellüberstand, im
Vergleich zur Mediumkontrolle, die Transmigration der IF12-Zellen insgesamt verstärkte
(Abbildung 4.17 C). Welche Substanzen aus dem Zellüberstand dafür verantwortlich waren,
wurde in dieser Arbeit allerdings nicht weiter untersucht. Womöglich handelt es sich um eine
unspezifische Migration.
5.4.1. Hemmung der CXCL10 vermittelten Zellmigration durch Einsatz von CXCL11(4-79)
Da der Einsatz des Chemokinrezeptor-Antagonists CXCL11(4-79) aufgrund seiner
Nachweisbarkeit und höheren Expressionsrate am vielversprechendsten zu sein schien, wurde
dieser vorwiegend eingesetzt. CXCL11(4-79) ist, wie auch das Chemokin CXCL11, in der Lage,
den Rezeptor CXCR3 zu binden. Da auch CXCL9 und CXCL10 diesen Rezeptor aktivieren und
eine Rolle bei der Rekrutierung von T-Zellen ins Entzündungsgebiet spielen, wurden alle drei
Chemokine im Chemotaxis-Assay getestet. Um die für den Assay geeignete
Chemokinkonzentration bestimmen und die Intensität der CXCL9-, CXCL10- und CXCL11vermittelten T-Zellmigration miteinander vergleichen zu können, wurden zunächst die EC50Werte ermittelt. Da die EC50-Werte, inklusive CXCL12, zwischen 5 und 55 nM liegen, wurden
für den Assay in der Regel Chemokinkonzentrationen von 5-10 nM eingesetzt (Abbildung
4.16). Bei einer zu geringen Konzentration transmigrieren zu wenige Zellen in das untere
Well, bei einer zu hohen Konzentration wird ein möglicher Effekt der Antagonisten überdeckt.
85
DISKUSSION
Ein Vergleich der EC50-Werte der verschiedenen CXCR3-Liganden miteinander zeigt, dass von
CXCL11 die höchste Konzentration notwendig ist, um eine 50%ige Wirkung zu erhalten. Mit
anderen Worten ist eine Konzentration von 54,37 nM notwendig, damit 50% der maximal
möglichen Anzahl an Zellen im Versuch transmigrieren. Der EC50-Wert für CXCL9 beträgt
21,8 nM und für CXCL10 nur 8,66 nM (Abbildung 4.16). Nach diesem Versuch lässt sich
vermuten, dass bei einer im Assay eingesetzten Chemokinkonzentration von 10 nM der
CXCR3-Ligand CXCL11 am einfachsten vom Antagonisten CXCL11(4-79) verdrängt werden
müsste. Jedoch muss hier die in vivo-Wirkung von CXCL9, CXCL10 und CXCL11, insbesondere
die Affinität zum Rezeptor, noch berücksichtigt werden.
CXCR3 wird vorwiegend von entzündlichen Th1-Zellen exprimiert und spielt mit seinen
Liganden eine entscheidende Rolle für deren Rekrutierung zum Entzündungsherd. Dass das
Vorhandensein verschiedener CXCR3-Liganden dabei von Vorteil ist und CXCL9, CXCL10 und
CXCL11 verschiedene Rollen für das „fine tuning“ einnehmen, wurde bereits in verschiedenen
Studien untersucht (Loetscher et al. 1996; Chen et al. 2004; Colvin et al. 2004). Dabei
wurden insbesondere bei CXCL11 Unterschiede zu den anderen beiden Chemokinen
festgestellt. Zum einen besitzt CXCL11 die höchste Affinität zu CXCR3 und zum anderen sind
bei der CXCL11 induzierten Aktivierung andere Rezeptordomänen und möglicherweise auch
andere Signalwege beteiligt (Booth et al. 2004; Colvin et al. 2004). Dass CXCL11 zudem auch
in geringerer Konzentration als CXCL9 oder CXCL10 die Internalisierung von CXCR3 auslöst,
wird dadurch erklärt, dass CXCL11 der physiologische Aktivator von CXCR3 ist (Sauty et al.
2001). Bestärkt wurde dies zusätzlich durch die Entdeckung der verschiedenen
Spließvarianten von CXCR3, wobei CXCL11 der alleinige Ligand von CXCR3-alt ist
(Korniejewska et al. 2011). Folglich scheint CXCL11 der effektivste Aktivator der CXCR3vermittelten Zellmigration zu sein. Obwohl also CXCL11 bei dem für diese Arbeit
durchgeführten Versuch von allen CXCR3-Liganden den höchsten EC50-Wert aufweist, wurde
es nicht bei den folgenden Chemotaxis-Experimenten zum Nachweis der CXCL11(4-79)Effizienz eingesetzt, da es die höchste Rezeptoraffinität besitzt und somit schon in geringen
Mengen leicht den Effekt des Antagonisten überdecken könnte. Allerdings ist es sehr sinnvoll,
dass der verwendete CXCR3-Antagonist CXCL11(4-79) auf der Sequenz von CXCL11 beruht
und dadurch auch dessen hohe Rezeptoraffinität besitzt.
Bei den durchgeführten Chemotaxis-Experimenten konnte für die CXCL10-induzierte Th1Migration eine signifikante Hemmung gezeigt und die biologische Wirksamkeit des
Antagonisten damit bestätigt werden (Abbildung 4.19). Auch ohne die Inkubation der
Antagonist-produzierenden Zellen in anti-CD3/28 haltigen Medium, was die allgemeine
Zellmigration verringert, den hemmenden Effekt von CXCL11(4-79) aber verstärkt, ist
tendenziell eine geringere Menge an Zellen transmigriert (Abbildung 4.18). Unter
Verwendung von CXCL9 ist ebenfalls eine reduzierte Zellmigration zu erkennen, jedoch ist
dieses Ergebnis statistisch nicht signifikant (Abbildung 4.19). Dass bei der CXCL10vermittelten Zellmigration die deutlichste von CXCL11(4-79) vermittelte Hemmung
vorhanden ist, liegt vermutlich an der eingesetzten Chemokinkonzentration von 10 nM. Der
EC50-Wert von CXCL10 liegt mit 8,66 nM der verwendeten Konzentration sehr nahe, weshalb
bei Anwesenheit von CXCL10 mit Abstand die meisten Zellen transmigrieren (Abbildung 4.18
86
DISKUSSION
und Abbildung 4.19). In der Regel werden Wirkstoffe besonders im Bereich der mittleren
effektiven Konzentration untersucht, da hier mögliche Effekte besonders deutlich zu erkennen
sind. Womöglich müsste CXCL9 mit einer höheren Konzentration von etwa 20 nM eingesetzt
werden, um hier ebenfalls einen signifikanten Effekt zu erhalten.
Als Kontrolle wurde neben den CXCR3-Liganden auch der CCR2-Ligand CCL2 im Assay
verwendet. Die CCL2-vermittelte Migration wird durch CXCL11(4-79) nicht gehemmt
(Abbildung 4.19). Da die durch CCL2 induzierte Zellmigration recht gering ist, sollte hier in
Folgeversuchen eine höhere Konzentration des Chemokins mitgetestet werden. Insgesamt
betrachtet konnte die Wirksamkeit des von transduzierten murinen Gedächtnis-Th1-Zellen
produzierten Chemokinrezeptor-Antagonisten CXCL11(4-79) nachgewiesen werden. Dennoch
könnten die Bedingungen für den Chemotaxis-Assay weiter verbessert werden. Beispielsweise
könnten eine höhere Konzentration des Antagonisten, sowie die Zugabe anderer
Chemokinkonzentrationen oder andere Inkubationszeiten zur weiteren Optimierung
beitragen. Außerdem könnten primäre oder humane Zellen anstatt der bisher verwendeten
IF12-Zellen eingesetzt werden.
5.4.2. Wirksamkeit der weiteren untersuchten Antagonisten CXCL12(P2G2) und vMIP-II
Aufgrund der geringeren Expressionsrate von CXCL12(P2G2) war es wesentlicher schwieriger
die Funktionalität dieses Muteins nachzuweisen. Auch hier wurden verschiedene Protokolle
für den Chemotaxis-Assay getestet, wobei ein Durchgang in Abbildung 4.17 dargestellt ist. Bei
diesem Versuch wurde die durch CXCL9, CXCL12 und CCL5 vermittelte Chemotaxis
untersucht. Für CXCL12(P2G2) ist nur bei der CXCL12-induzierten Chemotaxis eine
Verringerung in der Anzahl migrierter Zellen gegenüber dem Leervektor zu erkennen. Dies ist
zwar nur ein kleiner Effekt, aber dennoch an richtiger Stelle, weshalb er tatsächlich durch die
Wirkung des Antagonisten entstanden sein könnte. An sich ist die durch das Chemokin
CXCL12 induzierte Zellmigration deutlich zu erkennen, da eine hohe Anzahl von IF12-Zellen
im Assay transmigrieren. Dies kann auf einen EC50-Wert von nur 5,65 nM zurückgeführt
werden (Abbildung 4.16).
Da die Konzentration von CXCL12(P2G2) im Vergleich zu CXCL11(4-79) momentan bei einer
etwa 10-fach geringeren Menge liegt, ist es für weitere Nachweise notwendig, die Menge an
CXCL12(P2G2) im Zellüberstand der transduzierten Zellen zu erhöhen. Die beste Strategie
wäre wohl, das CXCL12(P2G2)-enthaltende Plasmid zu verändern, um die Expressionsrate zu
optimieren. Womöglich wäre ein anderes Trägerplasmid besser geeignet als das verwendete
Plasmid pCDH1-MCS1-EF1-copGFP. Ein anderer Ansatzpunkt wäre, die Menge der in die
Zielzellen inserierten Antagonist-Sequenzen zu erhöhen, entweder über eine effektivere
Transduktion oder über eine Anreicherung stark GFP-positiver Zellen mittels FACS. Neben
einer Verbesserung der Expressionsrate, wäre es zukünftig auch interessant CXCL12(P2G2) in
Kombination mit CXCL11(4-79) im Chemotaxis-Experiment zu untersuchen.
Noch schwieriger gestaltete sich der Nachweis des viralen Chemokinrezeptor-Antagonisten
vMIP-II. Wie bereits erwähnt, konnte die Expression von vMIP-II aufgrund des Fehlens
87
DISKUSSION
geeigneter Antikörper nur auf RNA-Ebene gezeigt werden. Aus diesem Grund war es auch
nicht möglich, die Menge an produziertem vMIP-II zu ermitteln. Die Nachweisgrenze von
rekombinantem vMIP-II im Western Blot mit dem verfügbaren Antikörper lag bei etwa 100 ng.
Dadurch kann zumindest geschlussfolgert werden, dass auch dieser Antagonist maximal in
ähnlich geringer Menge wie die Muteine von den Zellen produziert wird.
Trotz ungewisser Expression und Sekretion, wurde auch vMIP-II-enthaltender Zellüberstand
im Chemotaxis-Assay eingesetzt. Aufgrund seiner multiplen antagonistischen Wirkung
blockiert vMIP-II ebenfalls CXCR3 und CXCR4 als auch weitere Chemokinrezeptoren (Tabelle
4.1). Dabei zeigte sich bei CXCL9- sowie CXCL12-vermittelter Migration in der Tat eine
Reduktion in der Anzahl migrierter Zellen. Allerdings war bei der CCL5 induzierten Migration
keine Hemmung zu erkennen (Abbildung 4.17 C). Um die Wirkung von vMIP-II besser
einschätzen zu können, wurde in weiteren Versuchen als zusätzliche Kontrolle rekombinantes
vMIP-II verwendet. Zellen, die mit rekombinantem vMIP-II stimuliert wurden, zeigten eine
stark verringerte Transmigration bei CCL5-vermittelter Chemotaxis. Die CXCL12-induzierte
Zellmigration wurde deutlich weniger gehemmt. Überraschend war das Resultat der CXCL9vermittelten Chemotaxis. Anstatt einer Reduktion wurde hier eine starke Erhöhung der Anzahl
migrierter Zellen ermittelt (Abbildung 4.20 A).
Um diese Ergebnisse besser deuten zu können, wurde, unter Einsatz des rekombinanten
Proteins, die Wirkung von v-MIP-II auf die durch verschiedene Chemokine vermittelte
Migration nochmals näher betrachtet. Dafür wurden die folgenden Chemokine eingesetzt:
CCL2 (CCR2), CCL4 (CCR5), CCL5 (CCR1/3/5), CXCL9 (CXCR3), CXCL10 (CXCR3), CXCL11
(CXCR3/7) und CXCL12 (CXCR4/7). Die antagonistische Funktion von vMIP-II wurde für die
Chemokinrezeptoren CCR1, CCR2, CCR5, CXCR3, CXCR4 und CX3CR1 in der Literatur
beschrieben (Lindow et al. 2003; Kledal et al. 1997). Bei CCL2, CCL4, CCL5, CXCL10 und
CXCL12 ist auch, wie erwartet, eine Hemmung der Zellmigration zu sehen. Hingegen zeigt
sich bei CXCL9 und CXCL11 eine gegensätzliche Wirkung, indem die Anzahl migrierter Zell
deutlich erhöht ist (Abbildung 4.20 B). Erstaunlich ist dabei vor allem, dass diese
unterschiedlichen Effekte innerhalb der drei eingesetzten CXCR3-Liganden vorhanden sind.
Während vMIP-II bei der CXCL10-vermittelten Chemotaxis eine Reduktion der Anzahl
migrierter Zellen bewirkt, ist die durch CXCL9 und CXCL11 induzierte Migration verstärkt.
Daran ist zu erkennen, wie komplex der Wirkungsmechanismus des Virus ist, welcher
verhindert, vom Immunsystem des Wirts erkannt zu werden. Der ChemokinrezeptorAntagonist vMIP-II scheint so konstruiert zu sein, dass er, je nach Umfeld, über ein und
denselben Rezeptor unterschiedliche Signalwege aktivieren kann. Möglicherweise spielen
weitere Rezeptoren, wie beispielsweise CXCR7, oder die Konzentration des vorhandenen
Chemokins dabei eine entscheidende Rolle. In Versuchen mit vMIP-II enthaltenden
Zellüberstand war teilweise eine verringerte Zellmigration nach CXCL9 zu beobachten, bei
einer hohen Konzentration an rekombinanten vMIP-II hingegen eine Verstärkung der
Migration. Aufgrund dieser komplexen Wirkungsweise sowie der fehlenden Nachweisbarkeit,
lag der Fokus bei der Durchführung der Chemotaxis-Assays für den Nachweis der
Funktionalität der Antagonisten zunächst auf CXCL11(4-79).
88
DISKUSSION
5.5. Ausblick auf das Potential dieser auf Chemokinrezeptor-Antagonisten basierenden TZelltherapie für chronische Entzündungen
Das Konzept dieses Projekts war die Entwicklung einer Zelltherapie für die Behandlung von
Autoimmunerkrankungen mit chronischen Entzündungen, wie Diabetes Typ-1, MS, Psoriasis
oder rheumatoide Arthritis. Diese beruht zum einen auf der Verabreichung von
Chemokinrezeptor-Antagonisten zur Hemmung der unnötigen T-Zellinfiltration und zum
anderen auf der Verwendung von Gedächtnis-T-Zellen für eine spezifische und
langanhaltende Verabreichung dieses Wirkstoffs.
Die verwendeten Chemokinrezeptor-Antagonisten CXCL11(4-79), CXCL12(P2G2) und vMIP-II
waren bereits beschrieben und wurden für diese Arbeit ausgewählt, weil sie genau diejenigen
Chemokinrezeptoren hemmen, deren Signaltransduktion durch die Überexpression von
Chemokinen in chronisch entzündeten Gebieten unnötigerweise aktiviert wird. Dabei ist der
Einsatz einer Kombination dieser Antagonisten empfehlenswert um Kompensationen, welche
für das Netzwerk von Chemokinen und ihren Rezeptoren charakteristisch sind, möglichst zu
vermeiden. Insbesondere CXCR3 und CXCR4 scheinen vielversprechende Ziele zu sein. Wie
bereits in der Einleitung beschrieben, können CXCR3-Liganden unter anderem vermehrt im
Serum von Patienten mit Diabetes Typ-1, rheumatoider Arthritis und Multipler Sklerose
nachgewiesen werden. Eine erhöhte Expression von CXCL12 konnte in den entzündeten
Gebieten von Patienten mit Erkrankungen wie rheumatoider Arthritis, Multipler Sklerose und
systemischem Lupus Erythematodes gemessen werden. Zudem konnte in dieser Arbeitsgruppe
bereits in Vergangenheit eine Cross-Regulation dieser beiden Chemokinrezeptoren und ihren
Signalwegen gezeigt werden (Giegold et al. 2013). Inwieweit auch der von CXCL11 und
CXCL12 gemeinsame Rezeptor CXCR7 eine Rolle spielt, wird mit Sicherheit in Zukunft noch
näher betrachtet werden. Obwohl vMIP-II sich als schwierigstes der drei verwendeten
Antagonisten erwies, ist es sinnvoll, auch dieses in zukünftige und weiterführende
Experimente einzubeziehen. Im Gegensatz zu den beiden Muteinen besteht hier die
Besonderheit, mit nur einem einzigen Wirkstoff mehrere Zielrezeptoren hemmen zu können.
Zudem konnte die Funktionalität von vMIP-II bereits in vitro als auch in vivo nachgewiesen
werden (Rubant et al. 2006).
Um eine systemische Verabreichung von Chemokinrezeptor-Antagonisten und die damit
verbundenen Nebenwirkungen zu verhindern, ist der Einsatz von antigenspezifischen T-Zellen
durchaus eine sinnvolle Alternative. Gerade die selbstregulatorischen Fähigkeit als
Gedächtnis-Zelle im Körper zu verbleiben und bei Bedarf als Effektor-Zelle stark zu
proliferieren, macht T-Zellen einzigartig und besonders attraktiv für Zelltherapien in diesem
Bereich. Würden diese Wirkstoffe permanent verabreicht werden oder an falscher Stelle
wirken, können andere notwendige Immunreaktionen behindert werden, was katastrophale
Auswirkungen auf den Patienten haben könnte. Diese Strategie wurde bereits in anderen
Studien erfolgreich bei der Behandlung von Autoimmunerkrankungen und Tumoren getestet
(Kerkar 2013). Daher ist es auch denkbar, verschiedene Chemokinrezeptor-Antagonisten in
körpereigene T-Zellen zu integrieren und die transgenen Zellen dem Immunsystem
zurückzuführen. Durch die Verwendung körpereigener Zellen wird zudem sichergestellt, dass
keine Abstoßungsreaktion abläuft. Die funktionelle Produktion und Sekretion der
89
DISKUSSION
Chemokinrezeptor-Antagonisten von T-Zellen konnte für CXCL11(4-79) und CXCL12(P2G2)
erfolgreich, und eingeschränkt für vMIP-II in dieser Arbeit demonstriert werden.
Der nächste Schritt wäre nun, neben den bereits erwähnten Verbesserungen für den in vitroPart, diesen Therapieansatz auch in vivo zu testen. Nur unter solchen realen Bedingungen
kann die Wirksamkeit dieser Therapie hinreichend untersucht und aussagekräftige
Rückschlüsse für einen möglichen Einsatz beim Menschen gezogen werden. Insbesondere die
notwendige Konzentration der produzierten Antagonisten ist zurzeit noch ungewiss.
Möglicherweise würden sich die transgenen T-Zellen lokal so stark im Entzündungsgebiet
vermehren, dass die momentan erreichte Expressionsrate nicht oder zumindest nicht allzu
sehr erhöht werden müsste. Denkbare Mausmodelle hierfür wären beispielsweise das DNFB
(2,4-Dinitro-1-fluorobenzen)-induzierte Mausmodell für Kontaktdermatitis oder das RIPLCMV Mausmodell für Diabetes Typ-1 (Oldstone et al. 1991; McGavern et al. 2002; Schwarz
et al. 2004; Ludwig et al. 2005). Wichtig für die Auswahl eines geeigneten Tiermodells ist,
dass eine Überexpression der entsprechenden Chemokine die Entzündung im Zielgebiet
vorantreibt, die Zielantigene bekannt sind und der Krankheitsverlauf gut vorhersehbar ist.
Am Beispiel des RIP-LCMV Mausmodells für Diabetes Typ-1 werden Tiere verwendet, welche
ein spezifisches Protein des Lymphocytic Choriomeningitis Virus (LCMV) unter der Kontrolle
des Ratten Insulin Promoters (RIP) exprimieren. Aufgrund des eingesetzten Promoters kann
das virale Protein ausschließlich im Pankreas von den Insulin produzierenden Beta-Zellen
produziert werden. Diese Mäuse besitzen keinen veränderten Phänotyp, da das virale Protein
vom Immunsystem toleriert wird. Erst nach Infektion der Tiere mit LCMV wird diese Toleranz
durchbrochen, was schließlich zu einer Zerstörung der Beta-Zellen durch autoaggressive
CD8+ T-Zellen führt. Mit der Infektion der Mäuse kann der Zeitpunkt des Auftretens Diabetes
Typ-1 ähnlicher Symptome genau definiert werden. Zudem sind der Ablauf der Infiltration
aggressiver T-Zellen und die Zerstörung auf Zellebene sehr gut untersucht, was eine gezielte
Untersuchung der Zelltherapie ermöglicht. CXCR3-Liganden gehören zu den Chemokinen,
welche als erstes nach LCMV-Infektion produziert werden. Insbesondere CXCL10 ist in die
Rekrutierung Antigen-spezifischer T-Zellen involviert (Christen und Herrath 2004). Für die
Transduktion und Verabreichung der Antagonisten würden bei diesem Modell die
autoaggressiven CD8+ T-Zellen verwendet werden.
Bei dem zuvor beschriebenen Mausmodell für Diabetes Typ-1, wie auch bei anderen
Erkrankungen, könnten die für die Therapie verwendeten T-Zellen selbst ein problematischer
Faktor sein. Die Antigen-spezifischen T-Zellen, in deren Genom die Antagonisten inseriert
werden, sind gleichzeitig auch die aggressiven Zellen, welche die Autoimmunreaktion
vorantreiben. Daher könnte ihr Einsatz bei einer unzureichenden Wirkstoffproduktion die
Gewebezerstörung verstärken, anstatt sie zu vermindern. Daher sollte die Menge an
verabreichten transduzierten Zellen genau kalkuliert sein, um eine ausreichende
Antagonistkonzentration zu ermöglichen, eine zusätzliche Schädigung hingegen aber zu
vermeiden. Als mögliche Alternative zu den autoaggressiven T-Zellen wäre die Verwendung
von T-Zellen mit einer anderen Antigenspezifität denkbar. Das Antigen müsste allerdings
ebenfalls im Zielgebiet vorhanden sein. Hierbei läge das Problem allerdings in der fehlenden
T-Zellaktivierung und Proliferation, weshalb eine größere Menge an T-Zellen appliziert
90
DISKUSSION
werden müsste. Zudem wäre das selbstregulatorische An- und Abschalten der
Wirkstoffproduktion nicht gegeben. Eine weitere Alternative wäre der Gebrauch von
regulatorischen T-Zellen als Vehikel für die Antagonisten. Von Vorteil wäre hier, dass
regulatorische T-Zellen die Zellzerstörung nicht vorantreiben, sondern möglicherweise das
Abklingen der Immunreaktion zusätzlich fördern. Allerdings ist hierbei fraglich, ob diese
Zellen den Antagonist in ausreichender Menge und rechtzeitig zur gewünschten Zeit am
richtigen Ort produzieren würden.
Abschließend lässt sich sagen, dass auf jeden Fall Potential im Einsatz dieser durch Antigenspezifische T-Zellen produzierten Chemokinrezeptor-Antagonisten steckt. Von Vorteil sind vor
allem die spezifische und langanhaltende Wirkstoffzugabe sowie der flexible Einsatz für die
Hemmung der für die jeweilige Erkrankung relevanten Chemokinrezeptoren. Besonders die
Untersuchung in einem geeigneten Mausmodell würde zeigen, wie aussichtsreich diese
Zelltherapie für weiteren Gebrauch tatsächlich ist.
91
LITERATURVERZEICHNIS
6. Literaturverzeichnis
Bücher:
Kenneth P. Murphy: Janeway`s immunobiology. Garland Science, USA 2012, 8. Ausgabe, ISBN 978-08153-4243-4.
Publikationen:
Alessandri, Ana L.; Sousa, Lirlândia P.; Lucas, Christopher D.; Rossi, Adriano G.; Pinho, Vanessa;
Teixeira, Mauro M. (2013): Resolution of inflammation: mechanisms and opportunity for drug
development. In: Pharmacol. Ther. 139 (2), S. 189–212.
Antonelli, A.; Fallahi, P.; Ferrari, S. M.; Pupilli, C.; d'Annunzio, G.; Lorini, R. et al. (2008): Serum Th1
(CXCL10) and Th2 (CCL2) chemokine levels in children with newly diagnosed Type 1 diabetes: a
longitudinal study. In: Diabet. Med. 25 (11), S. 1349–1353.
Antonelli, Alessandro; Ferrari, Silvia Martina; Giuggioli, Dilia; Ferrannini, Ele; Ferri, Clodoveo; Fallahi,
Poupak (2014): Chemokine (C-X-C motif) ligand (CXCL)10 in autoimmune diseases. In: Autoimmun
Rev 13 (3), S. 272–280.
Bachelerie, Francoise; Ben-Baruch, Adit; Burkhardt, Amanda M.; Combadiere, Christophe; Farber,
Joshua M.; Graham, Gerard J. et al. (2014): International Union of Basic and Clinical Pharmacology.
[corrected]. LXXXIX. Update on the extended family of chemokine receptors and introducing a new
nomenclature for atypical chemokine receptors. In: Pharmacol. Rev. 66 (1), S. 1–79.
Bacon, Kevin; Baggiolini, Marco; Broxmeyer, Hal; Horuk, Richard; Lindley, Ivan; Mantovani, Alberto et
al. (2002): Chemokine/chemokine receptor nomenclature. In: J. Interferon Cytokine Res. 22 (10), S.
1067–1068.
Baggiolini, M. (2001): Chemokines in pathology and medicine. In: J. Intern. Med. 250 (2), S. 91–104.
Baggiolini, M.; Dewald, B.; Moser, B. (1997): Human chemokines: an update. In: Annu. Rev. Immunol.
15, S. 675–705.
Balabanian, Karl; Lagane, Bernard; Infantino, Simona; Chow, Ken Y. C.; Harriague, Julie; Moepps,
Barbara et al. (2005): The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor
RDC1 in T lymphocytes. In: J. Biol. Chem. 280 (42), S. 35760–35766.
Balicki, Danuta; Beutler, Ernest (2002): Gene therapy of human disease. In: Medicine (Baltimore) 81
(1), S. 69–86.
Ben-Baruch, Adit (2008): Organ selectivity in metastasis: regulation by chemokines and their
receptors. In: Clin. Exp. Metastasis 25 (4), S. 345–356.
Berahovich, Robert D.; Penfold, Mark E T; Schall, Thomas J. (2010): Nonspecific CXCR7 antibodies.
In: Immunol. Lett. 133 (2), S. 112–114.
Boehncke, Wolf-Henning; Schön, Michael P. (2007): Animal models of psoriasis. In: Clin. Dermatol. 25
(6), S. 596–605.
Boldajipour, Bijan; Mahabaleshwar, Harsha; Kardash, Elena; Reichman-Fried, Michal; Blaser, Heiko;
Minina, Sofia et al. (2008): Control of chemokine-guided cell migration by ligand sequestration. In:
Cell 132 (3), S. 463–473.
Bonifacino, Juan S.; Traub, Linton M. (2003): Signals for sorting of transmembrane proteins to
endosomes and lysosomes. In: Annu. Rev. Biochem. 72, S. 395–447.
92
LITERATURVERZEICHNIS
Booth, Valerie; Clark-Lewis, Ian; Sykes, Brian D. (2004): NMR structure of CXCR3 binding chemokine
CXCL11 (ITAC). In: Protein Sci. 13 (8), S. 2022–2028.
Bottomley, M. J.; Salim, K.; Panayotou, G. (1998): Phospholipid-binding protein domains. In: Biochim.
Biophys. Acta 1436 (1-2), S. 165–183.
Braddock, Martin (2007a): 11th annual Inflammatory and Immune Diseases Drug Discovery and
Development Summit 12-13 March 2007, San Francisco, USA. In: Expert Opin Investig Drugs 16 (6), S.
909–917.
Braddock, Martin (2007b): Advances in Anti-Inflammatory Therapeutics: 20-21 November 2006,
London, UK. In: Expert Opin Investig Drugs 16 (2), S. 257–261.
Brown, Matthew F.; Bahnck, Kevin B.; Blumberg, Laura C.; Brissette, William H.; Burrell, Sara A.;
Driscoll, James P. et al. (2007): Piperazinyl CCR1 antagonists--optimization of human liver microsome
stability. In: Bioorg. Med. Chem. Lett. 17 (11), S. 3109–3112.
Brunn, A.; Utermöhlen, O.; Mihelcic, M.; Sánchez-Ruiz, M.; Carstov, M.; Blau, T. et al. (2013):
Differential effects of CXCR4-CXCL12- and CXCR7-CXCL12-mediated immune reactions on murine
P0106-125 -induced experimental autoimmune neuritis. In: Neuropathol. Appl. Neurobiol. 39 (7), S.
772–787.
Burgering, B. M.; Coffer, P. J. (1995): Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase
signal transduction. In: Nature 376 (6541), S. 599–602.
Burman, Angela; Haworth, Oliver; Hardie, Debbie L.; Amft, E. Nicole; Siewert, Christiane; Jackson,
David G. et al. (2005): A chemokine-dependent stromal induction mechanism for aberrant lymphocyte
accumulation and compromised lymphatic return in rheumatoid arthritis. In: J. Immunol. 174 (3), S.
1693–1700.
Burns, Jennifer M.; Summers, Bretton C.; Wang, Yu; Melikian, Anita; Berahovich, Rob; Miao, Zhenhua
et al. (2006): A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion,
and tumor development. In: J. Exp. Med. 203 (9), S. 2201–2213.
Busillo, John M.; Benovic, Jeffrey L. (2007): Regulation of CXCR4 signaling. In: Biochim. Biophys. Acta
1768 (4), S. 952–963.
Bystrom, Jonas; Evans, Ian; Newson, Justine; Stables, Melanie; Toor, Iqbal; van Rooijen, Nico et al.
(2008): Resolution-phase macrophages possess a unique inflammatory phenotype that is controlled by
cAMP. In: Blood 112 (10), S. 4117–4127.
Campbell, Daniel J.; Kim, Chang H.; Butcher, Eugene C. (2003): Chemokines in the systemic
organization of immunity. In: Immunol. Rev. 195, S. 58–71.
Canals, Meritxell; Scholten, Danny J.; Munnik, Sabrina de; Han, Mitchell K. L.; Smit, Martine J.; Leurs,
Rob (2012): Ubiquitination of CXCR7 controls receptor trafficking. In: PLoS ONE 7 (3), S. e34192.
Carman, Christopher V.; Sage, Peter T.; Sciuto, Tracey E.; de la Fuente, Miguel A; Geha, Raif S.; Ochs,
Hans D. et al. (2007): Transcellular diapedesis is initiated by invasive podosomes. In: Immunity 26 (6),
S. 784–797.
Carman, Christopher V.; Springer, Timothy A. (2004): A transmigratory cup in leukocyte diapedesis
both through individual vascular endothelial cells and between them. In: J. Cell Biol. 167 (2), S. 377–
388.
Caruz, A.; Samsom, M.; Alonso, J. M.; Alcami, J.; Baleux, F.; Virelizier, J. L. et al. (1998): Genomic
organization and promoter characterization of human CXCR4 gene. In: FEBS Lett. 426 (2), S. 271–278.
Charo, Israel F.; Ransohoff, Richard M. (2006): The many roles of chemokines and chemokine
receptors in inflammation. In: N. Engl. J. Med. 354 (6), S. 610–621.
93
LITERATURVERZEICHNIS
Chen, Jun; Vistica, Barbara P.; Takase, Hiroshi; Ham, Don Il; Fariss, Robert N.; Wawrousek, Eric F. et
al. (2004): A unique pattern of up- and down-regulation of chemokine receptor CXCR3 on
inflammation-inducing Th1 cells. In: Eur. J. Immunol. 34 (10), S. 2885–2894.
Chiang, Nan; Fredman, Gabrielle; Bäckhed, Fredrik; Oh, Sungwhan F.; Vickery, Thad; Schmidt,
Birgitta A.; Serhan, Charles N. (2012): Infection regulates pro-resolving mediators that lower antibiotic
requirements. In: Nature 484 (7395), S. 524–528.
Chong, Benjamin F.; Mohan, Chandra (2009): Targeting the CXCR4/CXCL12 axis in systemic lupus
erythematosus. In: Expert Opin. Ther. Targets 13 (10), S. 1147–1153.
Christen, Urs; Herrath, Matthias G. von (2004): IP-10 and type 1 diabetes: a question of time and
location. In: Autoimmunity 37 (4), S. 273–282.
Chung, Soo-Hyun; Seki, Keisuke; Choi, Byung-Il; Kimura, Keiko B.; Ito, Akihiko; Fujikado, Noriyuki et
al. (2010): CXC chemokine receptor 4 expressed in T cells plays an important role in the development
of collagen-induced arthritis. In: Arthritis Res. Ther. 12 (5), S. R188.
Chu, Yiwei; Yang, Xiuli; Xu, Wei; Wang, Ying; Guo, Qiang; Xiong, Sidong (2007): In situ expression of
IFN-gamma-inducible T cell alpha chemoattractant in breast cancer mounts an enhanced specific antitumor immunity which leads to tumor regression. In: Cancer Immunol. Immunother. 56 (10), S. 1539–
1549.
Colvin, Richard A.; Campanella, Gabriele S. V.; Sun, Jieti; Luster, Andrew D. (2004): Intracellular
domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. In: J. Biol. Chem. 279 (29), S.
30219–30227.
Condon, T. P.; Flournoy, S.; Sawyer, G. J.; Baker, B. F.; Kishimoto, T. K.; Bennett, C. F. (2001):
ADAM17 but not ADAM10 mediates tumor necrosis factor-alpha and L-selectin shedding from
leukocyte membranes. In: Antisense Nucleic Acid Drug Dev. 11 (2), S. 107–116.
Costa, G. L.; Sandora, M. R.; Nakajima, A.; Nguyen, E. V.; Taylor-Edwards, C.; Slavin, A. J. et al.
(2001): Adoptive immunotherapy of experimental autoimmune encephalomyelitis via T cell delivery of
the IL-12 p40 subunit. In: J. Immunol. 167 (4), S. 2379–2387.
Cribbs, Adam P.; Kennedy, Alan; Gregory, Bernard; Brennan, Fionula M. (2013): Simplified production
and concentration of lentiviral vectors to achieve high transduction in primary human T cells. In: BMC
Biotechnol. 13 (1), S. 98.
Cruz-Orengo, Lillian; Chen, Ying-Jr; Kim, Joong Hee; Dorsey, Denise; Song, Sheng-Kwei; Klein, Robyn
S. (2011): CXCR7 antagonism prevents axonal injury during experimental autoimmune
encephalomyelitis as revealed by in vivo axial diffusivity. In: J Neuroinflammation 8, S. 170.
Datta, Dipak; Flaxenburg, Jesse A.; Laxmanan, Sreenivas; Geehan, Christopher; Grimm, Martin;
Waaga-Gasser, Ana Maria et al. (2006): Ras-induced modulation of CXCL10 and its receptor splice
variant CXCR3-B in MDA-MB-435 and MCF-7 cells: relevance for the development of human breast
cancer. In: Cancer Res. 66 (19), S. 9509–9518.
Dorr, Patrick; Westby, Mike; Dobbs, Susan; Griffin, Paul; Irvine, Becky; Macartney, Malcolm et al.
(2005): Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-molecule inhibitor
of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type 1 activity.
In: Antimicrob. Agents Chemother. 49 (11), S. 4721–4732.
Dotan, Iris; Werner, Lael; Vigodman, Sharon; Weiss, Sigal; Brazowski, Eli; Maharshak, Nitsan et al.
(2010): CXCL12 is a constitutive and inflammatory chemokine in the intestinal immune system. In:
Inflamm. Bowel Dis. 16 (4), S. 583–592.
Ehlert, Jan Erik; Addison, Christina A.; Burdick, Marie D.; Kunkel, Steven L.; Strieter, Robert M.
(2004): Identification and partial characterization of a variant of human CXCR3 generated by
posttranscriptional exon skipping. In: J. Immunol. 173 (10), S. 6234–6240.
94
LITERATURVERZEICHNIS
Elyaman, Wassim; Kivisäkk, Pia; Reddy, Jay; Chitnis, Tanuja; Raddassi, Khadir; Imitola, Jaime et al.
(2008): Distinct functions of autoreactive memory and effector CD4+ T cells in experimental
autoimmune encephalomyelitis. In: Am. J. Pathol. 173 (2), S. 411–422.
Fan, G. H.; Yang, W.; Wang, X. J.; Qian, Q.; Richmond, A. (2001): Identification of a motif in the
carboxyl terminus of CXCR2 that is involved in adaptin 2 binding and receptor internalization. In:
Biochemistry 40 (3), S. 791–800.
Faroudi, Mustapha; Hons, Miroslav; Zachacz, Agnieszka; Dumont, Celine; Lyck, Ruth; Stein, Jens V.;
Tybulewicz, Victor L J (2010): Critical roles for Rac GTPases in T-cell migration to and within lymph
nodes. In: Blood 116 (25), S. 5536–5547.
Fätkenheuer, Gerd; Pozniak, Anton L.; Johnson, Margaret A.; Plettenberg, Andreas; Staszewski,
Schlomo; Hoepelman, Andy I M et al. (2005): Efficacy of short-term monotherapy with maraviroc, a
new CCR5 antagonist, in patients infected with HIV-1. In: Nat. Med. 11 (11), S. 1170–1172.
Feng, Dian; Nagy, Janice A.; Dvorak, Harold F.; Dvorak, Ann M. (2002): Ultrastructural studies define
soluble macromolecular, particulate, and cellular transendothelial cell pathways in venules, lymphatic
vessels, and tumor-associated microvessels in man and animals. In: Microsc. Res. Tech. 57 (5), S. 289–
326.
Feng, Y.; Broder, C. C.; Kennedy, P. E.; Berger, E. A. (1996): HIV-1 entry cofactor: functional cDNA
cloning of a seven-transmembrane, G protein-coupled receptor. In: Science 272 (5263), S. 872–877.
Flomenberg, Neal; Comenzo, Raymond L.; Badel, Karin; Calandra, Gary (2010): Plerixafor (Mozobil)
alone to mobilize hematopoietic stem cells from multiple myeloma patients for autologous
transplantation. In: Biol. Blood Marrow Transplant. 16 (5), S. 695–700.
Franciotta, D.; Martino, G.; Zardini, E.; Furlan, R.; Bergamaschi, R.; Andreoni, L.; Cosi, V. (2001):
Serum and CSF levels of MCP-1 and IP-10 in multiple sclerosis patients with acute and stable disease
and undergoing immunomodulatory therapies. In: J. Neuroimmunol. 115 (1-2), S. 192–198.
Frigerio, Simona; Junt, Tobias; Lu, Bao; Gerard, Craig; Zumsteg, Urs; Holländer, Georg A.; Piali, Luca
(2002): Beta cells are responsible for CXCR3-mediated T-cell infiltration in insulitis. In: Nat. Med. 8
(12), S. 1414–1420.
Furusato, Bungo; Mohamed, Ahmed; Uhlén, Mathias; Rhim, Johng S. (2010): CXCR4 and cancer. In:
Pathol. Int. 60 (7), S. 497–505.
Gabbay, M. Andrade Lima; Sato, M. N.; Duarte, A. J. S.; Dib, S. A. (2012): Serum titres of antiglutamic acid decarboxylase-65 and anti-IA-2 autoantibodies are associated with different
immunoregulatory milieu in newly diagnosed type 1 diabetes patients. In: Clin. Exp. Immunol. 168 (1),
S. 60–67.
García-Bernal, David; Wright, Natalia; Sotillo-Mallo, Elena; Nombela-Arrieta, César; Stein, Jens V.;
Bustelo, Xosé R.; Teixidó, Joaquin (2005): Vav1 and Rac control chemokine-promoted T lymphocyte
adhesion mediated by the integrin alpha4beta1. In: Mol. Biol. Cell 16 (7), S. 3223–3235.
Giegold, Oliver; Ogrissek, Nadine; Richter, Cornelia; Schröder, Matthias; Herrero San Juan, Martina;
Pfeilschifter, Josef M.; Radeke, Heinfried H. (2013): CXCL9 causes heterologous desensitization of
CXCL12-mediated memory T lymphocyte activation. In: J. Immunol. 190 (7), S. 3696–3705.
Ginsberg, Mark H.; Partridge, Anthony; Shattil, Sanford J. (2005): Integrin regulation. In: Curr. Opin.
Cell Biol. 17 (5), S. 509–516.
Gladue, Ronald P.; Tylaska, Laurie A.; Brissette, William H.; Lira, Paul D.; Kath, John C.; Poss,
Christopher S. et al. (2003): CP-481,715, a potent and selective CCR1 antagonist with potential
therapeutic implications for inflammatory diseases. In: J. Biol. Chem. 278 (42), S. 40473–40480.
95
LITERATURVERZEICHNIS
Hallmann, Rupert; Horn, Nathalie; Selg, Manuel; Wendler, Olaf; Pausch, Friederike; Sorokin, Lydia M.
(2005): Expression and function of laminins in the embryonic and mature vasculature. In: Physiol. Rev.
85 (3), S. 979–1000.
Hanaoka, Ryosuke; Kasama, Tsuyoshi; Muramatsu, Mizuho; Yajima, Nobuyuki; Shiozawa, Fumitaka;
Miwa, Yusuke et al. (2003): A novel mechanism for the regulation of IFN-gamma inducible protein-10
expression in rheumatoid arthritis. In: Arthritis Res. Ther. 5 (2), S. R74-81.
Hancock, W. W.; Lu, B.; Gao, W.; Csizmadia, V.; Faia, K.; King, J. A. et al. (2000): Requirement of the
chemokine receptor CXCR3 for acute allograft rejection. In: J. Exp. Med. 192 (10), S. 1515–1520.
Hanna, Suhair; Etzioni, Amos (2012): Leukocyte adhesion deficiencies. In: Ann. N. Y. Acad. Sci. 1250,
S. 50–55.
Hecht, Iris; Cahalon, Liora; Hershkoviz, Rami; Lahat, Adi; Franitza, Suzanne; Lider, Ofer (2003):
Heterologous desensitization of T cell functions by CCR5 and CXCR4 ligands: inhibition of cellular
signaling, adhesion and chemotaxis. In: Int. Immunol. 15 (1), S. 29–38.
Hensbergen, Paul J.; Wijnands, Pepijn G. J. T. B.; Schreurs, Marco W. J.; Scheper, Rik J.; Willemze,
Rein; Tensen, Cornelis P. (2005): The CXCR3 targeting chemokine CXCL11 has potent antitumor
activity in vivo involving attraction of CD8+ T lymphocytes but not inhibition of angiogenesis. In: J.
Immunother. 28 (4), S. 343–351.
Hermann, Patrick C.; Huber, Stephan L.; Herrler, Tanja; Aicher, Alexandra; Ellwart, Joachim W.;
Guba, Markus et al. (2007): Distinct populations of cancer stem cells determine tumor growth and
metastatic activity in human pancreatic cancer. In: Cell Stem Cell 1 (3), S. 313–323.
Hernandez, Paolo A.; Gorlin, Robert J.; Lukens, John N.; Taniuchi, Shoichiro; Bohinjec, Joze; Francois,
Fleur et al. (2003): Mutations in the chemokine receptor gene CXCR4 are associated with WHIM
syndrome, a combined immunodeficiency disease. In: Nat. Genet. 34 (1), S. 70–74.
Hesselgesser, J.; Ng, H. P.; Liang, M.; Zheng, W.; May, K.; Bauman, J. G. et al. (1998): Identification
and characterization of small molecule functional antagonists of the CCR1 chemokine receptor. In: J.
Biol. Chem. 273 (25), S. 15687–15692.
Hickey, W. F. (1999): The pathology of multiple sclerosis: a historical perspective. In: J.
Neuroimmunol. 98 (1), S. 37–44.
Hidalgo, Andrés; Peired, Anna J.; Wild, Martin K.; Vestweber, Dietmar; Frenette, Paul S. (2007):
Complete identification of E-selectin ligands on neutrophils reveals distinct functions of PSGL-1, ESL-1,
and CD44. In: Immunity 26 (4), S. 477–489.
Horuk, Richard (2009): Chemokine receptor antagonists: overcoming developmental hurdles. In: Nat
Rev Drug Discov 8 (1), S. 23–33.
Huang, A. J.; Manning, J. E.; Bandak, T. M.; Ratau, M. C.; Hanser, K. R.; Silverstein, S. C. (1993):
Endothelial cell cytosolic free calcium regulates neutrophil migration across monolayers of endothelial
cells. In: J. Cell Biol. 120 (6), S. 1371–1380.
Hynes, Richard O. (2002): Integrins: bidirectional, allosteric signaling machines. In: Cell 110 (6), S.
673–687.
Infantino, Simona; Moepps, Barbara; Thelen, Marcus (2006): Expression and regulation of the orphan
receptor RDC1 and its putative ligand in human dendritic and B cells. In: J. Immunol. 176 (4), S.
2197–2207.
Ivetic, A.; Ridley, A. J. (2004): The telling tail of L-selectin. In: Biochem. Soc. Trans. 32 (Pt 6), S. 1118–
1121.
96
LITERATURVERZEICHNIS
Jaalouk, Diana E.; Lejeune, Laurence; Couture, Clément; Galipeau, Jacques (2006): A self-inactivating
retrovector incorporating the IL-2 promoter for activation-induced transgene expression in genetically
engineered T-cells. In: Virol. J. 3, S. 97.
Jamjian, M. Christine; McNicholl, Ian R. (2004): Enfuvirtide: first fusion inhibitor for treatment of HIV
infection. In: Am J Health Syst Pharm 61 (12), S. 1242–1247.
Johnson, Michael; Li, An-Rong; Liu, Jiwen; Fu, Zice; Zhu, Liusheng; Miao, Shichang et al. (2007):
Discovery and optimization of a series of quinazolinone-derived antagonists of CXCR3. In: Bioorg. Med.
Chem. Lett. 17 (12), S. 3339–3343.
Johnson, Z.; Power, C. A.; Weiss, C.; Rintelen, F.; Ji, H.; Ruckle, T. et al. (2004): Chemokine
inhibition--why, when, where, which and how? In: Biochem. Soc. Trans. 32 (Pt 2), S. 366–377.
Johnson, Zoë; Schwarz, Matthias; Power, Christine A.; Wells, Timothy N C; Proudfoot, Amanda E I
(2005): Multi-faceted strategies to combat disease by interference with the chemokine system. In:
Trends Immunol. 26 (5), S. 268–274.
Kerkar, Sid P. (2013): "Model T" Cells: A Time-Tested Vehicle for Gene Therapy. In: Front Immunol 4,
S. 304.
Kim, S. H.; Kim, S.; Evans, C. H.; Ghivizzani, S. C.; Oligino, T.; Robbins, P. D. (2001): Effective
treatment of established murine collagen-induced arthritis by systemic administration of dendritic cells
genetically modified to express IL-4. In: J. Immunol. 166 (5), S. 3499–3505.
Kledal, T. N.; Rosenkilde, M. M.; Coulin, F.; Simmons, G.; Johnsen, A. H.; Alouani, S. et al. (1997): A
broad-spectrum chemokine antagonist encoded by Kaposi's sarcoma-associated herpesvirus. In: Science
277 (5332), S. 1656–1659.
Klein, Robyn S.; Izikson, Leonid; Means, Terry; Gibson, Hilary D.; Lin, Eugene; Sobel, Raymond A. et
al. (2004): IFN-inducible protein 10/CXC chemokine ligand 10-independent induction of experimental
autoimmune encephalomyelitis. In: J. Immunol. 172 (1), S. 550–559.
Kohler, Rachel E.; Comerford, Iain; Townley, Scott; Haylock-Jacobs, Sarah; Clark-Lewis, Ian; McColl,
Shaun R. (2008): Antagonism of the chemokine receptors CXCR3 and CXCR4 reduces the pathology of
experimental autoimmune encephalomyelitis. In: Brain Pathol. 18 (4), S. 504–516.
Korniejewska, Anna; McKnight, Andrew J.; Johnson, Zoë; Watson, Malcolm L.; Ward, Stephen G.
(2011): Expression and agonist responsiveness of CXCR3 variants in human T lymphocytes. In:
Immunology 132 (4), S. 503–515.
Kramp, Birgit K.; Sarabi, Alisina; Koenen, Rory R.; Weber, Christian (2011): Heterophilic chemokine
receptor interactions in chemokine signaling and biology. In: Exp. Cell Res. 317 (5), S. 655–663.
Krumbholz, Markus; Theil, Diethilde; Cepok, Sabine; Hemmer, Bernhard; Kivisäkk, Pia; Ransohoff,
Richard M. et al. (2006): Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is
differentially linked to CNS immune cell recruitment. In: Brain 129 (Pt 1), S. 200–211.
Kwak, Han Bok; Ha, Hyunil; Kim, Ha-Neui; Lee, Jong-Ho; Kim, Hun Soo; Lee, Seungbok et al. (2008):
Reciprocal cross-talk between RANKL and interferon-gamma-inducible protein 10 is responsible for
bone-erosive experimental arthritis. In: Arthritis Rheum. 58 (5), S. 1332–1342.
Lacotte, Stéphanie; Brun, Susana; Muller, Sylviane; Dumortier, Hélène (2009): CXCR3, inflammation,
and autoimmune diseases. In: Ann. N. Y. Acad. Sci. 1173, S. 310–317.
Lasagni, Laura; Francalanci, Michela; Annunziato, Francesco; Lazzeri, Elena; Giannini, Stefano; Cosmi,
Lorenzo et al. (2003): An alternatively spliced variant of CXCR3 mediates the inhibition of endothelial
cell growth induced by IP-10, Mig, and I-TAC, and acts as functional receptor for platelet factor 4. In:
J. Exp. Med. 197 (11), S. 1537–1549.
97
LITERATURVERZEICHNIS
Lassmann, H.; Brück, W.; Lucchinetti, C. (2001): Heterogeneity of multiple sclerosis pathogenesis:
implications for diagnosis and therapy. In: Trends Mol Med 7 (3), S. 115–121.
Lawrence, M. B.; Kansas, G. S.; Kunkel, E. J.; Ley, K. (1997): Threshold levels of fluid shear promote
leukocyte adhesion through selectins (CD62L,P,E). In: J. Cell Biol. 136 (3), S. 717–727.
Lee, Eun Young; Lee, Zang Hee; Song, Yeong Wook (2013): The interaction between CXCL10 and
cytokines in chronic inflammatory arthritis. In: Autoimmun Rev 12 (5), S. 554–557.
Levine, S.; Saltzman, A. (1989): The hyperacute form of allergic encephalomyelitis produced in rats
without the aid of pertussis vaccine. In: J. Neuropathol. Exp. Neurol. 48 (3), S. 255–262.
Levoye, Angélique; Balabanian, Karl; Baleux, Françoise; Bachelerie, Françoise; Lagane, Bernard
(2009): CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. In:
Blood 113 (24), S. 6085–6093.
Ley, Klaus (2003): The role of selectins in inflammation and disease. In: Trends Mol Med 9 (6), S. 263–
268.
Li, An-Rong; Johnson, Michael G.; Liu, Jiwen; Chen, Xiaoqi; Du, Xiaohui; Mihalic, Jeffrey T. et al.
(2008): Optimization of the heterocyclic core of the quinazolinone-derived CXCR3 antagonists. In:
Bioorg. Med. Chem. Lett. 18 (2), S. 688–693.
Lindow, Morten; Nansen, Anneline; Bartholdy, Christina; Stryhn, Annette; Hansen, Nils J. V.; Boesen,
Thomas P. et al. (2003): The virus-encoded chemokine vMIP-II inhibits virus-induced Tc1-driven
inflammation. In: J. Virol. 77 (13), S. 7393–7400.
Li, Z.; Jiang, H.; Xie, W.; Zhang, Z.; Smrcka, A. V.; Wu, D. (2000): Roles of PLC-beta2 and -beta3 and
PI3Kgamma in chemoattractant-mediated signal transduction. In: Science 287 (5455), S. 1046–1049.
Loetscher, M.; Gerber, B.; Loetscher, P.; Jones, S. A.; Piali, L.; Clark-Lewis, I. et al. (1996): Chemokine
receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. In:
J. Exp. Med. 184 (3), S. 963–969.
Lo, Jeannette; Clare-Salzler, Michael J. (2006): Dendritic cell subsets and type I diabetes: focus upon
DC-based therapy. In: Autoimmun Rev 5 (6), S. 419–423.
Lopes, Fernando; Coelho, Fernanda M.; Costa, Vivian V.; Vieira, Érica L. M.; Sousa, Lirlândia P.; Silva,
Tarcília A. et al. (2011): Resolution of neutrophilic inflammation by H2O2 in antigen-induced arthritis.
In: Arthritis Rheum. 63 (9), S. 2651–2660.
Lu, B.; Humbles, A.; Bota, D.; Gerard, C.; Moser, B.; Soler, D. et al. (1999): Structure and function of
the murine chemokine receptor CXCR3. In: Eur. J. Immunol. 29 (11), S. 3804–3812.
Lucchinetti, C.; Brück, W.; Parisi, J.; Scheithauer, B.; Rodriguez, M.; Lassmann, H. (2000):
Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. In: Ann.
Neurol. 47 (6), S. 707–717.
Ludwig, Ralf J.; Zollner, Thomas M.; Santoso, Sentot; Hardt, Katja; Gille, Jens; Baatz, Holger et al.
(2005): Junctional adhesion molecules (JAM)-B and -C contribute to leukocyte extravasation to the
skin and mediate cutaneous inflammation. In: J. Invest. Dermatol. 125 (5), S. 969–976.
Luker, K. E.; Steele, J. M.; Mihalko, L. A.; Ray, P.; Luker, G. D. (2010): Constitutive and chemokinedependent internalization and recycling of CXCR7 in breast cancer cells to degrade chemokine ligands.
In: Oncogene 29 (32), S. 4599–4610.
Madri, J. A.; Graesser, D. (2000): Cell migration in the immune system: the evolving inter-related roles
of adhesion molecules and proteinases. In: Dev. Immunol. 7 (2-4), S. 103–116.
Mahabaleshwar, Harsha; Tarbashevich, Katsiaryna; Nowak, Matthias; Brand, Michael; Raz, Erez
(2012): β-arrestin control of late endosomal sorting facilitates decoy receptor function and chemokine
gradient formation. In: Development 139 (16), S. 2897–2902.
98
LITERATURVERZEICHNIS
Mahad, D. J.; Lawry, J.; Howell, S. J. L.; Woodroofe, M. N. (2003): Longitudinal study of chemokine
receptor expression on peripheral lymphocytes in multiple sclerosis: CXCR3 upregulation is associated
with relapse. In: Mult. Scler. 9 (2), S. 189–198.
Mamdouh, Zahra; Mikhailov, Alexei; Muller, William A. (2009): Transcellular migration of leukocytes
is mediated by the endothelial lateral border recycling compartment. In: J. Exp. Med. 206 (12), S.
2795–2808.
Ma, Q.; Jones, D.; Borghesani, P. R.; Segal, R. A.; Nagasawa, T.; Kishimoto, T. et al. (1998): Impaired
B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1deficient mice. In: Proc. Natl. Acad. Sci. U.S.A. 95 (16), S. 9448–9453.
Marchese, A.; Benovic, J. L. (2001): Agonist-promoted ubiquitination of the G protein-coupled receptor
CXCR4 mediates lysosomal sorting. In: J. Biol. Chem. 276 (49), S. 45509–45512.
Marchese, Adriano (2014): Endocytic trafficking of chemokine receptors. In: Curr. Opin. Cell Biol. 27C,
S. 72–77.
McDonald, W. I.; Compston, A.; Edan, G.; Goodkin, D.; Hartung, H. P.; Lublin, F. D. et al. (2001):
Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the
diagnosis of multiple sclerosis. In: Ann. Neurol. 50 (1), S. 121–127.
McGavern, Dorian B.; Christen, Urs; Oldstone, Michael B. A. (2002): Molecular anatomy of antigenspecific CD8(+) T cell engagement and synapse formation in vivo. In: Nat. Immunol. 3 (10), S. 918–
925.
Melter, M.; Exeni, A.; Reinders, M. E.; Fang, J. C.; McMahon, G.; Ganz, P. et al. (2001): Expression of
the chemokine receptor CXCR3 and its ligand IP-10 during human cardiac allograft rejection. In:
Circulation 104 (21), S. 2558–2564.
Mikami, Sakae; Nakase, Hiroshi; Yamamoto, Shuji; Takeda, Yasuhiro; Yoshino, Takuya; Kasahara,
Katushiro et al. (2008): Blockade of CXCL12/CXCR4 axis ameliorates murine experimental colitis. In:
J. Pharmacol. Exp. Ther. 327 (2), S. 383–392.
Miki, Jun; Furusato, Bungo; Li, Hongzhen; Gu, Yongpeng; Takahashi, Hiroyuki; Egawa, Shin et al.
(2007): Identification of putative stem cell markers, CD133 and CXCR4, in hTERT-immortalized
primary nonmalignant and malignant tumor-derived human prostate epithelial cell lines and in
prostate cancer specimens. In: Cancer Res. 67 (7), S. 3153–3161.
Millán, Jaime; Hewlett, Lindsay; Glyn, Matthew; Toomre, Derek; Clark, Peter; Ridley, Anne J. (2006):
Lymphocyte transcellular migration occurs through recruitment of endothelial ICAM-1 to caveola- and
F-actin-rich domains. In: Nat. Cell Biol. 8 (2), S. 113–123.
Misu, T.; Onodera, H.; Fujihara, K.; Matsushima, K.; Yoshie, O.; Okita, N. et al. (2001): Chemokine
receptor expression on T cells in blood and cerebrospinal fluid at relapse and remission of multiple
sclerosis: imbalance of Th1/Th2-associated chemokine signaling. In: J. Neuroimmunol. 114 (1-2), S.
207–212.
Moll, Natalia M.; Cossoy, Michael B.; Fisher, Elizabeth; Staugaitis, Susan M.; Tucky, Barbara H.;
Rietsch, Anna M. et al. (2009): Imaging correlates of leukocyte accumulation and CXCR4/CXCL12 in
multiple sclerosis. In: Arch. Neurol. 66 (1), S. 44–53.
Molon, Barbara; Gri, Giorgia; Bettella, Monica; Gómez-Moutón, Concepción; Lanzavecchia, Antonio;
Martínez-A, Carlos et al. (2005): T cell costimulation by chemokine receptors. In: Nat. Immunol. 6 (5),
S. 465–471.
Mueller, Andre Michael; Yoon, Bo Hyung; Sadiq, Saud Ahmed (2014): Inhibition of hyaluronan (HA)
synthesis protects against CNS autoimmunity and increases CXCL12 expression in the inflamed CNS.
In: J. Biol. Chem.
99
LITERATURVERZEICHNIS
Müller, A.; Homey, B.; Soto, H.; Ge, N.; Catron, D.; Buchanan, M. E. et al. (2001): Involvement of
chemokine receptors in breast cancer metastasis. In: Nature 410 (6824), S. 50–56.
Muller, William A. (2003): Leukocyte-endothelial-cell interactions in leukocyte transmigration and the
inflammatory response. In: Trends Immunol. 24 (6), S. 327–334.
Muller, William A. (2011): Mechanisms of leukocyte transendothelial migration. In: Annu Rev Pathol 6,
S. 323–344.
Murphy, P. M. (1994): The molecular biology of leukocyte chemoattractant receptors. In: Annu. Rev.
Immunol. 12, S. 593–633.
Murphy, P. M.; Baggiolini, M.; Charo, I. F.; Hébert, C. A.; Horuk, R.; Matsushima, K. et al. (2000):
International union of pharmacology. XXII. Nomenclature for chemokine receptors. In: Pharmacol. Rev.
52 (1), S. 145–176.
Nagasawa, T.; Tachibana, K.; Kishimoto, T. (1998): A novel CXC chemokine PBSF/SDF-1 and its
receptor CXCR4: their functions in development, hematopoiesis and HIV infection. In: Semin. Immunol.
10 (3), S. 179–185.
Nakagawa, Yoshinori; Shimada, Akira; Oikawa, Yoichi; Irie, Jun-ichiro; Shigihara, Toshikatsu;
Tsumura, Kazuhiro et al. (2003): Two cases of "fulminant" type 1 diabetes suggesting involvement of
autoimmunity. In: Ann. N. Y. Acad. Sci. 1005, S. 359–361.
Nanki, T.; Hayashida, K.; El-Gabalawy, H. S.; Suson, S.; Shi, K.; Girschick, H. J. et al. (2000): Stromal
cell-derived factor-1-CXC chemokine receptor 4 interactions play a central role in CD4+ T cell
accumulation in rheumatoid arthritis synovium. In: J. Immunol. 165 (11), S. 6590–6598.
Narumi, Shosaku; Kaburaki, Toshikatu; Yoneyama, Hiroyuki; Iwamura, Hiroyuki; Kobayashi, Yuko;
Matsushima, Kouji (2002): Neutralization of IFN-inducible protein 10/CXCL10 exacerbates
experimental autoimmune encephalomyelitis. In: Eur. J. Immunol. 32 (6), S. 1784–1791.
Naumann, Ulrike; Cameroni, Elisabetta; Pruenster, Monika; Mahabaleshwar, Harsha; Raz, Erez;
Zerwes, Hans-Günter et al. (2010): CXCR7 functions as a scavenger for CXCL12 and CXCL11. In: PLoS
ONE 5 (2), S. e9175.
Naya, Akira; Kobayashi, Kensuke; Ishikawa, Makoto; Ohwaki, Kenji; Saeki, Toshihiko; Noguchi,
Kazuhito;
Ohtake,
Norikazu
(2003):
Structure-activity
relationships
of
2(benzothiazolylthio)acetamide class of CCR3 selective antagonist. In: Chem. Pharm. Bull. 51 (6), S.
697–701.
Neel, Nicole F.; Schutyser, Evemie; Sai, Jiqing; Fan, Guo-Huang; Richmond, Ann (2005): Chemokine
receptor internalization and intracellular trafficking. In: Cytokine Growth Factor Rev. 16 (6), S. 637–
658.
Neptune, E. R.; Iiri, T.; Bourne, H. R. (1999): Galphai is not required for chemotaxis mediated by Gicoupled receptors. In: J. Biol. Chem. 274 (5), S. 2824–2828.
Nicoletti, F.; Conget, I.; Di Mauro, M.; Di Marco, R.; Mazzarino, M. C.; Bendtzen, K. et al. (2002):
Serum concentrations of the interferon-gamma-inducible chemokine IP-10/CXCL10 are augmented in
both newly diagnosed Type I diabetes mellitus patients and subjects at risk of developing the disease.
In: Diabetologia 45 (8), S. 1107–1110.
Oldstone, M. B.; Nerenberg, M.; Southern, P.; Price, J.; Lewicki, H. (1991): Virus infection triggers
insulin-dependent diabetes mellitus in a transgenic model: role of anti-self (virus) immune response.
In: Cell 65 (2), S. 319–331.
Omari, Kakuri M.; John, Gareth R.; Sealfon, Stuart C.; Raine, Cedric S. (2005): CXC chemokine
receptors on human oligodendrocytes: implications for multiple sclerosis. In: Brain 128 (Pt 5), S.
1003–1015.
100
LITERATURVERZEICHNIS
Orsini, M. J.; Parent, J. L.; Mundell, S. J.; Marchese, A.; Benovic, J. L. (1999): Trafficking of the HIV
coreceptor CXCR4. Role of arrestins and identification of residues in the c-terminal tail that mediate
receptor internalization. In: J. Biol. Chem. 274 (43), S. 31076–31086.
Otero, Carolina; Groettrup, Marcus; Legler, Daniel F. (2006): Opposite fate of endocytosed CCR7 and
its ligands: recycling versus degradation. In: J. Immunol. 177 (4), S. 2314–2323.
Petri, Björn; Kaur, Jaswinder; Long, Elizabeth M.; Li, Hang; Parsons, Sean A.; Butz, Stefan et al.
(2011): Endothelial LSP1 is involved in endothelial dome formation, minimizing vascular permeability
changes during neutrophil transmigration in vivo. In: Blood 117 (3), S. 942–952.
Phillipson, Mia; Kaur, Jaswinder; Colarusso, Pina; Ballantyne, Christie M.; Kubes, Paul (2008):
Endothelial domes encapsulate adherent neutrophils and minimize increases in vascular permeability
in paracellular and transcellular emigration. In: PLoS ONE 3 (2), S. e1649.
Picanco-Castro, Virginia; Sousa Russo-Carbolante, Elisa Maria de; Tadeu Covas, Dimas (2012):
Advances in lentiviral vectors: a patent review. In: Recent Pat DNA Gene Seq 6 (2), S. 82–90.
Pillai, Radhakrishna G.; Beutelspacher, Sven C.; Larkin, D. Frank P.; George, Andrew J. T. (2008):
Expression of the chemokine antagonist vMIP II using a non-viral vector can prolong corneal allograft
survival. In: Transplantation 85 (11), S. 1640–1647.
Proudfoot, A. E.; Buser, R.; Borlat, F.; Alouani, S.; Soler, D.; Offord, R. E. et al. (1999): Aminoterminally modified RANTES analogues demonstrate differential effects on RANTES receptors. In: J.
Biol. Chem. 274 (45), S. 32478–32485.
Proudfoot, Amanda E. I.; Power, Christine A.; Schwarz, Matthias K. (2010): Anti-chemokine small
molecule drugs: a promising future? In: Expert Opin Investig Drugs 19 (3), S. 345–355.
Rahman, Arshad; Fazal, Fabeha (2009): Hug tightly and say goodbye: role of endothelial ICAM-1 in
leukocyte transmigration. In: Antioxid. Redox Signal. 11 (4), S. 823–839.
Rajagopal, Sudarshan; Kim, Jihee; Ahn, Seungkirl; Craig, Stewart; Lam, Christopher M.; Gerard,
Norma P. et al. (2010): Beta-arrestin- but not G protein-mediated signaling by the "decoy" receptor
CXCR7. In: Proc. Natl. Acad. Sci. U.S.A. 107 (2), S. 628–632.
Ransohoff, Richard M. (2006): EAE: pitfalls outweigh virtues of screening potential treatments for
multiple sclerosis. In: Trends Immunol. 27 (4), S. 167–168.
Raphael, Itay; Nalawade, Saisha; Eagar, Todd N.; Forsthuber, Thomas G. (2014): T cell subsets and
their signature cytokines in autoimmune and inflammatory diseases. In: Cytokine.
Ray, Paramita; Mihalko, Laura Anne; Coggins, Nathaniel L.; Moudgil, Pranav; Ehrlich, Anna; Luker,
Kathryn E.; Luker, Gary D. (2012): Carboxy-terminus of CXCR7 regulates receptor localization and
function. In: Int. J. Biochem. Cell Biol. 44 (4), S. 669–678.
Rhode, Antje; Pauza, Mary E.; Barral, Ana Maria; Rodrigo, Evelyn; Oldstone, Michael B. A.; Herrath,
Matthias G. von; Christen, Urs (2005): Islet-specific expression of CXCL10 causes spontaneous islet
infiltration and accelerates diabetes development. In: J. Immunol. 175 (6), S. 3516–3524.
Roep, B. O.; Kleijwegt, F. S.; van Halteren, A. G. S.; Bonato, V.; Boggi, U.; Vendrame, F. et al. (2010):
Islet inflammation and CXCL10 in recent-onset type 1 diabetes. In: Clin. Exp. Immunol. 159 (3), S.
338–343.
Rubant, Simone; Ludwig, Ralf J.; Pfeffer, Jeannette; Schulze-Johann, Petra; Kaufmann, Roland;
Pfeilschifter, Josef M. et al. (2006): Eukaryotic expression of the broad-spectrum chemokine receptor
antagonist vMIP-II and its effects on T-cell function in vitro and in vivo. In: Exp. Dermatol. 15 (8), S.
634–642.
101
LITERATURVERZEICHNIS
Ruth, J. H.; Rottman, J. B.; Katschke, K. J.; Qin, S.; Wu, L.; LaRosa, G. et al. (2001): Selective
lymphocyte chemokine receptor expression in the rheumatoid joint. In: Arthritis Rheum. 44 (12), S.
2750–2760.
Sallusto, F.; Kremmer, E.; Palermo, B.; Hoy, A.; Ponath, P.; Qin, S. et al. (1999): Switch in chemokine
receptor expression upon TCR stimulation reveals novel homing potential for recently activated T cells.
In: Eur. J. Immunol. 29 (6), S. 2037–2045.
Sánchez-Alcañiz, Juan Antonio; Haege, Sammy; Mueller, Wiebke; Pla, Ramón; Mackay, Fabienne;
Schulz, Stefan et al. (2011): Cxcr7 controls neuronal migration by regulating chemokine
responsiveness. In: Neuron 69 (1), S. 77–90.
Sauty, A.; Colvin, R. A.; Wagner, L.; Rochat, S.; Spertini, F.; Luster, A. D. (2001): CXCR3
internalization following T cell-endothelial cell contact: preferential role of IFN-inducible T cell alpha
chemoattractant (CXCL11). In: J. Immunol. 167 (12), S. 7084–7093.
Schnickel, Gabriel T.; Bastani, Sam; Hsieh, George R.; Shefizadeh, Ali; Bhatia, Rubina; Fishbein,
Michael C. et al. (2008): Combined CXCR3/CCR5 blockade attenuates acute and chronic rejection. In:
J. Immunol. 180 (7), S. 4714–4721.
Schwarz, Agatha; Maeda, Akira; Wild, Martin K.; Kernebeck, Kerstin; Gross, Nicole; Aragane, Yoshinori
et al. (2004): Ultraviolet radiation-induced regulatory T cells not only inhibit the induction but can
suppress the effector phase of contact hypersensitivity. In: J. Immunol. 172 (2), S. 1036–1043.
Serhan, Charles N. (2014): Pro-resolving lipid mediators are leads for resolution physiology. In: Nature
510 (7503), S. 92–101.
Servant, G.; Weiner, O. D.; Neptune, E. R.; Sedat, J. W.; Bourne, H. R. (1999): Dynamics of a
chemoattractant receptor in living neutrophils during chemotaxis. In: Mol. Biol. Cell 10 (4), S. 1163–
1178.
Shimada, A.; Morimoto, J.; Kodama, K.; Suzuki, R.; Oikawa, Y.; Funae, O. et al. (2001): Elevated
serum IP-10 levels observed in type 1 diabetes. In: Diabetes Care 24 (3), S. 510–515.
Singh, Anup Kumar; Arya, Rakesh Kumar; Trivedi, Arun Kumar; Sanyal, Sabyasachi; Baral,
Rathindranath; Dormond, Olivier et al. (2013): Chemokine receptor trio: CXCR3, CXCR4 and CXCR7
crosstalk via CXCL11 and CXCL12. In: Cytokine Growth Factor Rev. 24 (1), S. 41–49.
Song, Jeong Sup; Kang, Chun Mi; Kang, Hyeon Hui; Yoon, Hyung Kyu; Kim, Young Kyoon; Kim, Kwan
Hyung et al. (2010): Inhibitory effect of CXC chemokine receptor 4 antagonist AMD3100 on bleomycin
induced murine pulmonary fibrosis. In: Exp. Mol. Med. 42 (6), S. 465–472.
Sørensen, Torben L.; Trebst, Corinna; Kivisäkk, Pia; Klaege, Karen L.; Majmudar, Amit; Ravid, Rivka et
al. (2002): Multiple sclerosis: a study of CXCL10 and CXCR3 co-localization in the inflamed central
nervous system. In: J. Neuroimmunol. 127 (1-2), S. 59–68.
Sotsios, Y.; Whittaker, G. C.; Westwick, J.; Ward, S. G. (1999): The CXC chemokine stromal cellderived factor activates a Gi-coupled phosphoinositide 3-kinase in T lymphocytes. In: J. Immunol. 163
(11), S. 5954–5963.
Sousa, Lirlândia Pires; Alessandri, Ana Leticia; Pinho, Vanessa; Teixeira, Mauro Martins (2013):
Pharmacological strategies to resolve acute inflammation. In: Curr Opin Pharmacol 13 (4), S. 625–631.
Sozzani, S.; Luini, W.; Bianchi, G.; Allavena, P.; Wells, T. N.; Napolitano, M. et al. (1998): The viral
chemokine macrophage inflammatory protein-II is a selective Th2 chemoattractant. In: Blood 92 (11),
S. 4036–4039.
Sperandio, Markus (2006): Selectins and glycosyltransferases in leukocyte rolling in vivo. In: FEBS J.
273 (19), S. 4377–4389.
102
LITERATURVERZEICHNIS
Sperandio, Markus; Smith, Michael L.; Forlow, S. Bradley; Olson, Timothy S.; Xia, Lijun; McEver,
Rodger P.; Ley, Klaus (2003): P-selectin glycoprotein ligand-1 mediates L-selectin-dependent leukocyte
rolling in venules. In: J. Exp. Med. 197 (10), S. 1355–1363.
Stefanidakis, Michael; Koivunen, Erkki (2006): Cell-surface association between matrix
metalloproteinases and integrins: role of the complexes in leukocyte migration and cancer progression.
In: Blood 108 (5), S. 1441–1450.
Steinman, L. (2001): Myelin-specific CD8 T cells in the pathogenesis of experimental allergic
encephalitis and multiple sclerosis. In: J. Exp. Med. 194 (5), S. F27-30.
Steinman, Lawrence; Zamvil, Scott S. (2005): Virtues and pitfalls of EAE for the development of
therapies for multiple sclerosis. In: Trends Immunol. 26 (11), S. 565–571.
Stephens, L.; Smrcka, A.; Cooke, F. T.; Jackson, T. R.; Sternweis, P. C.; Hawkins, P. T. (1994): A novel
phosphoinositide 3 kinase activity in myeloid-derived cells is activated by G protein beta gamma
subunits. In: Cell 77 (1), S. 83–93.
Szczuciński, Adam; Losy, Jacek (2007): Chemokines and chemokine receptors in multiple sclerosis.
Potential targets for new therapies. In: Acta Neurol. Scand. 115 (3), S. 137–146.
Szekanecz, Zoltán; Szücs, Gabriella; Szántó, Sándor; Koch, Alisa E. (2006): Chemokines in rheumatic
diseases. In: Curr Drug Targets 7 (1), S. 91–102.
Tachibana, K.; Hirota, S.; Iizasa, H.; Yoshida, H.; Kawabata, K.; Kataoka, Y. et al. (1998): The
chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. In: Nature 393
(6685), S. 591–594.
Takami, S.; Minami, M.; Nagata, I.; Namura, S.; Satoh, M. (2001): Chemokine receptor antagonist
peptide, viral MIP-II, protects the brain against focal cerebral ischemia in mice. In: J. Cereb. Blood Flow
Metab. 21 (12), S. 1430–1435.
Tarner, Ingo H.; Slavin, Anthony J.; McBride, Jacqueline; Levicnik, Alenka; Smith, Richard; Nolan,
Garry P. et al. (2003): Treatment of autoimmune disease by adoptive cellular gene therapy. In: Ann. N.
Y. Acad. Sci. 998, S. 512–519.
Thelen, M. (2001): Dancing to the tune of chemokines. In: Nat. Immunol. 2 (2), S. 129–134.
Thelen, M.; Peveri, P.; Kernen, P.; Tscharner, V. von; Walz, A.; Baggiolini, M. (1988): Mechanism of
neutrophil activation by NAF, a novel monocyte-derived peptide agonist. In: FASEB J. 2 (11), S. 2702–
2706.
Tilton, B.; Ho, L.; Oberlin, E.; Loetscher, P.; Baleux, F.; Clark-Lewis, I.; Thelen, M. (2000): Signal
transduction by CXC chemokine receptor 4. Stromal cell-derived factor 1 stimulates prolonged protein
kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. In: J. Exp. Med. 192
(3), S. 313–324.
Timotijević, Gordana; Mostarica Stojković, Marija; Miljković, Djordje (2012): CXCL12: role in
neuroinflammation. In: Int. J. Biochem. Cell Biol. 44 (6), S. 838–841.
Trentin, L.; Agostini, C.; Facco, M.; Piazza, F.; Perin, A.; Siviero, M. et al. (1999): The chemokine
receptor CXCR3 is expressed on malignant B cells and mediates chemotaxis. In: J. Clin. Invest. 104 (1),
S. 115–121.
Tybulewicz, Victor L J; Henderson, Robert B. (2009): Rho family GTPases and their regulators in
lymphocytes. In: Nat. Rev. Immunol. 9 (9), S. 630–644.
Uno, Sae; Imagawa, Akihisa; Saisho, Kenji; Okita, Kohei; Iwahashi, Hiromi; Hanafusa, Toshiaki;
Shimomura, Iichiro (2010): Expression of chemokines, CXC chemokine ligand 10 (CXCL10) and
CXCR3 in the inflamed islets of patients with recent-onset autoimmune type 1 diabetes. In: Endocr. J.
57 (11), S. 991–996.
103
LITERATURVERZEICHNIS
Vago, Juliana P.; Nogueira, Camila R. C.; Tavares, Luciana P.; Soriani, Frederico M.; Lopes, Fernando;
Russo, Remo C. et al. (2012): Annexin A1 modulates natural and glucocorticoid-induced resolution of
inflammation by enhancing neutrophil apoptosis. In: J. Leukoc. Biol. 92 (2), S. 249–258.
Venetz, Daniel; Ponzoni, Maurilio; Schiraldi, Milena; Ferreri, Andrés J M; Bertoni, Francesco; Doglioni,
Claudio; Uguccioni, Mariagrazia (2010): Perivascular expression of CXCL9 and CXCL12 in primary
central nervous system lymphoma: T-cell infiltration and positioning of malignant B cells. In: Int. J.
Cancer 127 (10), S. 2300–2312.
Vestweber, D.; Blanks, J. E. (1999): Mechanisms that regulate the function of the selectins and their
ligands. In: Physiol. Rev. 79 (1), S. 181–213.
Vestweber, Dietmar (2002): Regulation of endothelial cell contacts during leukocyte extravasation. In:
Curr. Opin. Cell Biol. 14 (5), S. 587–593.
Vestweber, Dietmar (2007): Adhesion and signaling molecules controlling the transmigration of
leukocytes through endothelium. In: Immunol. Rev. 218, S. 178–196.
Vestweber, Dietmar (2012): Relevance of endothelial junctions in leukocyte extravasation and vascular
permeability. In: Ann. N. Y. Acad. Sci. 1257, S. 184–192.
Villalvilla, Amanda; Gomez, Rodolfo; Roman-Blas, Jorge A.; Largo, Raquel; Herrero-Beaumont, Gabriel
(2014): SDF-1 signaling: a promising target in rheumatic diseases. In: Expert Opin. Ther. Targets, S. 1–
11.
Wang, Andrew; Fairhurst, Anna-Marie; Tus, Katalin; Subramanian, Srividya; Liu, Yang; Lin, Fangming
et al. (2009): CXCR4/CXCL12 hyperexpression plays a pivotal role in the pathogenesis of lupus. In: J.
Immunol. 182 (7), S. 4448–4458.
Wang, Andrew; Guilpain, Philippe; Chong, Benjamin F.; Chouzenoux, Sandrine; Guillevin, Loïc; Du,
Yong et al. (2010): Dysregulated expression of CXCR4/CXCL12 in subsets of patients with systemic
lupus erythematosus. In: Arthritis Rheum. 62 (11), S. 3436–3446.
Wang, Jinhai; Norcross, Michael (2008): Dimerization of chemokine receptors in living cells: key to
receptor function and novel targets for therapy. In: Drug Discov. Today 13 (13-14), S. 625–632.
Wang, Shijun; Voisin, Mathieu-Benoit; Larbi, Karen Y.; Dangerfield, John; Scheiermann, Christoph;
Tran, Maxine et al. (2006): Venular basement membranes contain specific matrix protein low
expression regions that act as exit points for emigrating neutrophils. In: J. Exp. Med. 203 (6), S. 1519–
1532.
Wang, Xu; Sharp, Joshua S.; Handel, Tracy M.; Prestegard, James H. (2013): Chemokine
oligomerization in cell signaling and migration. In: Prog Mol Biol Transl Sci 117, S. 531–578.
Weber, K. S.; Gröne, H. J.; Röcken, M.; Klier, C.; Gu, S.; Wank, R. et al. (2001): Selective recruitment
of Th2-type cells and evasion from a cytotoxic immune response mediated by viral macrophage
inhibitory protein-II. In: Eur. J. Immunol. 31 (8), S. 2458–2466.
Weber, M.; Uguccioni, M.; Baggiolini, M.; Clark-Lewis, I.; Dahinden, C. A. (1996): Deletion of the
NH2-terminal residue converts monocyte chemotactic protein 1 from an activator of basophil mediator
release to an eosinophil chemoattractant. In: J. Exp. Med. 183 (2), S. 681–685.
Wedderburn, L. R.; Robinson, N.; Patel, A.; Varsani, H.; Woo, P. (2000): Selective recruitment of
polarized T cells expressing CCR5 and CXCR3 to the inflamed joints of children with juvenile
idiopathic arthritis. In: Arthritis Rheum. 43 (4), S. 765–774.
Wenzel, Joerg; Bekisch, Barbara; Uerlich, Manfred; Haller, Otto; Bieber, Thomas; Tüting, Thomas
(2005): Type I interferon-associated recruitment of cytotoxic lymphocytes: a common mechanism in
regressive melanocytic lesions. In: Am. J. Clin. Pathol. 124 (1), S. 37–48.
104
LITERATURVERZEICHNIS
Werner, Lael; Guzner-Gur, Hanan; Dotan, Iris (2013): Involvement of CXCR4/CXCR7/CXCL12
Interactions in Inflammatory bowel disease. In: Theranostics 3 (1), S. 40–46.
Wittchen, Erika S. (2009): Endothelial signaling in paracellular and transcellular leukocyte
transmigration. In: Front Biosci (Landmark Ed) 14, S. 2522–2545.
Woodfin, Abigail; Voisin, Mathieu-Benoit; Beyrau, Martina; Colom, Bartomeu; Caille, Dorothée;
Diapouli, Frantzeska-Maria et al. (2011): The junctional adhesion molecule JAM-C regulates polarized
transendothelial migration of neutrophils in vivo. In: Nat. Immunol. 12 (8), S. 761–769.
Xia, Lijun; Sperandio, Markus; Yago, Tadayuki; McDaniel, J. Michael; Cummings, Richard D.; PearsonWhite, Sonia et al. (2002): P-selectin glycoprotein ligand-1-deficient mice have impaired leukocyte
tethering to E-selectin under flow. In: J. Clin. Invest. 109 (7), S. 939–950.
Xiao, Z.; Zhang, N.; Murphy, D. B.; Devreotes, P. N. (1997): Dynamic distribution of chemoattractant
receptors in living cells during chemotaxis and persistent stimulation. In: J. Cell Biol. 139 (2), S. 365–
374.
Yin, Z.; Siegert, S.; Neure, L.; Grolms, M.; Liu, L.; Eggens, U. et al. (1999): The elevated ratio of
interferon gamma-/interleukin-4-positive T cells found in synovial fluid and synovial membrane of
rheumatoid arthritis patients can be changed by interleukin-4 but not by interleukin-10 or
transforming growth factor beta. In: Rheumatology (Oxford) 38 (11), S. 1058–1067.
Zack, Jerome A.; Kim, Sohn G.; Vatakis, Dimitrios N. (2013): HIV restriction in quiescent CD4⁺ T cells.
In: Retrovirology 10, S. 37.
Zipp, F.; Hartung, H. P.; Hillert, J.; Schimrigk, S.; Trebst, C.; Stangel, M. et al. (2006): Blockade of
chemokine signaling in patients with multiple sclerosis. In: Neurology 67 (10), S. 1880–1883.
105
ABKÜRZUNGSVERZEICHNIS
7. Abkürzungsverzeichnis
Amp
AP-1
APC
ATP
BSA
Ca2+
cAMP
CD
cDNA
CFSE
CMV
CRA
CT
CTL
CXCL, CCL, CX3CL, XCL
CXCR, CCR, CX3CR, XCR
Cy7
DAG
dest. H2O
DMSO
DNA
dNTPs
EAE
EC50
E. coli
EDTA
EF1
EL-4
ELISA
FACS
FCS
FITC
GAG
GAPDH
GFP
HEK
IF12
IFN-γ
IL
IL2-p
IP2
IP3
IRES
JURKAT
Ampicilin
activator protein 1
Fluorochrom Allophycocyanin
Adenosintriphosphat
Rinderalbumin
Calcium-Ionen
Cyclisches Adenosinmonophosphat
Differenzierungsmarker
Komplementäre DNA
Carboxyfluorescein-Succinimidyl Ester
Promoter des Cytomegalovirus
Chemokinrezeptor-Antagonist
Chemotaxis
Cytotoxische T-Lymphozyten
Chemokinrezeptor-Liganden
Chemokinrezeptoren
Fluorochrom Cyanin7
Diacylglycerol
destilliertes Wasser
Dimethylsulfoxid
Desoxyribonukleinsäure
Desoxyribonukleosidtriphasphate
Experimentelle autoimmune Enzephalitis
Mittlere effektive Konzentration
Escherichia coli
Ethylendiamintetraessigsäure
Promoter des humanen Proteins Elongationsfaktors-1 alpha
Murine Thymus Lymphom Zelllinie
Enzym-gekoppelter Immunadsorptionstest
Fluoreszenz-aktivierte Zellsortierung
Fetales Kälberserum
Fluorochrom Fluoresceinisothiocyanat
Glykosaminoglykane
Glycerinaldehyd-3-phosphat-Dehydrogenase
Grün fluoreszierendes Protein
Zelllinie aus menschlichen embryonalen Nierenzellen
Zelllinie aus murinen Th1-Gedächtniszellen
Interferon-gamma
Interleukin
Interleukin-2 Promoterelement
Phosphatidylinositol-3,4-bisphosphat
Inositoltrisphosphat
Interne ribosomale Eintrittsstelle
Leukämie-Zelllinie menschlicher T-Zellen
106
ABKÜRZUNGSVERZEICHNIS
K
K562
LTR
LV
MAPK
MCS
MHC
mRNA
MS
n
NFAT
PBS
PCR
PE
PEI
PFA
PI3K
PK
PL
PMA
Puro
R2
RA
Rac
RFP
RNA
RT
rtTA3
SD
SDS
shRNAmir
TBS
TCR
Th1-, Th2-, Th17-, TfhTNF-α
TRE
T2A
UBC
vMIP-II
WB
Zeo
Kontrolle
humane myeloische Leukämie-Zelllinie
DNA-Wiederholungssequenzen
Leervektor
Mitogen-activierte Proteinkinase
Multiple Klonierungsstelle
Haupthistokompatibilitätskomplex
Boten/“messenger“-RNA
Multiple Sklerose
Anzahl der Durchgänge
nuclear factor of activated T cells
Phosphat-gepufferte Salzlösung
Polymerase-Kettenreaktion
Fluorochrom Phycoerythrin
Polyethylenimin
Paraformaldehyd
Phosphatidylinositol-3-Kinase
Proteinkinase
Phospholipase
Phorbol-12-myristat-13-acetat
Puromycin
Determinationskoeffizient
rheumatoide Arthritis
GTPasen
Rot fluoreszierendes Protein
Ribonukleinsäure
Reverse Transkription
reversen Tetrazyklin-Transaktivators
Standardabweichung
Natriumdodecylsulfat
mikro-RNA mit Haarnadelstruktur
Tris-gepufferte Salzlösung
T-Zellrezeptor
Wichtige Subtypen von T-Helferzellen
Tumornekrosefaktor-alpha
Tetrazyklin-induzierbaren Promoters
Selbstherausschneidende Sequenz
Promoter des humanen Proteins Ubiquitin C
Chemokin-Analog vom humanen Herpesvirus (HHV8)
Western Blot
Zeomycin
107
ABBILDUNGSVERZEICHNIS
8. Abbildungsverzeichnis
Abbildung 1.1 Extravasation von Leukozyten aus Blutgefäßen ins entzündete Gebiet. ..........................6
Abbildung 1.2 Chemokine und Chemokinrezeptoren nach Bachelerie et al. ...........................................9
Abbildung 1.3 Differentielle Expression von Chemokinrezeptoren auf T-Zellen nach Baggiolini. ........10
Abbildung 2.1 Schematische Darstellung der T-Zell-basierten Therapie für den Einsatz von
Chemokinrezeptor-Antagonisten.. ...................................................................................................27
Abbildung 3.1 Ausgangsvektoren für die Klonierung der Chemokinrezeptor-Antagonisten (CRA)exprimierenden Konstrukte. .............................................................................................................33
Abbildung 4.1 Nukleotidsequenzen der verwendeten Chemokinrezeptor-Antagonisten. .....................44
Abbildung 4.2 Lentivirale Konstrukte des Trägerplasmids pCDH1-MCS1-EF1-copGFP. .......................46
Abbildung 4.3 Lentivirale Konstrukte des Trägerplasmids pTRIPZ. ......................................................47
Abbildung 4.4 Transduktion von IF12 mit den pCDH1-MCS1-EF1-copGFP -Konstrukten für (A)
konstitutive und (B) induzierbare CRA-Expression. ..........................................................................51
Abbildung 4.5 Transduktion von JURKAT- und K562-Zellen mit dem Leervektor pTRIPZ.. .................53
Abbildung 4.6 Transduktion von primären CTLs mit den pCDH1-MCS1-EF1-copGFP -Konstrukten für
induzierbare CRA-Expression. ..........................................................................................................54
Abbildung 4.7 Nachweis der CRA-Expression nach Transduktion verschiedener T-Zelllinien mit
pCDH1-MCS1-EF1-copGFP -Konstrukten für (A) konstitutive und (B) induzierbare CRA-Expression
auf RNA-Ebene mittels PCR. ............................................................................................................56
Abbildung 4.8 Nachweis der CRA-Expression und -Sekretion nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für konstitutive CRA-Expression auf Protein-Ebene mittels
Western Blot-Analyse. ......................................................................................................................58
Abbildung 4.9 Nachweis der CRA-Expression und -Sekretion nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für konstitutive CRA-Expression auf Protein-Ebene mittels ELISA.
.........................................................................................................................................................58
Abbildung 4.10 Nachweis der CXCL11(4-79)-Expression nach Transduktion von IF12 mit pCDH1MCS1-EF1-copGFP -Konstrukten für induzierbare CRA-Expression auf Protein-Ebene mittels
Western Blot-Analyse. ......................................................................................................................60
Abbildung 4.11 Nachweis der CRA-Expression und -Sekretion von T-Zellen nach Transduktion mit
pCDH1-MCS1-EF1-copGFP -Konstrukten für induzierbare CRA-Expression auf Protein-Ebene
mittels ELISA................................................................................................................................ 61
Abbildung 4.12 FACS-Färbung und -Messung von CXCR3 auf transduzierten IF12. ............................64
Abbildung 4.13 FACS-Färbung und -Messung von CXCR3 bei transduzierten IF12 nach TZellaktivierung. ................................................................................................................................65
Abbildung 4.14 FACS-Färbung und -Messung von CXCR3, CXCR4 und CXCR7 bei IF12-Zellen. .........66
Abbildung 4.15 FACS-Färbung und -Messung von CXCR3 bei IF12-Zellen nach Stimulierung mit
Zellüberstand ± CRA11.. .................................................................................................................67
Abbildung 4.16 Chemotaxis-Assay zur Bestimmung der EC-50 Werte der CXCL9-, CXCL10-, CXCL11und CXCL12- induzierten IF12-Zellmigration. .................................................................................69
Abbildung 4.17 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung der CRA..............................71
Abbildung 4.18 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung des CRA CXCL11(4-79). ....73
Abbildung 4.19 Chemotaxis-Assay zur Bestimmung der in vitro-Wirkung des CRA CXCL11(4-79) nach
zusätzlicher Stimulierung mit anti-CD3/28. ....................................................................................76
Abbildung 4.20 Chemotaxis-Assays zur Bestimmung der in vitro-Wirkung von vMIP-II. ......................78
108
TABELLENVERZEICHNIS
9. Tabellenverzeichnis
Tabelle 1.1 Auswahl an Klinischen Studien mit Einsatz von Chemokinrezeptor-Antagonisten nach
Bachelerie et al. ................................................................................................................................25
Tabelle 3.1 Standard-PCR. .....................................................................................................................28
Tabelle 3.2 Auflistung der verwendeten Oligonukleotide. ....................................................................29
Tabelle 3.3 RT-PCR. ...............................................................................................................................29
Tabelle 3.4 Auflistung der einzelnen Bestandteile des Trägerplasmids pCDH1-MCS1-EF1-copGFP mit
der jeweiligen Funktion. ..................................................................................................................34
Tabelle 3.5 Auflistung der einzelnen Bestandteile des Trägerplasmids TRIPZ mit der jeweiligen
Funktion. ..........................................................................................................................................34
Tabelle 3.6 Kulturmedium für murine und humane Zelllinien ..............................................................35
Tabelle 3.7 Kulturmedium für murine Milzzellen. .................................................................................36
Tabelle 3.8 ACK-Puffer ...........................................................................................................................36
Tabelle 3.9 Medium für T-Zellaufreinigung ...........................................................................................36
Tabelle 3.10 Kulturmedium für primäre murine T-Zellen .....................................................................37
Tabelle 3.11 Chemotaxismedium. ..........................................................................................................39
Tabelle 3.12 Lysispuffer. ........................................................................................................................41
Tabelle 3.13 FACS-Puffer .......................................................................................................................42
Tabelle 4.1 Übersicht der eingesetzten Chemokinrezeptor-Antagonisten, ihrer Herkunft und
Rezeptorspezifitäten.........................................................................................................................43
Tabelle 4.2 Auflistung der Transduktionseffizienz der pCDH1-Konstrukte für konstitutive CRAExpression bei verschiedenen Zelllinien. .........................................................................................52
Tabelle 4.3 Auflistung der Transduktionseffizienz der pCDH1-Konstrukte für induzierbare CRAExpression bei verschiedenen Zelllinien. .........................................................................................52
Tabelle 4.4 EC50-Werte und Determinationskoeffizienten der CXCL9-, CXCL10-, CXCL11- und
CXCL12-induzierten Migration von IF12-Zellen. .............................................................................69
109
KONGRESSE UND PUBLIKATIONEN
10. Kongresse und Publikationen
Kongresse:
DGPT - DEUTSCHE GESELLSCHAFT FÜR EXPERIMENTELLE UND KLINISCHE PHARMAKOLOGIE UND
TOXIKOLOGIE (Frankfurt am Main, 30.03.-01.04.11; Dresden, 19.-22.03.12; Hannover, 01.03.04.2014)
 2012, 2014: Poster
2011 JOINT ANNUAL MEETING OF SIICA AND DGFI - ITALIAN SOCIETY OF IMMUNOLOGY, CLINICAL
IMMUNOLOGY AND ALLERGOLOGY AND GERMAN SOCIETY FOR IMMUNOLOGY
(Riccione, 28.09.-01.10.11)
 Poster
WIRM - WORLD IMMUNE REGULATION MEETING VII
(Davos, 13.-16.03.13)
 Poster und Vortrag
9TH INTERNATIONAL CONGRESS ON AUTOIMMUNITY
(Nizza, 26.-30.03.2014)
 Poster
Puplikationen:
Giegold O, Ogrissek N, Richter C, Schröder M, Herrero San Juan M, Pfeilschifter JM, Radeke
HH. CXCL9 causes heterologous desensitization of CXCL12-mediated memory T lymphocyte
activation. J Immunol. 2013 Apr 1;190(7):3696-705. doi: 10.4049/jimmunol.1101293.
Giegold O, Ogrissek N, Radeke HH. Response to comment on "CXCL9 causes heterologous
desensitization of CXCL12-mediated memory T lymphocyte activation". J Immunol. 2013 Jul
15;191(2):525-6. doi: 10.4049/jimmunol.1390037.
110
DANKSAGUNG
11. Danksagung
An dieser Stelle möchte ich mich schließlich noch bei allen Personen bedanken, die mir
während der Zeit meiner Promotion geholfen und mich unterstützt haben.
Zuerst bedanke ich mich bei Herrn Prof. Dr. Heinfried H. Radeke für die Ermöglichung dieser
Doktorarbeit sowie bei Herrn Prof. Dr. Josef Pfeilschifter. Für den Gedankenblitz dieses
interessanten Themas bedanke ich mich zudem besonders bei Dr. Oliver Giegold und für die
Finanzierung dieser Stelle bei Merck und der Goethe-Universität.
Des Weiteren möchte ich mich bei der gesamten Arbeitsgruppe für die alltägliche Hilfe im
Laboralltag, die tolle Arbeitsatmosphäre und das offene Ohr bei jeglicher Frustration
bedanken - ich wünsche Euch allen weiterhin alles Gute!
Auch bei allen anderen Angehörigen des Instituts für Allgemeine Pharmakologie und
Toxikologie als auch des Graduiertenkollegs 1172 „Biologicals“ möchte ich mich bedanken.
Bei Prof. Dr. Beatrix Süß bedanke ich mich für die Bereitschaft zur Übernahme der
fachbereichsinternen Betreuung meiner Arbeit, zuerst an der Goethe-Universität in Frankfurt
und später an der TU Darmstadt.
Ganz besonderer Dank gilt zuletzt noch meiner Familie und meinen Freunden.
Danke!
„Es irrt der Mensch, solang er strebt.“
(Johann Wolfgang von Goethe)
111
LEBENSLAUF
12. Lebenslauf
Persönliche Daten:
Name:
Nadine Ogrissek
Anschrift:
Heiligkreuzgasse 9a, 60313 Frankfurt am Main
Geburtsdatum:
03.01.1987
Geburtsort:
Wolfen
Staatsangehörigkeit:
deutsch
Werdegang:
03/2011 - 10/2014
Doktorarbeit im Bereich Immunpharmakologie am Institut für
allgemeine Pharmakologie und Toxikologie des Uniklinikums der
Goethe-Universität, Frankfurt am Main
Prof. Dr. Heinfried H. Radeke
Titel: Entwicklung einer T-Zelltherapie für chronisch-entzündliche
Erkrankungen basierend auf Chemokinrezeptor-Antagonisten
Stipendium von Merck innerhalb des Graduiertenkollegs 1172
„Biologicals“ von FIRST
10/2009 - 10/2010
Externe Diplomarbeit in Genetik am Biochemischen Institut des
Uniklinikums der Justus-Liebig-Universität, Gießen
Prof. Dr. Ritva Tikkanen
Titel: Funktionelle Charakterisierung der Reggie-Proteine einer
Reggie-1 Knockout Zelllinie
10/2005 - 10/2009
Biologiestudium an der Goethe-Universität, Frankfurt am Main
Hauptstudium: Spezialisierung auf die Fachrichtungen Genetik,
Zellbiologie und Neurobiologie
Abschluss: Diplom-Biologin (Note 1,0)
08/1997 - 08/2005
Gymnasium Großzschachwitz, Dresden
Abschluss: Abitur (Note 2,2)
112
EHRENWÖRTLICHE ERKLÄRUNG
13. Ehrenwörtliche Erklärung
Ich erkläre hiermit ehrenwörtlich, dass ich die vorliegende Arbeit entsprechend den Regeln
guter wissenschaftlicher Praxis selbstständig und ohne unzulässige Hilfe Dritter angefertigt
habe.
Sämtliche aus fremden Quellen direkt oder indirekt übernommenen Gedanken sowie
sämtliche von Anderen direkt oder indirekt übernommenen Daten, Techniken und Materialien
sind als solche kenntlich gemacht. Die Arbeit wurde bisher bei keiner anderen Hochschule zu
Prüfungszwecken eingereicht.
(Datum)
(Nadine Ogrissek)
113
Herunterladen
Explore flashcards