Prof. Dr. Hannsjörg Seyberth (2005)

Werbung
Aus dem
Zentrum für Kinder- und Jugendmedizin
Geschäftsführender Direktor:
Prof. Dr. Hannsjörg Seyberth (2005)/
Prof. Dr. med. Rolf Felix Maier
des Fachbereichs Medizin der Philipps-Universität Marburg
Korrektur postnataler Nierenreifungsstörung
bei der COX-2 negativen Maus
Inaugural-Dissertation
zur Erlangung des Doktorgrades der gesamten Humanmedizin
dem Fachbereich Medizin der Philipps-Universität Marburg
vorgelegt von:
Christian Breitbarth aus Gotha
Marburg 2006
Angenommen vom Fachbereich Humanmedizin der Philipps-Universität Marburg am 27.09.2007.
Gedruckt mit Genehmigung des Fachbereichs
Dekan:
Prof. Dr. med. Matthias Rothmund
Referent:
Prof. Dr. rer. nat. Rolf Michael Nüsing
Korreferent:
PD Dr. med. U. Kuhlmann
1
Meinen Eltern
INHALTSVERZEICHNIS
1. EINLEITUNG
1.1. Literaturübersicht Prostaglandine
1.1.1. Geschichte
1.1.2. Prostaglandine und Rezeptoren
1.1.3. PPAR
1.2. Cyclooxygenase-Isoenzyme
1.2.1. COX-1
1.2.2. COX-2
1.3. Einfluß der PG auf den Zellzyklus und Bedeutung der COX-2 in der Entstehung von Krebs
1.3.1. COX-2 -unabhängige Mechanismen auf die Karzinogenese
1.3.2. direkte Wirkungen von COX-2
1.3.3. Förderung der Angiogenese
1.3.4. Apoptose
1.3.5. Physiologischer Einfluß auf Proliferation und Differenzierung
1.4. COX und Niere
1.4.1. COX-1
1.4.2. COX-2
1.4.3 NO-Synthase
1.5. Die COX-2 knockout-Maus
1.5.1. typische Nierenveränderungen
2. ZIELSETZUNG
3. MATERIAL UND METHODEN
3.1. Versuchstiere
3.2. Genotypisierung
3.2.1. Isolierung der DNA
3.2.2. PCR
3.3. Prostaglandinsubstitution
2
3.4. Präparation der Tiere
3.5. Histologische Schnitte
3.5.1 HE-Färbung
3.6. Histomorphometrie
3.7. Statistische Tests
4. ERGEBNISSE
4.1. Histologie
4.1.1. Zeitlicher Verlauf der Nierenentwicklung
4.2. Prostaglandinsubstitution
4.2.1. Plazebogruppe
4.2.2. Alprostadil
4.2.3. Misoprostol
4.2.4. Iloprost
4.2.5. 15-deoxy-Prostaglandin J2
4.2.6. Sulproston
4.2.7. ONO AE1-329
4.2.8. zusammenfassende Darstellung
4.2.8.1 mittlerer glomerulärer Durchmesser
4.2.8.2. Distanz der ersten Glomerulusschicht zur Kapsel
4.2.8.3. relatives Nierengewicht (NG/KGx1000)
4.2.8.4 Verteilungskurve der Glomerulusdurchmesser
4.2.9. zusätzliche Untersuchungen
4.2.9.1. Behandlung von C57BL6 -Wildtypmäusen mit ONO AE1-329 ,20µg/kgKG
4.2.9.2. Behandlung von C57BL6 -Wildtypmäusen mit dem PGF2α –Analogon
Fluprostenol, 2mg/kg KG
4.3. Vergleich unbehandelter Mäuse am Tag P21
4.4. Statistische Tests
5. DISKUSSION
6. ZUSAMMENFASSUNG
7. QUELLENNACHWEIS
8. DANKSAGUNG
9. VERZEICHNIS MEINER AKADEMISCHEN LEHRER
10. LEBENSLAUF
3
1. EINLEITUNG
Kaum ein Medikament hat eine ähnlich große Bedeutung für die Medizin und spielt in so zahlreichen
Prozessen, angefangen bei einfachem Kopfschmerz bis hin zur Prävention von Krebs eine Rolle wie
Aspirin o. andere Nichtsteroidale Antirheumatika (NSAR). NSAR erzielen ihre entzündungshemmende
und antiphlogistische Wirkung im Gegensatz zu Kortikosteroiden durch Hemmung der Synthese von
Prostaglandinen (PG), - einer Gruppe von Zellhormonen o. Mediatoren die von nahezu jedem Gewebe
synthetisiert werden und eine unüberschaubare Zahl verschiedener organspezifischer und
situationsabhängiger Wirkungen vermitteln. Seit der Entdeckung der Cyclooxygenase 2 (COX-2),
einer neuen Isoform der Cyclooxygenase (COX)- dem Enzym das die beiden ersten Syntheseschritte
der PG übernimmt, versuchte man zu verstehen, welche Rolle jeder der zwei Isoformen in
physiologischen und pathologischen Prozessen zukommt. Zu diesem Zweck wurden erstmals 1995
von Dinchuk, Langenbach und Morham et al. Mäuse mit permanent ausgeschalteter COX-1 bzw.
COX-2 durch Gen ’knockout’ erzeugt [50,135,162]. Es zeigte sich, dass neben einer Reihe weiterer
Pathologien bei COX-2 knockout Mäusen die Nierenentwicklung stark beeinträchtigt ist. Die
Nierenkörperchen oder Glomeruli dieser Mäuse bleiben unterentwickelt, eine homogene Verteilung
über die Nierenrinde und der Anschluss an das Tubulussystem findet nicht statt, so dass die meisten
Tiere im Alter von ca. 3-4 Monaten am chronischen Nierenversagen sterben.
Ziel dieser Arbeit war es, den Zusammenhang zwischen normaler Funktion der COX-2 und
Nephrogenese besser zu verstehen und zweitens zu versuchen die ausnahmslos sich entwickelnde
renale Pathologie durch Zufuhr verschiedener Substanzen von außen zu verhindern. Dabei stellt sich
die Frage: Ist die normale Nierenreifung tatsächlich über die PG vermittelt oder bestehen andere
COX-2 vermittelte Mechanismen? Von vornherein standen zwei mögliche Theorien im Vordergrund:
1.: die Nierenreifung bzw. Ausdifferenzierung der Glomeruli ist ein rein hämodynamischer Effekt oder
2.: COX-2 aktiviert Transkriptionsfaktoren und Gene, die für die Gewebedifferenzierung nötig sind.
Beide Prozesse können, müssen aber nicht PG-vermittelt sein.
Zum besseren Verständnis der Zusammenhänge soll die folgende Literaturübersicht dienen.
1.1. Literaturübersicht Prostaglandine
1.1.1 Geschichte
Aspirin, 1897 erstmals von F.Hoffmann
synthetisiert [Review 158] und andere NSAR wurden
eingesetzt, lange vor Kenntnis der ersten PG. Erst 1971 zeigten Vane und Smith [229,259], dass
NSAR die Synthese der PG unterdrücken und stellten so den Zusammenhang her. In den frühen 30er
Jahren wurden erstmals im menschlichen Sperma [201] und im Extrakt der Samenbläschen von
Schafen
[263]
hormonähnliche
Substanzen
beschrieben,
die
blutdrucksenkende
und
uteruskontrahierende Wirkungen hatten. Von Euler [263] beschrieb deren Fettlöslichkeit und Polarität.
Von ihm stammt der (eigentlich falsche Name) ‚Prostaglandine’, da er annahm dass die Prostata
deren Herkunftsort sei. Sjovall und Bergström [18,19] isolierten 1960 die PG PGE1 und PGF1α und
Massenspektrometrie und Chromatographie zeigten, dass es sich um mehrfach ungesättigte 20-CFettsäuren handeln müsse. Bis 1976 waren nach und nach alle 5 klassischen PG beschrieben:
4
nämlich PGH2, PGE2, PGF2α, Thromboxan A2 (TXA2) und PGI2. Eliasson fand, dass die
Phospholipase A2 die Synthese der PG verstärken konnte [11]. Versuche mit radioaktiv markierter
Arachidonsäure [17,258] belegten, dass Arachidonsäure als Substrat für die PG-Synthese notwendig
ist und, dass das zur Umsetzung zu PG verantwortliche Enzym Dioxygenaseaktivität aufweisen muss
[200]. Samuelsson beschrieb zuerst die Umsetzung von Arachidonsäure zu PGG2 durch das Enzym
COX und die spätere Umwandlung in PGH2 [202]. 1971 zeigten sowohl Vane [259] als auch Smith
[229], dass die Wirkung aller NSAR durch Hemmung der COX und der durch sie vermittelten PGSynthese zu erklären ist.
Parallel zur Entdeckung der PG wurde eine weitere Klasse von Gewebsmediatoren beschrieben, die
sich ebenfalls von der Arachidonsäure ableitet, die Leukotriene. Deren Synthese ist jedoch nicht an
die COX gebunden, sondern erfolgt durch Lipoxygenase, die Arachidonsäure zu 5-HPETE (5Hydroperoxyeicosatetraensäure) umsetzt. In weiteren Folgeschritten erfolgt dann die Umwandlung in
die verschiedenen Leukotriene. (z.B. Leukotrien B4, -D4, -C4,-E4) PG und Leukotriene werden seit
1979 in der Stoffklasse der Eicosanide zusammengefasst.
1.1.2. PG und Rezeptoren
Die Synthese der PG beginnt mit der Abspaltung von Arachidonsäure oder einer anderen mehrfach
ungesättigten 20-C-Fettsäure aus der Phospholipidschicht der Zellmembran (bzw. Kernmembran, s.u.)
durch die Phospholipase A2 . Eine zentrale Rolle für die folgenden Schritte spielt die COX, auch
Prostaglandin H- Synthase genannt. Diese zentrale Stellung wird dadurch verdeutlicht, dass in vielen
pathologischen Zuständen ,z.B. Entzündung, die COX verstärkt exprimiert wird und zweitens, viele
pro-inflammatorische Faktoren, z.B. IL-1, die COX -Expression stimulieren können. Die COX besitzt
zwei aktive Zentren, die die ersten beiden Schritte der PG-Synthese katalysieren. In einem ersten
Schritt erfolgt die Umwandlung von Arachidonsäure in PGG2 (Dioxygenasereaktion), in einem zweiten
wird PGG2 zu PGH2 umgesetzt [155]. PGH2 ist selbst als PG wirksam, jedoch instabil. Es dient als
Substrat für die Umsetzung in die PG PGD2, PGE2, PGF2α, PGI2, TXA2 durch nachgeschaltete
Synthasen, wobei für jedes PG eine eigene Synthase zur Verfügung steht, z.B. PGE-Synthase. Alle
NSAR blockieren die Dioxygenasereaktion der COX, nicht jedoch die Peroxidasereaktion [154].
Ebenfalls unbeeinflusst bleibt die Lipoxygenase, wodurch einige Nebenwirkungen der NSAR erklärt
werden könnten. Ein verringerter Umsatz von Arachidonsäure zu PG führt zu einer vermehrten
Bildung von Leukotrienen über den Lipoxygenaseweg und könnte z.B. für allergische Reaktionen der
NSAR verantwortlich sein.
PG haben umfassende physiologische und pathophysiologische Wirkungen und sind beteiligt an
Prozessen
wie
Fieber,
Schmerz,
Entzündung,
Blutgerinnung,
Ovulation,
Geburt,
Knochenstoffwechsel, Nierenfunktion, Tumorwachstum und Metastasierung, Gefässtonus und
Immunantwort. Im Gegensatz zu klassischen Hormonen, die meist aus einem einzigen endokrinen
Organ stammen, synthetisieren die meisten Gewebe PG. Deren Wirkung bleibt jedoch auf die
unmittelbare Umgebung beschränkt (autokrine und parakrine Wirkung) [52]. Die PG-Wirkung ist ferner
von einer Vielzahl von Faktoren wie Rezeptordichte und -verteilung im Gewebe, Zell-Zell-Interaktionen
5
und Aktivität der unterschiedlichen PG-Synthasen abhänging. Aufgrund dieser komplexen Regulation
können selbst durch eine PG-Klasse gegenteilige Wirkungen vermittelt werden [1].
Für die PG gesichert ist der Wirkmechanismus über G-Protein gekoppelte transmembranäre
Rezeptoren. Bisher sind 9 Prostanoidrezeptoren identifiziert worden: DP, TP, EP1- 4, FP, IP und
CRTH2 [1], benannt nach dem PG mit der höchsten Affinität zum Rezeptor (CRTH2 als zweiter
PGD2-Rezeptor). Es ist jedoch nachgewiesen, dass keine absolute Rezeptorspezifität für jedes
einzelne PG existiert und ein PG z.T. mehrere Rezeptoren aktivieren kann. Für eine detaillierte
Darstellung der Einzelsubstanzen und PG-Rezeptoren sei auf die Übersichtsarbeiten von Breyer et al.
2001 [26] sowie Aaron et al. 2004 [1] verwiesen.
1.1.3. PPAR’s
Neben der PG-Bindung an membranständige Rezeptoren an der Zelloberfläche existieren z.T. auch
intrazelluläre Aktivierungswege. Dafür spricht z.B. die Existenz von COX-2 und PGI-Synthase im
Bereich des endoplasmatischen Retikulums (ER) und der Kernmembran [141]. Eine Möglichkeit der
intrazellulären PG-Wirkung stellt die Aktivierung von „peroxisome proliferator-activeted Rezeptoren“
(PPAR’s) dar, die zur Klasse der Steroidrezeptoren zählen. Drei PPAR sind bekannt: PPARα,
PPARβ/δ und PPARγ. Für einige PG, darunter PGI2, vor allem jedoch als bisher stärkstem Liganden
das 15-deoxy-delta(12,14)PGJ2 , wurde eine Kopplung an PPAR beschrieben [282]. Die Gruppe der
PPAR-Liganden ist jedoch recht umfassend und beinhaltet z.B. so unspezifische Stoffgruppen wie
mehrfach ungesättigte Fettsäuren [122], ferner NSAR [139] und Vertreter der Thiazolinedione (orale
Antidiabetika, z.B.Troglitazone). PPAR binden an entsprechende response-Elemente auf der DNA und
wirken als Transkriptinsfaktoren [49,70]. So wird z.B. in Monozyten die Expression NFκB- abhängiger
pro-inflammatorischer
Gene
proliferationshemmende
unterdrückt
Wirkungen
[142],
[107].
so
PPARγ
z.B.
auf
scheint
antineoplastische
und
Pankreaskarzinomzellen
und
Osteosarkomzellen [114] zu vermitteln. Santoro et al. [203] beschrieben eine Hemmwirkung auf die
Virusreplikation durch PPAR-bindende PG. PPAR- Aktivierung ist außerdem an der Zelldifferenzierung
von Fettzellen beteiligt [121] und kann in Endothelzellen Apoptose auslösen. Neben einer möglichen
Aktivierung von PPAR durch PG konnte jedoch auch gezeigt werden, dass PPARγ-Aktivierung in der
Lage ist, die Zytokin-induzierte COX- und PGE2 Stimulation zu blockieren [28,57,193,236], obwohl
z.T. wohl auch PPAR- unabhängige Mechanismen für die Hemmwirkung einiger PPAR- Liganden
verantwortlich sind [103].
1.2. COX - Isoenzyme
Drei Isoenzyme der COX werden diskutiert: die ‚klassische’ und zuerst entdeckte COX-1, die
‚induzierbare’ COX-2 und, als neue Variante der COX-1 vor allem im ZNS, die COX-3, auf die im
folgenden nicht näher eingegangen werden soll, da deren Existenz und Funktion noch sehr kontrovers
diskutiert werden. Die Isolierung und Charakterisierung der COX-1 gelang erstmals 1976 durch
Miyamoto et al. [160] und andere Gruppen [95,178,257]. Erste Hinweise auf die Existenz einer zweiten
6
Form der COX, heute als COX-2 bekannt, ergaben die Arbeiten von Rosen [198] , Xie [276] und
Kujubu et al. [130] in den Jahren 1989-91.
Die beiden Isoformen COX-1 und COX-2 weisen einige entscheidende Unterschiede sowohl in ihren
chemischen Eigenschaften, als auch in ihrer Lokalisation und Induzierbarkeit auf. COX-2 verfügt über
ein grösseres aktives Zentrum und ist dadurch in der Lage, ein breiteres Spektrum an Substraten
umzusetzen, darunter Anandamine und
Linolsäure [132,186]. Dieser Umstand erlaubt auch die
Entwicklung COX-2 -spezifischer Inhibitoren (Coxibe). Die Gensequenz der COX-2 ist kurz, verfügt
über eine TATA-Box sowie eine Reihe von enhancer-Segmenten, wie CEBP/NF-IL6, CRE, NFκB [5].
Tatsächlich ist eine COX-2 -Expression in den meisten Geweben unter Normalbedingungen nicht
messbar, kann jedoch durch eine Vielzahl mitogener Faktoren, darunter LPS, IL1β, IL2 und TNFα
[38,60,96,137] schnell induziert werden [2,21,51,131,171,187]. Eine de novo Synthese [130] der
COX-2 ist im wesentlichen verantwortlich für die ligandeninduzierte PG-Produktion, wie sie für
Fibroblasten [187], Endothelzellen [51], Neutrophile [21], Makrophagen [2] und Monozyten gezeigt
werden konnte [2,131,171].
COX-2 mRNA enthält 12-18 (Maus) bzw. 22 (Mensch) Kopien der Sequenz AUUUA, einer Sequenz,
von der bekannt ist, dass sie zum schnellen und effektiven mRNA- Abbau führt [176,177,217,276].
Dexamethason vermag v.a. durch schnelle mRNA-Spaltung die Aktivität der COX-2 zu regulieren.
[129]. Zusammengefasst kann die COX-2 durch rasche Genaktivierung - induziert durch äußere
Stimuli - bei Bedarf exprimiert, und auf der anderen Seite durch Beeinflussung der mRNA- Stabilität
ebenso rasch wieder deaktiviert werden. Demgegenüber wird die COX-1 von fast allen Geweben
unter Ruhebedingungen konstant exprimiert [45] und hält vermutlich eine basale PG-Produktion
aufrecht. COX-1 -DNA enthält keine TATA-Box und keine promoter/enhancer-Regionen.
Weitere Unterschiede bestehen in der Substratverwertung und Lokalisation beider COX. COX-1 ist
nicht in der Lage, endogene Arachidonsäure zu verwerten, jedoch COX-2 [165,188]. Morita et al.
[163] zeigten die unterschiedlichen Lokalisationen von COX-1 und COX-2 in der Zelle, durch die sich
Unterschiede in der Substratverwertung erklären lassen. COX-1 Expression findet sich am ER und der
Kernmembran, COX-2 -Aktivität gleichfalls am ER, darüberhinaus jedoch auch an der inneren
Kernmembran und direkt im Nukleus.
All dies unterstützt einen möglichen Einfluss der COX-2 auf die Genregulation und Beteiligung an
Prozessen wie Zellwachstum, Differenzierung und Kanzerogenese.
1.2.1. COX-1
Die COX-1 spielt in der Homöostase physiologischer Funktionen unter Ruhebedingungen eine Rolle,
jedoch ist auch eine Beteiligung an inflammatorischen Prozessen sicher. Kernlose Thrombozyten sind
auf COX-1 und die Synthese von TXA2 angewiesen [205] und die proaggregatorische Potenz von
TXA2 wird durch die ebenfalls COX- vermittelte Synthese von PGI2 im Gefässendothel kontrolliert.
[94]. COX-1 -Blockade durch unselektive NSAR führt zu Magenschleimhauterosionen und -ulzera. Die
Zytoprotektion der Mukosa durch PG, v.a PGE2, wurde lange Zeit auf eine durchblutungsfördernde
Wirkung der PG zurückgeführt [98,244], scheint jedoch auch durch Inhibition der Motilität und dadurch
verminderte Faltenbildung der Mukosa bedingt [7]. PGE2 fördert zudem die Bikarbonat- und
7
Mukusbildung. In klinischen Studien zeigten die selektiven COX-2 -Hemmer Celecoxib und Rofecoxib
eine verminderte Inzidenz gastrointestinaler Nebenwirkungen verglichen mit klassischen NSAR
[33,270].
In der Niere halten PG u.a. die renale Durchblutung aufrecht, und vor allem in Situationen mit bereits
eingeschränkter Nierenfunktion können unselektive NSAR ein akutes Nierenversagen durch renale
Ischämie auslösen. Desweiteren wurden vereinzelt Fälle von akutem, reversiblem Nierenversagen
und Oligohydramnion bei Neugeborenen berichtet, deren Mütter NSAR zur Tokolyse kurz vor der
Geburt oder aus anderer Ursache im Verlauf der späten Schwangerschaft erhielten [15,58].
Die antithrombotische Wirkung von ASS durch Blockade der TXA2- Synthese ist durch mehrere große
klinische Studien gesichert und ist heute Standardtherapie in der Sekundärprophylaxe nach
Herzinfarkt und Schlaganfällen.
1.2.2. COX-2
Die COX-2 ist an der Entstehung von Fieber beteiligt. Intraperitoneale LPS-Injektionen bei der Ratte
verursachen Fieber, Cao et al. [30,156] zeigten die zum Fieber parallel ansteigende Synthese von
COX-2 in Endothelzellen des Gehirns, wobei die Gabe eines COX-2 -Hemmers die Entstehung des
Fiebers verhindern konnte [239]. Ferner wurde die Wirkung von IL1 auf Endothelzellen während der
Fieberentstehung gezeigt, einem wichtigen COX-2 induzierendem Zytokin [29].
Kaufmann et al. [113] beschrieben eine Rolle von COX-2 in der späten Reifung des ZNS, im Sinne der
Verarbeitung von Umwelteinflüssen. Im Gastrointestinaltrakt induzieren COX-2 -abhängig gebildete
PG die Salz- und Wassersekretion während einer bakteriellen Infektion der Darmwand [53]. Eine
Schädigung der Darmwand durch Bestrahlung führt hingegen nicht zu verstärkter COX-2 -Expression.
Vielmehr scheint hierbei, wie im Magen, COX-1 eine wichtige Rolle im Zellüberleben zu spielen [44].
COX-2 vermittelte PG-Synthese ist notwendig für die Ovulation [192]. Die zur Vorbereitung der
Implantation des Embryos benötigten PG werden durch die COX-1 synthetisiert, COX-2 dagegen
spielt in der Interaktion des Embryos mit dem Uterus eine Rolle [24,142].
Postpartal gebildete, kontrahierend wirkende PG scheinen zum Verschluss des Ductus arteriosus zu
führen und COX-2 knockout in Mäusen führt zu einer erhöhten Sterblichkeit durch Persistens des
Ductus Botalli. Präpartal hingegen vermitteln PG aus dem maternalen Kreislauf die aktive Dilatation
des Ductus [146]. Tiermodelle zur entzündlichen Arthritis zeigten erstmals die Sonderstellung der
COX-2 in entzündlichen Prozessen [3]. COX-2-Expression und verstärkte PG-Synthese konnte hierbei
durch die pro-inflammatorischen Zytokine IL1, TNFα, LPS sowie die Wachstumsfaktoren TGF3, EGF,
PDGF und FGF induziert werden. Andererseits bewirkten entzündungshemmende Substanzen wie
IL4, IL13 sowie Glukokortikoide eine COX-2 - Suppression.
Auch die Enstehung und Verarbeitung von Schmerz ist durch die COX reguliert. Peripher als auch
zentral (Rückenmark) wurde hierbei COX-2 -Expression nachgewiesen [12]. Sowohl das COX-2
selektive NS398, als auch Indomethacin als unspezifisches NSAR konnte peripher und intrathekal die
Schmerzempfindung abschwächen [277]. Andererseits hatte der teilweise COX-2 selektive Inhibitor
Meloxicam keinen Einfluss auf die zentrale Schmerzempfindung [134]. NSAR scheinen einen
protektiven Effekt auf die Enstehung der Alzheimerkrankheit zu haben [4,157,234]. Ob dieser Effekt
8
über eine Reduktion COX-2 vermittelter inflammatorischer Mediatoren und Mikrogliaaktivierung zu
erklären ist, oder andere Mechanismen beteiligt sind, ist unklar [22,23]. Von besonderer Bedeutung ist
ein beschriebener direkter Zusammenhang zwischen COX-2 -Expression und der Entstehung
maligner Tumoren, sowie die protektive Wirkung sowohl klassischer NSAR als auch selektiver COX-2Hemmer auf die Karzinogenese [74,75,227,246,247].
Lange Zeit nahm man eine mehr physiologische Rolle der COX-1 an, währdend eine COX-2Expression vorwiegend auf pathologische Prozesse beschränkt schien und z.T. für unerwünschte
Wirkungen verantwortlich gemacht wurde. Durch klinische Fallberichte sowie die Generation der
ersten COX-2 knockout Mäuse kristallisierte sich jedoch auch nach und nach eine wichtige
physiologische Bedeutung der COX-2 heraus. COX-2 ist wahrscheinlich entscheidend an der
Gewebedifferenzierung und -proliferation, als auch an anderen physiologischen Vorgängen beteiligt,
so z.B. an der Regulation der Nierenfunktion.
Da die Rolle der COX-2 auf die normale Nierenentwicklung zentrales Thema dieser Arbeit ist, soll
deren Funktion an der adulten Niere, sowie ihr Einfluss auf Proliferation und Tumorgenese in einem
eigenen Kapitel dargestellt werden.
1.3. Einfluss der PG auf den Zellzyklus und Bedeutung der COX-2 in der Entstehung
von Krebs
Da komplettes Fehlen der COX-2 die Ausreifung und Differenzierung der fetalen Niere beeinträchtigt,
ist denkbar, dass eine Wirkung der COX auch über die Aktivierung von Genen zustandekommt. In
diesem Zusammenhang ist interessant, dass eine Überexpression von COX-2 in vielen Tumoren
vorkommt. Es soll deshalb kurz auf die Rolle der Zyklooxygenase in der Entstehung von Tumoren
eingegangen werden.
Epidemiologische Studien zeigten ein bis zu 30-50% vermindertes Risiko für die Entwicklung kolorektaler Polypen und Darmkrebs unter längerfristiger NSAR-Einnahme [69]. Eine Reduktion der
Sterberate wurde daneben für mehrere Krebserkrankungen wie Magen-, Ösophagus-, Blasen- und
Brustkrebs, ferner Bronchial-, Prostata- und Ovarialkarzinom gezeigt [161,248].
Selbst die
Schrumpfung oder sogar komplette Regression von Kolonpolypen bei Patienten mit FAP (Familiäre
Polpyposis
coli)
unter
Therapie
mit
Sulindac
+
Celecoxib
wurde
beobachtet
[72,133,175,227,233,264,265]. Prospektive Studien an jüngeren Patienten mit FAP zeigten allerdings,
dass Sulindac nicht in der Lage ist, die Neuentstehung adenomatöser Polypen zu verhindern [73].
Eine Zweitauswertung einer großen randomisierten klinischen Studie zur Untersuchung der
Wirksamkeit
von Acetylsalicylsäure in der Herzinfarktprophylaxe, zeigte keine Reduktion der
Entstehung des kolorektalen Karzinoms [68].
1.3.1. COX-2 unabhängige Mechanismen auf die Karzinogenese
Wie bereits erwähnt sind viele NSAR selbst in der Lage an PPAR zu binden [92]. So ist eine direkte
Korrelation von verminderter PPARγ-Expression und gesteigerter PPARβ/δ -Expression mit der
Entwicklung kolorektaler Karzinome beschrieben. NSAR könnten mit PPARβ/δ interferieren. He et al.
und andere Gruppen beschrieben eine mögliche Aktivierung eines bisher unbekannten PPARγLiganden durch NSAR [92]. COX-2 besitzt neben Dioxygenaseaktivität auch Peroxidaseaktivität [230],
9
wodurch polyzyklische Kohlenwasserstoffe, Aflatoxine, Phenole und halogenierte Pestizide in
mutagene Substanzen überführt werden können [221]. Daneben kann PGH2 in Malondialdehyd, ein
weiteres direktes Mutagen, umgewandelt werden. Allerdings wird die Peroxidase der COX nicht von
NSAR blockiert [154].
1.3.2. Direkte Wirkung von COX-2
Eine direkte Wirkung von COX-2 auf die Tumorentstehung belegten Versuche mit einem Mausmodell
zur FAP. Dazu wurden APC∆716 -Mäuse mit COX-2 -negativen Mäusen gekreuzt, und es zeigte sich
eine Reduktion von Zahl und Grösse intestinaler Polypen bei den Nachkommen, verglichen mit
APC∆716-Tieren [181].
Unter den verschiedenen PG nimmt PGE2 eine Schlüsselstellung in der
Entwicklung von Krebs ein. In Kolonkarzinomzellen, die die COX-2 überexprimieren, ist auch die
PGE2 Konzentration erhöht [280]. PGE2 ist in der Lage, in vitro die Angiogenese zu fördern und hat
zudem apoptosehemmende Effekte [63]. Ferner fand sich nur bei PGE-Rezeptor negativen Mäusen
eine verminderte Zahl dysplastischer Foci in Schleimhautkrypten, nicht bei IP-,DP-,FP-, oder TPKnockout- Mäusen. Unterschiedliche Ergebnisse existieren zur Rolle der 4 bekannten PGE2 Rezeptoren EP1-EP4. Sonoshita et al. [232]
bei EP2 -/- , nicht jedoch EP1 -/-
beobachteten eine verminderte Zahl von Kolonpolypen
APC∆716 -Tieren. Die Expression des EP2 -Rezeptors war
gesteigert in Adenomzellen, EP1, EP3 o.EP4 dagegen nicht. In einem Modell zur Tumorinduktion
durch Azoxymethan (AOM) dagegen resultierte der EP1 -knockout
in einer verminderten Zahl
dysplastischer Zellen [268]. In Übereinstimmung dazu konnte durch den EP1-Antagonisten
ONO 8711 in der Min (multiple intestinal neoplasia) -Maus die Zahl der Dysplasien reduziert werden
[268]. Auch der EP4 -Rezeptor scheint eine zentrale Rolle in der AOM-induzierten Karzinogenese zu
spielen, und Gabe des EP4 -Antagonisten ONO AE2-227 reduzierte die Zahl der Polypen >1,5mm in
der APCmin Maus [167].
Besondere Bedeutung erlangt in diesem Zusammenhang die PI-3 -
vermittelte Phosphorylierung der ERK-kinasen und Expression des early growth response factor1(EGRF-1) durch EP4, als auch die Aktivierung des Transkriptionsfaktors β-Catenin durch GSK-3
[64,65]. Neben der Wirkung von PGE2 auf die PG-Rezeptoren EP1 bis -4 scheint auch eine
Aktivierung von epidermal growth factor (EGF) durch COX-2 möglich [182]. Erhöhte COX-2 -Aktivität
wird sowohl durch gesteigerte Gentranskription, als auch erhöhte mRNA-Stabilität erreicht. Rho-B
steigert die COX-2 -Transkription und Akt/Protein Kinase-B erhöht die mRNA- Stabilität [216,218].
Onkogenaktivierung, so z.B. Ki-ras und Wnt [8], als auch Verlust von Tumorsuppressorgenen, etwa
durch Mutation von p53 [67,235], resultiert in einer Überexpression von COX-2.
Die zentrale Frage ist jedoch, ob COX-2 unmittelbar in der Lage ist, Krebs zu induzieren. Liu et al.
[145] koppelten das COX-2 -Gen an den Promotor von MMTV, ein brustkrebs- induzierendes Virus.
Die erhöhte COX-2 -Expression führte zur Hyperplasie der Brustdrüsen und teilweise zu Brustkrebs,
jedoch nur bei mehrfachgebärenden Mäusen, was vermuten lässt, dass weitere stimulierende
Faktoren zur Krebsinduktion notwendig sind. Interessanterweise konnte eine erhöhte Expression des
apoptosehemmenden Bcl-2 und verminderte Expression von Bax (pro-apoptotisch) nur in den
Tumorzellen gefunden werden, nicht jedoch im umgebenden Gewebe. COX-2- Expression und
Synthese von PGE2 und PGF2α fand dagegen auch in nichtentarteten Zellen statt. Das führte zur
Vermutung, dass die Veränderungen von Bax/Bcl-2 nicht durch COX-2 vermittelt sind[145]. In einem
10
Hautkrebs-Tiermodell werden Tumore der Haut durch Administration von DMBA und nachfolgender
Verstärkung durch PMA induziert. Mäuse, die COX-2 überexprimieren, entwickelten Tumorwachstum
allein nach DMBA-Gabe, und eine weitere Verstärkung durch PMA war nicht erforderlich [164]. Muller
et al. [164] vermuteten, dass COX-2 einen fördernden Einfluss auf das Tumorwachstum, jedoch nicht
auf deren Induktion hat.
1.3.3. Förderung der Angiogenese
Williams et al. übertrugen Tumorgewebe auf kompatible Wildtyp-, COX-2 -/- und COX-1 -/- Tiere und
beobachteten ein reduziertes Tumorwachstum bei den COX-2 Knockout- Mäusen. Parallel dazu fand
sich eine niedrigere Aktivität von VEGF und eine geringere Gefässdichte in den Tumoren [274].
Eine Ableitung dieser Versuche war, dass auch Nicht-Tumorzellen in der Umgebung zum
Tumorwachstum beitragen. COX-2 -Aktivität bei APC∆716 -Mäusen lief parallel zur Expression von
pro-angiogenetischen Faktoren wie VEGF, βFGF u.a.. Seed et al. zeigten 1997, dass Diclofenac in
der Lage ist, das Wachstum von Kolon-26-Zellen bei Nacktmäusen zu blockieren und zwar durch
Inhibition der Angiogenese [214]. Anderen Gruppen gelang die Unterdrückung der Neovaskularisation
auf der Kornea, und Zufuhr eines TP-Agonisten hob diesen Effekt auf [47]. In Kolonkarzinomzellen
erhöhte Überexpression von COX-2 in vitro die Produktion von VEGF, PDGF, βFGF und TGF und
bewirkte eine Endothelzellproliferation und -migration. Dieser Effekt konnte mit dem COX-2 Hemmer
NS 398 blockiert werden [255].
1.3.4. Apoptose
Der COX-2 wird ein hemmender Einfluss auf die Apoptose zugesprochen. Lu [150] beschrieb eine
Induktion der Apoptose durch NSAR in Zellkulturen. Tsuiji et al. zeigten 1995 eine gesteigerte
Resistenz COX-2 exprimierender Zellen gegenüber dem apoptoseinduzierenden Butyrat. Sulindac
hob diese Resistenz auf [253]. Ferner scheint PGE2 selbst vor Apoptose zu schützen [220].
Gesteigertes Tumorwachstum könnte folglich erklärt werden durch 1.) direkte Stimulation des den
Tumor umgebenden Gewebes durch proangiogenetische Faktoren, die zu Endothelzellproliferation
und -migration und damit Versorgung des Tumors mit Nährstoffen und Sauerstoff führen, 2.) durch
Erhöhung der Resistenz gegenüber Apoptose infolge Veränderungen im Gleichgewicht zwischen
Bax/Bcl-2 sowie anderer Regulatoren und 3.) durch direkte proliferationsfördernde Wirkung über COX2 vermittelte Aktivierung von Transkriptionsfaktoren, PPAR-Bindung o.a.intrazelluläre Signalwege.
1.3.5. Physiologischer Einfluss auf Proliferation und Differenzierung
Unabhängig von ihrer Überexpression in vielen Tumoren ist die COX-2 auch an der physiologischen
Gewebeproliferation und -differenzierung beteiligt. Avner et al. [9]
zeigten an Versuchen mit
metanephritischen Zellen in vitro die Notwendigkeit von PGE1 für Proliferation und Differenzierung.
Abwesenheit von PGE1 im Kulturmedium führte zu einer Verminderung des Zellwachstums um 33%,
ferner war PGE1 absolut notwendig zur Ausdifferenzierung der Kulturzellen in Glomerulusepithel .
PGE1 war in dieser Fähigkeit fast genauso effektiv wie eine komplett zusammengesetzte Nährlosung
mit Selen, Insulin, Transferrin und Thyroxin und PGE1. Die Interaktion von 15dPGJ2 mit
11
intrazellulären Rezeptoren (PPARy) während der Differenzierung von Fettzellen [121,140] ist ein
weiteres Beispiel einer physiologischen Rolle der PG auf Gewebewachstum und -differenzierung.
Fehlen der COX-2 durch Gen-knockout bei Mäusen führt zu einer mangelhaften Ausbildung der
Glomeruli in der Niere mit schweren Folgeschäden [50], ein Effekt, der sich auch durch präpartale und
postpartale COX-2 -Inhibition mit dem COX-2 -selektiven NSAR SC 58236 [125] erzielen lässt.
All dies zusammen betrachtet, v.a. auch in Verbindung mit der Tatsache, dass viele Gewebe wie die
Nieren oder die Samenblasen, die so gut wie nie Tumoren entwickeln, große Mengen COX-2 unter
physiologischen Umständen exprimieren, lässt die Vermutung zu, dass der COX-2 zwar ein fördernder
Einfluss auf die Tumorgenese zukommt, sie jedoch selbst keine karzinominduzierende Wirkung
entfaltet. Vielmehr scheint es so zu sein, dass die eigentliche maligne Transformation unabhängig von
der COX-2 -Expression geschieht und die Tumoren mit der COX-2 -vermittelten PG-Synthese einen
physiologischen Mechanismus nutzen, der auch in gesunden Zellen Proliferation und Differenzierung
steuert. Die COX-2 wird somit zum Werkzeug entarteter Zellen, hat deshalb aber trotzdem
entscheidenden Einfluss auf Tumorwachstum und Metastasierung.
1.4. COX und Niere
1.4.1. COX-1
Die COX-1 wird in der Niere in Arterien, Arteriolen, im Mesangium, der Papille sowie Sammelrohren,
nicht jedoch in Zellen der Macula densa o. Tubuluszellen der Henleschleife exprimiert [85,87,243].
Die COX-1 ist vermutlich an der Natriumexkretion [46] und Regulation des renalen Blutflusses unter
Ruhebedingungen beteiligt. Im Gegensatz zu selektiven COX-2 -Hemmern (Celecoxib) konnten
klassische NSAR bei Hunden und Ratten Papillennekrosen induzieren [10,116] und führten in
klinischen Studien zur Beeinträchtigung von GFR und Nierenfunktion [33,223,270].
Daneben ist bekannt, dass NSAR akute renale Ischiämie und Nierenversagen, besonders bei bereits
eingeschränkter Nierenfunktion, sowie Oligohydramnion und ANV bei Neugeborenen auslösen
können [15,58,284]. Zumindest teilweise ist der renoprotektive Effekt der PG also auf die Funktion der
COX-1 zurückzuführen. Klinische Studien zeigen jedoch keinen Unterschied im Auftreten von
Nierenversagen und Reduktion der GFR zwischen COX-2 Hemmern und unselektiven NSAR.
1.4.2. COX-2
COX-2 -Expression wurde im renalen Gefässendothel und glatten Muskelzellen, ferner in den vasa
recta, Podozyten und Sammelrohren nachgewiesen. Daneben ließ sich COX-2 in Zellen der Macula
densa (MD) sowie im dicken aufsteigenden Teil der Henleschleife (TALH) im Gewebe der Maus,
Ratte, Hase und Hund nachweisen [88]. Auch in der humanen Niere ist COX-2 dort vorhanden,
obwohl lange Zeit der Nachweis unter Ruhebedingungen nicht gelang, wahrscheinlich aufgrund
mangelnder Sensitivität der Nachweismethoden [88]. Die COX-2 ist an zwei wesentlichen
Regelkreisen der Niere beteiligt, dem tubulo-glomerulären Feedback und dem Renin-AngiotensinAldosteron-System. (RAAS).
Mit Hilfe des tubologlomerulären Feedbacks (TGF) ist jedes einzelne Nephron in der Lage, seine
glomeruläre Filtration zu drosseln. Die Regulation des TGF findet am juxtaglomerulären Apparat (JGA)
statt [76,249], wo der distale Tubulus in Kontakt mit dem Glomerulum steht. Spezielle
12
+
+
Tubulusepithelzellen bilden die Macula densa, sie verfügen über einen Na /K /2Cl- Kotransporter
[275], wie er auch in der Henleschleife vorkommt [79]. Die darüber erfolgenden Veränderungen der
Cl- Konzentration in den Zellen der MD [198] stellen die entscheidende Messgrösse zur
Reninsekretion dar (s.unten) [184]. Ito et al. [101] zeigten am isoliert perfundiertem JGA, dass eine
Steigerung der NaCl-Konzentration im Tubulussystem an der MD zu einer Konstriktion des
glomerulären vas afferens führt. Schleifendiuretika hoben diesen Effekt auf [101]. Neben dem Einfluss
der MD auf den Tonus des vas afferens, existiert eine Autoregulation der Gefässwand. Beide
Mechanismen regulieren zusammen die GFR jedes Einzelnephrons [103,108].
Die TGF wird
allerdings in vivo auch durch andere Faktoren, z.B. Sympathikotonus und Stickstoffmonoxid (NO)
moduliert. Während die TGF -Regulation kurzfristige Veränderungen der luminalen NaClKonzentration im Bereich der MD ausgleicht, tritt eine RAAS- Aktivierung immer dann ein, wenn z.B.
ein längerbestehendes NaCl- Defizit registriert wird [208]. Setzt aufgrund anhaltend niedriger oder
hoher NaCl -Konzentrationen eine Veränderung im Renin/ Angiotensinsystem ein, erfolgt eine
Modulation des TGF und Veränderung der Sensitivität [249,250],
so dass auf jetzt verändertem
Ausgangsniveau wieder eine Feinregulation der GFR durch den TGF erfolgen kann. Der TGF arbeitet
vor allem durch Freisetzung vasodilatatorischen Stickstoffmonoxids (NO). Hohe NaCl-Spiegel im
Bereich der MD führen zur Vasokonstriktion des vas afferens, niedrige NaCl -Konzentrationen zur
verstärkten Freisetzung von NO und Vasodilataion. Als Enzym fungiert die neuronale NO-Synthase,
(nNOS) der Macula Densa.
In welcher Beziehung COX-2 und NOS stehen, ist noch nicht bis ins Detaill verstanden.
Viele
Hinweise sprechen dafür, dass NOS der COX-2 vorgeschaltet ist. COX-2 -Aktivierung ist auf
zwischenzeitliche NOS-Aktivität angewiesen, Blockade der NO-Synthase verhindert eine COX-2 Stimulation [41,89,245]. Harris et al. [89,266] zeigten, dass die Synthese von NO durch nNOS zum
Ansteigen von COX-2 mRNA führt. NOS -Inhibitoren konnten die üblicherweise eintretende COX-2
Stimulation durch Behandlung mit Captopril oder salzarme Diät verhindern. Andererseits führt eine
COX-2 -Blockade auch zur Unterdrückung des TGF. nNOS knockout führt nicht zu einer langfristigen
Beeinflussung des TGF. Plasmareninspiegel bei NOS Knockout -Mäusen waren um ca. 50% reduziert
gegenüber Wildtyp, möglicherweise als Anpassungsmechanismus gegenüber der gesteigerten TGFReaktion bei NOS -Verlust [84]. Es wurde vermutet, dass das Signal für den TGF in einer
Veränderung des interstitiellen Volumens im Bereich des Mesangiums besteht [183].
Furosemid
reduzierte durch Blockade des Na+/K+/2Cl -Transporters das interstitielle Volumen [184]. Während
PGI2, durch Relaxierung mesangialer Zellen und Steigerung des interstitiellen Volumens den TGF
verstärkte, [183] schwächten PGE2 und Angiotensin-2 die TGF-Reaktion ab, wahrscheinlich durch
Kontraktion mesangialer Zellen [128]. Eine Rolle der PG im TGF wird jedoch von einigen Autoren
bestritten.
Eindeutiger ist die Rolle der COX-2 auf die Reninsekretion. Skott und Briggs [226] zeigten erstmals
1987 die Stimulation der Reninsekretion durch Verminderung des tubulären NaCl -Angebots und
Lorenz et al. demonstrierten die Regulation der Reninsekretion durch physiologische Schwankungen
der NaCl-Konzentration [149]. Stimulus für die Reninsekretion ist eine intrazelluläre Cl-Verarmung
+
+
[149,198] in den Zellen der MD. Cl- Ionen werden aktiv über den Na /K /2Cl-Kotransporter in die Zelle
transportiert [88,147,184], und an der basolateralen Seite über einen Chloridkanal wieder
+
ausgeschleust. Zum Ladungsausgleich muss K die MD-Zellen über einen luminalen Kaliumkanal
13
(ROMK+) verlassen. Die MD-vermittelte Stimulation für die Ausschüttung von Renin ist PG -abhängig
[62,78,144,148,271].
Obwohl unter Ruhebedingungen in der menschlichen Niere keine COX-2 Expression im Bereich von
MD und TALH nachgewiesen werden konnte [123],
fand sich COX-2 an dieser Lokalisation
verschiedentlich bei älteren Patienten mit reduzierter Nierenfunktion [120,123,126] oder im Rahmen
von renovaskulärer Hypertonie [119,124,168]. Generell ist die COX-2 Expression immer dann
gesteigert, wenn eine Aktivierung des RAAS vorliegt [39,85,91,105,152,266], so z.B. bei
Herzinsuffizienz, Hypertonie [119], diabetischer Nephropathie u.a.. Experimentelle Anordnungen, von
denen bekannt ist, dass sie Hyperreninämie erzeugen, zeigten jetzt eine zur Reninsekretion parallele
Steigerung der COX-2 -Expression im Bereich der MD.
Harris et al. [85] zeigten gesteigerte COX-2 Expression bei Ratten unter salzarmer Diät. Eine künstlich
erzeugte Nierenarterienstenose führte ebenso zu COX-2 Expression wie Behandlung mit Furosemid
[85,152,153].
+
+
Furosemid ist in der Lage durch Blockade des Na /K /2Cl -Transporters die Cl-
Aufnahme in die MD-Zellen zu verhindern und täuscht so eine niedrige tubuläre Cl-Konzentration vor.
Ein ähnlicher Mechanismus führt zu exzessiver COX-2 -Stimulierung und PGE-2 -Synthese bei
Patienten mit Hyperprostaglandin-E- oder Bartter-Syndrom. Hierbei liegt ein genetischer Defekt im
+
+
+
Na K 2Cl -Transporter (Bartter1), im luminalen K -Kanal ROMK+ (Bartter2) o. dem basolateralen ClKanal (Bartter3) vor [174,190]. In mehreren Versuchen wurde gezeigt, dass COX-2 Blockade mit
unselektiven NSAR [86], als auch mit COX-2 selektiven Substanzen [84,279] die Hyperreninämie
unterdrückt. Ebenso zeigten COX-2 negative Mäuse eine gestörte Reaktion auf Salzrestriktion in dem
Sinne, dass die Stimulation der Reninsekretion ausblieb [40,278]. COX-1 negative Tiere dagegen
unterschieden sich nicht von Wildtypmäusen. Auch bei in vitro -Versuchen mit isoliert perfundierten
Glomeruli ließ sich der durch niedrige Chloridkonzentration provozierte Reninanstieg durch COX-2 Blockade verhindern, nicht jedoch durch COX-1 selektive Substanzen. Wang et al. [267] erreichten
durch subtotale Nephrektomie bei Ratten eine durch COX-2- Überexpression bedingte glomeruläre
Hyperfiltration sowie Proteinurie. Der COX-2 -Hemmer SC-58236 reduzierte in diesem Modell die sich
regelmäßig entwickelnde Glomerulosklerose. Cheng et al. beobachteten eine Überexression von
COX-2 in MD-Zellen bei Ratten unter dem ACE-Hemmer Captopril [40] und andere Untersuchungen
zeigten eine Stimulation der COX-2 und Reninsekretion nach Blockade von Angiotensin-1 (AT1), nicht
jedoch AT2-Rezeptoren [40]. Gleichsinnig verhielten sich Mäuse mit Nullmutation des AT1Rezeptorgens (Atr1a). Cheng [40] widerlegte die Theorie der direkten negativen Rückkopplung von
Angiotensin II über AT-Rezeptoren auf die Reninsekretion [87], indem er Mäuse mit genetischem
Chimerismus in der Expression des AT1-Rezeptors erzeugte. Es zeigte sich, dass zwischen AT1positiven und -negativen Zellen des JGA kein Unterschied in der Reninsekretion bestand. Eine
negative Rückkopplung von AngII auf die Reninsekretion geschieht vielmehr über die COX-2.
AT1 -Rezeptoren in MD-Zellen wurden nachgewiesen [90]. Kovacs et al. [127] zeigten weiterhin, dass
AngII die Aktivität des Na+/K+/2Cl -Kotransporters in der MD steigert und so den negativen Feedback
vermittelt.
Weitere Betrachtungen zur Rolle der PG auf die MD-vermittelte Reninsekretion ergaben eine
Beteiligung von PGI2 und PGE2. Sowohl in vivo bei Hunden [71], als auch an isoliert perfundierten
Nieren der Ratte [83] erhöhten diese beiden Eicosanoide die Reninsekretion. Zusammen mit der
14
Tatsache, dass sowohl PGE2 als auch PGI2 über G-Protein-Aktivierung zur intrazellulären cAMP Erhöhung führen können und cAMP ein Stimulus für die Exozytose von Renin darstellt, scheint die
Aktivierung der Adenylat-Cyclase die Reninsekretion zu vermitteln [106]. Schweda et al. [213]
untersuchten die Wirkung von PGE2 auf isoliert perfundierte Nieren von EP1-,EP2-,EP3-,und EP4knockout Mäusen. Die Fähigkeit zur Reninsekretion war bei EP1- und EP3 negativen Tieren
unverändert gegenüber dem Wildtyp. EP2 knockout sowie EP4 knockout führten jeweils zu
verminderten Renin-Basalwerten, ferner ließ sich die Reninsekretion im Vergleich zum Wildtyp nur
submaximal
steigern.
CAY
10399,
ein
EP2-Agonist
stimulierte
bei
Wildtypmäusen
die
Reninausschüttung, nicht jedoch bei EP2 negativen Tieren, wodurch gezeigt wurde, dass die
Stimulation wirklich über den EP2-Rezeptor läuft. Die Autoren vermuteten weiterhin eine
Sonderstellung des EP4-Rezeptors auf die Reninsekretion, da selbst unter Stimulation durch den
EP2-Agonisten CAY 10399 extern zugeführtes PGE2 bei Wildtypmäusen eine weitere Steigerung der
Reninsekretion bewirkte. Ferner war die Empfindlichkeit auf PGE2 mit Reninausschüttung zu
reagieren nur bei EP4 -/- Mäusen vermindert, während bei EP1-,EP2-und EP3 knockout vergleichbare
Effekte wie beim Wildtyp erzielt wurden. Ähnliche Ergebnisse beobachtete die Arbeitsgruppe von
Nüsing und Treude et al. [252]. Cheng et al. [42] zeigten in MD-Zellkulturen, dass Inhibitoren der ERKKinase sowie p38MAP-Kinase die COX-2 -Expression blockierten.
Neben ihrer Wirkung auf die Reninsekretion modulieren PG die renale Hämodynamik. Edwards et al.
[54] wiesen EP2- und EP4 -Rezeptoren in afferenten Arterien des Glomerulus nach, und zeigten einen
vasodilatatorischen Effekt von PGE2 auf das vas afferens beim Hasen. Andere Gruppen zeigten
sowohl vasodilatatorische als auch vasokonstriktorische Effekte der PG auf glomeruläre Gefässe
[11,100,207]. Schweda et al. [213] und andere [56] beobachteten eine Vasodilatation durch PGE2 in
niedriger Konzentration, dagegen Vasokonstriktion in höherer Konzentration. Es wurde vermutet, dass
alle vier EP -Rezeptoren die PGE-2 -Wirkung modulieren, mit EP2 und EP4 durch Stimulation der
Adenylat-Cyclase als Vasodilatatoren, EP1 und EP3, durch intrazelluläre Kalziumerhöhung bzw.
Adenylat-Cyclase- Inhibierung als Vasokonstriktoren. Daneben könnten auch IP-Rezeptoren [37] an
der PGE2-Wirkung beteiligt sein. Die renale Hämodynamik wird außerdem durch die Prostglandine
PGI2, PGF2α über FP-Rezeptoren oder TXA2 über glomeruläre TP-Rezeptoren [14,25,54,104,273]
beeinflusst.
Im Nierenmark vermittelt PGE2 die Natriumexkretion in Situationen erhöhter Volumenbelastung
(sog.“Drucknatriurese“) [31,195]. Mäuse mit EP2 knockout zeigen eine gesteigerte Empfindlichkeit für
Salzbelastung und Entwicklung von Hypertonie [115].
Aus klinischen Gesichtspunkten ergeben sich folgende Konsequenzen: Die PG der Niere wirken
nephroprotektiv in Situationen verminderter peripherer Durchblutung (Exsikkose, Hypotonie) und
NSAR-Gabe kann in solchen Fällen Nierenversagen sowie Papillennekrose auslösen [10,116,223]. In
Situationen gesteigerter RAAS-Aktivität infolge vorbestehender Nierenschädigung kann dagegen eine
Blockade der COX-2 durch selektive NSAR wahrscheinlich die Progression renaler Schäden durch
Hyperfiltration und Glomerulosklerose verhindern [267].
15
1.4.3. NOS
Die renale NO-Synthase (NOS) ist in ihrem Verhalten ähnlich der COX-2. Einige Arbeiten deuten
darauf hin, dass die NO-Sythase und Freisetzung von Stickstoffmonoxid der COX-2- Aktivierung im
Rahmen des tubuloglomerulären feedbacks vorgeschaltet sind [48]. Die nNOS der Macula Densa
führt in Situationen mit niedriger luminaler NaCl- Konzentration zur Vasodilatation des vas afferens
und Perfusionssteigerung des Glomerulums und erhöht die GFR. Knockout von NOS-1 (nNOS) bei
Mäusen führt zu einer Reduktion der Plasmareninspiegel um ca. 50%, möglicherweise als Ausgleich
einer gesteigerten TGF-Reaktion durch den NOS- Verlust [209]. Andererseits beschrieben andere
Gruppen keinen Unterschied in der Expression von COX-2 zwischen nNOS-negativen Mäusen und
Wildtypmäusen, ebenso war die Stimulation der COX-2 durch Salzrestriktion in beiden Gruppen
vergleichbar [242]. nNOS, die neuronale Form der NO-Synthase, lässt sich nachweisen in Zellen der
MD und TALH [269] und Situationen, für die eine gesteigerte COX-2 Expression gezeigt wurde, etwa
Salzrestriktion, Furosemidtherapie, Nierenarterienstenose, führten auch zu einer Überexpression von
nNOS [20,210,224,269]. In vitro Studien am isolierten juxtaglomerulären Apparat zeigten eine
Inhibition der Reninsekretion nach Behandlung mit Nitroprussid, einem NO-Donor [77,212]. Daneben
wurde auch ein fördernder Einfluss von NO auf die Reninsekretion beschrieben [93], indem Zufuhr von
L-Arginin in vitro Reninanstieg bewirkte und dieser Effekt durch NOS-Blockade verhindert wurde [272].
Wilcox et al. [272] erklärten diese Beobachtung damit, dass eine Salzrestriktion zwar zur
Überexpression von nNOS führt, diese jedoch aufgrund eines Mangels an L-Arginin als Substrat in
ihrer Wirkung NO zu synthetisieren funktionslos bleibt. Auf diese Weise könnte die verminderte
Synthese von NO zur Steigerung des tubulo-glomerulären Feedbacks (TGF) und renaler
Vasokonstriktion beitragen. Andere Gruppen zeigten eine eindeutige Beziehung zwischen gesteigerter
NOS-Expression und Aktivierung des RAAS, mit Ausbleiben des Reninanstiegs unter Furosemid,
wenn die NOS blockiert war [13,189]. nNOS -negative Mäuse zeigten verminderte Plasmareninspiegel [84], jedoch eine normale Steigerung der Reninsekretion unter
Furosemid [32]. NOS-
Blockade durch den selektiven Inhibitor L-NAME verhinderte vollständig die Stimulation der
Reninsekretion durch Furosemid bei Wildtypmäusen [210]. Auch in anderen Modellen zur RAASAktivierung, z.B. durch eine Behandlung mit dem ACE-Hemmer Ramipril oder experimentell erzeugter
Nierenarterienstenose bei Ratten, konnte nNOS -Blockade die Steigerung der Reninsekretion
unterbinden [209,211,240]. Cheng at al. [41] beschrieben eine Suppression von COX-2 in den Zellen
der MD durch den unselektiven NOS-Inhibitor 7-nitroindazol. Es ist möglich, dass NO die COX-2 Expression in NOS-positiven Zellen stimuliert, daneben kann NO-Freisetzung in anderen, nNOSnegativen Zellen z.B. der TALH die Expression der COX-2 nicht erklären.
NO wirkt über cGMP-Aktivierung, Cheng et al.[41] zeigten eine cGMP-vermittelte COX-2- Stimulation
in TALH-Zellkulturen beim Hasen. Andererseits konnte weder in Zellen der MD noch der TALH bei
der Ratte cGMP-Expression gefunden werden [241]. cGMP -unanhängige COX-2 -Expression durch
Aktivierung von ERK-Kinase und p38-Kinase wurde demonstriert und könnte eine Rolle spielen [40].
Insgesamt ist die Datenlage zur Rolle der NOS auf die Reninsekretion noch sehr widersprüchlich und
komplex. Interessanterweise konnte bei Mäusen mit Gen-knockout für COX-2 eine gesteigerte
nNOS -Expression im Bereich der MD während der postnatalen Entwicklung (Tag3 bis 60) gezeigt
werden [283]. Eine Beeinträchtigung der Nierenentwicklung ist dagegen bei NOS negativen Mäusen
bisher nicht beeschrieben.
16
1.5. Die COX-2 Knockout - Maus
Die erstmalige Erzeugung COX-1- und COX-2 -negativer Mäuse durch gezielte Genausschaltung
erfolgte in der Absicht, die Rolle der COX-Isoenzyme intensiver zu erforschen. Die COX-1 Knockout Maus wurde 1995 von Langenbach et al. generiert [135]. Die Tiere waren gesund, zeigten normales
Wachstum, erreichten ein normales Alter und vermehrten sich entsprechend der Mendelschen
Gesetze. Allein das komplette Fehlen der COX-1 bei Verpaarung homozygot negativer Weibchen und
Männchen führte dazu, dass fast alle Jungen tot geboren wurden, was auf eine Bedeutung der COX-1
während der Geburt hinweisen könnte [135]. Gross et al. [80] beobachteten eine Verzögerung des
Geburtsvorgangs bei COX-1 -/- Mäusen. Die histologische Untersuchung von Leber, Milz, Nieren,
Lunge, Herz, Gastrointestinaltrakt und
Fortpflanzungsorganen ergab keine Abweichungen vom
Normalbefund [135]. Die Fähigkeit der Thrombozytenaggregation war wie erwartet vermindert [135].
In der Induktion von Entzündung und Ödem im Ohr im „ear-swelling-test“ [66] zeigten COX-1 -negative
Mäuse
eine
verminderte
Entzündungsreaktion
Reaktion
hervorrief.
auf
Die
Arachidonsäure,
Erklärung
hierfür
wohingegen
war,
dass
TPA
eine
normale
normalerweise
COX-1
Arachidonsäure in PGH2 und PGE2 umwandelt und dadurch die Entzündung vermittelt wird. Wildtypund COX-2 -/-Tiere zeigten gleiches Verhalten gegenüber Arachidonsäure in diesem Modell, ebenso
gegenüber
TPA,
was
überraschte,
da
bekannt
ist
,dass
TPA
COX-2
induziert
[135].
Erstaunlicherweise führte COX-1 knockout nicht zu spontanen gastrointestinalen Blutungen und die
Empfindlichkeit für Indomethacin-induzierte Ulzera [135] war sogar reduziert, obwohl PGE2 in der
Magenschleimhaut
auf
1%
des
Normwertes
reduziert
war.
COX-2
Expression
als
Kompensationsmechanismus scheint deshalb unwahrscheinlich. Auch konnte in Western-blotUntersuchungen keine COX-2 in der Magenschleimhaut der Tiere nachgewiesen werden. Die Niere
COX-1 -negativer Mäuse zeigte, wie gesagt, keine pathologischen Befunde.
Die Generierung der COX-2 Knockout-Maus gelang 1995 unabhängig voneinander Dinchuk [50] und
Morham et al. [162]. In der Entzündungsreaktion der COX-2 -/- Maus bestanden Unterschiede
gegenüber dem Wildtyp dahingehend, dass TPA und Arachidonsäure im “ear-swelling-test“ zwar eine
normale Reaktion hervorriefen [136,162], in anderen Modellen („air-pouch modell“[6]) jedoch die PGProduktion um etwa 75% auf ein Niveau reduziert war, wie es auch durch COX-2 -Blockade mit NS
398 erreicht wurde [136]. Eine gesteigerte Rate gastrointestinaler Ulzera wurde nicht beobachtet
[136,162]. Dinchuk beschrieb eine Häufung kardialer Fibrose und Myopathie [162], die von anderen
Autoren nicht beobachtet wurde [162]. Norwood et al. beschrieben lediglich eine normale Entwicklung
des relativen Herzgewichtes [172] ohne histologisch das Herz zu untersuchen. Morham et al.
beobachteten eine Häufung spontaner bakterieller Peritonitiden, v.a. bei männlichen Homozygoten,
die von anderen nicht beschrieben wurde.
Die
markantesten
Auffälligkeiten
der
COX-2
Knockout-
Maus
betrafen
dagegen
die
Reproduktionsfähigkeit und die Nierenentwicklung.
Homozygot COX-2 -negative Weibchen sind infertil. Wie von Lim et al. [143] beschrieben, ist die
COX-2 beteiligt an Ovulation, Implantation des Embryos sowie Einleitung der Geburt und alle drei
Prozesse sind bei der Knockout- Maus wahrscheinlich gestört. Die Autoren beobachteten eine zeitlich
begrenzte Expression des PGE2-Rezeptors EP2 im Uterusepithel der Maus [142] und auch für EP3,
17
EP4, IP und TP wurde eine solche Expression gezeigt [59,112,166,281]. Erstaunlich auf der anderen
Seite ist, dass weder EP3-,EP4-,IP- oder TP -/- Mäuse eine Einschränkung der Fertilität zeigen [251],
lediglich bei EP2 knockout ist die Reproduktionsfähigkeit reduziert [146] . FP knockout führt dagegen
zur Beeinträchtigung der Geburt mit einer hohen Zahl von Totgeburten [237],
was auf eine
verminderte Oxytozinrezeptorexpression bei diesen Tieren zurückgeführt wird [238].
Unter einem Wurf heterozygot verpaarter COX-2 -/-Tiere verteilen sich die Genotypen Wildtyp zu
heterozygot zu homozygot entsprechend den Mendelschen Gesetzen [136,172]. Obwohl von Morham
[162]
und Norwood et al. [172]
nicht beschrieben, zeigte sich später eindeutig eine erhöhte
Sterblichkeit homozygot COX-2 -negativer Tiere innerhalb der ersten 48 Stunden, wie von Dinchuk et
al. beobachtet [50], höchstwahrscheinlich aufgrund eines persistierend offenen Ductus arteriosus. Wie
von Loftin et al. [146] gezeigt, verhindert das Fehlen der COX-2 allein den Ductus-Verschluss bei
einem Teil der Neugeborenen und führt zu einer perinatalen Mortalität von ca.35%. COX-1 knockout
dagegen hat keinen Einfluss und führt zum postnatalen Verschluss bei 100% der Tiere [45]. Das
Überleben der übrigen 65% der COX-2 -/- Mäuse führten die Autoren auf eine teilweise Kompensation
durch die COX-1 zurück. Mäuse mit Nullmutation im EP4-Rezeptorgen wiesen eine perinatale
Mortalität von 95% auf, bedingt durch Persistenz des Ductus [170,215]. Die in utero zur aktiven
Dilatation des Ductus arteriosus benötigten PG könnten bei COX-2- negativen Tieren aus der
maternalen Zirkulation bzw. der Plazenta stammen [228]. Von den homozygoten Tieren, die die ersten
48 Stunden überleben, stirbt die Mehrzahl im Alter von etwa 8 Wochen [162], hauptsächlich infolge
chronischen Nierenversagens. Die mittlere Überlebenszeit beträgt ca. 3,5 Monate [50,162,172].
1.5.1. typische Nierenveränderungen
Während die Niere fetaler [50] und neugeborener COX-2 -/- Mäuse keine histologischen
Abweichungen vom Wildtyp zeigt [50,125,162,172], entwickeln sich etwa um die postnatalen Tage 210 (P2-P10) typische Veränderungen in der Art, dass es zu einem „Arrest“ der Nierenreifung und
Ausbildung funktionsfähiger Nephrone kommt [162]. Es finden sich hypoplastische kortikale Glomeruli,
die in großer Zahl direkt unter der Nierenkapsel liegen, was zu blassen, kleinen Nieren mit granulierter
Oberfläche [162] führt. Daneben finden sich normal ausgereifte juxtamedulläre Nephrone, was
vermuten lässt, dass sie vor Eintritt des Entwicklungsstillstands während der Fetalzeit enstanden sind.
Es muss betont werden, dass die Nierenentwicklung bei Nagern zum Zeitpunkt der Geburt noch nicht
abgeschlossen ist, und im Falle der Maus noch etwa bis zur dritten Woche postpartal anhält.
Die Entwicklung der (humanen) Niere entsteht durch Verschmelzung von Ureterknospe aus dem
Wolff’schen Gang und metanephrogenem Blastem, die sich gegenseitig beeinflussen [16].
Die Ureterknospe erweitert sich zur Ampulle, die sich im weiteren Verlauf dichotom verzweigt und das
metanephrogene Blastem zur Proliferation anregt. Aus der Ureterknospe entstehen nach und nach die
Sammelrohre. Jedem Sammelrohr sitzt eine Knospe metanephrogenen Gewebes auf, welches unter
dem induzierenden Einfluss des Sammelrohrs proliferiert und ein epitheliales Bläschen bildet, welches
sich S-förmig streckt (S-shaped bodies). Aus dem Epithelbläschen entstehen später durch Einstülpung
Bowman-Membran und Glomerulus [16]. Dieser Prozess führt nach und nach zur Generierung aller
Nephrone der Niere, wobei der Ort der Nephronbildung die äußerste Schicht der Nierenrinde ist. Bleibt
der Anschluss neugebildeter Nephrone an das Tubulussystem aus, bilden sich Nierenzysten.
Im Falle der COX-2 -/- Maus spricht die Tatsache, dass in den ersten Tagen nach der Geburt kein
Unterschied zum Wildtyp zu erkennen ist dafür, dass die sich entwickelnde renale Pathologie nicht auf
18
eine gestörte Organanlage, sondern auf eine spätere Störung der Gewebedifferenzierung
zurückzuführen ist. Dinchuk [50] beschrieben S-shaped bodies in der COX-2 negativen Niere am Tag
P2 als Indikator für die Unreife des Organs. Im Alter von 8 Wochen zeigt sich bei allen Mäusen das
Vollbild der Nierenschädigung mit in der Zahl verminderten hypoplastischen Nephronen mit unreifen
Glomeruli und Tubuli direkt unter der Nierenkapsel, daneben eine Hypertrophie der verbleibenden
funktionstüchtigen Glomeruli im Bereich des Nierenmarks, tubuläre Atrophie und Regeneration und
Zystenbildung [162]. Die renale Überlastung zeigt sich letztendlich mit zunehmendem Alter in
interstitieller Fibrose, tubulärer Atrophie, z.T. massiver Zystenbildung und fokal-segmentaler bzw.
globaler Glomerulosklerose [162]. Norwood et al. [172] beschrieben eine Erhöhung von Kreatinin und
Harnstoff, sowie Abnahme der GFR auf 50% bei erwachsenen Mäusen. Letztendlich versterben alle
Tiere in der Urämie. Die Hypertrophie der juxtamedullären Glomeruli ist z.T. zu erklären durch die
relative Hyperfiltration, da aufgrund der großen Zahl hypoplastischer Nephrone im Bereich der
Nierenkapsel
insgesamt
zu
wenig
Filtrationsfläche
zur
Verfügung
steht.
Ein
solcher
Kompensationsmechanismus wurde bei Ratten nach subtotaler Nephrektomie gezeigt [34] und von
Brenner et al.[24] ausführlich beschrieben. Die glomeruläre Hypertrophie und Sklerose kann in diesen
Modellen durch proteinarme Diät reduziert werden. Kömhoff et al. [125] erzielten durch Behandlung
mit dem COX-2 selektiven Inhibitor SC 58236 bei Wildtypmäusen eine der COX-2 -/- Maus
vergleichbare Störung der Nierenentwicklung. Dabei zeigte sich, dass Blockade der COX-2 über die
Fetalzeit hinaus bis Tag P21 einen nahezu identischen Effekt auf die glomeruläre Reifung hatte, wie
alleinige Blockade der COX-2 in der postpartalen Phase. Außerdem zeigten sie an Versuchen mit
Ratten, dass eine gewisse Reife der Glomeruli bereits erreicht war, da sich sowohl endotheliale
(Faktor VIII) als auch mesangiale Marker (Thy 1.1) in hypoplastischen Nephronen nachweisen ließen
[125]. Behandlung mit COX-1 selektiven Substanzen, oder COX-1 knockout [125,135] führte nicht zur
Beeinträchtigung der Nierenentwicklung. Ebenso zeigten heterozygote COX-2 Tiere eine normale
Nephrogenese [136,162].
Der Zeitpunkt der ersten Veränderungen in der COX-2 negativen Niere ist nicht ganz klar. Dinchuk et
al. beobachteten bereits am Tag P2 Veränderungen, Morham, Norwood und Kömhoff erst später (P7
bzw. P8). Teilweise könnten diese Unterschiede dadurch erklärt werden, dass Norwood und Kömhoff
bereits Nachfolgegenerationen der ersten COX-2 -/- Mäuse verwendeten und sich der Effekt
abgeschwächt haben könnte. Spätestens am Tag P8-10, sicher jedoch am Tag P21, dem Tag des
vermuteten Abschlusses der Nierenentwicklung sind die Unterschiede zum Wildtyp eindeutig. Die
Rolle der COX-2 auf die Entwicklung der Niere wird bestärkt durch die nachgewiesene Expression von
COX-2 im Bereich mesenchymaler S-shaped bodies und Sammelrohrepithel während der
Embryonalperiode, sowie im Bereich von TALH und MD bei der Ratte [87]. Bei Mäusen stieg die COX2 Expression auf ein Maximum am Tag P4 und fiel dann langsam ab
[125]. Ein ähnliches
Expressionsverhalten zeigten die Nieren von Hund und Kaninchen [117]. Zhang [286] sowie Vio et al.
[261] wiesen vermehrte COX-2 mRNA in der Niere der Ratte bis zum dritten postpartalen Monat
nach, mit einem Maximum (10fach) in der 2.und 3.Woche. Parallel dazu fand sich ein Abfall der
Glukokortikoidspiegel nach der Geburt, der bis zu zwei bis drei Wochen anhält [97], so dass postuliert
wird, dass bei der Ratte die COX-2 -Expression und die Glukokortikoidrezeptordichte in einer inversen
Beziehung zueinander stehen. Die Dichte des Glukokortikoidrezeptors ist am höchsten im Bereich der
Medulla und nimmt zum Kortex hin ab, wohingegen die COX-2 -Expression im Kortex höher als im
Mark ist. Ein inhibitorischer Effekt von Glukokortikoiden auf die COX-2 ist bekannt [261]. Die niedrigen
19
Spiegel dieses Hormons nach der Geburt ermöglichen also wahrscheinlich die Nierenentwicklung.
Auch in der sich entwickelnden humanen Niere in utero wurde COX-2 im Bereich von MD/TALH
gefunden, wohingegen diese Zellen bei der adulten Niere, bis auf Ausnahmen (s.oben) keine
messbaren Mengen COX-2 enthalten [110,123].
Dass die COX-2 auch auf die Reifung der Niere beim Menschen Einfluss nimmt, zeigten mehrere in
der Literatur beschriebene Fälle kindlicher renaler Dysplasien nach langfristiger Einnahme von NSAR
während der Schwangerschaft [111,185,204,256].
Nierenbiopsien ergaben auch hier rudimentäre
Glomeruli, glomeruläre Zysten sowie Erweiterung einzelner Tubuli mit wenig differenziertem Epithel
[111]. Der Abschluss der Nierenentwicklung wird beim Menschen in der 24-32. Schwangerschaftswoche vermutet, sodass eine NSAR -Exposition innerhalb dieser Zeit möglichst vermieden werden
sollte.
Zusammengenommen lassen diese Daten eine wesentliche Rolle der COX-2 auf die Entwicklung der
Niere sowohl beim Menschen als auch bei anderen Spezies vermuten, die verschieden ist von ihrer
Funktion in der Regulation von TGF und RAAS. Inwiefern der Einfluss der PG auf die Nephrogenese
trotzdem auf ähnlichen Mechanismen wie in der adulten Niere beruht oder auf direkte Aktivierung von
Transkriptionsfaktoren oder anderer Signale zurückgeht, ist nach wie vor unbekannt und wesentlicher
Inhalt dieser Arbeit.
20
2. ZIELSETZUNG DER ARBEIT
Dinchuk et al. [50] und Langenbach und Morham et al. [162], die die ersten COX-2 Knockout Mäuse
generierten, beschrieben erstmals 1995 typische Nierenveränderungen bei den Tieren. Vor allem die
Ausreifung zu funktionsfähigen Glomeruli scheint stark beeinträchtigt zu sein, sodass aufgrund
ungenügender Filtrationsfläche eine Überlastung der Glomeruli eintritt und die Tiere infolge globaler
Glomerulosklerose und Nierenversagen sterben. Die Nephrogenese ist beeinträchtigt bei komplettem
Verlust der COX-2, heterozygote Tiere zeigen ebenso wie COX-1 -/- Tiere keine renale Pathologie.
Hauptanliegen dieser Arbeit ist es, die Rolle der COX-2 während der Nephrogenese besser zu
verstehen. Möglicherweise beeinflussen von der COX-2 gebildete Prostaglandine über die klassischen
membranständigen, G-Protein gekoppelten Rezeptoren die Nierenreifung durch hämodynamische
Effekte oder eine Aktivierung des Renin-Angitensin-Aldosteronsystems. Es ist jedoch auch möglich,
das zur Zeit der Nephrogenese andere, bisher nicht bekannte Mediatoren durch COX-2 produziert
werden, oder sogar eine direkte Beeinflussung von Gentranskription und -Aktivierung stattfindet.
Da fehlende COX-2 Aktivität durch COX-1 nur teilweise kompensiert werden kann, wurde versucht,
über extern zugeführte Prostaglandinanaloga und PG-Rezeptoragonisten eine normale Nierenreifung
zu erreichen. Wenn dies gelänge, wäre zumindest gezeigt, dass Prostaglandine an der Nephrogenese
beteiligt sind, und welche Rezeptoren eine Rolle spielen. Wir konzentrierten uns in der Auswahl vor
allem auf PGE2, und die PGE -Rezeptoren EP2 und EP4, für die vasodilatatorische Effekte
beschrieben sind, und die auch bei der adulten Niere i.R. des Renin-Angiotensin-Aldosteronsystems
eine wichtige Rolle spielen. Demgegenüber wurde geprüft, ob z.B. mit vasokonstriktoischem PGF2α
eine negative Beeinflussung der Nephrogenese bei Wildtypmäusen erfolgen kann.
Weiterhin wurde der zeitliche Verlauf der sich entwickelnden renalen Veränderungen erfasst, da
hierzu unterschiedliche Angaben in den vorliegenden Arbeiten von Dinchuk et al.[50], Morham et al.
[162], Norwood et al. [172] und Kömhoff et al. [125] vorliegen.
Ein dritter Teil der Arbeit vergleicht Mäuse mit unterschiedlichem Genotyp und Verlust einzelner PGRezeptoren miteinander anhand der drei verwendeten Parameter Glomerulusgrösse, relatives
Nierengewicht und Distanz der ersten glomerulären Schicht von der Nierenkapsel. Verglichen wurden
Tiere mit EP1-, EP2-, EP3-, EP4 und IP-knockout, COX-2 -/- und COX-2 +/-, Wildtyp, EP2/EP4 Doppelknockout und mit COX-2 Hemmer behandelte Tiere.
Eine Aufklärung der Rolle der COX-2 während der Nephrogenese ist auch von klinischer Relevanz, da
Fallberichte vorliegen, wonach auch beim Menschen nach längerfristiger Einnahme von NSAR
während der Schwangerschaft die Nierenreifung stark und irreversibel beeinträchtigt wird.
21
3. MATERIAL UND METHODEN
Die Arbeit besteht aus drei Teilen. Zum einen sollte der zeitliche Ablauf der
sich entwickelnden renalen Patholgie bei COX-2 Knockout Mäusen morphologisch erfasst werden. In
einem zweiten Teil wurde versucht, durch externe Substanzen das Fehlen der COX-2 zu ersetzen.
Abschließend wurden verschiedene Mutanten mit Fehlen einzelner PGE2-Rezeptoren anhand
wichtiger morphologischer Parameter miteinander verglichen.
Zeitlicher Verlauf
Um den zeitlichen Verlauf der Nierenveränderungen zu erfassen, wurden an den postnatalen Tagen
P8, P10, P12, P15 und P21 jeweils ein homozygotes (-/-) und ein heterozygotes (+/-) COX-2
Knockout-Tier getötet, die Niere entnommen und histologische Schnitte angefertigt. Sowohl von
Morham [162], Norwood [172], Dinchuk [50] und Kömhoff [125] wurden keine histologischen
Veränderungen an Nieren heterozygoter Tiere beobachtet. Diese Tiere wurden deshalb immer zum
direkten Vergleich hinzugezogen.
PG-Substitution
Da durch das komplette Fehlen der COX-2 die Niere homozygoter Tiere nicht in der Lage ist, PG zu
produzieren, sollte im Haupteil der Arbeit bei diesen Tieren versucht werden, durch Zufuhr externer
PG-Analoga bzw.-Rezeptoragonisten eine normale Nierenentwicklung zu erreichen. Homozygote
-/- Männchen wurden mit heterozygoten +/- Weibchen verpaart, und jeweils ein kompletter Wurf durch
intraperitoneale Injektion, zweimal täglich im 12-h Intervall behandelt. Reine Prostaglandinsubstitution
kam nicht in Frage, da die physiologische HWZ der meisten Substanzen bei mehreren Sekunden bis
einigen Minuten liegt und sehr schnelle Metabolisierung in Leber und Lunge erfolgt. Orale Zufuhr war
ebenfalls nicht möglich, da die Jungen bis zur 3. Woche gestillt werden und praktisch ausgeschlossen
war, dass ausreichende Mengen wirksamer Prostaglandine über die Muttermilch in den kindlichen
Kreislauf gelangen, wo widerum ein ausgeprägter first-pass Effekt zum Abbau der Substanzen geführt
hätte. Die i.p.-Applikationen begannen am Morgen des 3.Tages nach Geburt (=postpartaler Tag P2)
zu einem Zeitpunkt, wo die kritische Phase des Verschlusses des Ductus arteriosus bereits
überstanden ist und die Expression der COX-2 üblicherweise stark ansteigt [125].
Die Behandlung wurde kontinuierlich bis zum Tag P21 fortgesetzt. Anschließend wurden alle Tiere
gewogen, das Geschlecht bestimmt und mit Ohrmarken markiert. Nach Tötung der Tiere durch
zervikale Dislokation erfolgte die Entnahme von beiden Nieren und Herz. Die Nieren wurden jeweils
halbiert und zur histologischen Untersuchung und Auswertung asserviert. Anschließend erfolgte die
Genotypisierung der Tiere durch PCR.
22
Die zur Substitution verwendeten Sustanzen waren im Einzelnen:
-
das PGE1 -Analogon Misoprostol mit Wirkung auf EP3, EP4 und z.T. EP2
-
der EP1 und EP3 -Rezeptoragonist Sulproston
-
das PGE1 -Analogon Alprostadil mit Wirkung auf EP3, EP4 und EP2
-
der EP4 -Rezeptoragonist ONO AE1-329
-
der IP- und EP1 -Rezeptoragonist Iloprost
-
der PPARγ -Ligand 15-deoxy-PGJ2
Das PGF2α Analogon Fluprostenol wurde an C57BL6 Wildtypmäusen auf eine mögliche negative
Beeinflussung der Nierenreifung getestet.
Bei den Dosierungen orientierten wir uns an Angaben aus der Literatur, z.B. an Versuchen zu
Indomethacin-induzierten Schleimhautulcera bei Ratten unter Misoprostolschutz oder Wirkung von
Iloprost auf die pulmonale Zirkulation. Schwere allgemeine Reaktionen beobachteten wir allein in der
Iloprost-Gruppe, wo die Tiere nach den Injektionen schlaff und reglos wirkten, z.T. eine deutlich
sichtbare Vertiefung der Atmung und allgemeine Rötung der Haut zeigten und schlecht gediehen.
Eine mögliche Erklärung dieser Reaktion wäre eine starke Vasodilatation mit Hypotonie bzw. eine
starke gefässerweiternde Wirkung auf die Lungenstrombahn. Wir reduzierten deshalb die IloprostDosis in einem zweiten Versuch. Tiere, die am Tag der Tötung Zeichen einer Peritonitis zeigten, was
insgesamt zweimal vorkam, und durch die Vielzahl der i.p.Applikationen erklärbar ist, oder aus
anderer ungeklärter Ursache deutliche Wachstumsverzögerung aufwiesen, wurden nicht in die
Auswertung übernommen.
Histomorphometrie
Die Erfassung der renalen Veränderungen erfolgte durch die Lichtmikroskopie. Um die Unterschiede
zu quantifizieren und besser darstellbar zu machen, übernahmen wir die von Kömhoff [125]
verwendete Ermittlung des mittleren glomerulären Durchmessers, der bei COX-2 negativen Tieren
signifikant reduziert ist. Dazu wurden 4µm dicke Paraffinschnitte der formalinfixierten Nieren am
Lichtmikroskop bei 200-facher Vergrösserung digital fotografiert und am Computer die Durchmesser
aller Glomeruli in einem kompletten Nierenquerschnitt ermittelt. Aus den Einzelwerten der
glomerulären Durchmesser erfolgte die Berechnung des mittleren Glomerulusvolumens nach der
3
Formel V = 4/3π r .
Als zweiten wichtigen Parameter verwendeten wir den Abstand der Glomeruli in der äußersten Schicht
zur Nierenkapsel. Wie von Norwood [172] beschrieben, unterscheiden sich homozygot COX-2
negative Mäuse auch in ihrem relativen Nierengewicht, berechnet als Verhältnis von Nieren- zu
Körpergewicht signifikant vom Wildtyp. Dies war der dritte wichtige Wert zur Beschreibung der renalen
Unterschiede. Alle ermittelten Werte der homozygoten Mutanten wurden innerhalb eines Wurfes mit
den heterozygoten Tieren verglichen, da sich die einzelnen verwendeten Substanzen in ihren
allgemeinen Wirkungen auf das Wachstum und Gedeihen der Tiere sicher unterschieden.
Trotzdem wurde, sozusagen als Zweitkontrolle, ein Wurf mit Plazebo (NaCl) über 21 Tage behandelt.
23
Vergleich verschiedener Genotypen
In einem dritten Teil der Arbeit ermittelten wir die Werte für mittleres glomeruläres Volumen und Durchmesser, Abstand äußerer Glomeruli von der Nierenkapsel und relatives Nierengewicht von
unbehandelten und am Tag P21 getöteten EP1-,EP2-,EP3-,EP4-,IP-,COX-2 und Wildtypmäusen,
sowie von zwei oral mit dem COX-2 -Inhibitor SC-58236 behandelten Tieren und einer EP-2/EP-4
Doppelknockout-Maus.
3.1. Versuchstiere
Die verwendeten COX-2 Tiere wurden freundlicherweise von Robert Langenbach, National Institute of
Environmental Health Science, North Carolina, die verwendeten PG-Rezeptor Knockout Mäuse von S.
Narumiya, Department of Pharmacology Kyoto University zur Verfügung gestellt.
Die Zucht erfolgte durch Verpaarung unter Standardbedingungen im Tierstall des Instituts für
Molekularbiologie und Tumorforschung, Marburg, sowie im Tierstall des physiologischen Instituts
Marburg. Es wurde ein 12-h Hell-Dunkel-Zyklus eingehalten, die Tiere erhielten Standard-Pelletfutter
und Trinkwasser ad libitum.
Es wurden mindestens 8 Wochen alte homozygote (-/-)Cox-2 knockout Männchen mit erwachsenen
heterozygoten (+/-)Weibchen verpaart. Nach der Geburt verblieb der komplette Wurf bis Ende der
Versuchsreihe am 21.postpartalen Tag bei der Mutter. In gleicher Weise erfolgte die Zucht der
Genoptypen EP1 -/- ,EP2 -/-, EP3 -/-, EP4 -/-, FP -/-,TP -/-, COX-1 -/- und C57BL6 (Wildtyp).
3.2. Genotypisierung
3.2.1. Isolierung der DNA
Die Genotypisierung eines Wurfes erfolgte jeweils nach Tötung der Tiere am Tag P21.
Zur DNA-Gewinnung wurde je ca.1cm Schwanzbiopsie in 500µl Schwanz-Lyse-Puffer überführt und
unter Einwirkung von 5µl Proteinase K, 10mg/ml für 12h bei 55°C im Schüttler inkubiert. Danach
erfolgte die Zentrifugation mit 13000 U/min bei Raumtemperatur für 10min, Überführen des
Überstands in 500µl Isopropanol und Verwerfen des Zentrifugats. Anschließend Schütteln bis zum
Sichtbarwerden des DNA-Pellets und erneutes Zentrifugieren mit 12000 U/min für 30s. Der Überstand
wurde verworfen. Zugabe von 500µl Ethanol, 70% zum Waschen der DNA. Nach erneuter
Zentrifugation bei 13000 U/min für 5min, Verwerfen des Überstandes und Verdunstung restlichen
Ethanols wurde das Zentrifugat mit der enthaltenen DNA in 250µl TE-Puffer gelöst. Dazu gutes
Mischen und Verwahrung im Schüttler für 1-2h bei 55°C.
Chemikalien: Schwanz-Lyse-Puffer :
-
100mM Tris-HCl (Sigma) ,pH:8
5mM EDTA (Sigma)
-
0,2 % SDS (Sigma)
-
200mM NaCl (Merck)
für 100ml
1,5760g
0,1461g
0,2g
1,1688g
24
TE - Puffer
1 ml
-
1M Tris (Sigma)
200µl 0,5M EDTA (Sigma)
Proteinase K, 20U/mg (Fungal Invitrogen)
Ethanol, Isopropanol (Riedel de Haen)
3.2.2. PCR
Alle verwendeten Primer für EP1, EP2, EP3, EP4, IP und COX-2 wurden bei Invitrogen bezogen und
nach den unten aufgeführten Sequenzen synthetisiert. Im Prinzip wurde jede DNA-Probe mit dem
Primer für die Wildtypsequenz und für die mutierte, durch Gen-knockout erzeugte Sequenz versetzt,
daneben enthielt jede Probe den Primer zur rückläufigen Transkription.
Primer-Vorbereitung: Trockene Primer wurden in 100µM Lösung gebracht. Dazu wurden
entsprechend der angegebenen molaren Masse 10µl TE je nmol Primer zugefügt. Für die PCR
erfolgte weitere Verdünnung der Stammlösung mit RNAse-freiem Wasser auf 10µM.
PCR-cups(100µl) auf Eis wurden mit je 2µl DNA bestückt. Anschließend erfolgte die Zugabe von
je 1µl WT-Primer, NEO-Primer und R-Primer. Ferner Zugabe von 2µl eines 2mM dNTP-Gemischs,
10µl RNAse freien Wassers, 2µl Taq-PCR-Puffer sowie zuletzt je 1µl Taq-Polymerase pro
Reaktionsgefäss. Verbringen der PCR-cups in den auf 94°C vorgeheizten Thermocycler und Start der
PCR mit
35 Zyklen a:
94°C für 30s
58°C für 30s
72°C für 30s
nach einer Vorlaufzeit von 5min bei 94°C und mit einer Nachlaufzeit von 5min bei 72°C.
Chemikalien: Primer:
- KOIP-F
5’- GTATCTTTCAGTACCTGAGGA
- KOIP-R
- GAGCAGAAAAATTCCCAGAGG
- KOIP-NEO
- TGACCGCTTCCTCGTCTTA
- KOEP1-F
5’- GCGGAGAGTCCGGCTAGAGAAG
- KOEP1-R
- TGAGCCTAGCGGATGAGGCAGC
- KOEP1-NEO
- ATGACAAGACGCTGGGCGGGGT
- KOEP2-F
5’- CTGGCCATTATGACCATCACC
- KOEP2-R
- CTGAGCAACACCCATGTTTCTATCCTGG
- KOEP2-NEO
- TGATAATGCTGAAGAGCTTGGCGGCGAA
- KOEP3-F
5’- GAGTCCTCCACTTTGGTGTACACAGTAC
- KOEP3-R
- AAAGTGACTAGCACCCAGAATTCCTGCC
- KOEP3-NEO
- TGCCGAATATCATGGTGGAAAATGGCCG
25
- KOEP4-F
5’- TCTACTTGCTCCCAGTGGACATAGATGG
- KOEP4-R
- GAACAGACTCCTGAACTGGGTATGGTTC
- KOEP4-NEO
- TGCCGAATATCATGGTGGAAAATGGCCG
- KOCOX-2/F
5’- ACACCTTCAACATTGAAGACC
- KOCOX-2/R
- ATCCCTTCACCAAATGCCTC
- KOCOX-2/NEO - ACGCGTCACCTTAATATGCG
Taq-Puffer (Sigma,10x Lot 102K9125)
Taq-Polymerase 5U/µl (Sigma, Lot 102K9100)
dNTP (Sigma)
H2O, RNAse -frei
TE (s.oben)
Nach der PCR erfolgte die gelelektrophoretische Auftrennung und Fotografie der Proben.
Dazu wurden 1,5g Agarose in 100ml TAE (1x) unter Erhitzen gelöst. Alle DNA-Proben wurden mit
einem speziellen Färbepuffer gefärbt und je 10µl Probe je Tasche, sowie 7µl Standard base-pairladder ins Gel gefüllt. Die Auftrennung erfolgte bei 150V, 150mA für etwa 30 min. Anschließend
Färbung des Gels in mit 50µl Ethidiumbromid versetztem aqua dest. (500 ml) für 10 min und Waschen
in aqua dest. für 20min.
Chemikalien: 50xTAE - 242 g Tris Base (Roth)
- 57,1 ml CH3COOH konz. (Merck)
- 100 ml 0,5M EDTA (Sigma) ,ph 8
- 1000 ml aqua dest.
Färbepuffer
- 25 mg Bromphenolblau
- 25 mg Xylene cyanol FF
- 4 g Sucrose in Wasser (40%)
1xTAE
Ethidiumbromid 1% (Roth)
Agarose (Sigma)
base-pair-ladder (Amersham Bioscience Lot 223819)
26
---COX-2 NEO
---COX-2 Wildtyp
Abbildung 1: Labordokumentation der Genotypisierung
Die Graphik zeigt die gelelektrophoretische Auftrennung der beiden COX-2 Gene. Das Wildtypgen hat eine
kurzere DNA-Sequenz und wandert im elektr. Feld weiter als das grössere, inaktivierte knockout-Gen.
Alle Tiere sind entweder homozygote knockout-Mutanten oder heterozygot für COX-2.
3.3. Prostaglandinsubstitution
Zur intraperitonealen Applikation wurden folgende Substanzen verwendet:
Jeweils ein kompletter Wurf homozygot (-/-) x heterozygot (+/-) verpaarter COX-2 Knockout- Mäuse
erhielt zweimal täglich, um 8 Uhr und um 20 Uhr:
-
Sulproston in einer Dosis von
300µg / kg KG
-
Misoprostol
100µg / kg KG
-
Iloprost
100µg / kgKG
bzw.
-
15-deoxy-PGJ-2
-
ONO AE1-329
-
NaCl 0,9%
20µg / kgKG in der zweiten Serie
2000µg / kg KG
20µg / kg KG
20µl / Maus
Von diesem Standardschema abweichend erhielt ein Wurf homozygot (-/-) x heterozygot
(+/-)
verpaarter Tiere aufgrund der kurzen HWZ (a-Phase 0,2min ;b-Phase 8min beim Menschen) viermal
täglich um 8, 12, 16 und 20 Uhr das PGE1-Analogon Alprostadil, 250µg/kg KG, allerdings nur vom 2.
bis zum 11.postpartalen Tag (10 Tage). Tötung der Tiere erfolgte ebenfalls am Tag P21.
Ein Wurf Wildtypmäuse (C57BL6) erhielt über die Tränke bzw. Milch der Mutter den COX-2- Inhibitor
SC-58236 in einer Konzentration von 0,6mg/l Trinkwasser, beginnend am Tag P1. Tötung der Tiere
erfolgte am Tag P21.
27
Zwei Würfe Wildtypmäuse erhielten nach dem Standardprotokoll das PGF2α Analogon Fluprostenol in
einer Dosierung von 2000µg/kg KG zweimal täglich i.p. Dazu wurde jeweils die Hälfte eines Wurfes
mit Fluprostenol behandelt, die restlichen Tiere mit 0,9 % NaCl. Eine Markierung der Tiere zur
Zuordnung in Versuchs- oder Kontrollgruppe erfolgte mittels Faserstift am Schwanz.
Die Einzelsubstanzen waren (Fluprostenol) oder wurden (Sulproston, Misoprostol, Alprostadil,
15-d-PGJ2, ONO AE1-329) in reinem Ethanol gelöst und bei -80°C gelagert. Unmittelbar vor der
Injektion wurden die Stammlösungen auf die erforderliche Konzentration mit steriler physiologischer
NaCl-Lösung verdünnt. Iloprost lag als wässrige Lösung vor und wurde bei +4°C gelagert und
ebenfalls vor Applikation mit steriler NaCl-Lsg. verdünnt. Die Konzentrationen wurden jeweils so
gewählt, dass das zu applizierende Gesamtvolumen ca. 20µl für die ersten Tage, später max. 40µl
betrug. Die Berechnung der erforderlichen Menge orientierte sich dabei am gemessenen Gewicht der
Mäusebabies. Die verschiedenen Prostaglandine wurden vor dem Aufziehen in die Spritze auf eine
entsprechende Anzahl steriler PCR-cups(100µl) verteilt. Die Proportionierung erfolgte mittels MicroPipette unter der Sterilbank.
Unmittelbar vor dem Spritzen der Substanzen wurde der gesamte Wurf von der Mutter getrennt und
unter einer Rotlichtquelle gewärmt. Der Inhalt eines gefüllten PCR-cups wurde mittels 1 ml
Tuberkulinspritze (Omnifix Tuberkulin Einmalspritze, 1ml) und Einmalkanüle ( Microlance 3 - 27G3/4 0,4x19 - Nr.20, BECTON DICKINSON) aufgezogen. Nach behelfsmässiger Desinfektion der
Bauchhaut mit Einmal-Alkoholtupfer (Braun) erfolgte die i.p.-Applikation und Verwerfen der Kanüle.
Nach der letzten Maus wurde die Mutter zum Wurf zurückgesetzt und die Mäuse nicht weiter gestört.
Abweichend von diesem Vorgehen erfolgte die Injektion bei den Mäusen von Tag 3 (P2) bis 5/6 (P4/5)
nicht intraperitoneal, sondern subkutan unter die Haut zwischen den Schulterblättern bzw. am Rücken,
da bei i.p.-Applikation durch die noch ganz zarte Bauchdecke fast drei Viertel des Injektionsvolumens
wieder zurückfloss.
Verwendete Substanzen:
-
Sulproston (Nalador® Schering, Deutschland); Amp.a 500µg als Trockensubstanz
-
Iloprost (Ilomedin® Schering, Deutschland); Amp. a 20µg/1ml Lsg.in Ethanol
-
Misoprostol
(Cayman
Chemical,
USA;
Kat.Nr.13820);
5mg/100µl
Lsg.in
Methylacetat
-
Fluprostenol (Cayman Chemical, USA; Kat.Nr.16767); 1mg/100µl Lsg. in Ethanol
-
15-deoxy-∆12,14-PGJ2 (Cayman Chemical, USA; Kat.Nr.18570.1);
1mg/100µl Lsg. in Methylacetat
-
Alprostadil (Prostavasin® 40 Schwarz Pharma, Deutschland); Amp.a 40µg
Trockensubstanz
-
ONO AE1-329, 10mg/500µl Lsg. in Methylacetat; freundlicherweise zur
Verfügung gestellt von ONO Pharmaceutical & Co.Ltd.,Osaka, Japan
-
SC-58236, 600µg/l Trinkwasser, freundlicherweise bereitgestellt durch
Dr. Martin Kömhoff, Kinderklinik Marburg
28
3.4. Präparation der Tiere
Die Tötung und Präparation der Tiere erfolgte am Nachmittag des 21.postpartalen Tages (P21).
Zuerst wurden alle Tiere eines Wurfes mit Ohrmarken markiert und das Geschlecht bestimmt.
Anschließend wurden die Tiere auf einer Laborwaage auf 0,1g genau gewogen. Die Tötung und
Organentnahme erfolgte in einem separaten Raum. Nach Betäubung mit Isofluoran wurden die Tiere
durch zervikale Dislokation getötet. Nach Fixierung in Rückenlage erfolgte die Durchtrennung der
Bauchhaut von kaudal in Richtung Zwerchfell mit der Präparationsschere. Anschließend Eröffnung der
Bauchhöhle bis zum Zwerchfell, Durchtrennen von Zwerchfell und Sternum. Absetzen der großen
Gefässe (Aorta,V.cava, A. pulmonalis) und Entnahme des Herzens. Die Herzhöhlen wurden längs mit
dem Skalpell eröffnet und restliches Blut durch Wälzen auf der Zellstoffunterlage entfernt.
Anschließend wurde das Herzgewicht auf einer chemischen Analysenwaage (Sartorius R180D-D1)
mit 0,1mg Genauigkeit bestimmt. Aufsuchen der linken Niere im Retroperitoneum mit zwei
Präparierpinzetten, Fassen der Niere am Hilus und stumpfes Herauspräparieren. Anschließend
Durchtrennung von Ureter am Nierenbecken, Absetzen der Gefäßstümpfe am Nierenhilus und
Herausschälen der Niere aus der Fettkapsel. Erneut Bestimmung des Gewichtes auf der
Analysenwaage. Mit dem Skalpell erfolgte die möglichst schonende Trennung der Niere in zwei
Hälften quer zur Längsachse. Die Präparation der rechten Niere erfolgte analog zur linken Niere.
Das Herz wurde verworfen. Je eine Hälfte der linken und rechten Niere wurde in frisch angesetztes
4%iges Formalin überführt, bei 4°C für 12-24h fixiert und anschließend in 70% Ethanol gelagert.
Die verbleibenden beiden Nierenhälften wurden für mögliche weitere Untersuchungen mit
Carnoy’scher Lösung fixiert bzw. im Isopentanbad auf Trockeneis tiefgefroren und bei -80°C
aufbewahrt. Dazu Einbettung in Tissue-Tek.
3.5. Histologische Schnitte
Zur Auswertung wurden jeweils nur die formalinfixierten linken Nieren verwendet, da ein
physiologischer Grössenunteschied li./re. besteht.
Die in 70% Ethanol gelagerten, formalinfixierten Nieren wurden für jeweils 1 Stunde unter ständiger
Durchmischung in 80%, 95%, 100%, 100% Ethanol überführt. Anschließend Überführung in Xylol als
Intermedium für je zweimal 1h, danach erfolgte die Durchtränkung mit 62°C heissem Wachs
(TissueWax medite, Schmelzpunkt 52-54°C) für 1h. Erneutes Überführen der Nieren in frisches
Wachs für 1 weitere Stunde und vorsichtiges Erstarren zum Gewebsblock auf der Eisplatte. Dabei
wurde darauf geachtet, dass die Nieren jeweils auf ihrer Schnittfläche zu liegen kommen, um später
beim Schneiden den kompletten Querschnitt zu erfassen.
Aus den Paraffinblöcken wurden 4µm dicke Schnitte mit einem Rotationsmikrotom (Leica)
angefertigt und diese auf Superfrost plus Gläser (Menzel Glaser) aufgezogen.
29
3.5.1. HE-Färbung
Die Entparaffinierung erfolgte durch schrittweises Überführen der Objektträger für 2x 5min in Xylol,
2x 2min in Methanol, 2x 2min Leitungswasser. Zur Färbung verwendeten wir Hämatoxylin nach Mayer
für 1min, anschließendes Wässern unter fließendem Leitungswasser für 2-3min und Gegenfärbung
mit Eosin für 40s.
Im Anschluss erfolgte die Entwässerung der Schnitte durch eine aufsteigende Alkoholreihe
mit 50%, 70%, 95%, 100% Ethanol für je 1min und abschließend 100% Ethanol für 3min.
Nach Durchtränkung mit Xylol für 1min Eindeckeln mit Entellan (Merck Microscopy).
Chemikalien: Formalin
-
4g para-Formaldehyd (Sigma)
-
90 ml PBS bei 70°C
PBS
-
11,5g Na2HPO4
-
79,48g NaCl
-
1,9g KH2PO4
-
1,94g KCl
-
1000 ml aqua dest.
Carnoy’sche Lösung
-
6 Teile Ethanol,100%
-
3 Teile Chlorororm(Merck)
-
1 Teil Essigsäure konz.(Merck)
Eosin-Stammlösung
-
1g Eosin (Sigma)
-
100ml aqua dest.
Eosin Färbelösung: Stammlösung 1:10 verdünnen
Hämatoxylin nach Mayer (Fluka, BioChemika)
Isofluoran (Forene,Abbott)
Isopentan (Fluka)
Tissue Tek 4583 (Sakura)
Ethanol, Methanol, Xylol, (Riedel deHaen)
30
3.6. Histomorphometrie
Zur Ermittlung des glomerulären Durchmessers wurden die Schnitte bei 200-facher Vergrösserung im
Lichtmikroskop (Leica DMRB) digital fotografiert (Kamera SPOT Visitron) und am Computer
ausgemessen. (Software: SPOT advanced, Version 3.4.5 for windows; Diagnostic Instruments)
Zur Eichung der Kamera verwendeten wir eine Neubauer-Zählkammer (DIN) für Blutausstriche.
Pro Tier wurden je zwei komplette Nierenquerschnitte, deren Schnittebene mind. 50µm auseinander
liegen mussten, eingescannt und alle Glomeruli vermessen. Dabei wurde nur der Durchmesser des
Gefässknäuels, nicht derjenige der Bowmanmembran (bzw. äußeres Blatt der Bowmanmembran)
ermittelt. Bei der Bestimmung der glomerulären Grösse wird meist von der Annahme ausgegangen,
dass es sich um ein Rotationsellipsoid handelt, bei dem das Volumen aus dem großen und dem
diesen halbierenden senkrechten Durchmesser nach der Formel V= π /6 (LxB)
3/2
berechnet wird.
3
[206]. Jedoch auch die klassiche Formel zum Kugelvolumen V= 4/3π r wird in der Literatur verwendet
[260,27]. In dieser Studie wurde vereinbarungsgemäss jeweils strikt der glomeruläre Durchmesser
senkrecht zur Nierenoberfläche bestimmt, wobei sich Verformungsfehler, die bei der Organentnahme
und Halbieren der Nieren auftreten bei einer Zahl von ca.160-200 Einzelwerten pro Niere z.T.
gegenseitig aufheben würden. Aus den ermittelten Messwerten wurde der mittlere glomeruläre
Durchmesser, sowie das aus den Einzelvolumina errechnete mittlere Volumen nach V= 4/3 π r
3
berechnet.
Bei der Interpretation der Werte ist zu bedenken, dass mittleres glomeruläres Volumen und
Durchmesser mit der Nierenmasse korreliert ist, und diese wiederum in Beziehung zum Körpergewicht
steht, d.h. kleine Mäuse haben kleinere Nieren und kleinere Glomeruli als große [197]. Hinzu kommt,
dass sich alle Versuchstiere noch in der Wachstumsphase befanden, was diesen Effekt verstärkt.
Norwood et al. [172] beschrieben auf jeden Fall eine normale Entwicklung des Körpergewichts von
cox-2 -/- Mäusen, dagegen relativ zu kleine Nieren, d.h. die Veränderungen der glomerulären
Durchmesser sind bedingt durch den Gendefekt und nicht bloss Ausdruck einer allgemeinen
Wachstumsverzögerung.
Da die verschiedenen i.p.-applizierten Substanzen unterschiedlichen Einfluss auf das Körperwachstum und damit auch auf Nieren- und Glomerulusgrösse haben könnten, wurden alle Parameter
immer innerhalb eines Wurfes verglichen. Beim Vergleich mit der Plazebogruppe ist also auch der
Einfluss der jeweiligen Testsubstanz auf das allgemeine Wachstum zu berücksichtigen. Insgesamt
waren alle behandelten Tiere, auch in der Plazebogruppe, durch die zweimal tägliche i.p.-Applikation
und den damit verbundenen Stress am Tag P21 kleiner und leichter als unbehandelte Tiere (7-8g
versus 10g)
Eine wesentliche Charakteristik der Niere COX-2 negativer Tiere ist, wie gesagt, die Lokalisation vieler
hypoplastischer Glomeruli direkt unter bzw. mit Kontakt zur Nierenkapsel, wohingegen in der
ausgereiften Niere jedes Glomerulum von mindestens 2-3 Lagen Tubulusepithel (proximaler Tubulus)
umgeben wird. Wir bestimmten deshalb auch den Abstand der in der äußersten Schicht unter der
Nierenoberfläche gelegenen Glomeruli zur Nierenkapsel. Die Zuordnung zur ‚äußersten Schicht’ bleibt
natürlich relativ subjektiv, als grobe Regel kann jedoch gelten, dass ein Glomerulum, wenn es mehr
als einen Durchmesser tiefer lag als das am meisten außen gelegene, nicht gezählt wurde. (siehe
Graphik)
31
Abbildung 2: Die Nieren wurden am Mikroskop digital fotographiert und mit der Software SPOT advanced,
Diagnostic instruments, der Durchmesser jedes einzelnen Glomerulums (nicht gezeigt) und der Abstand der
ersten Glomerulusschicht von der Nierenkapsel gemessen.
In einer alternativen Darstellung ließe sich die Anzahl der Glomeruli innerhalb einer Zone von z.B.
50µm Breite, gemessen von der Oberfläche wiedergeben. Doch auch diese Beschreibung ist nicht
ganz unproblematisch, da die Nieren der COX-2 Knockout Maus insgesamt kleiner sind und auch
weniger Glomeruli enthalten als Wildtypnieren.
Da bei der COX-2 negativen Niere neben vielen hypoplastischen Nierenkörperchen im äußeren Kortex
auch normalgroße oder hypertrophierte Glomeruli juxtamedullär vorliegen, und die reine Berechnung
des mittleren Durchmessers eine zu grobe Mittelung darstellt, wurden die Werte der glomerulären
Durchmesser auch in ihrer relativen Häufigkeit dargestellt. Z.T. ist so die zweigipflige Verteilung mit
einer ersten Häufung hypoplastischer Glomeruli und einem zweiten kleineren Gipfel normaler, großer
Nierenkörperchen zu erkennen.
In den nierenspezifischen Parametern die zur Auswertung verwendet wurden, beobachteten wir
keinen geschlechtsspezifischen Unterschied, wie von Morham [162] mit deutlich schlechteren Nieren
der männlichen Tiere beschrieben. Hackbarth et al.[82] stellten bei mehreren Versuchstieren (Maus,
Ratte, Hamster) einen grösseren Glomerulusdurchmesser der männlichen Tiere fest, wobei dieser
Unterschied allein durch das grössere Körpergewicht bedingt zu sein scheint. Kangaloo [109] und
Magassa et al. [151] beschreiben dagegen bei weiblichen Mäusen eine signifikant grössere Nierenkörperchendichte als bei männlichen Tieren. Für eine umfassende Darstellung sei auf die Arbeit von
Annett Skorka [225] verwiesen.
32
3.7. Statistische Tests
Der Vergleich der Glomerulusgrösse erfolgte mit Hilfe des U-Tests nach Whitney-Mann,
der deshalb gewählt wurde, weil weder symmetrische noch Normalverteilung für die Durchführbakeit
gefordert wird. Der U-Test vergleicht die zentrale Tendenz zweier unabhängiger Stichproben. Ist er
signifikant, ist davon auszugehen, dass sich die Mediane der zugrundeliegenden Populationen
unterscheiden. Er besitzt hierbei eine höhere Teststärke als der Mediantest.
Hierzu wurde für jede Maus ermittelt, wieviele Glomeruli in ihrem Durchmesser unter dem
Schwellenwert von 25µm liegen. Die relativen Häufigkeiten wurden in einer zusammengefassten
Rangliste geordnet und jedem Wert ein Rangwert, beginnend bei 1 für den kleinsten Wert zugeordnet.
Anschließend wurde die Summe der Rangwerte für die zu vergleichenden Gruppen gebildet als
Summe T1 und Summe T2.
Es folgte die Berechnung der beiden U-Werte für die entsprechenden Gruppen mit
U1= N1 x N2 + N1 x(N1+1) -T1
2
U2= N1 x N2 + N2 x(N2+1) -T2
2
Der kleinere der beiden U-Werte wurde dann mittels einer U-Werttabelle auf Signifikanz überprüft.
(Im 95% - Konfidenzintervall mit einer Irrtumswahrscheinlichkeit von 5% im zweiseitigen Test)
In gleicher Weise erfolgte die Prüfung auf signifikante Unterschiede im relativen Nierengewicht
homozygoter und heterozygoter Knockout Tiere.
Der U-Test versagte aufgrund der geringen Zahl behandelter Mäuse für die Gruppen Alp, Mi, Ilo, Su,
PGJ. So kann z.B. bei Vergleich zweier Gruppen mit N1=4 und N2= 3 eine Irrtumswahrscheinlichkeit
≤ 5% für zweiseitigen Test nicht mehr erreicht werden.
Alternativ anwendbar wäre der Mediantest, doch auch hier zeigen sich die Werte in ihrem Unterschied
nicht signifikant. Ob tatsächlich zweiseitig getestet werden muss, lässt sich diskutieren. Da kompletter
COX-2 -Verlust für die Nierenschädigung verantwortlich ist, scheint es sehr unwahrscheinlich, dass
Prostaglandinzufuhr
die
Situation
weiter
verschlechtern
kann.
Nichtsdestotrotz
wurde
sicherheitshalber zweiseitig getestet, und die Werte der anderen Gruppen bleiben damit nichtsignifikant und nur beschreibend.
Die Kurven für die Häufigkeitsverteilung der Glomerulusgrösse sind mit statistischen Tests nur sehr
schwer vergleichbar, da sowohl unabhängige Daten (Glomeruli verschiedener Tiere eines Wurfes), als
auch abhängige Daten (Glomeruli innerhalb einer Niere) vermischt sind. Außerdem wird durch die
große Zahl von Glomeruli pro Niere eine Repräsentativität suggeriert, die in Wirklichkeit nicht
vorhanden ist. Trotzdem sollte auf diese Darstellung nicht verzichtet werden, weil sie Unterschiede
zwischen den Gruppen sehr plastisch veranschaulicht.
Ein methodisches Manko dieser Arbeit ist, dass die Zuordnung der Tiere zur Plazebogruppe und
Wirkstoffgruppe nicht randomisiert erfolgte. Somit ergibt sich theoretisch die Möglichkeit, dass
Unterschiede in den ermittelten Parametern nicht substanzbedingt sind, sondern allein auf zufälligen
Differenzen zwischen verschiedenen Würfen beruhen. Diesbezüglich soll noch einmal betont werden,
33
dass es auch bei der jetzigen Vorgehensweise nicht einfach war eine ausreichende Zahl homozygoter
Knockout-Tiere zu erhalten, zumal die Genotypisierung immer erst nach Tötung der Tiere erfolgte.
Ferner setzte sich zumindest die ONO-Gruppe aus Tieren dreier verschiedener Würfe zusammen.
34
4. ERGEBNISSE
4. 1. Histologie
Die Nieren der homozygoten COX-2 -/- Tiere lassen sich meist auf den ersten Blick von denen
heterozygoter Tiere in der Kontrollgruppe unterscheiden. Bei den heterozygoten Tieren, deren Nieren
sich histologisch nicht vom Wildtyp unterscheiden, waren alle Glomeruli ungefähr gleich groß und
homogen über die Nierenrinde verteilt. Es wurden keine kapselberührenden oder randständigen
Glomeruli beobachtet. Vielmehr fanden sich zwischen erster glomerulärer Schicht und Nierenkapsel
immer einige Tubuluszellagen. Das Dickenverhältnis von Nierenrinde zu Nierenmark betrug am Tag
der Tötung (P21) etwa 3:2.
Die Nieren der Knockout -Mäuse waren dagegen bereits in der Übersichtsvergrößerung kleiner und
v.a. die Nierenrinde schien im Vergleich zu heterozygoten Tieren verschmälert, mit einem RindenMark-Verhältnis von ca. 1:1. Es fanden sich viele hypoplastische Glomeruli mit direktem Kontakt zur
Nierenkapsel und ohne umgebendes Tubulussystem. Glomeruli, die weiter in Richtung Nierenmark
lagen, schienen dagegen normal entwickelt und vom Durchmesser vergleichbar mit denen der
Kontrollgruppe. Einige sehr große, im weiteren Verlauf hypertrophierende Glomeruli fanden sich
juxtamedullär. Dieses typische Bild zeigten alle COX-2 Knockout -Tiere, auch die PG- behandelten.
Einzige Ausnahme bildete hier die Gruppe der mit dem EP-4 -Agonisten ONO AE1-329 behandelten
Mäuse.
Neben diesen Unterschieden in Verteilung und Größe der Glomeruli wiesen einige, jedoch nicht alle
Knockout-Tiere subkapsuläre und kortikale Zysten auf, z.T. als echte, epithelausgekleidete Zysten,
z.T. als “falsche“ zystische Erweiterungen im Interstitium. Diese könnten Ausdruck der gestörten
Nephronausreifung und fehlendem Anschluß neu entstehender Nephrone an das Sammelrohrsystem
sein. Besonders deutlich waren diese zystischen Veränderungen bei jeweils einer Maus in der
Iloprost- und der mit 15dPGJ2 behandelten Gruppe. Möglicherweise entwickeln auch die anderen,
zum Zeitpunkt der Tötung unauffälligen Tiere mit zunehmendem Alter solche Zysten und
Tubulusauftreibungen. [162]
Zu keinem Zeitpunkt wurden bei den Versuchstieren dagegen Zeichen einer Entzündung im
Nierengewebe oder Zellinfiltration beobachtet. Auch eine Sklerosierung der überlasteten Glomeruli
konnte nicht gefunden werden, allerdings waren die Tiere dafür einfach noch zu jung.
35
Abbildung 3: Typische histologische Merkmale der COX-2 negativen Niere:
A:) Überblick; hypoplastische Glomeruli mit Kontakt zur Nierenkapsel (kleine Pfeile)
daneben normalgroße Glomeruli in Marknähe; mehrere Zysten
B:) große, epithelausgekleidete Zyste
(Vergr.:100fach)
(Vergr.:400fach)
C:) Homogen über die Nierenrinde verteilte Glomeruli beim Wildtyp, kein Kapselkontakt;
im Vergleich dazu COX-2 -/- (D)
(Vergr.:beide 100fach)
36
4. 1. 1. Zeiltlicher Verlauf der Nierenentwicklung
Bereits die jüngsten untersuchten Tiere am Tag P8 lassen einen deutlichen Unterschied zwischen
Knockout- und gesunder Niere erkennen. (s.Abb.3 u. 4) Am Tag P8 berührt kein einziges Glomerulum
der Kontrollgruppe mehr die Nierenkapsel. Der Abstand der ersten glomerulären Schicht zum Rand
der
Nierenrinde
beträgt
schätzungsweise 15-30
etwa
einen
halben
bis
einen
glomerulären
Durchmesser,
also
µm. Trotzdem erkennt man noch die Zone unter der Nierenkapsel als
Ursprung oder Keimzentrum der Nephrone, denn hier ist die Glomerulusdichte am höchsten.
Ein ähnliches Bild zeigt die COX-2 -negative Niere am Tag P8 mit in Größe und Anzahl vergleichbaren
Glomeruli, jedoch finden sich hier direkt randständige Nierenkörperchen.
Zu diesem Zeitpunkt ist die Dicke der Nierenrinde in beiden Gruppen in etwa gleich.
Am Tag P10 hat sich der Abstand der ersten glomerulären Schicht vom Nierenrand in der
Kontrollgruppe bereits fast verdoppelt, die Glomeruli sind größer und weiter in Richtung Mark
vorgedrungen. Gleichzeitig hat sich die Nierenrinde insgesamt verbreitert. Dieser Prozess setzt sich
kontinuierlich fort bis zum Tag P21, wo eine breite, kräftige Nierenrinde mit homogen verteilten,
gleichgroßen Glomeruli vorliegt. Die erste Glomerulusschicht liegt jetzt in einem Abstand von rund 2
glomerulären Durchmessern unter der Kapsel, also 60-70 µm.
Abbildung 4:
normale Nierenhistologie (COX-2 +/-) am Tag P8, P10 und P21 (Vergr.:200fach)
homogene Verteilung gleichmäßig ausgereifender Glomeruli über die Nierenrinde
37
In der COX-2 -/- Gruppe findet sich am Tag P10 ebenfalls eine Größenzunahme der tieferliegenden
Glomeruli, die gleichzeitig auch weiter in Richtung Mark vorgedrungen sind.
Diese marknahen Glomeruli erreichen später, besonders deutlich bereits am Tag P15 normale Größe,
um im weiteren Verlauf aufgrund der Hyperfiltration zu hypertrophieren[162].
Die kapselberührenden Glomeruli verharren jedoch an dieser Stelle während der gesamten Zeit bis
P21, zeigen keine Größenzunahme, sondern scheinen z.T. sogar wieder im Durchmesser
abzunehmen und zu atrophieren.(Vergleich P8 und P12).
Zwischen diesen beiden Extremen, den normalgroßen juxtamedullären und den atrophierten
kapselständigen Glomeruli findet sich eine Population relativ zu kleiner, aber scheinbar
funktionsfähiger Glomeruli in der äußeren Rindenschicht.
Am Tag P21 zeigt sich letztendlich das für COX-2 knockout typische Bild mit insgesamt schmaler,
hypotropher
Nierenrinde,
ausgereiften
juxtamedullären
Glomeruli
sowie
hypoplastischen
subkapsulären Glomeruli und z.T. Zystenbildung. Der Abstand der ersten glomerulären Schicht von
der Nierenkapsel beträgt strenggenommen Null µm.
Abbildung 5: COX-2 -/- Nieren am Tag 8, 10, 12, 15 und 21;
deutlicher Größenunterschied subkapsulärer und juxtamedullärer Glomeruli ab Tag P12;
kapselberührende Glomeruli in allen Schnitten (Vergr.:200fach)
38
4. 2 . Prostaglandin-Substitution
4. 2. 1. Plazebogruppe
Da alle i.p.-behandelten Mäuse am Tag P21 kleiner und leichter waren als ungestört aufgewachsene
Tiere, wurde angenommen, dass das zweimalig-tägliche Spritzen einen erheblichen Streß für die
Tiere darstellt und so zu Wachstumsverzögerung führt. Um vergleichbare Messwerte zu erhalten,
wurde deshalb ein Wurf homozygot x heterozygot verpaarter COX -/- Mäuse mit isotoner NaCl-Lsg.,2x
tgl. über 21 Tage, in gleicher Weise wie die Mäuse der Versuchsgruppen behandelt. Abb.1 zeigt die
Nierenhistologie dieser Plazebogruppe. Dies war der Ausgangswert, mit dem alle PG-behandelten
Tiere auf einen möglichen positiven Effekt hin verglichen wurden.
Abbildung 6:
heterozygote und homozygote COX-2 -/- Tiere nach Behandlung mit NaCl
oben: homogen verteilte, gleichgroße Glomeruli
bei heterozygoten Tieren; entspr. Normalbefund
unten: viele hypoplastische Glomeruli mit direktem Kontakt zur
Nierenkapsel bei homozygoten Knockout-Tieren, daneben
normalentwickelte Glomeruli in den tieferen Schichten, zystisch
dilatierte Tubuli (dicker Pfeil)
Insgesamt ist der mittlere glomeruläre Durchmesser reduziert,
die Distanz der ersten glomerulären Schicht zur Kapsel
praktisch Null. Die in der Übersichtsvergrößerung sichtbare
Verschmälerung der Nierenrinde äußert sich in einem
gegenüber der Vergleichsgruppe reduzierten relativen
Nierengewicht
Tabelle 1: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben, hier
bei je 1 Tier ± 0. Das glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne
Standardabweichung angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n=1 ]
COX-2 -/- [ n=1 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
28,8 ± 0 µm
24,6 ± 0 µm [91,5%]
n.mgl.
-glomerul. Volumen
15628 µm3
11450 µm3
n.mgl.
40,4 ± 0 µm
1,5 ± 0 µm
n.mgl.
9,6 ± 0
n.mgl.
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
13,5 ± 0
39
Die Glomeruli COX-2 negativer Tiere sind in der Größe sehr unterschiedlich. Man beobachtet, wie gesagt
eine große Zahl sehr kleiner Nierenkörperchen an der Nierenkapsel und daneben normalgroße Glomeruli
weiter in Richtung Nierenmark. Dagegen sind die Glomeruli der heterozygoten Tiere sehr homogen. Um
diese Unterschiede besser darzustellen, als es mit der reinen Berechnung des mittleren Durchmessers
möglich ist, wurden alle Einzelwerte des glomerulären Durchmessers der homozygoten Tiere einer Gruppe
in einer Rangliste dargestellt und den Klassen 0-2,5µm, 2,5-5µm ....62,5-65µm zugewiesen. In gleicher
Weise wurde mit heterozygoten Tieren verfahren. Es ergibt sich so eine Häufigkeitsverteilung der
Durchmesser der Glomeruli für jede Gruppe, die aufgrund der kleinen Zahl enthaltener Tiere (meist 6-8 je
Wurf) allerdings nicht repräsentativ ist.
Um mehrere Verteilungskurven besser miteinander vergleichen zu können, wurden alle Häufigkeiten mit
einem linearen Faktor multipliziert, so dass die größte relative Häufigkeit jeweils den Wert 1 erreicht. Das
Verhältnis der Häufigkeiten zueinander wird auf diese Weise nicht verändert. In der folgenden Grafik sieht
man die eingipflige und zu größeren Werten verschobene Kurve der heterozygoten Tiere mit einem
Maximum bei 30µm, neben der Kurve für homozygote Knockout-Tiere, beide aus der Plazebogruppe
(NaCl). Die Verteilungskurve der homozygoten Tiere ist angedeutet zweigipflig und zeigt eine Mehrzahl von
Glomeruli mit einem Durchmesser von 25µm, sowie eine zweite Häufung bei 37,5 - 45 µm, die die großen,
marknahen Glomeruli repräsentiert.
0
5
10 15 20 25 30 35 40 45 50 55 60
1
Häufigkeit
0,75
COX-2 +/-
0,5
COX-2 -/0,25
0
Durchm esser µm
Abbildung 7: Häufigkeitsverteilung der glomerulären Durchmesser bei homozygoten und
heterozygoten Tieren der Placebogruppe
Das Häufigkeitsmaximum liegt bei Knockout-Tieren bei einem kleineren Wert als in der
Gruppe der heterozygoten Tiere, ein zweiter ‚peak’ bei 45 µm spiegelt die großen
marknahen Glomeruli wieder.
Alle Glomeruli wurden anhand ihres Durchmessers den Klassen 0-5, 5-10 …55-60 µm
zugeteilt und die relative Häufigkeit der einzelnen Klassen dargestellt; blau dargestellt
sind die homozygoten Knockout-Tiere eines Wurfes, rot die heterozygoten.
[ Anmerkung: Im Vergleich zu Abb. 10, 13, 16, 19, 22 und 25 wurde zur Kurvenglättung
ein gröberes Raster (weniger Klassen) gewählt, die zugrundeliegenden Einzelwerte sind identisch.]
40
4. 2. 2. Alprostadil
Abb. 8: Nierenquerschnitt einer COX2 Knockout Maus nach Behandlung mit
Alprostadil
Behandlung mit dem PGE1 -Analogon Alprostadil, 250µg/kgKG zeigte rein histologisch keine
Verbesserung gegenüber Plazebo. Die Werte für rel.Nierengewicht sowie die Distanz zur Kapsel
entsprechen weitgehend der Plazebogruppe. Der mittlere glomeruläre Durchmesser COX-2 -/- Tiere
erreicht 91,5% des Wertes aus der heterozygoten Gruppe.
Tabelle 2: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n=4 ]
COX-2 -/- [ n=3 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
27,7 ± 0,1 µm
25,4 ± 1,1 µm [91,5%]
P = 0,034
-glomerul. Volumen
14030 µm3
12465 µm3
44,2 ± 3,4 µm
6,6 ± 2,3 µm
P = 0,034
14,2 ± 0,7
10,5 ± 0,9
P = 0,034
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
Der Häufigkeitsgipfel in der Verteilungskurve aller Einzeldurchmesser liegt bei COX-2 -/- Tieren bei
22,5 µm gegenüber 30 µm bei COX-2 +/- Tieren, homozygote und heterozygote Tiere unterscheiden
sich also wie in der Plazebogruppe deutlich voneinander.
Der direkte Vergleich der Verteilungskurven homozygoter Alprostadil-behandelter Mäuse mit
homozygoten NaCl-behandelten Mäusen zeigt keinen signifikanten Unterschied.
41
0
5 10 15 20 25 30 35 40 45 50 55 60
1
Häufigkeit
0,75
COX-2 +/-
0,5
COX-2 -/-
0,25
0
[ n = 480 bei 3 Tieren -/- vs. n = 817 bei
4 Tieren +/-]
Durchmesser µm
0
Abbildung 10: Kein Unterschied nach
Behandlung mit Alprostadil (rote Kurve)
gegenüber Placebo in der Glomerulusgröße
bei COX-2 -/-Tieren.
5 10 15 20 25 30 35 40 45 50 55 60
1
Häufigkeit
0,75
Alp
0,5
Abbildung 9: Größere Glomeruli in der
Gruppe der heterozygoten Tiere,
zweigipfliger Kurvenverlauf in der Gruppe
der Knockout -Tiere nach Behandlung mit
Alprostadil
Alle Glomeruli wurden anhand ihres Durchmessers
den Klassen 0-5, 5-10 …
55-60 µm zugeteilt und die relative
Häufigkeit der einzelnen Klassen dargestellt.;
blau dargestellt sind die homozygoten KnockoutTiere eines Wurfes, rot die heterozygoten
NaCl
[ n = 167 bei 1 Tier (NaCl) vs. n = 480
bei 3 Tieren (Alp.)]
0,25
0
Durchmesser µm
4. 2. 3. Misoprostol
Abb.11: Nierenquerschnitt einer COX2 Knockout Maus nach Behandlung mit
Misoprostol
42
Die Histologie COX-2 negativer Tiere hat sich nach Behandlung mit dem PGE1 -Analogon und
Agonisten für EP2, EP3 und EP4 Misoprostol, 100µg/kgKG nicht geändert. Es finden sich die
typischen kapselberührenden Glomeruli wie in der Plazebogruppe. Sowohl die Glomeruli der
heterozygoten als auch der homozygoten Tiere sind kleiner als in der Plazebogruppe, der Unterschied
im mittleren Glomerulusdurchmesser zwischen COX-2 +/- und -/- liegt mit 85 % im Bereich der
Plazebogruppe, ebenso die Werte für relatives Nierengewicht und Distanz zur Kapsel. Das deutlich
reduzierte Volumen der homozygoten Tiere darf nicht überbewertet werden, da sich dieser Wert aus
den Durchmessern berechnet und Differenzen im Durchmesser (und Messfehler) immer in dritter
Potenz in diesen Wert eingehen. Die Verteilungskurven zwischen Knockout- und Kontrollgruppe
unterscheiden sich deutlich. Gegenüber Plazebo-behandelten Knockout-Tieren besteht kein
wesentlicher Unterschied. Zusammengefasst scheint Misoprostol keinen, evtl sogar einen gering
negativen Effekt auf die Nierenentwicklung COX-2- negativer Tiere zu haben.
Tabelle 3: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n=4 ]
COX-2 -/- [ n=2 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
25,4 ± 0,2 µm
21,8 ± 0,5 µm [85,8%]
P = 0,064
-glomerul. Volumen
11028 µm3
7520 µm3
25,7 ± 2,6 µm
4,8 ± 0,7 µm
P = 0,064
14,2 ± 0,9
10,2 ± 0,6
P = 0,064
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
0
5 10 15 20 25 30 35 40 45 50 55 60
1
Häufigkeit
0,75
COX-2 +/-
0,5
Abbildung 12: Nach Behandlung mit
Misoprostol haben COX-2 -/-Tiere nach wie
vor kleinere Glomeruli als heterozygote Tiere.
Alle Glomeruli wurden anhand ihres Durchmessers
den Klassen 0-5, 5-10 …
55-60 µm zugeteilt und die relative
Häufigkeit der einzelnen Klassen dargestellt
COX-2 -/-
[ n = 366 bei 2 Tieren -/- vs. n = 838
bei 4 Tieren +/-]
0,25
0
Durchmesser µm
0
5 10 15 20 25 30 35 40 45 50 55 60
Abbildung 13:
1
Häufigkeit
0,75
Misopr.
0,5
NaCl
Glomerulusgröße COX-2 - negativer Tiere
nach Behandlung mit Misoprostol (rote
Kurve). Kein signifikanter Unterschied
gegenüber Placebo.
[ n = 167 bei 1 Tier (NaCl)
vs. n = 366 bei 2 Tieren (Mi.)]
0,25
0
Durchmesser µm
43
4. 2. 4. Iloprost
Abb. 14:
Nierenquerschnitt einer
COX-2 Knockout Maus nach Behandlung mit Iloprost
Behandlung mit dem IP- und EP1- Agonisten Iloprost, 20µg/kgKG führte nicht zur Ausreifung der
kapselständigen Glomeruli. Daneben fiel bei einem
der homozygoten Tieren dieser Gruppe eine
besonders starke Zystenbildung auf, wie sie nur in der PGJ-Gruppe noch auftrat. Da nicht alle Tiere
diese Zysten bilden, muss eine Prädisposition bei der Maus bereits vorhanden sein.Tritt dann
Zystenbildung ein, scheint Iloprost diese zu verstärken. Mittlerer glomerulärer Durchmesser und
Volumen, Distanz zur Kapsel sowie relatives Nierengewicht sind für homozygote und heterozygote
Tiere verschieden und den Werten der Plazebogruppe sehr ähnlich. Die homozygoten Tiere erreichen
einen durchschnittlichen Glomerulusdurchmesser der 83,4% des heterozygoten Wertes entspricht. Die
Verteilungskurve der homozygoten Tiere zeigt zweigipfligen Verlauf und ist zu kleineren Werten
verschoben. Die Glomerulusdurchmesser Iloprost-behandelter Tiere unterscheiden sich nicht von
denen der Plazebogruppe.
Tabelle 4: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n= 4 ]
COX-2 -/- [ n=2 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
28,9 ± 0,4 µm
24,1 ± 0,2 µm [83,4%]
P = 0,064
-glomerul. Volumen
15118 µm3
10475 µm3
43,0 ± 4,2 µm
3,5 ± 0,4 µm
P = 0,064
14,2 ± 0,5
10,6 ± 0,1
P = 0,064
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
44
0
5 10 15 20 25 30 35 40 45 50 55 60 65
1
Häufigkeit
0,75
COX-2 +/-
0,5
COX-2 -/0,25
0
Durchmesser µm
0
[ n = 349 bei 2 Tieren -/vs. n = 807 bei 4 Tieren (+/-]
5 10 15 20 25 30 35 40 45 50 55 60
Abbildung 16: Glomerulusgrössen
homozygoter Tiere der Iloprostgruppe
vs. Placebo.
Nahezu identischer Kurvenverlauf.
1
0,75
Häufigkeit
Abbildung 15: Häufigkeiten der
Glomerulusgrößen bei heterozygoten und
homozygoten Tieren nach Behandlung mit
Iloprost. Die Kurve der Knockout Tiere ist
zu kleineren Werten verschoben und
zweigipflig.
Alle Glomeruli wurden anhand ihres
Durchmessers den Klassen 0-5, 5-10 …
55-60 µm zugeteilt und die relative
Häufigkeit der einzelnen Klassen
dargestellt
Iloprost
0,5
NaCl
0,25
[ n = 167 bei 1 Tier (NaCl)
vs. n = 349 bei 2 Tieren (Ilo)]
0
Durchmesser µm
4. 2. 5. 15deoxy-PGJ2
Abb. 17:
Nierenquerschnitt einer
COX-2 Knockout Maus nach Behandlung mit 15deoxy-PGJ2
45
Nach Behandlung mit dem PPARγ-Liganden 15dPGJ2, 2mg/kgKG zeigen die Nieren homozygoter
Tiere die typische Pathologie. Die Glomeruli homozygoter Tiere erreichen nur 80,5% des Wertes der
heterozygoten Tiere, ähnlich der Plazebogruppe. So unterscheiden sich auch die Verteilungskurven
der Durchmesser COX-2 +/- und COX-2 -/- Glomeruli deutlich voneinander. Im Vergleich mit
plazebobehandelten Tieren ergibt sich kein signifikanter Unterschied in der Häufigkeitsverteilung bei
homozygoten Tieren.
Die Distanz zu Kapsel beträgt für die erste Glomerulusschicht 3µm für COX-2 -/- versus 47,1 ± 1,5µm
für COX-2 +/-. Das relative Nierengewicht ist mit 12,2 bzw.15,8 ± 0,9 sowohl bei homo- als auch
heterozygoten Tieren gesteigert gegenüber der Plazebogruppe, was für einen allg. wachstumsfördernden Effekt von PGJ2 spricht. Zusammen mit der Histologie und den anderen Parametern
scheint PGJ2 jedoch keinen positiven Einfluss auf die Reifung COX-2 negativer Nieren zu haben.
Tabelle 5: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n= 5 ]
COX-2 -/- [ n=1 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
30,8 ± 0,5 µm
24,8 ± 0 µm [80,5%]
Datenmenge zu klein
-glomerul. Volumen
18165 µm3
11583 µm3
47,1± 1,5 µm
3,0 ± 0 µm
Datenmenge zu klein
15,8 ± 0,9
12,2 ± 0
Datenmenge zu klein
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
0 5 10 15 20 25 30 35 40 45 50 55 60 65
1
Häufigkeit
0,75
COX-2 +/-
0,5
COX-2 -/-
0,25
0
[ n = 107 bei 1 Tier -/- vs. n = 543
bei 3 ausgewerteten Tieren +/- ]
Durchmesser µm
0
5 10 15 20 25 30 35 40 45 50 55 60
Abbildung 19:
Häufigkeit
1
0,75
15dPGJ
0,5
Abbildung 18: Häufigkeit der
glomerulären Durchmesser nach Behandlung
mit 15dPGJ2. Alle Glomeruli wurden
anhand ihres Durchmessers den Klassen
0-5, 5-10 …55-60 µm zugeteilt und die relative
Häufigkeit der einzelnen Klassen dargestellt.
Wie in der Placebogruppe besteht eine deutlich
nach links verschobene Kurve für die COX-2 -/Tiere. Angedeutet zu erkennen ist der zeigipflige
Verlauf.
Glomeruli der COX-2 -/-Tiere
nach Behandlung mit 15dPGJ2 bzw. Placebo.
Es konnte keine Verbesserung des
glomerulären Durchmessers erreicht werden.
NaCl
0,25
[ n = 167 bei 1 Tier (NaCl) vs. n = 107
bei 1 Tier (15dPGJ)]
0
Durchmesser µm
46
4. 2. 6. Sulproston
Abb. 20:
Nierenquerschnitt einer
COX-2 Knockout Maus nach Behandlung mit Sulproston
Der EP1/EP3 -Rezeptoragonist Sulproston wurde in einer Konzentration von 300µg/kgKG verabreicht.
Die homozygoten Tiere zeigen die typische Nierenpathologie. Im mittleren Durchmesser sind sowohl
die Glomeruli homozygoter als auch heterozygoter Tiere etwas kleiner als in der Plazebogruppe.
Homozygote Tiere erreichen 87,5% des Wertes heterozygoter Tiere. Die Verteilungskurve der
Glomerulusdurchmesser ist bei COX-2 -/- Mäuse zweigiflig und zu kleiner Werten verschoben. Im
Vergleich zur NaCl-Gruppe kann kaum ein Unterschied beobachtet werden. Reduktion von
glomerulärem Durchmesser und Volumen für beide Genotypen könnte einen Substanzeffekt
widerspiegeln. Die Werte für rel.Nierengewicht und Distanz zur Kapsel entsprechen weitgehend dener
der Plazebogruppe. Es ergaben sich folgende Werte:
Tabelle 6: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n=2 ]
COX-2 -/- [ n=4 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
26,4 ± 1,4 µm
23,1 ± 0,9 µm [87,5%]
P = 0,064
-glomerul. Volumen
11563 µm3
9219 µm3
45,9 ± 3,8 µm
6,3 ± 0,7 µm
P = 0,064
9,6 ± 0,7
P = 0,056
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
14,7 ± 0
47
1
Häufigkeit
0,75
0,5
COX-2 +/COX-2 -/-
0,25
0
0 5 10 15 20 25 30 35 40 45 50 55 60
[ n = 704 bei 4 Tieren -/- vs. n = 357
bei 3 Tieren +/-]
Durchmesser µm
0
5 10 15 20 25 30 35 40 45 50 55 60
Abbildung 22: Glomerulusgrössen
homozygoter Tiere nach Sulprostonbehandlung vs. Placebo. Es zeigt sich kein
Effekt auf die Glomerulusgröße.
1
Häufigkeit
0,75
Sulprost.
0,5
Abbildung 21: Glomerulusgrössen
heterozygoter und homozygoter Tiere nach
Behandlung mit Sulproston. Alle Glomeruli
wurden anhand ihres Durchmessers den
Klassen 0-5, 5-10… ..55-60 µm zugeteilt und
die relative
Häufigkeit der einzelnen Klassen dargestellt.
Es besteht wie in der Placebogruppe ein
Unterschied zwischen COX-2 -/- und
heterozygoten Tieren. Zweigipfliger
Kurvenverlauf in der Gruppe der
homozygoten Tiere.
NaCl
0,25
[ n = 167 bei 1 Tier (NaCl)
vs. n = 704 bei 4 Tieren (Su)]
0
Durchmesser µm
4. 2. 7. ONO–AE1 329
Bei Tieren die mit dem EP-4 Agonisten (20µg/kgKG) behandelt wurden, zeigte sich eine
deutliche Verbesserung in der Nierenhistologie. Zur erneuten Überprüfung des Genotyps wurde
jeweils die asservierte rechte Niere für die PCR verwendet.
Aufgrund des deutlichen Effektes, wurden zwei weitere homozygot x heterozygot verpaarte
Würfe in gleicher Weise mit dieser Substanz behandelt. Im Ergebnis zeigte sich bei etwa der
Hälfte der Tiere eine eindeutige Verbesserung der Nierenhistologie. Z.T. waren keine
kapselberührenden Glomeruli mehr vorhanden, die sonst kleinen und hypoplastischen
Glomeruli der ersten Schicht waren größer und von Tubuli umgeben. Bei anderen Tieren
dagegen fand sich nach wie vor das typische Bild COX-2 negativer Nieren, sodass evtl. die
verwendete Dosis noch zu gering war und etwa der ED50 entsprach. Z.T. gab es selbst
innerhalb ein- und derselben Niere Areale mit besser ausgereiften und von der Kapsel gelösten
Glomeruli neben solchen mit unverändert schlechtem histologischen Bild, was darauf hinweisen
könnte, dass die i.p.-verabreichte Substanz nicht alle Nierenbereiche in gleicher Weise und
Konzentration erreicht hat
48
Abbildung 23: 4 Beispiele COX-2 -/- Nieren nach Behandlung mit ONO-AE1329
A: fast normale Histologie mit weit von der Kapsel gelösten Glomeruli und homogener Größe; daneben weniger
deutlicher Effekt bei B u. C mit kleineren randständigen Glomeruli, jedoch kein Kapselkontakt;
D:typische COX-2 -/- Histologie
(Vergr.:200fach)
Tabelle 7: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben. Das
glomeruläre Volumen wurde aus dem mittleren Durchmesser berechnet und ohne Standardabweichung
angegeben. Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
COX-2 +/- [ n=6 ]
COX-2 -/- [ n=7 ]
Signifikanz mit 5%
Irrtumswahrscheinlichkeit
-glom. Durchmesser
30,2 ± 1,0 µm
28,0 ± 1,9 µm [ 93 % ]
P = 0,022
-glomerul. Volumen
17212 µm3
15125 µm3
47,7 ± 7,2 µm
14,4 ± 8,6 µm
P = 0,027
14,1 ± 0,8
12,1 ± 1,1
P = 0,022
-Distanz zur Kapsel
-rel. Nierengewicht
(NG/KG x1000)
49
Der Mittelwert der glom. Durchmesser beträgt 28,0 ± 1,9 µm für die homozygoten Tiere und
entspricht beinahe dem Wert der heterozygoten Tiere aus der Plazebogruppe (=28,9µm).
Allerdings sind auch die heterozygoten Durchmesser der ONO-Gruppe größer, nämlich 30,2±1
µm. Das unterstreicht die Notwendigkeit, alle Werte immer im direkten Vergleich mit den
heterozygoten Tieren desselben Wurfes zu betrachten, da substanzspezifische Effekte auf das
allg. Körperwachstum der Mäuse möglich sind. Der Mittelwert der Durchmesser homozygoter
Tiere erreicht 93% des Wertes der heterozygoten Tiere und liegt damit höher als in jeder
anderen Gruppe.
Im relativen Nierengewicht liegen die homozygoten Tiere der ONO-Gruppe mit 12,1 ± 1,1 genau
zwischen den Knockout-Tieren aller übrigen Gruppen (ca .10,0 ) und heterozygoten Tieren mit
etwa 14,0.
Die Distanz der ersten glomerulären Schicht zur Nierenkapsel beträgt ca.14,4 µm bei COX-2 -/versus 47,7µm bei +/- Tieren und hat sich damit etwa verdreifacht im Vergleich zu den
homozygoten Tieren anderer Gruppen. Verglichen mit heterozygoten Mäusen beträgt sie ca. ein
Drittel, während die Knockout-Tiere anderer Gruppen, einschließlich Plazebo nur 1/9 bis 1/6 der
Werte heterozygoter Tiere erreichen.
Betrachtet man die Häufigkeitsverteilung der glomerulären Durchmesser, lässt sich nach wie
vor ein Unterschied zwischen COX-2 +/- und -/- erkennen. Der Häufigkeistgipfel der
Durchmesser heterozygoter Tiere mißt 30µm, im Gegensatz zu 25µm bei homozygoten Tieren.
Die Kurve der homozygoten Mäuse ist allerdings nicht mehr zweigipflig, sondern relativ
symmetrisch und hat sich weiter der Kurve heterozygoter Tiere angeglichen.Verglichen mit der
Verteilungskurve Plazebo-behandelter Knockout-Tiere ergibt sich ein deutlicher Unterschied mit
nach höheren Werten verschobener und homogenerer Kurve für die ONO-Gruppe.
50
0
5 10 15 20 25 30 35 40 45 50 55 60 65
1
Häufigkeit
0,75
COX-2 +/-
0,5
COX-2 -/-
0,25
0
Durchmesser µm
Abbildung 24:
Häufigkeitsverteilung der glomerulären Durchmesser bei COX-2 -/Tieren und heterozygoten Tieren der ONO-Gruppe
Sehr viel homogenerer Kurvenverlauf für die Glomerulusgröße COX-2
negativer Tiere als in der Plazebogruppe. Die Kurve homozygoter Tiere nähert
sich der der heterozygoten an.
[ n = 1156 bei 7 Tieren -/- vs. n = 1214 bei 6 Tieren +/-]
0
5
10 15 20 25
30 35
40 45
50 55
60
1
Häufigkeit
0,75
ONO
0,5
NaCl
0,25
0
Durchmesser µm
Abbildung 25: Glomerulusgrössen homozygoter Knockout- Tiere nach Behandlung mit
ONO AE1-329 im Vergleich zu Placebo-behandelten Tieren.
Signifikanter Unterschied in der Glomerulusgröße nach Behandlung mit ONO AE1-329,
verglichen mit NaCl-behandelten Knockout-Tieren. Der Kurvenverlauf der COX-2 -/-Tiere
ist nach Behandlung nicht mehr zweigipflig.
[ n = 167 bei 1 Tier (NaCl) vs. n = 1156 bei 7 Tieren (ONO)]
Betrachtet man alle Parameter zusammen, scheint die Behandlung mit ONO-AE1 329, v.a. in
Verbindung mit der Histologie, einen positiven Effekt auf die Nierenreifung COX-2 negativer Mäuse zu
haben.
51
4. 2. 8. Zusammenfassende Darstellung
4.2.8.1 mittlerer glomerulärer Durchmesser
Abbildung 26:
mittlerer glomerulärer Durchmesser der i.p. behandelten Versuchstiere in µm mit
Angabe der Standardabweichung (fehlt bei Gruppen mit nur einem Tier).
Vergleichende Darstellung aller Versuchsgruppen. Paarweise nebeneinander jeweils die
homozygoten Tiere (linker Balken) und heterozygoten Tiere eines Wurfes. Unter jedem
Balkenpaar ist angegeben, wieviel Prozent des glomerulären Durchmessers der heterozygoten
Tiere von den homozygoten erreicht wird.
Unterschiede im Glomerulusdurchmesser zwischen den verchiedenen Gruppen können auf eine
allgemeine Wirkung der Substanzen auf das Körperwachstum oder natürliche Differenzen in der
Körpergröße verschiedener Würfe zurückgehen.
Der Durchmesser COX-2 -/- Tiere erreicht jeweils etwa
80 bis 85% der COX-2+/- Tiere.
Ausnahmen bilden die mit Alprostadil und ONO -AE1-329 behandelten Tiere mit 91,5 bzw 93%, was
auf einen positiven Effekt dieser Substanzen auf die Nierenreifung homozygoter Knockout -Tiere
hinweisen könnte.
52
4.2.8.2. Distanz der ersten Glomerulusschicht zur Kapsel
Abbildung 27:
Distanz der ersten glomerulären
Schicht von der Kapsel in µm mit
Angabe der Standardabweichzng bei
Tieren nach i.p.-Behandlung mit den
sechs PG-analoga.
Paarweise zusammen die COX-2 +/(li.Balken) und COX-2 -/- Tiere eines
Wurfes (re.Balken).
Die Glomeruli COX-2 -negativer Tiere liegen mit 1,5 -6,6 µm nur wenige µm unter der Nierenkapsel,
diejenigen der heterozygoten Tiere liegen in mindestens 6-facher Entfernung (Misoprostol). In der
Gruppe der ONO AE1-329 behandelten Knockout-Tiere hat sich die Distanz auf 14,4 µm erhöht und
erreicht ca. 1/3 des Wertes der heterozygoten Tiere.
4.2.8.3. relatives Nierengewicht (NG/KGx1000)
Abbildung 28:
Das Verhältnis von Nierengewicht zu
Körpergewicht der Versuchstiere mit
Angabe der Standardabweichung (fehlt bei
Gruppen mit nur einem Tier)
Paarweise nebeneinander die
homozygoten (li.) und hetero-zygoten Tiere
(re.) eines Wurfes.
Das relative Nierengewicht COX-2 -negativer Tiere beträgt meist ca. 10 gegenüber 14 bei heterozygoten Tieren. Nach Behandlung mit ONO AE1-329 hat sich der Wert homozygoter Tiere auf 12,1
erhöht und liegt so genau in der Mitte, während bei heterozygoten Tiere das Nierengewicht nicht
zugenommen hat. Auch die homozygoten Mäuse der 15dPGJ2 –Gruppe erreichen 12,2, allerdings
haben auch die heterozygoter Tiere nach 15dPGJ2 -Behandlung ein gesteigertes Nierengewicht und
der Unterschied zwischen beiden Genotypen bleibt unverändert.15dPGJ2 scheint deshalb einen allg.
Wachstumsfördernen Effekt zu haben, während ONO AE1-329 selektiv die Situation COX-2 negativer
Tiere verbessert.
53
4.2.8.4 Verteilungskurve der Glomerulusdurchmesser
0
7,5
15
22,5
31
37,5
45
52,5
60
Abbildung 29:
1
alp
0,8
Häufigkeit
ilo
mi
0,6
ONO
PGJ
0,4
Darstellung der verschiedenen
glomerulären Durchmesser
entsprechend ihrer relativen Häufigkeit.
Dargestellt sind nur die Kurven der
homozygoten Tiere (COX-2 -/-)aus den
6 Versuchsgruppen.
su
NaCl
0,2
0
Durchmesser µm
Die Graphik zeigt jeweils die Häufigkeitsverteilung der Glomerulusgröße bei den homozygoten Tieren
jeder Gruppe. Während die Kurven nach Behandlung mit den jeweiligen Substanzen weitgehend der
Plazebogruppe (NaCl) entsprechen, ist die Kurve der ONO-behandelten Tiere symmetrischer, zeigt
nicht den typischen zweigipfligen Verlauf und ist zu größeren Werten hin verschoben.
Alle vier ermittelten Parameter deuten auf eine positive Beeinflussung der Nierenreifung durch den
EP4-Agonisten ONO-AE1-329 hin. Bestätigt wird dieser Eindruck durch die Histologie. Größeres
Nierengewicht in der 15dPGJ2 -Gruppe betrifft sowohl homozygote als auch heterozygote Tiere und
scheint einen allgemeinen wachstumsfördernden Effekt dieser Substanz widerzuspiegeln. Die
Histologie nach 15dPGJ2 -Behandlung ist unverändert gegenüber Plazebo. Das PGE1 analoge
Alprostadil
erhöhte
zwar
den
mittleren
glomerulären
Durchmesser
homozygoter
Tiere,
Verteilungskurve, relatives Nierengewicht und Kapselabstand sowie die Histologie zeigen jedoch
keine Verbesserung gegenüber Plazebo.
54
4.2.9. zusätzliche Untersuchungen
4.2.9.1. Behandlung von C57BL6 Wildtypmäusen mit ONO AE1-329 ,20µg/kgKG
Um zu testen, ob Behandlung mit ONO AE1-329 auch bei Wildtypmäusen einen Einfluss auf die
Glomerulusgröße bzw. die anderen verwendeten Paramet hat, wurde ein Wurf von C57BL6
Wildtypmäusen zur Hälfte mit dem EP4-Agonisten, zur Hälfte mit NaCl behandelt. Es zeigte sich kein
signifikanter Unterschied im glomerulären Durchmesser, Nierengewicht oder Abstand der ersten
glomerulären Schicht zur Kapsel. Auch zeigten beide Gruppen eine normale Nierenhistologie. Die
Glomerulusreifung scheint bei diesen Tieren optimal reguliert und weitere Stimulation des EP4 Rezeptors ohne Effekt.
40
Abbildung 30:
36,2
35
29
30
27,6
26,3
25
B6-ono
B6-kontr.
20
Wildtypmäuse nach i.p.-Behandlung mit ONO-AE1-329.
Dargestellt sind die drei zur Beschreibung mgl.
Unterschiede verwendeten Parameter relatives
Nierengewicht, Abstand der ersten glomerulären Schicht
von der Nierenkapsel und Glomerulusgröße.
14 13,6
15
10
5
Durchmesser
Nierengewicht
Distanz
Tabelle 8: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben.
Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
ONO [ n = 3 ]
Durchmesser:
29 ± 0,5 µm
rel. Nierengewicht:
14 ± 0,2
Distanz zur Kapsel
NaCl [ n = 3 ]
Signifikanz
vs. 27,6 ± 0,9 µm ;
p = 0,666
vs.
;
p = 0,506
;
p = 0,121
13,6 ± 0,6
26,3 ± 0,3µm vs. 36,2 ±2,7 µm
Bei behandelten Wildtypmäusen zeigt sich kein wesentlicher Unterschied zwischen Kontrollgruppe
(NaCl) und Versuchsgruppe für den glom. Durchmesser und das Nierengewicht. Die Distanz der
ersten Glomerulusschicht von der Nierenkapsel beträgt 26,3 ± 0,3 µm für mit dem EP4 -Agonisten
behandelte Tiere versus 36,2 ± 2,7 µm in der Kontrollgruppe.
0
Abbildung 31:
5 10 15 20 25 30 35 40 45 50 55 60
1
Häufigkeit
0,75
0,5
ONO
NaCl
Häufigkeitsverteilung der glomerulären
Durchmesser nach Behandlung von
Wildtypmäusen mit dem EP4- Agonisten ONO
AE1-329 vs. Placebo.
Identischer Kurvenverlauf der Glomerulusgröße
bei Versuchs-und Kontrollgruppe.
0,25
0
Durchmesser µm
[ n = 445 bei 2 ausgewerteten Tieren
(ONO) vs. n = 360 bei 2 ausgewerteten
Tieren (NaCl)]
55
4.2.9.2. Behandlung von C57BL6 Wildtypmäusen mit dem PGF2α –Analogon
Fluprostenol, 2mg/kg KG
Da Stimulation des vasodilatatorischen PGE2-Rezeptors EP4 durch ONO-AE1 329 offensichtlich
einen positiven Einfluss auf die Differenzierung funktionsfähiger Nephrone zu haben schien, sollte in
einer zusätzlichen Versuchsreihe geprüft werden, ob sich ein negativer Effekt auf die Nierenreifung bei
Wildtypmäusen durch Stimulation des vasokonstriktorischen FP-Rezeptors erzielen lässt.
Wir fanden signifikante Unterschiede in keinem der drei verwendeten Parameter relatives
Nierengewicht,
Abstand
der
ersten
glomerulären
Schicht
von
der
Kapsel
oder
mittlerer
Glomerulusdurchmesser. Auch histologisch unterschieden sich die mit Fluprostenol behandelten
Mäuse nicht vom Wildtyp.
0
26,4 26,1
26
25
5 10 15 20 25 30 35 40 45 50 55 60
1
24,9
0,75
20
Häufigkeit
30
Flu
13,1 13,4
15
kontr.
kontr.
0,5
flu
0,25
10
5
0
Durchmesser
Nierengew icht
Distanz
Durchmesser µm
Abbildung 32: Wildtypnieren nach i.p.-Behandlung
mit Fluprostenol (li. Balken) bzw. NaCl
im Vergleich anhand der Parameter rel. Nierengewicht,
Abstand der ersten glomerulären Schicht von der Kapsel
und Glomerulusgröße
Abbildung 33: Häufigkeitsverteilung der
Glomerulusgrössen bei Wildtypnieren nach Behandlung
mit Fluprostenol im Vergleich zu Placebo.
[ n = 1022 bei 6 Tieren (Flu) vs. n = 1012 bei 5
Tieren (NaCl)]
Tabelle 7: Mittelwerte des glomeren Durchmessers, der Distanz zur Nierenkapsel und des relativen
Nierengewichts in den verglichenen Gruppen. Die Werte sind ± Standardabweichung angegeben.
Prüfung auf Signifikanz anhand des U-Tests (Withney-Mann).
Fluprostenol [ n = 6 ]
NaCl [ n = 5 ]
Signifikanz
Durchmesser:
26,4 ± 1,5 µm
vs. 26,1 ± 1,1 µm ;
p = 0,792
rel. Nierengewicht:
13,1 ± 0,4
vs. 13,4 ± 0,3
p = 0,31
Distanz zur Kapsel
26,0 ± 6,8 µm
vs. 24,9 ± 4,7 µm ;
;
p=1
Der mittlere glomeruläre Durchmesser Fluprostenol-behandelter Mäuse betrug 26,4 ± 1,5 µm versus
26,1 ± 1,1 µm bei Plazebo-behandelten. Das relative Nierengewicht war mit 13,1 ± 0,4 bzw. 13,4 ± 0,3
in beiden Gruppen nahezu identisch. Ebenso zeigten die Distanzen zur Kapsel mit 26 ± 6,8 versus
24,9 ± 4,7 µm, als auch die Verteilungskurven der Glomerulusgröße keine Unterschiede.
56
4.3. Vergleich unbehandelter Mäuse am Tag P21
Im dritten Teil der Arbeit wurden je zwei Tiere der folgenden Stämme am Tag P21 getötet und die
Parameter mittleres glomeruläres Volumen, relatives Nierengewicht, Distanz der ersten glomerulären
Schicht zur Nierenkapsel und Häufigkeitsverteilung der Glomerulus-größe bestimmt.
Die Liste umfaßt folgende Mausstämme: EP-1 -/-, EP-2 -/-, EP-3 -/-, EP-4 -/-, IP -/-, COX-2 -/-,
COX-2 +/- und Wildtyp (C57BL6).
Daneben zwei mit dem COX-2 Inhibitor SC-58236 über die Tränke behandelte Tiere und ein EP-2/EP4 Doppel-Knockout. Die über die Tränke behandelten Tiere wurden bewußt nicht mit i.p. -behandelten
Tieren verglichen, da bei ihnen der Behandlungsstreß durch das Spritzen wegfiel und sie deshalb im
Körpergewicht nicht mit den anderen Tieren vergleichbar waren.
0
5 10 15 20 25 30 35 40 45 50 55 60 65
1
ep-1
Häufigkeit
0,75
ep-2
ep-3
ep-4
0,5
ip
WT
0,25
cox-2 +/-
0
Durchmesser µm
Abbildung 34: Häufigkeitsverteilungskurven der glomerulären Durchmesser für die
Genotypen EP1-, EP2-, EP3-, EP4- und IP-knockout, COX-2 +/- und Wildtyp
Kaum Unterschiede in der Häufigkeit der Glomerulusgrößen bei EP2-, EP3-, EP4-, IP-knockout und
COX-2 +/- gegenüber Wildtyp. Die Kurve der EP1-negativen Tiere erreicht ihr Maximum bei 25µm und
ist etwas zu kleineren Werten verschoben.
57
0
5 10 15 20 25 30 35 40 45 50 55 60 65
1
Häufigkeit
0,75
WT
sc-236
0,5
cox-2 -/ep-2/ep-4
0,25
0
Durchmesser µm
Abbildung 35: Häufigkeitsverteilungskurven der glomerulären Durchmesser für die
Genotypen COX-2 knockout, EP2/EP4 knockout und Wildtyp.
Zusätzlich gezeigt ist die Gruppe der mit dem COX-2 Inhibitor SC-58236
behandelten Wildtypmäuse
COX-2- negative Tiere haben deutlich reduzierte glomeruläre Durchmesser gegenüber Wildtyp mit
einem Maximum bei 25µm vs. 35µm. Genauso stark reduziert sind die Werte der EP-2/EP-4 negativen
Maus. Zusätzlich fällt in beiden Gruppen der zweigipflige Kurvenverlauf
auf, mit einem kleinen
zweiten ‚peak’ bei größeren Durchmessern. Behandlung mit dem COX-2 Inhibitor SC- 58236 erreicht
nicht ganz den Effekt des COX-2 knockout.
Abbildung 36: Vergleich der verschiedenen Genotypen anhand des mittleren glomerulären Durchmessers.
(Angaben in µm mit Angabe der Standardabweichung, falls mehr als ein Tier pro Gruppe;
die Standardabweichung für die Gruppen EP-1 und EP-2 ist kleiner 0,05 und nicht dargestellt)
Gegenüber Wildtyp sind die glomerulären Durchmesser der EP- und IP- Rezeptor negativen Tiere,
speziell auch EP-2 und EP-4 knockout nicht reduziert. Erst der Verlust von EP-2 und EP-4 führt zur
Reduktion der Glomerulusgröße, ebenso wie Behandlung mit dem COX-2 Inhibitor SC-58236 oder
COX-2- knockout. Heterozygote COX-2 -Mäuse haben normalgroße Nierenkörperchen.
58
68,3
70,0
50,0
Distanz µm
59,2
58,0
60,0
45,5
40,4
40,0
38,2
33,8
30,0
20,0
13,7
10,0
4,7
6,8
2/
ep
4
co
x2
-/co
x2
+/
-
ty
p
ep
ild
6
W
82
3
SC
-5
ip
4
ep
ep
3
2
ep
ep
1
0,0
Abbildung 37: Distanz der ersten glomerulären Schicht von der Kapsel bei
unterschiedlichem Genotyp (Mittelwerte in µm)
Paradoxerweise ist die Distanz zur Nierenkapsel bei EP-2 und EP-4 -negativen Mäusen erhöht.
EP-2/EP-4 Doppel-Knockout führt zu einer gleichstarken Reduktion dieses Abstands wie bei COX-2 negativem Genotyp. Eine weniger ausgeprägte Reduktion findet sich nach Behandlung mit dem COX2 Inhibitor SC-58236. Die Tiere diser Gruppe erhielten den COX-2 Inhibitor ausschließlich während
der postnatalen Zeit.
Abbildung 38: Relatives Nierengewicht bei PG-Rezeptor knockout bzw. Behandlung mit einem
COX-2 Inhibitor im Vergleich zum Wildtyp. (Angabe der Standardabweichung,
falls mehr als 1 Tier pro Gruppe)
Das relative Nierengewicht liegt für die meisten Genotypen im Bereich um 14, EP-2 mit 15,8 und IPRezeptor negative Tiere erreichen etwas höhere Werte. Für COX-2 +/- und -/-, sowie den EP-2/EP-4
Doppel-Knockout liegen leider keine Daten vor. (Die Nieren wurden nicht gewogen).
59
4.4. Statistische Tests
Die Prüfung auf Signifikanz der Unterschiede in der Glomerulusgröße zwischen COX-2 -/- und
COX-2 +/- erfolgte mit Hilfe des U-Tests nach Whitney-Mann. Auf diese Weise ergaben sich folgende
Werte:( WinSTAT®,Add-In für Microsoft Excel)
- ONO,homozygot
vs. Plazebo,homozygot:
P =0,034 (für den zweiseitigen Test)
- ONO,homozygot
vs. ONO,heterozygot:
P =0,022
“
D.h. mit ONO AE1-329 behandelte Knockout-Tiere hatten signifikant größere Glomeruli als Plazebobehandelte.
Homozygote COX-2 -Tiere hatten nach Behandlung mit ONO AE1-329 nach wie vor signifikant
kleinere Glomeruli als die heterozygoten Kontrolltiere, was bedeutet, dass die Nierenentwicklung nicht
vollständig normalisiert werden konnte.
Behandlung von Wildtypmäusen mit mit ONO AE1-329 erbrachte keinen signifikanten Unterschied
gegenüber Plazebo. (P =0,666)
Ebenso ergaben sich keine Unterschiede in der Glomerulusgröße zwischen Behandlung von
Wildtypmäusen mit dem PGF2α –Analogon Fluprostenol und Plazebobehandlung. (P =0,792)
Der U-Test versagte aufgrund der geringen Zahl behandelter Mäuse für die anderen Gruppen.
(s. Material und Methoden) Hauptziel dieser Arbeit war es, herauszufinden, ob überhaupt ein Effekt
durch externe PG-Gabe erzielt werden kann. Dafür reicht das Ergebnis der ONO-Gruppe jedoch
schon aus.
Das relative Nierengewicht ergab, parallel zur Glomerulusgröße, signifikante Unterschiede zwischen
COX-2 -/- Tieren der ONO-Gruppe und Plazebotieren (P = 0,024), wenn auch das Nierengewicht
heterozygoter Tiere nicht erreicht wird (ONO,homozygot vs. ONO,heterozygot:
P =0,022). Die Unterschiede im relativen Nierengewicht ONO AE1-329- und Fluprostenol-behandelter
Wildtypmäuse sind nicht signifikant (P = 0,121 bzw. P = 1,0).
60
5. DISKUSSION
COX-2 ist essentiell für die Nephrogenese
Das Vorhandensein der COX-2 ist für die Nierenentwicklung essentiell. Die in dieser Arbeit
untersuchten Tiere mit Verlust dieses Enzyms durch Gen-Knockout wiesen ausgeprägte
Veränderungen der Nierenhistologie auf, wie auch von Dinchuk, Morham und Norwood et al. [50,162,
172] beschrieben. Ein ähnliches Bild zeigten die Nieren der mit dem COX-2- Inhibitor SC-58236
behandelten Wildtypmäuse. COX-2 scheint also eine wesentliche Rolle in der Nephrogenese, speziell
in der Ausbildung funktionsfähiger Nephrone zu spielen. Dies deckt sich mit Berichten über die
Entwicklung einer renaler Hypotrophie bei Rhesusaffen durch Behandlung mit Indomethacin in der
Schwangerschaft [173] und Fallberichten, wonach es nach langfristiger Einnahme von NSAR in der
Schwangerschaft auch zu Nierendysplasien beim Menschen kam, mit wenig differenzierten
proximalen Tubuli, Häufung von Glomeruli und Tubulusauftreibungen, mehr im äußeren als im inneren
Kortex [262]. Die Nierenreifung ist bei der Maus zum Zeitpunkt der Geburt noch nicht abgeschlossen,
und hält noch etwa bis zur dritten postnatalen Woche an [87]. Der selektive COX-2 Inhibitor SC58236 führte bei Wildtypmäusen zu dem typischen histologischen Bild des COX-2 Knockout, wobei
die Behandlung ausschließlich in der postnatalen Zeit einen nur geringfügig schwächeren Effekt
zeigte, als Behandlung während embryonaler und postnataler Periode [125], was vermuten lässt, dass
nicht die eigtl. Organanlage gestört ist, sondern eine spätere funktionelle Ausreifung der Nephrone.
Ein weiterer wichtiger Hinweis ist die Tatsache, dass die Expression der COX-2 während der Zeit der
Nierenentwicklung bei Mäusen und Ratten im Bereich von MD und TALH-Zellen auf den 10fachen
Wert gesteigert ist, mit einem Maximum am Tag 4 bei der Maus [125] und Tag 15 bei der Ratte [261],
parallel zu einer Reduktion der Glukokortikoidspiegel in dieser Zeit [35]. Während in der Niere
erwachsener Menschen im Bereich der MD und TALH keine COX-2 Expression nachweisbar ist, findet
sich hier COX-2 Expression während der Fetalzeit [118].
Dass COX-1 den Verlust der COX-2 nicht kompensieren kann, wird z.T. erklärt durch die große
Menge exprimierter COX-2 während der Nierenentwicklung, was für COX-1, die eine gleichmässige
Expression zeigt und im Gegensatz zur COX-2 nicht induziert werden kann, nicht möglich ist.
Außerdem ist die COX-1 in der Niere anders lokalisiert. COX-2 findet sich in tunica media und
Endothel sämtlicher Gefässe und im Glomerulum, außerdem im Tubulusepithel von MD und TALH,
COX-1 dagegen im Bereich der Sammelrohre und niemals in MD- oder TALH-Zellen [243].
Zeitlicher Verlauf der COX- abhängigen Nierenentwicklung
Bei den in dieser Studie verwendeten COX-2 -/- Mäusen zeigten sich erste Unterschiede in der
Nierenhistologie bereits am Tag P8, in Übereinstimmung mit den Arbeiten von Norwood et al. (P7) und
Kömhoff et al. (P8)[125,172]. Jüngere Tiere wurden nicht untersucht und evtl.hätten sich bereits
früher Unterschiede erkennen lassen, wie auch von Dinchuk et al. (P2) [50] beschrieben.
Heterozygote Tiere, deren histologisches Bild dem Wildtyp entspricht, weisen zu diesem Zeitpunkt
bereits keine kapselberührenden Glomeruli mehr auf, ein Zeichen, dass sich ein funktionierendes
Tubulussystem um jedes Glomerulum gebildet hat, während bei homozygoten Tieren viele
randständige Glomeruli zu finden sind. Die Glomerulusgrösse ist zu dieser Zeit bei beiden Genotypen
61
in etwa gleich, ebenfalls die Dicke der Nierenrinde und das für beide Gruppen unauffällige
Nierenmark. Im weiteren Verlauf beginnen die Glomeruli heterozygoter Tiere sich gleichmässig über
die Nierenrinde zu verteilen, während die randständigen Glomeruli der Knockout-Tiere weder
Grössenzunahme, noch Ausbildung eines Tubulussystems und damit Lösung von der Kapsel zeigen.
Tieferliegende Nierenkörperchen der homozygoten Tiere wachsen dagegen regelrecht und es
entwickeln sich zunehmend zwei Populationen, einmal hypoplastische kapselberührende Glomeruli
und zum anderen normalgroße, juxtamedulläre Glomeruli, besonders deutlich bereits am Tag P15.
Zystische Veränderungen treten in milder Form bei allen Knockout-Tieren auf, bei einigen sind sie
besonders ausgeprägt. Vergleich der Nieren am Tag P21 zeigt einen reduzierten mittleren
glomerulären Durchmesser bei homozygoten Tieren, wie von Kömhoff [125] beschrieben. In
Übereinstimmung mit der Arbeit von Norwood [172] ist das relative Nierengewicht der Knockout-Tiere,
berechnet aus NG/KGx1000, mit Werten um 10 versus 14 bei der heterozygoten Gruppe reduziert,
was v.a. auf eine Hypotrophie der Nierenrinde zurückzuführen ist. Die erste glomeruläre Schicht liegt
bei homozygoten Tieren in einer Distanz zur Nierenkapsel, die mit durchschnittlich 1,5µm gegenüber
40 µm bei heterozygoten Tieren deutlich reduziert ist.
PG-Substitution bei COX-2 Knockout- Mäusen
Wenn auch das Vorhandensein der COX-2 als Bedingung für die Nierenentwicklung bewiesen ist, so
ist noch unklar, welche Mechanismen daran beteiligt sind. in der vorliegenden Arbeit sollte versucht
werden, den Reifungsstopp der Nieren COX-2 negativer Mäuse durch Zufuhr externer PG und PGRezeptoragonisten zu durchbrechen, was bisher nicht beschrieben ist. Für die Wahl von PG-Analoga
hauptsächlich der PGE-Reihe gab es folgende Gründe. PGE1 war in Zellkulturen metanephrogenen
Gewebes für maximales Wachstum und Differenzierung nötig und konnte die Differenzierung in
Glomerulusepithel induzieren [9]. Ferner sind in Zellen der MD neben COX-2 auch PGE-Synthase
und PGE-Rezeptoren [87,174] lokalisiert. Ein weiterer Grund war die vasodilatatorische Wirkung von
PGE2 durch Bindung an EP2 und EP4 -Rezeptoren mit nachfolgendem cAMP-Anstieg [1]. Es schien
möglich, dass zur vollständigen Ausbildung der Glomeruli eine aktive Vasodilatation erfolgen muss.
Zur Untersuchung dieses möglichen hämodynamischen Effektes wählten wir außerdem das
vasodilatatorische PGI2-Analogon Iloprost und das vasokonstriktorische PGF2α-analoge Fluprostenol.
Ein von COX-2 produziertes PG ist 15deoxyPGJ2, das als bisher stärkster PPARγ Ligand gilt [61,159],
und möglicherweise über Aktivierung von Transkriptionsfaktoren die Nierenreifung unterstützt. Wir
testeten deshalb auch 15dPGJ2.
Um ausreichend COX-2 negative Tiere zu erhalten, zumal Genotypisierung erst nach Ende der
Versuche am Tag 21 möglich war, wurden homozygote Männchen mit heterozygoten Weibchen
gekreuzt. Von den rechnerisch 50% Knockout-Tieren eines Wurfes starben innerhalb der ersten 48
Stunden jeweils noch ca. 30%, vermutlich infolge der Persistenz des Ductus arteriosus [45]. Nachteil
dieser Zucht ist, dass keine Wildtypen zum Vergleich zur Verfügung stehen. Jedoch wurden von
Morham et al. [162] keine Abweichungen in der Nierenhistologie heterozygoter Tiere vom Wildtyp
beschrieben und wir verwendeten deshalb jeweils die heterozygoten Tiere eines Wurfes als
Kontrollgruppe.
62
Betrachtet man die
Ergebnisse der
PG-Substitution, so ergibt sich
nur
für
den EP-4
Rezeptoragonisten ONO AE1-329 ein positiver Effekt auf die Nierenentwicklung der Knockout-Mäuse.
Etwa 50% der so behandelten Tiere zeigt ein Bild, das fast dem der heterozygoten entspricht, bei
anderen erkennt man eine Lösung der ersten Glomeruli von der Nierenkapsel, aber weniger deutlich
und einige Tiere haben kaum veränderte Nieren gegenüber plazebobehandelten Tieren, was dafür
spricht, dass die verwendete Konzentration noch zu niedrig war und etwa der ED50 entsprach. Ferner
sind z.T.innerhalb einer Niere Gebiete mit fast normaler Histologie neben anderen, deutlich
schlechteren Arealen erkennbar, sodass evtl. die i.p.-applizierte Substanz nicht alle Bereiche der
Niere in gleicher Weise erreicht hat. Die ermittelten Werte für glomerulären Durchmesser und
Volumen, Distanz zur Kapsel und relatives Nierengewicht unterstreichen den Eindruck, den die
Histologie vermittelt. So liegt der mittlere glomeruläre Durchmesser COX-2- negativer Mäuse mit 93%
des Wertes der heterozygoten Tiere so hoch wie in keiner anderen Gruppe, wo jeweils 80-85%
erreicht werden. Auch die Distanz der ersten glomerulären Schicht zur Nierenkapsel liegt mit 14,4 µm
dreimal so hoch wie bei den anderen behandelten k.o.-Tieren und beträgt ca. ein Drittel des Wertes
der heterozygoten Tiere, verglichen mit je etwa 1/10 bis 1/6 in den anderen Gruppen.
Das relative Nierengewicht, das mit Werten um 10 für knockout gegenüber 14 für heterozygote Tiere
reduziert ist, und die in der Übersichtsvergrösserung sichtbare Hypotrophie der Nierenrinde ausdrückt,
beträgt für die Tiere der ONO-Gruppe 12,1, liegt also auf halber Strecke zwischen knockoutut und
Wildtyp.
Besonders deutlich wird der positive Effekt des EP4 Agonisten in der Häufigkeitsverteilung für die
Einzelwerte der Glomerulusgrösse. Die Kurve der ONO-behandelten Knockout-Mäuse zeigt nicht den
typischen zweigipfligen Verlauf, entsprechend der großen Zahl kleiner Glomeruli unter der Kapsel und
einer zweiten Häufung großer, marknaher Glomeruli, sondern ist relativ symmetrisch und zu
insgesamt grösseren Durchmessern verschoben. Dass die Unterschiede zur PlazeboGruppe nicht
grösser sind, liegt sicher auch an der oben beschriebenen Inhomogenität der ONO-behandelten Tiere.
Hier sollten weitere Versuche mit einer höheren Konzentration des EP4 Agonisten folgen.
Behandlung mit ONO AE1-329 hat keinen Effekt auf die Nieren von Wildtypmäusen, was unterstreicht,
dass es selektiv die Situation COX-2 negativer Tiere verbessert. Alle anderen Substanzen zeigten
keine positive Wirkung. Ein relativ hoher Wert im mittleren Glomerulusdurchmesser homozygoter
Tiere von 91,5% verglichen mit heterozygoten in der Alprostadil-Gruppe ging nicht parallel mit einer
Zunahme im relativen Nierengewicht oder in der Distanz zur Nierenkapsel. Auch die Nierenhistologie
nach Alprostadil-Behandlung entspricht dem Bild der Plazebogruppe.
Behandlung mit 15dPGJ2
führte zu einer Zunahme des relativen Nierengwichtes sowohl der homozygoten als auch der
heterozygoten Tiere, ohne die Differenz im mittleren Glomerulusdurchmesser zwischen beiden
Genotypen zu verändern. Ebenso war die Distanz zur Nierenkapsel und die Histologie homozygoter
Mäuse unverändert gegenüber Plazebo. Welche Struktur der Niere für die Zunahme im Nierengewicht
der PGJ2 -behandelten Tiere verantwortlich ist, ist nicht bekannt. Die Glomeruli waren nach wie vor
klein und hypoplastisch. Eine Maus zeigte starke Zystenbildung und möglicherweise ist eine
Proliferation von Tubuli bzw. Sammelrohren ein Grund für die Zunahme im Nierengewicht.
63
Dass die PGE1 -Analoga Alprostadil und Misoprostol (EP3-EP4 und z.T. EP2 -Wirkung), sowie
Sulproston (EP1 und EP3) und Iloprost (IP) ohne Wirkung blieben, spiegelt nicht unbedingt eine
generelle Wirkungslosigkeit wieder, sondern könnte auch Folge einer zu geringen Dosierung oder
ungünstigen Pharmakokinetik sein, und muss durch stabilere PG-Rezeptoragonisten überprüft
werden. So liegt die HWZ für Alprostadil (beim Menschen) bei ca. 0,2 min für die a-Phase und 8min
für die b-Phase, und es findet eine Metabolisierung von 80-90% während einer Lungenpassage statt.
Aus diesem Grund wurde Alprostadil abweichend vom Standardprotokoll viermal täglich gespritzt. Die
HWZ der anderen Substanzen war deutlich günstiger und lag bei 20-40min für Misoprostol, ca. 30min
für Iloprost und <2 stunden für Sulproston. (keine Daten für ONO AE1-329 und 15dPGJ2).
Ob zweimal-tägliche i.p.-Applikation ausreicht, um eine gleichmässige Rezeptoraktivierung zu
bewirken ist fraglich. Günstiger wäre sicher eine orale Zufuhr über die Muttermilch, wie für den
selektiven COX-2 Inhibitor SC-58236 möglich [125], allerdings bereitet diese Variante eine Reihe
zusätzlicher Schwierigkeiten, z.B. chemische Stabilität im mütterlichen Kreislauf, Übertritt in die
Muttermilch, first pass Effekt durch die Leber der Mäusebabies usw.
Histomorphometrie
Inwiefern die verwendeten Parameter geeignet sind, die Unterschiede COX-2 negativer und normaler
Niere zu erfassen, lässt sich diskutieren. Der von Norwood [172] verwendete Wert des relativen
Nierengewichtes, berechnet aus NG/KGx1000 scheint sinnvoll, da rein histologisch die Niere COX-2
negativer Tiere eine verschmälerte Nierenrinde und reduzierte Zahl von Nephronen aufweist und sich
auf diese Weise sehr einfach ein signifikanter Unterschied zwischen COX-2-/- und Kontrolltieren
beschreiben lässt. Zudem ist dieser relative Wert nicht beeinflusst von Schwankungen im
Körpergewicht. Im Vergleich dazu erbrachte das relative Herzgewicht für alle Genotypen gleiche
Werte. Die Berechnung des mittleren glomerulären Durchmessers zeigt die Unterschiede beider
Gruppen weniger deutlich als das histologische Bild, da große juxtamedulläre Glomeruli bei COX-2 -/Tieren den Wert nach oben treiben. Vergleich der Häufigkeiten der einzelnen Glomerulusgrössen zeigt
feinere Unterschiede und lässt die zwei großen Populationen in der Niere homozygoter Tiere
erkennen.
Der glomeruläre Durchmesser korelliert mit dem Körpergewicht [225]. so dass große Mäuse grössere
Glomeruli haben als kleine. Auch zwischen männlichen und weiblichen Tieren werden von einigen
Autoren Unterschiede in der Glomerulusgrösse beschrieben, die wir allerdings nicht feststellen
konnten, und die sicher in den Schwankungen, bedingt durch unterschiedliches Körpergewicht
untergingen. Die Bestimmung der Distanz der ersten Glomerulusschicht zur Nierenkapsel ist relativ
fehlerbehaftet, weil die Zuordnung zur „ersten Schicht“ subjektiv erfolgt. Besser wäre vielleicht die
Bestimmung der Zahl von Glomeruli innerhalb der ersten 50µm unterhalb der Nierenkapsel, doch
auch dieser Wert ist problematisch, da COX-2 negative Tiere weniger Glomeruli besitzen und
insgesamt kleinere Nieren haben als heterozygote.
Mechanismen der PG-Wirkung
Die Tatsache, dass Aktivierung des klassischen membranständigen EP-4 -Rezeptors die Ausreifung
der Nephrone positiv beeinflusst, führt dazu, dass alternative Signalwege weniger wahrscheinlich
werden. COX-2 und PGE2 -Synthase sind im Ggs. zu COX-1 nicht nur im Zytosol, sondern auch an
64
der inneren Kernmembran lokalisiert [163],
und es wäre denkbar, dass während der Zeit der
Nierenentwicklung COX-2-Syntheseprodukte, möglicherweise andere als die klassischen PG,
direkt auf die Gentranskription einwirken. Diese Möglichkeit ist zwar durch den positiven Effekt der EP4 -Aktivierung in dieser Arbeit allein nicht auszuschließen. In Kombination mit der Beobachtung, dass
Doppel-knockout von EP-2 und EP-4-Rezeptoren zum gleichen Bild führt, wie COX-2 knockout ist es
sehr wahrscheinlich, dass die COX-2-Wirkung über diese Rezeptoren erfolgt.
Auch PPARγ-Aktivierung scheint keine wesentliche Rolle in der Glomerulogenese zu spielen.
Hämodynamik
Bleibt die Frage, welche Mechanismen durch EP-4 (und EP-2)-Rezeptoraktivierung ausgelöst werden.
Bindung an EP-2 und EP-4 führt über Gs-Protein Aktivierung zur Erhöhung des intrazellulären cAMP
und in Gefässen zur Vasodilatation [1]. Auch die Freisetzung von Renin aus granulierten
Epitheloidzellen des juxtaglomerulären Apparates erfolgt über cAMP -Anstieg [26]. Denkbar ist, dass
neugebildete glomeruläre Gefässe eine aktive Vasodilatation des vas afferens
benötigen, um
ausreichend perfundiert zu werden und sich voll zu entwickeln. Hierzu wären gefässerweiternde PGRezeptoren in der Gefässwand nötig. Ferner könnte so die Wirkungslosigkeit von Misoprostol und
Sulproston erklärt werden, denn diese Substanzen aktivieren vor allem die vasokonstriktorischen
Rezeptoren EP-1 und EP-3 (Sulproston) bzw. gefässerweiternde und -verengende Rezeptoren (EP-4
und EP-3 für Misoprostol), deren Effekt sich gegenseitig aufheben könnte.
Gegen diese Hämodynamiktheorie spricht allerdings, dass die fetale Überexpression von COX-2 [243]
vor allem das Tubulusepithel von MD und TALH-Zellen betrifft. Beim Menschen findet nur in der
Fetalzeit COX-2 Expression im Bereich von MD und TALH statt, Expression von COX-2 in prä- und
postglomerulären Gefässen dagegen während des ganzen Lebens [243]. Auch bei der Maus ist die
COX-2 im Bereich von MD und TALH während der Zeit der Nierententwicklung bis zu 10fach
gesteigert [125], also in tubulären, nicht vaskulären Zellen. Auch scheint IP-Rezeptoraktivierung
(Vasodilatation) und FP-Aktivierung (Vasokonstriktion) keinen Effekt auf die Nierenmorphologie zu
haben. Für die Hämodynamiktheorie spricht die Existenz der normalentwickelten juxtamedullären
Glomeruli in der COX-2 negativen Niere. Wenn ein existenzieller Mechanismus durch das Fehlen der
COX-2 unterbunden ist, würden alle Glomeruli betroffen sein. Möglicherweise sind die normalgroßen
Glomeruli bereits vor der Geburt vollständig ausgereift, etwa durch PG aus dem mütterlichen
Kreislauf. Verlust der nötigen Rezeptoren wie im Falle des EP-2/EP-4 knockouts kann jedoch nicht
kompensiert werden. Doch auch bei der EP-2/EP-4 Knockout Maus fanden sich einige normale
Glomeruli. Es ist möglich, dass die normalgroßen Glomeruli von Anfang an optimal perfundiert
wurden, während die Perfusion anderer Nephrone aktiv verbessert werden muss.
COX-2 und RAAS
COX-2 -Lokalisation in Zellen der Macula densa [81,85,120,125]
lässt vermuten, dass evtl. ein
Zusammenhang zwischen Nierenreifung und dem Renin-Angiotensin-Aldosteron-System (RAAS)
besteht, wo COX-2 die Reninausschüttung bewirkt. Salzarme Diät,
Nierenarterienstenose,
Behandlung mit ACE-Hemmern, sowie Verlust des Cl-Messfühlers in Zellen der MD beim BartterSyndrom führen zur Überexpression von COX-2 in der adulten Niere, und zwar ebenfalls im Bereich
65
von MD und TALH [88], in gleicher Lokalisation also, wie bei der sich entwickelnden Niere. Renin
erhöht den Perfusionsdruck im nachfolgenden Glomerulum. Eine Steigerung der Perfusion
neuentstandener Nephrone ist also auch möglich, ohne dass direkte Vasodilatation durch EP-2-, EP4-, oder IP-Rezeptoraktivierung erfolgen muss. Eine Erhöhung des intrazellulären cAMP-spiegels ist
der wesentliche Mechanismus der Reninfreisetzung und wird v.a. durch EP-2 und EP-4
Rezeptoraktivierung bewirkt [26]. In einer Studie zur Stimulation der Reninsekretion bei isolierten
Nieren von EP1-, EP2-, EP3- und EP4- Knockout- Mäusen zeigte sich, dass EP-2- und EP-4
zusammen notwendig sind, um maximale Reninfreisetzung zu erreichen [213]. EP-4 -/- Tiere hatten
reduzierte Plasmareninwerte, EP-2 -/- Tiere dagegen nicht, ebensowenig EP-1 und EP-3 KnockoutMäuse. Maximale Stimulation der EP-2 Rezeptoren bei Wildtyp-Nieren durch den selektiven Agonisten
CAY-10399 führte zu einer Reninfreisetzung, die durch zusätzlich Zufuhr von PGE2 weiter gesteigert
werden konnte, wahrscheinlich als Folge einer Aktivierung von EP-4. Der EP-4 Rezeptor scheint
wesentlich empfindlicher auf PG-Zufuhr mit Reninfreisetzung zu reagieren. Die Zufuhr
externen
PGE2’s bewirkte in einer Konzentration von 1nmol/l bei Wildtyp, EP1-, EP2-, und EP3 -/- Nieren eine
Steigerung der Reninsekretion, nicht jedoch bei Nieren EP-4 negativer Tiere [213].
Obwohl sich EP-2 und EP-4 Rezeptoren stark ähneln, existieren doch auch Unterschiede zwischen
beiden. So ist für EP-4 die Aktivierung von Gs-protein geringer als bei EP-2 [1] und es existieren
alternative Signalwege für EP-4.(s.u.)
Ein weiteres Enzym, dass an der Regulation der glomerulären Perfusion beteiligt ist, ist die NOSynthase [272]. NOS und COX-2 Expression weisen große Gemeinsamkeiten auf. Zustände die eine
Aktivierung des RAAS bewirken, führen nicht nur zu einer gesteigerten COX-2 Expression, sondern
erhöhen auch die NOS-Aktivität. Salzarme Diät, Nierenarterienstenose usw. führen zu gesteigerter
NOS-Expression und für NOS-negative Mäuse wurden reduzierte Plasmareninwerte beschrieben
[208,283]. Interessanterweise zeigten COX-2 -/- Mäuse während der Zeit der Nierenentwicklung
ebenfalls erhöhte NOS-Werte, beginnend am Tag P3 bis zum Tag P60 [283]. NOS war bei diesen
Mäusen lokalisiert im Bereich der MD. Es scheint so, als würde NOS hochreguliert, in der Absicht den
Verlust der COX-2 zu kompensieren, was allerdings nicht gelingt. Auch das unterstützt die Theorie,
dass zwischen Nierenentwicklung und RAAS ein Zusammenhang besteht. Ob tatsächlich eine
Steigerung der Reninsekretion und damit Perfusionserhöhung in der sich entwickelnden Niere
stattfindet, und damit die Hämodynamiktheorie zutrifft, bleibt Spekulation. Zur Überprüfung wäre eine
Bestimmung der Plasmareninaktivität während der Zeit der Nierenreifung sinnvoll. Insgesamt scheint
diese Theorie aber sehr attraktiv.
Proliferation und Differenzierung
Eine mögliche Alternative bleibt bestehen. Wie in der Einleitung beschrieben, entsteht die spätere
Niere durch die Verschmelzung von Ureterknospe aus dem Wolff’schen Gang und metanephrogenem
Blastem, wobei sich beide Gewebe gegenseitig beeinflussen und Wachstum induzieren. Die
Ureterknospe teilt sich dichotom und bildet nach und nach Sammelrohre und das Nierenbecken aus.
Jeder Verzweigung der Ureterknospe sitzt kappenförmig metanephrogenes Gewebe auf, das unter
dem induzierenden Einfluss der Ampulle proliferiert (Benninghoff,Anatomie) [16]. Es differenziert sich
ein epitheliales Bläschen, welches sich streckt und einstülpt und aus dem Bowman-Kapsel und
66
Glomerulum hervorgehen. Auffällig ist, dass die MD schon sehr zeitig in Kontakt mit dem sich
bildenden Gefässpol zu erkennen ist [16]. Das distale Ende der Nephronanlage bekommt Anschluss
an die Ampulle (Teil der Ureterknospe). Gleichzeitig teilt sich die Ampulle und die zweite neu
enstandene Ampulle induziert ihrerseits in dem nephrogenen Gewebe die Anlage eines weiteren
Nephrons... [16].
Während der Nephrogenese finden also ausgeprägte Zell-Zell-Interaktionen statt. Es ist denkbar, dass
hieran PG aufgrund ihres autokrinen und parakrinen Charakters wesentlich beteiligt sind.
Für den EP-4 Rezeptor ist ein Gs-Protein-unabhängiger Signalweg beschrieben, nämlich die durch
PI-3 Kinase (phospatidyl-inositol 3-Kinase) vermittelte Phosphorylierung der ERK (extracellular signal
related kinase) und Expression von early growth response factor -1 (EGRF-1) [1]. Daneben spielt PI-3
Kinase eine Rolle in der Aktivierung von β-Catenin durch den EP-4 Rezeptor. β-Catenin ist ein
Transkriptionsfaktor und an der Embryonalentwicklung und Entstehung von Krebs beteiligt. Bindung
an EP-4 scheint die normalerweise stattfindende Phosphorylierung und damit Inaktivierung von βCatenin durch GSK-3 zu unterdrücken. Neben EP-4 kann auch EP-2-Rezeptorbindung β-Catenin
aktivieren [1]. Wenn also während der postpartalen Nierenentwicklung bei Mäusen Mechanismen auf
zellulärer Ebene und Genaktivierung eine Rolle spielen, dann scheinen EP-4 und z.T. EP-2
Rezeptoren als wichtigste Kandidaten in der Vermittlung, und das könnte den positiven Effekt des EP4 -Agonisten ONO AE1-329 erklären.
Von vielen malignen Tumoren ist bekannt, dass sie COX-2 überexprimieren und für weiteres
Tumorwachstum nutzen [Review 285]. COX-2 ist in der Lage, Angiogenese zu fördern [253,254,255].
Außerdem fördert PGE2 Zellproliferation, z.T. über EGF-Rezeptor- Transaktivierung [182,219] und
unterdrückt Apoptose durch erhöhte bcl-2 Expression [220]. Mehrere Wachstumsfaktoren wie vascular
endothelial growth factor und basic fibroblast growth factor werden durch COX-2 vermehrt freigesetzt
[43]. Parallel dazu war PGE1 in vitro in der Lage Zellwachstum in Zellkulturen metanephrogenen
Gewebes zu fördern und die Differenzierung in Glomerulusepithel zu induzieren [9].
Bleibt die Frage, warum einige Glomeruli bei der COX-2- bzw. EP2/EP4- Knockout Maus normales
Wachstum und normale Differenzierung zeigen, v.a. wenn die nötigen Rezeptoren für EP-2 und EP-4
wie im Falle der EP2/EP4-negativen Maus nicht vorhanden sind.
Fazit
Zusammengefasst ergeben sich aus der vorliegenden Arbeit Hinweise, dass eine COX-2 vermittelte
Ausbildung funktionsfähiger Nephrone in der Postpartalzeit über die bekannten membranständigen
Rezeptoren EP-4 und EP-2 läuft. Welche Mechanismen dafür im weiteren verantwortlich sind, bleibt
jedoch unklar. Sowohl für eine Beeinflussung der Hämodynamik entstehender Nephrone durch das
RAAS als auch für eine Beeinflussung der Transkription von Genen sind die Rezeptoren EP-2 und
EP-4 die wichtigsten Vermittler.
Für eine Wirkung auf die Nierenentwicklung durch die PG-Rezeptoren IP, FP, EP-1und EP-3, sowie
den PPARγ liganden 15dPGJ2 ergeben sich keine Hinweise, jedoch sind die möglichen Ursachen für
die Wirkungslosigkeit vielfältig und es sollten Versuche mit stabileren und selektiven Agonisten für die
einzelnen Rezeptoren folgen.
67
6. ZUSAMMENFASSUNG
Die Beteiligung von PG an entzündlichen Prozessen, Fieber und Schmerz ist bekannt und relativ gut
erforscht. Darüberhinaus finden sich aber immer wieder weitere pathologische und physiologische
Vorgänge, an denen Prostaglandine (PG) aufgrund ihres autokrinen und parakrinen Charakters
beteiligt sind. Erster Schritt in der PG-Synthese ist die Umwandlung von Arachidonsäure aus der
Zellmembran in PGH2 durch die Cyclooxygenase (COX), und die Menge produzierter PG wird durch
die aktuelle COX-Aktivität bestimmt. Seit etwa 13 Jahren ist bekannt, dass zwei Isoformen der COX
existieren, COX-1 und COX-2. Durch die Lokalisation von COX-2 und PG-Synthasen an der inneren
Kernmembran und der Tatsache, dass COX-2 von vielen Tumoren überexprimiert wird, ergeben sich
Hinweise, dass die COX-2 selbst in die Gentranskription eingreift.
COX-2 scheint im Rahmen der Tumorgenese Proliferation zu fördern und Apoptose zu unterdrücken.
Daneben fördert COX-2 die Angiogenese und stimuliert die Freisetzung mehrerer Wachstumsfaktoren.
Dass sie auch physiologischerweise in den Zellzyklus eingreifen könnte, zeigten Versuche mit
Zellkulturen, wo PGE1 maximales Wachstum und Differenzierung auslöste. In der Absicht, die Rolle
der COX-2 auf die Krebsentstehung zu untersuchen, wurden erstmals 1995 durch Dinchuk et al. [50]
und Morham et al. [162] COX-2 -negative Mäuse durch Gen-knockout generiert. Hier zeigte sich u.a.,
dass bei den COX-2 -negativen Tieren die Nierenentwicklung stark beeinträchtigt war, und diese
gestörte Nierenentwicklung ist eigentlicher Inhalt dieser Arbeit.
In einem ersten Teil der Arbeit wurde der zeitliche Verlauf der sich entwickelnden renalen Schäden bei
COX-2 -/- Tieren festgehalten. Wir fanden erste deutliche Unterschiede zwischen Knockout- und
Kontrollnieren bereits am Tag P8, in Übereinstimmung mit früheren Arbeiten zu diesem Thema.
Die Nieren COX-2 -negativer Tiere zeigen einen Reifungsstopp neu entstandener Nephrone. Während
bei Wildtypmäusen eine homogene Verteilung gleichgroßer Glomeruli über die gesamte Nierenrinde
stattfindet,
bleiben die hypoplastischen Glomeruli der Knockout- Tiere in direktem Kontakt zur
Nierenkapsel und zeigen keine Grössenzunahme. Daneben finden sich einige wenige normalgroße
Glomeruli in Marknähe, die später durch Hyperfiltration überlastet werden und sklerosieren, was zum
Tod der Tiere nach durchschnittlich 3,5 Monaten in der Urämie führt. Die Unterschiede zwischen
Wildtyp und COX-2 knockout entstehen erst während der postnatalen Zeit der Nierenreifung, die ca. in
der dritten Woche abgeschlossen ist. Es scheint deshalb so zu sein, dass nicht die eigentliche
Organanlage, sondern eine spätere funktionelle Ausreifung der Nephrone gestört ist. Weiterführende
Arbeiten zeigten tatsächlich eine physiologischerweise gesteigerte COX-2 -Expression während der
Zeit der Nierenentwicklung sowohl bei der Maus, als auch bei anderen Spezies, einschließlich der
humanen. COX-2 ist während dieser Zeit v.a. lokalisiert in Zellen der Macula densa (MD) und dickem,
aufsteigendem Teil der Henleschleife (TALH). Auch in der adulten Niere findet an dieser Lokalisation
COX-2 -Expression statt, und zwar im Zusammenhang mit der Regulierung des Renin-AngiotensinAldosteron-Systems (RAAS). Veränderungen der tubulären NaCl-Konzentration werden durch MDZellen registriert und bewirken in Situationen verminderter Cl-Konzentration, z.B. nach salzarmer Diät
oder Furosemidbehandlung eine gesteigerte COX-2 -Expression. Durch COX-2 synthetisierte PG
setzen aus granulierten Epitheloidzellen des juxtaglomerulären Apparates Renin frei.
68
Eine Beeinträchtigung der Nierenentwicklung COX-2 -negativer Mäuse ließe sich erklären durch eine
Störung im RAA-System oder durch Veränderungen auf zellulärer Ebene, wie etwa COX-2 vermittelte
Genaktivierung bzw. -transkription während der Ausbildung neuer Nephrone.
Von dieser Situation ausgehend sollte im zweiten Teil dieser Arbeit versucht werden, durch externe
PG-Zufuhr den Reifungsstopp der Nieren COX-2 -negativer Mäuse zu durchbrechen. Zu diesem
Zweck wurden junge Mäusebabies durch intraperitoneale Injektion, zweimal täglich, vom 3.
postpartalen Tag bis zum 21. postpartalen Tag behandelt. Anschließend wurden nach Tötung der
Tiere die Nieren zur histologischen Auswertung entnommen.
Die zur intraperitonealen Injektion verwendeten Substanzen waren:
-
die PGE1 -Analoga Alprostadil und Misoprostol mit Wirkung auf die PGE-Rezeptoren EP2,
EP3 und EP4.
-
der EP1- und EP3-Rezeptoragonist Sulproston,
-
der EP4-Agonist ONO AE1-329,
-
das PGI2 analoge Iloprost mit Wirkung auf IP-Rezeptoren,
-
das PGF2α analoge Fluprostenol mit Wirkung auf FP-Rezeptoren und
-
der PPARγ-Ligand 15dPGJ2.
Verglichen wurden am Tag P21 jeweils die Knockout- Tiere mit den heterozygoten Tieren eines
Wurfes, deren Histologie dem Wildtyp entspricht. Außerdem wurden die behandelten Knockout- Tiere
jeweils mit einer Plazebo (NaCl)- behandelten Gruppe verglichen. Ausgewertet wurden das
histologischen Bild, der durchschnittliche glomeruläre Durchmessers, der Abstand der ersten
Glomerulusschicht von der Nierenkapsel und das relative Nierengewicht. Im Ergebnis zeigte sich ein
deutlich positiver Effekt auf die Nierenentwicklung COX-2- negativer Tiere durch die Injektion des
EP-4 -Agonisten ONO AE1-329. Die so behandelten Mäuse hatten grössere Glomeruli, die in
grösserem Abstand zur Nierenkapsel lagen als in der Plazebogruppe. Die Nierenmasse hatte
zugenommen, und passend zu diesen Parametern zeigten die Nieren einiger Tiere ein fast normales
histologisches Bild. Die Nierenentwicklung bei Wildtypmäusen ließ sich dagegen durch Behandlung
mit ONO AE1-329 nicht beeinflussen. Behandlung mit 15dPGJ2 hatte einen allgemeinen
wachstumsfördernden Effekt auf die Niere homozygoter und heterozygoter Tiere, ohne die typische
Histologie der Knockout- Tiere zu verbessern. Die anderen verwendeten Substanzen blieben ohne
Effekt.
Im dritten Teil der Arbeit wurden die Nieren unbehandelter Mäuse mit Gen-knockout einzelner PGRezeptoren miteinander verglichen. EP1-, EP2-, EP3-, EP4- und IP-negative Tiere hatten keine
reduzierten Werte für die oben beschriebenen Parameter verglichen mit Wildtyp. Dagegen bewirkte
Doppel-Knockout von EP2 und EP4 eine Beeinträchtigung der Nierenentwicklung, wie sie auch bei
COX-2 Knockout oder Behandlung mit dem COX-2 -Inhibitor SC-58236 eintritt. Auch dies weist auf
eine Beteiligung des EP-4 (und z.T. EP-2) -Rezeptors an der Nephrogenese hin. Da sowohl EP2 als
auch EP4 zur Erhöhung der intrazellulären cAMP-Konzentration führen, ist eine Beeinflussung der
Hämodynamik
neu
entstehender
Nephrone
durch
Vasodilatation
oder
MD-vermittelte
Reninfreisetzung, beides cAMP -gesteuerte Prozesse, denkbar. Daneben sind für beide Rezeptoren
alternative Signalwege bekannt, durch die eine Wirkung auf Transkriptinsfaktoren und Zellzyklus
69
erzielt werden kann. Für den beobachteten positiven Effekt auf die Nierenentwicklung durch EP4Aktivierung lassen sich also mehrere mögliche Erklärungen finden.
Zusammengefasst konnte mit dieser Arbeit bewiesen werden, dass
1.) bei COX-2 negativen Mäusen die postpartale Nierenentwicklung stark beeinträchtigt ist,
2.) durch Zufuhr externer PG-Rezeptorangonisten der Reifungsstopp der Nieren COX-2 negativer
Mäuse durchbrochen werden kann und
3.) der Einfluss der von COX-2 produzierten PG über die klassischen, membranständigen PGRezeptoren EP4 (und z.T. EP2) läuft. Somit kann bestätigt werden, dass die PG eine zentrale Stellung
in der postnatalen Nierenentwicklung einnehmen.
Teile der Arbeit wurden im Rahmen des folgenden Symposiums präsentiert:
Rolf M. Nüsing, Andreas Herud, Christian Breitbarth, Anika Schuster, Antje Treude; „Rescue of COX-2
dependent renal dysgenesis by EP receptor ligands“; Kick-Off Symposium „Lipid Signaling” der
Universitätsklinik Frankfurt/Main, November 2004.
70
7.
QUELLENNACHWEIS
1)
Aaron N. Hata, Richard M. Breyer Pharmacology and signaling of prostaglandin receptors: Multiple roles
in inflammation and immune modulation Pharmacology and Therap.2004 (Vol.103,2): 147-166
2)
Aderam A.A.,Cohen M.A., Wright D.S.; J.Exp.Med. 1986(16,4) :165-179
3)
Anderson, G. D., Hauser, S. D., McGarity, K. L., Bremer, M. E., Isakson, P. C., and Gregory, S. A.
Selective inhibition of cylooxygenase (COX)-2 reverses inflammation and expression of COX-2 and
interleuken 6 in rat adjuvant arthritis. J. Clin. Invest. 1996(97): 2672–2679
4)
Andersen, K., Launer, L. J., Ott, A., Hoes, A. W., Breteler, M. M., and Hofman, A. Do nonsteroidal antiinflammatory drugs decrease the risk for Alzheimer's disease? The Rotterdam Study. Neurology
1995(45): 1441–1445
5)
Appleby S, Ristimaki A , Structure of the human cyclo-oxygenase-2 gene, Biochem J (1994) 723-727
6)
Appleton I,Tomlinson A; Temporal and spatial immunolocalization of cytokines in murine chronic
granulomatous tissue. Lab.Invest. 1993(69):405-414
7)
Araki H, Ukawa H; The roles of prostaglandin E receptor subtypes in the cytoprotective action of
prostaglandin E2 in rat stomach; Aliment.Pharmac.Therap.(Suppl) 2000(14,1):116- 124
8)
Araki Y, Okamura S, Hussain SP, Nagashima M, He P, Shiseki M, Miura K, Harris CC Regulation of
cyclooxygenase-2 expression by the Wnt and ras pathways. Cancer Res 2003(63):728–734
9)
Avner, E., Sweeney, Jr.; Growth factor requirements of organogenesis in serum-free metanephric organ
culture. In Vitro Cell. Dev. Biol. 1985(21): 297-304
10)
Bach PH, Hardy TL: Relevance of animal models to analgesic-associated renal papillary necrosis in
humans. Kidney Int 1985(28): 605 613
11)
Baylis C, Deen W, Myers B, Brenner B. Effects of some vasodilator drugs on transcapillary fluid
exchange in renal cortex. Am. J. Physiol. 1976(230):1148-1158
12)
Beiche, F., Scheuerer, S., Brune, K., Geisslinger, G., and Goppelt-Struebe, M. Up-regulation of
cyclooxygenase-2 mRNA in the rat spinal cord following peripheral inflammation. FEBS Lett. 1996(390):
165–169
13)
Beierwaltes, W. B. Selective neuronal nitric oxide synthase inhibition blocks furosemide-stimulated renin
secretion in vivo. Am. J. Physiol. 1995(269) (Renal Fluid Electrolyte Physiol. 38): F134-F139
14)
Bek M, Nüsing R, Kowark P, Henger A, Mundel P, Pavenstadt H. Characterization of prostanoid
receptors in podocytes. J. Am. Soc. Nephrol. 1999(10):2084-2093
15)
Benini D, Fanos V ;In utero exposure to nonsteroidal anti-inflammatory drugs: neonatal renal failure;
Pediatr Nephrol. 2004(19,2):232-234
16)
Benninghoff ; Anatomie 2; Urban&Schwarzenberg ;13. Auflage 1985: 329ff
17)
Bergström S, Danielsson H, Samuelsson B. The enzymatic formation of prostaglandin E from
arachidonic acid. Biochem Biophys Acta 1964 (90): 207 -210
18)
Bergström S, Sjovall J. II. The isolation of prostagladin E from sheep prostata glands. Acta Chem
Scand.1960 (14): 1701 -1705
19)
Bergström S, Sjovall J. I. The Isolation of prostaglandin F from sheep prostate glands. Acta Chem
Scand. 1960 (14): 1693 -1700
20)
Bosse HM, Böhm R, Resch S, Bachmann S. Parallel regulation of constitutive NO synthase and renin at
JGA of rat kidney under various stimuli. Am J Physiol. 1995(269): F793–805
21)
Bottoms G.D.,Johnson M.A.,Lamar C; Circ.Shock 1985(15):155-162
22)
Breitner, J; Inflammatory processes and antiinflammatory drugs in Alzheimer's disease: a current
appraisal. Neurobiol. Aging 1996(17): 789–794
71
23)
Breitner, J., Welsh, K., Helms, M., Gaskell, P., Gau, B., Roses, A., Pericak-Vance, M., and Saunders, A.
Delayed onset of Alzheimer's disease with nonsteroidal anti-inflammatory and histamine H2 blocking
drugs. Neurobiol. Aging 1995(16): 523–530
24)
Brenner B.M.; Nephron adaptation to renal injury or ablation; Am.J.Physiol. 1985(249): F324-F337
25)
Breshnahan BA, Kelefiotis D, Stratidakis I, Lianos EA. PGF2alpha-induced signaling events in
glomerular mesangial cells. Proc. Soc. Exp. Biol. Med. 1996(212):165-173
26)
Breyer M.D., Breyer R.M., G protein-coupled prostanoid receptors and the kidney, Annu Rev Physiol,
2001(63): 579—605
27)
Busch R. Histometrische und histopathologische Charakterisierung altersabhängiger
Nierenveränderungen an den Malpighischen Körperchen bei zwei Stämmen des Syrischen
Goldhamsters (Mesocricetus auratus W.) Vet. med. Diss. Gießen 1988
28)
Callejas NA, Castrillo A, Bosca L, Martin-Sanz P. Inhibition of prostaglandin synthesis up-regulates
cyclooxygenase-2 induced by lipopolysaccharide and peroxisomal proliferators.
J Pharmacol Exp Ther. 1999(288): 1235–1241
29)
Cao C., Matsumura, K., Watanabe, Y. Induction of cyclooxygenase-2 in the brain by cytokines. Ann.
N.Y. Acad. Sci. 1997(813): 307–309
30)
Cao C., Matsumura, K., Yamagata, K., Watanabe, Y. Involvement of cyclooxygenase-2 in LPS-induced
fever and regulation of its mRNA by LPS in the rat brain. Am. J. Physiol. 1997(272): R1712–R1725
31)
Carmines P, Bell P, Roman R, Work J, Navar L. Prostaglandins in the sodium excretory response to
altered renal arterial pressure in dogs. Am. J. Phyisol. Renal Physiol. 1985(248):F8-F14
32)
Castrop H, Schweda F; Permissive role of nitric oxide in macula densa control of renin secretion; Am J
Physiol Renal Physiol. 2004(286,5): F848-457
33)
Catella-Lawson F, McAdam B, Effects of specific inhibition of cyclooxygenase-2 on sodium balance,
hemodynamics, and vasoactive eicosanoids. J Pharmacol Exp Ther 1999(289): 735 741
34)
Celsi G; Influence of age on compensatory renal growth in rats; Pediatric Research, 1986 (20): 347-350
35)
Celsi, G., Nishi, A., Akusjarvi, G., Aperia, A., Abundance of Na–K-ATPase mRNA is regulated by
glucocorticoid hormones in infant rat kidneys. Am. J. Physiol. 1991(260): F192–F197.
36)
Chakraborty, I., Das, S. K., Wang, J., and Dey, S. K. Developmental expression of the cyclooxygenase-1
and cyclooxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by
the blastocyst and ovarian steroids. J. Mol. Endocrinol. 1996(16): 107–122
37)
Chaudhari A, Gupta S, Kirschenbaum M. Biochemical evidence for PGI2 and PGE2 receptors in the
rabbit renal preglomerular microvasculature. Biochim. Biophys. Acta 1990(1053):156-161
38)
Chen C, Sun Y , Chen J, Tumor necrosis factor-alpha-induced cyclooxygenase-2 expression via
sequential activation of ceramide-dependent mitogenactivatedprotein kinases, and IkappaB kinase 1/2
in human alveolar epithelial cells, Mol. Pharmacol. 2001(59): 493–500.
39)
Cheng H.F, Wang, J.L., Zhang, M et al. . Angiotensin II attenuates renal cortical cyclooxygenase-2
expression. J Clin Invest 1999(103): 953-961
40)
Cheng H F,Wang J,Zhang M; Genetic deletion of COX-2 prevents increased renin expression in
response to ACE inhibition ;Am J Physiol Renal Physiol 2001( 280): F449-F456
41)
Cheng HF, Wang JL, Zhang MZ, McKanna JA, Harris RC. Nitric oxide regulates renal cortical
cyclooxygenase-2 expression. Am J Physiol. 2000(279): F122–F129
42)
Cheng H.F., Wang J, Zhang, M.Z., McKanna, J.A. & Harris, R.C. Role of p38 in the regulation of renal
cortical cyclooxygenase-2 expression by extracellular chloride. J Clin Invest 2000(106): 681-688
43)
Cianchi F, Cortesini C, Bechi P, Fantappie O, Messerini L, Vannacci A, Sardi I, Baroni G Up-regulation
of cyclooxygenase 2 gene expression correlates with tumor angiogenesis in human colorectal cancer.
Gastroenterology 2001(121):1339–1347
44)
Cohn, S. M., Schloemann, S., Tessner, T., Seibert, K., Stenson, W. F. Crypt stem cell survival in the
mouse intestinal epithelium is regulated by prostaglandins synthesized through cyclooxygenase-1. J.
Clin. Invest. 1997(99): 1367–1379
72
45)
Crofford, L. J. COX-1 and COX-2 tissue expression: implications and predictions. J. Rheum.
1997(24): 15–19
46)
Currie MG, Needleman P: Renal arachidonic acid metabolism. Annu Rev Physiol 1984(46): 327 341
47)
Daniel T, Liu H, Morrow J D ,Thromboxane A2 is a mediator of cyclooxygenase-2-dependent endothelial
migration and angiogenesis, Cancer Res. 1999(59):4574–4577.
48)
Deng A., Temporal adaptation of tubuloglomerular feedback: Effects of COX-2 Kidney Int. 2004 (66)
2348-2353;
49)
Desvergne B, Wahli W. Peroxisome proliferator-activated receptors: nuclear control of metabolism.
Endocr Rev. 1999(20): 649–688
50)
Dinchuk, J.E., Car, B.D., Focht, R.J. et al. Renal abnormalities and an altered inflammatory response in
mice lacking cyclooxygenase II. Nature 1995(378), 406-409.
51)
Doerfler E.M.,Danner L.R. J.Clin.Invest. 1989 (83):970-977
52)
Dubois R.N., Abramson S B , Crofford L Cyclooxygenase in biology and disease
The FASEB Journal. 1998 (12):1063-1073.
53)
Eckmann, L., Stenson, W. F., Savidge; Role of intestinal epithelial cells in the host secretory response to
infection by invasive bacteria: bacterial entry induces epithelial prostaglandin H synthase-2 expression
and prostaglandin E2 and F2 production. J. Clin. Invest. 1997(100): 296–309
54)
Edwards RM. Effects of prostaglandins on vasoconstrictor action in isolated renal arterioles. Am. J.
Physiol. Renal Physiol. 1985(248):F779-F84
55)
Eliasson R. Studies on the prostaglandin: occurrens, formation and biological actions. Acta Physiol
Scand. 1959 (46,Suppl. 168): 1 -73
56)
Eligini S, Habib A, Lebret M, Creminon C, Levy-Toledano S, Maclouf J: Induction of cyclo-oxygenase-2
in human endothelial cells by SIN-1 in the absence of prostaglandin production. Br J Pharmacol
2001(133): 1163–1171
57)
Fahmi H, Pelletier JP, 15d—PGJ(2) is acting as a ‘dual agent’ on the regulation of COX—2 expression in
human ostheoarthritic chondrocytes; Osteoarthritis Cartilage 2002(10,11) :845-851
58)
Fieni S, Gramellini D; Oligohydramnions and fetal renal sonographic appearances related to
prostaglandin synthetase inhibitors; Fet.Diagn.Ther. 2004(19): 224-227
59)
Fleming, E.F., Urinary concentrating function in mice lacking EP3 receptors for prostaglandin E2.
Am. J. Physiol. 1998(275):F955–F961.
60)
Fong C, Pang L, Holland E, Knox A J, TGF-beta1 stimulates IL-8 release, COX-2 expression, and
PGE(2) release in human airway smooth muscle cells, Am. J. Physiol. Lung Cell Mol. Physiol.
2000(279):L201–L207.
61)
Forman BM, Tontonoz P, Chen J; 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte
determination factor PPAR gamma. Cell. 1995(83): 803–812
62)
Francisco L, Osborn J L , DiBona G F . Prostaglandins in renin release during sodium deprivation. Am.
J. Physiol. 1982(243):F537-F542
63)
Fukuda R, Kelly B , Semenza G L, Vascular endothelial growth factor gene expression in colon cancer
cells exposed to prostaglandin E2 is mediated by hypoxia-inducible factor1,
Cancer Res. 2003(63):2330–2334.
64)
Fujino H., West K.A., Regan J.W., Phosphorylation of glycogen synthase kinase-3 and stimulation of Tcell factor signaling following activation of EP2 and EP4 prostanoid receptors by prostaglandin E2, J Biol
Chem, Volume: 2002(277): 2614—2619
65)
Fujino H., Xu W., Regan J.W., Prostaglandin E2 induced functional expression of early growth response
factor-1 by EP4, but not EP2, prostanoid receptors via the phosphatidylinositol 3-kinase and extracellular
signal-regulated kinases, J Biol Chem, 2003(278):12151—12156
66)
Gad S.C.;Development and validation of an alternative dermal sensitization test: the mouse ear swelling
test; Toxic.Appl.Pharm. 1986(84):93-114
73
67)
Gallo O, Schiavone N, Papucci L, Sardi I, Magnelli L, Franchi A, Masini E, Capaccioli S Down-regulation
of nitric oxide synthase-2 and cyclooxygenase-2 pathways by p53 in squamous cell carcinoma. Am J
Pathol 2003(163):723–732
68)
Gann P, Manson J, Glynn J, Low-dose aspirin and incidence of colorectal tumors in a randomized trial,
J. Natl Cancer Inst. 1993(85): 1220–1224.
69)
Garcia Rodriguez L, C. Huerta-Alvarez, Reduced incidence of colorectal adenoma among long-term
users of nonsteroidal antiinflammatory drugs: a pooled analysis of published studies and a new
population-based study; Epidemiology 2000(11): 376–381.
70)
Gelman L, Fruchart JC, Auwerx J. An update on the mechanisms of action of the peroxisome
proliferator-activated receptors (PPARs) and their roles in inflammation and cancer. Cell Mol Life Sci.
1999(55): 932–943
71)
Gerber JG, Keller RT, Nies AS. Prostaglandins and renin release: the effect of PGI2, PGE2, and 13,14dihydro PGE2 on the baroreceptor mechanism of renin release in the dog. Circ. Res 1979(44): 796–799
72)
Giardiello F, Hamilton S R , Krush A, S, Treatment of colonic and rectal adenomas with sulindac in
familial adenomatous polyposis, N. Engl. J. Med. 1993(328): 1313–1316.
73)
Giardiello F, Yang V W , Hylind L, Primary chemoprevention of familial adenomatous polyposis with
sulindac, N. Engl. J. Med. 2002(346): 1054–1059.
74)
Giovannucci E., Egan K. M., Hunter D. J., Stampfer, M. J., Aspirin and the risk of colorectal cancer in
women. N. Engl. J. Med. 1995(333): 609–614
75)
Giovannucci E., Rimm E. B., Stampfer M. J., Colditz G. A. Aspirin use and the risk for colorectal cancer
and adenoma in male health professionals. Ann. Int. Med. 1994(121): 241–246
76)
Goormaghtigh N: Facts in favor of an endocrine function of the renal arterioles. J Pathol 1945( 57): 392
393,
77)
Greenberg S, He X , Schnermann J, Effect of nitric oxide on renin secretion. I. Studies in isolated
juxtaglomerular granular cells. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 1995(37): F948-F952
78)
Greenberg S, Lorenz J, He X , Schnermann J; Effect of prostaglandin synthesis inhibition on macula
densa-stimulated renin secretion. Am. J. Physiol. 1993(265):F578-F583
79)
Greger R; Ion transport mechanisms in thick ascending limb of henle’s loop of mammalian nephron;
Physiol.Rev. 1985(65): 760-797
80)
Gross G,Imamura T; Opposing actions of prostaglandins and oxytocin determine the onset of murine
labor; Proc.Natl.Acad.Sci. USA 1998(95):11875-11879
81)
Guan Y., Chang M., Cho W., Cloning, expression, and regulation of rabbit cyclooxygenase-2 in renal
medullary interstitial cells. Am J Physiol 1997(273): F18-F26
82)
Hackbart H.; Buchholz C., Franke P., Gunter L.; Tapken H.; Vergleichende histometrische
Untersuchungen zur Größe der Nierenglomeruli bei Maus, Ratte und Hamster.
Dtsch. tierärztliche Wochenschr. 1987(94): 58-61
83)
Hackenthal E, Schwertschlag U, and Seyberth HW. Prostaglandins and renin release studies in the
isolated perfused rat kidney. Prog Biochem Pharmacol 1980(17): 98–107
84)
Harding P, Sigmon DH, Alfie ME, Cyclooxygenase-2 mediates increased renal renin content induced by
low-sodium diet. Hypertension 1997(29,1 Pt 2):297 302
85)
Harris C, McKanna J; Cyclooxygenase-2 is associated with the macula densa of rat kidney and
increases with salt restriction; Jou.Clin.Invest. 1994(94,Dec.):2504-2510
86)
Harris, R.C. The macula densa: recent developments. J Hypertens 1996(14): 815-822.
87)
Harris C, Wang J, Cheng H; Prostaglandins in macula densa function; Kidney Int.1998 (54 Issue s67):49
88)
Harris R, Zhang M, Cheng H; Cyclooxygenase-2 and the renal renin-angiotensin system;
Acta.Physiol.Scand. 2004(181,4):543
89)
Harris R. C., Cheng H, Interactions of the renin-angiotensin system and neuronal nitric oxide synthase in
regulation of cyclooxygenase-2 in the macula densa. Acta Physiol. Scand. 2000 (168): 47-51
74
90)
Harrison-Bernard, LM, Navar LG, Ho MM, Vinson GP, and El-Dahr SS. Immunohistochemical
localization of ANG II AT1 receptor in adult rat kidney using a monoclonal antibody Am J Physiol Renal
Physiol 1997(273): F170-F177,
91)
Hartner A., Goppelt-Struebe M., Hilgers, K.F. Coordinate expression of cyclooxygenase-2 and renin in
the rat kidney in renovascular hypertension. Hypertension 1998(31): 201-205.
92)
He T, Chan A , Vogelstein B , PPARdelta is an APC-regulated target of nonsteroidal anti-inflammatory
drugs, Cell 1999(99):335–345.
93)
He, X.-R., Greenberg S , Briggs J, Schnermann J, Effect of nitric oxide on renin secretion. II. Studies in
the perfused juxtaglomerular apparatus. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 1995(37):
F953-F959
94)
Hébert RL, Jacobson HR, Fredin D, Breyer MD. Evidence that separate PGE2 receptors modulate
water and sodium transport in rabbit cortical collecting duct. Am. J. Physiol. Renal Physiol.
1993(265):F643- F650
95)
Hemler M, Lands WE. Purification of the cyclooxygenase that forms prostaglandins. Demonstration of
two forms of iron in the holoenzyme. J Biol Chem 1976(251): 5575–5579.
96)
Hempel S, Monick M, Hunninghake G, Lipopolysaccharide induces prostaglandin H synthase-2 protein
and mRNA in human alveolar macrophages and blood monocytes, J. Clin. Invest. 1994(93) : 391–396.
97)
Henning, S. J. Plasma concentrations of total and free corticosterone during development in the rat. Am.
J. Physiol. 235 (Endocrinol. Metab. Gastrointest. Physiol. 1978(4): E451-E456
98)
Hirata T, Kakizuka A, Ushikubi F, Fuse I, Arg60 to Leu mutation of the human thromboxane A2
receptor in a dominantly inherited bleeding disorder. J. Clin. Invest. 1994(94): 1662-1667
99)
Ikawa H,Kameda H; Effect of PPAR activators on cytokine-stimulated cyclooxygenase-2 expression in
human colorectal carcinoma cells; Exp Cell Res. 2001(267,1):73-80
100)
Inscho E, Carmines P, Navar L. Prostaglandin influences on afferent arteriolar responses to
vasoconstrictor agonists. Am. J. Physiol. Renal Physiol. 1990(259):F157-F163
101)
Ito Sadajoshi ;Characteristics of isolated perfused juxtaglomerular apparatus. Kidney Int. 1998(54,67):46
102)
Ito S, Carretero O: Effect of prostanoids on renin release from rabbit afferent arterioles with and without
macula densa. Kidney Int 1989(35): 1138 1144
103)
Ito S, Juncos L, Carretero O: Pressure-induced constriction of the afferent arteriole of spontaneously
hypertensive rat. Hypertension 1992 19(Suppl 2): 164 167
104)
Jackson E. Relationship between renin release and blood pressure response to nonsteroidal antiinflammatory drugs in hypertension. Hypertension 1989(14):469-471
105)
Jensen, B.L. & Kurtz, A. Differential regulation of renal cyclooxygenase mRNA by dietary salt intake.
Kidney Int 1997(52): 1242-1249.
106)
Jensen BL, Schmid C, Kurtz A. Prostaglandins stimulate renin secretion and renin mRNA in mouse renal
juxtaglomerular cells. Am J Physiol Renal Fluid Electrolyte Physiol 1996(271): F659–F669
107)
Jiang C, Ting A, Seed B, PPAR-gamma agonists inhibit production of monocyte in¯ ammatory cytokines,
Nature 1998(391,6662) 82-86
108)
Juncos L, Garvin J, Carretero O, Ito S: Flow modulates myogenic responses in isolated microperfused
rabbit afferent arterioles via endothelium-derived nitric oxide. J Clin Invest 1995 (95): 2741 2748
109)
Kangaloo M. Der Alters- und Geschlechtseinfluß auf morphometrische Parameter des glomerulären
Apparates der Niere bei der BALB/cHan- Maus. Vet. med. Diss. Hannover 1977
110)
Kanwar Nasir M, Cyclooxygenase-2 Expression in the Developing Human Kidney; Pediatric and
Developmental Pathology 2001(4): 461–466
111)
Kaplan B; Renal failure in the neonate associated with in utero exposure to non-steroidal antiinflammatory agents; Pediat.Nephr. 1994(8): 700-704
112)
Katsuyama, M., Distinct cellular localization of the messenger ribonucleic acid for prostaglandin E
receptor subtypes in the mouse uterus during pseudopregnancy. Endocrinology. 1997(138):344–350.
75
113)
Kaufmann, W, Worley F., Taylor C , Bremer, Cyclooxygenase-2 expression during rat neocortical
development and in Rett syndrome. Brain Dev. 1997(19): 25–34
114)
Kawa S, Nikaido T, Growth inhibition and differentiation of pancreatic cancer cell lines by PPAR gamma
ligand troglitazone, Pancreas 2002 Jan; 24(1) :1—7
115)
Kennedy C, Zhang Y, Brandon S, Guan S, Hypertension and reduced fertility in mice lacking the
prostaglandin EP2 receptor. Nat. Med.1999 ( 5):217-220
116)
Khan KN, Alden CL, Gleissner SE, Effect of papillotoxic agents on expression of cyclooxygenase
isoforms in the rat kidney. Toxicol Pathol 1998(26) : 137 142,
117)
Khan KN, Silverman LR, Baron DA. Cyclooxygenase in the developing canine kidney [abstract].
Vet Pathol 1999(36): 486A.
118)
Khan KN, Stanfield KM, Dannenberg A, Cyclooxygenase-2 expression in the developing human kidney.
Pediatr Dev Pathol 2001(4): 461–466
119)
Khan KN, Stanfield KM, Harris RK, Expression of cyclooxygenase-2 in the macula densa of human
kidney in hypertension, congestive heart failure, and diabetic nephropathy. Ren. Fail 2001(23): 321–330
120)
Khan KN, Venturini CM, Bunch RT, Interspecies differences in renal localization of cyclooxygenase
isoforms: Implications in nonsteroidal antiinflammatory drug-related nephrotoxicity. Toxicol Pathol
1998(26): 612–620,
121)
Kliewer S, J.M. Lenhard, T.M. Willson, A prostaglandin J2 metabolite binds peroxisome proliferatoractivated receptor gamma and promotes adipocyte differentiation, Cell 1995(83, 5) :813-819
122)
Kliewer S, Sundseth SS; Fatty acids and eicosanoids regulate gene expression through direct
interactions with peroxisome proliferator-activated receptors alpha and gamma. Proc Natl Acad Sci U S
A. 1997(94): 4318–4323
123)
Kömhoff M., Grone H.J., Klein T., Seyberth H, Nüsing R, Localization of cyclooxygenase-1 and -2 in
adult and fetal human kidney: implication for renal function. Am J Physiol 1997(272): F460-F468
124)
Kömhoff M, Jeck ND, Seyberth HW: Cyclooxygenase-2 expression is associated with the renal macula
densa of patients with Bartter-like syndrome. Kidney Int 2000(58): 2420–2424
125)
Kömhoff M, Wang J, Cheng H, Langenbach R, McKanna JA, Harris RC, Breyer MD Cyclooxygenase-2selective inhibitors impair glomerulogenesis and renal cortical development. Kidney Int 2000(57):414–
422
126)
Koki A, Khan NK, Woerner BM, Dannenberg AJ: Cyclooxygenase-2 in human pathological disease. Adv
Exp Med Biol 2002(507): 177–184
127)
Kovacs G,Peterdi J, Angiotensin II directly stimulates macula densa Na-2Cl-K cotransport via apical
AT1 receptors; Am J Physiol Renal Physiol 2002(282): F301-F306
128)
Kreisberg J, Cell biology and biochemistry of the glomerular mesangium; Miner.Electrolyt Metab.
1988(14) :167-175
129)
Kujubu A, Herschmann R, Dexamethason inhibits mitogen induction of the TIS10 prostaglandin
synthase/cyclooxygenase gene,
Journal of Biolog.Chem 1992(267,12) : 7991-7994
130)
Kujubu D, Bradley S, TIS10, a Phorbol Ester Tumor Promoter-inducible mRNA from Swiss 3T3 Cells,
Encodes a Novel Prostaglandin Synthase/Cyclooxygenase Homologue
Jou.Biol.Chem. 1991(266,20):12866-12872
131)
Kurland J, Bockman R; J.Exp.Med. 1978(147): 952-957
132)
Kurumbail R, Stevens A , Gierse J , Structural basis for selective inhibition of cyclooxygenase-2 by antiin¯ ammatory agents, Nature 1996(384,6610):644-648.
133)
Labayle D, Fischer D, Vielh P, Sulindac causes regression of rectal polyps in familial adenomatous
polyposis, Gastroenterology 1991(101):635–639.
134)
Laird J, Herrero J, Garcia de la Rubia J, Analgesic activity of the novel COX-2 preferring NSAID,
meloxicam, in mono-arthritic rats: central and peripheral components. Inflamm. Res. 1997(46): 203–210
76
135)
Langenbach R, Morham S, Tiano H, Loftin C: Prostaglandin synthase 1 gene disruption in mice reduces
arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell 1995(83): 483
492
136)
Langenbach R, Loftin C; Cyclooxygenase-deficient Mice: A Summary of Their Characteristics and
Susceptibilities to Inflammation and Carcinogenesis; Annals of the New York Academy of Sciences
1999(889):52-61
137)
Laporte J, Moore P, Lahiri T , p38 MAP kinase regulates IL-1 beta responses in cultured airway smooth
muscle cells, Am. J. Physiol. Lung Cell Mol. Physiol. 2000(279):L932–L941.
138)
Law RE, Meehan WP, Xi XP; Troglitazone inhibits vascular smooth muscle cell growth and intimal
hyperplasia. J Clin Invest. 1996(98): 1897–1905
139)
Lehmann JM, Lenhard JM; Peroxisome proliferator-activated receptors alpha and gamma are activated
by indomethacin and other non-steroidal anti-inflammatory drugs. J Biol Chem. 1997(272): 3406–3410
140)
Lemberger T, Desvergne B , Wahli W , Peroxisome pro-liferator-activated receptors: a nuclear receptor
signaling pathway in lipid physiology, Annu Rev Cell Dev Biol 1996(12,335):335-363.
141)
Lim H, Dey SK, A novel pathway of prostacyclin signaling-hanging out with nuclear receptors;
Endocrinology 2002(143,9): 3207-3210
142)
Lim H, Dey S; Prostaglandin E2 Receptor Subtype EP2 Gene Expression in the Mouse Uterus Coincides
with Differentiation of the Luminal Epithelium for Implantation; Endocrinology 1997(Vol. 138, No. 11):
4599-4606
143)
Lim H, Paria B; Multiple female reproductive failures in cyclooxygenase 2-deficient mice;
Cell 1997(91): 197-208
144)
Linas S; Role of prostaglandins in renin secretion in the isolated kidney. Am. J. Physiol. 1984(246):
F81 1-F818
145)
Liu C, Chang S, Narko K, Overexpression of cyclooxygenase-2 is sufficient to induce tumorigenesis in
transgenic mice, J. Biol. Chem. 2001(276):18563–18569.
146)
Loftin C, Trivedi B, Tiano H , Failure of ductus arteriosus closure and remodeling in neonatal mice
deficient in cyclooxygenase-1 and cyclooxygenase-2; PNAS 2001 (98): 1059 -1064
147)
Lorenz J, Weihprecht H; Renin release from isolated juxtaglomerular apparatus depends on macula
densa chloride transport; Am J Physiol 1991(260): F486-F493
148)
Lorenz J, Greenberg S, Briggs J ; The macula densa mechanism for control of renin secretion. Seminars
in Nephrology. 1993(13):531-542.
149)
Lorenz J, Weihprecht H, Schnermann J;Characterization of the macula densa stimulus for renin
secretion; Am J Physiol 1990(259): F186-F193.
150)
Lu X, Xie W, Bradshaw W, Nonsteroidal anti-inflammatory drugs cause apoptosis and induce
cyclooxygenases in chicken embryo fibroblasts, Pro. Natl. Acad.
Sci. USA 1995(92):7961–7965.
151)
Magassa S, Vergleichend- histometrische Studien an Nieren verschiedener Inzuchtstämme von
Mäusen. Vet. med. Diss. Hannover 1983
152)
Mann B, Hartner A, Jensen B, Acute upregulation of COX-2 by renal artery stenosis. Am J Physiol
Renal Physiol 2001(280):F119 F125
153)
Mann B, Hartner A, Jensen BL, Furosemide stimulates macula densa cyclooxygenase-2 expression in
rats. Kidney Int 2001(59): 62 68
154)
Marnett L, Kalgutkar A, Curr. Op.Chem. Biol., 1998(2,4), 482-490
155)
Marnett L, Kalgutkar A, Trends Pharmacol. Sci., 1999(20,11), 465-469
156)
Matsumura K., Cao C, Watanabe Y, Possible role of cyclooxygenase-2 in the brain vasculature in febrile
response. Ann. N.Y. Acad. Sci. 1997(813): 302–306
157)
McGeer P, Schulzer M, McGeer E, Arthritis and anti-inflammatory agents as possible protective factors
for Alzheimer's disease: a review of 17 epidemiologic studies. Neurology 1996(47): 425–432
77
158)
Mead J , Alfin-Slater R, Howton, D; Prostaglandins, thromboxanes, and prostacyclin. In Lipids:
Chemistry, Biochemistry, and Nutrition 1986 (Mead, J. F., ed) :149–216
159)
Mendez, M, LaPointe M, PPAR[gamma] Inhibition of Cyclooxygenase-2, PGE2 Synthase, and Inducible
Nitric Oxide Synthase in Cardiac Myocytes; Hypertension , 2003(42,4, Part 2): 844-850
160)
Miyamoto T, Ogino N, Yamamoto S, Purification of prostaglandin endoperoxide synthetase from bovine
vesicular gland microsomes. J Biol Chem 1976(251): 2629–2636.
161)
Moran E, Epidemiological and clinical aspects of nonsteroidal anti-inflammatory drugs and cancer risks,
J. Environ. Pathol. Toxicol. Oncol. 21 (2002) 193–201.
162)
Morham S, Langenbach R, Loftin C Prostaglandin synthase 2 gene disruption causes severe renal
pathology in the mouse. Cell 1995(83): 473 472
163)
Morita I, Schindler M; Different Intracellular Locations for Prostaglandin Endoperoxide H Synthase-1 and
-2; Am. Soc. Bioch. Molec. Biol. 1995 (Volume 270,18):10902-10908
164)
Muller-Decker K, Neufang G, Berger I, Transgenic cyclooxygenase-2 overexpression sensitizes mouse
skin for carcinogenesis, Proc. Natl Acad. Sci. USA 2002(99):12483–12488.
165)
Murakami M, Matsumoto R, Austen K , J. Biol. Chem. 1994(269): 22269-22275
166)
Murata T, Altered pain perception and inflammatory response in mice lacking prostacyclin receptor.
Nature. 1997(388):678–682.
167)
Mutoh M, Watanabe K, Kitamura T, Shoji Y, Involvement of prostaglandin E receptor subtype EP(4) in
colon carcinogenesis, Cancer Res. 2002(62):28–32.
168)
Nantel F, Meadows E, Denis D, Connolly B, Immunolocalization of cyclooxygenase-2 in the macula
densa of human elderly. FEBS Lett 1999(457): 475–477
169)
Narko K, Ristimaki A, MacPhee M, Smith E, Tumorigenic transformation of immortalized ECV endothelial
cells by cyclooxygenase-1 overexpression, J. Biol. Chem. 1997(272): 21455–21460
170)
Nguyen M , Camenisch T , Snouwaert J , Hicks E , Nature (London) 1997(390): 78-81
171)
Nichols C, Schenkein A, Rutherford B; Biochem.Biophys.Acta 1987(927):148-157
172)
Norwood V, Morham S; Postnatal development and progression of renal dysplasia in cyclooxygenase-2
null mice; Kidney Int. 2000(58): 2291-2300
173)
Novy M: Effects of indomethacin on labor, fetal oxygenation, and fetal development in rhesus monkeys.
Adv Prostaglandin Thromboxane Res 1978(4): 285 300
174)
Nüsing R, Seybert H; The role of cyclooxygenases and prostanoid receptorsin furosemide-like salt
losing tubulopathy: the hyperprostaglandin E syndrome; Acta Phys.Scand. 2004(181,4):523
175)
Nugent F, Farmer K, Spigelman A , Randomized controlled trial of the effect of sulindac on duodenal
and rectal polyposis and cell proliferation in patients with familial adenomatous polyposis,
Br. J. Surg. 1993(80):1618–1619.
176)
O’Banion MK, Sadowski HB, Winn V, Young DA. A serum- and glucocorticoid-regulated 4-kilobase
mRNA encodes a cyclooxygenase-related protein. J Biol Chem
1991(266):23261–23267.
177)
O’Banion MK, Winn VD, Young DA. cDNA cloning and functional activity of a glucocorticoid-regulated
inflammatory cyclooxygenase. Proc Natl Acad Sci U S A 1992(89):4888–4892.
178)
Ogino N, Ohki S, Yamamoto S, Hayaishi O. Prostaglandin endoperoxide synthetase from bovine
vesicular gland microsomes. Inactivation and activation by heme and other metalloporphyrins. J Biol
Chem 1978(253): 5061–5068.
179)
Ollerstam A, Increased blood pressure in rats after long-term inhibition of the neuronal isoform of nitic
oxide synthase; J. Clin. Invest. 1997 (199):2212-2218,
180)
Okuda T, Kojima I, Ogata E; Ambient Cl ions modify mesangial cell contraction by modulating cell
inositol triphosphate and Ca2+ via enhanced prostaglandin E2. J Clin Invest 1989(84): 1886 1872
181)
Oshima M, Dinchuk J, Kargman S, Suppression of intestinal polyposis in Apc delta716 knockout mice
by inhibition of cyclooxygenase 2 (COX-2), Cell 1996(87):803–809.
78
182)
Pai R, Soreghan B, Szabo IL, Pavelka M, Prostaglandin E2 transactivates EGF receptor: a novel
mechanism for promoting colon cancer growth and gastrointestinal hypertrophy. Nat Med 2002(8):
289–293
183)
Persson A, Boberg U; Interstitial pressure as a modulator of tubuloglomerular feedback control. Kidney
Int. 1982(22):S122-S128
184)
Persson A, Salomonsson M; Macula densa cell function; Kidney Int.1991(39 suppl.32):S39-S44
185)
Peruzzi L; Neonatal end-stage renal failure associated with maternal ingestion
of cyclo-oxygenase-type-1 selective inhibitor nimesulide as tocolytic; Lancet 1999(354):1605
186)
Picot D, Loll P ,Garavito R , The X-ray crystal structure of the membrane protein prostaglandin H2
synthase-1, Nature 1994(367):243-249.
187)
Raz A, Wyche A, Needleman P;Proc.Natl.Acad.Sci. USA 1986 (86):1657-1661
188)
Reddy S., Herschman H, J. Biol. Chem. 1994(269):15473-15480
189)
Reid I., Chou L, Effect of blockade of nitric oxide synthesis on the renin secretory response to
furosemide in conscious rabbits. Clin. Sci. (Colch.) 1995(88): 657-663
190)
Reinalter S, Jeck N, Brochhausen C; Role of cyclooxygenase-2 in hyperprostaglandin E
syndrome/antenatal Bartter syndrome;Kidney Int.2002(62,1):253
191)
Ren Y, Garvin J, Ito S; Role of neuronal nitric oxide synthase in the macula densa
Kidney International 2001 (60): 1676-1683
192)
Richards J, Fitzpatrick S, Clemens J, Ovarian cell differentiation: a cascade of multiple hormones,
cellular signals, and regulated genes. Rec. Prog. Hormone Res. 1995(50): 223–254
193)
Ricote M, Li AC, Willson TM; The peroxisome proliferator-activated receptor-gamma is a negative
regulator of macrophage activation. Nature. 1998(391): 79–82
194)
Ristimaki A, K. Narko, T. Hla, Down-regulation of cytokine-induced cyclo-oxygenase-2 transcript
isoforms by dexamethasone: evidence for post-transcriptional regulation, Biochem J (1996) 325-331.
195)
Roman R, Lianos E. Influence of prostaglandins on papillary blood flow and pressure
response. Hypertension 1990(15):29-35
196)
Rosen GD, Birkenmeier TM, Raz A, Holtzman MJ. Identification of a cyclooxygenase-related gene and
its potential role in prostaglandin formation. Biochem Biophys Res Commun 1989(164):1358–1365.
197)
Rytand A.D. The number and size of mammlian glomeruli as related to kidney and to body weight, with
methods for their enumaration and measurement. Am. J. Anat. 1938(62):501-520
198)
Sales K, Milne S, Williams A, Expression, localization, and signaling of prostaglandin F2 alpha receptor
in human endometrial adenocarcinoma: regulation of proliferation by activation of the epidermal growth
factor receptor and mitogen-activated protein kinase signaling pathways, J Clin Endocrinol Metab,
2004(89):986—993
199)
Salomonsson M,Gonzales E; Chloride concentration in macula densa and cortical thick ascending limb
cells; Kidney Int.1991(39 suppl.32):S51-S54
200)
Samuelseon B. On the incorporaiton of oxygen in the conversion of 8,11,14-eicosatrienoic acid into
prostaglandin E J Am Chem Soc 1965 (87): 3011 -3013
201)
Samuelson B, eds. Prostaglandins, Proceedings of the Second Nobel Symposium. 1967:17 -20.
202)
Samuelsson B. Prostaglandin endoperoxides and thromboxanes: short lived bioregulators In: Crabbe P,
ed. Prostaglandin research. 1977 Pp. 17-46
203)
Santoro M, Benedetto A, Carruba G, Prostaglandin A compounds as antiviral agents, Science
1980(209,4460): 1032-1034
204)
Schachter A.D.; Non-steroidal anti-inflammatory drug-associated nephrotoxicity in Bartter syndrom;
Pedia.Nephr. 1998(12): 775-777
205)
Schafer, A. I. Effects of nonsteroidal antiinflammatory drugs on platelet function and systemic
hemostasis. J. Clin. Pharmacol. 1995(35): 209–219
natriuretic
79
206)
Schilling E. Metrische Untersuchungen an Nieren von Wild- und Haustieren.
Z. Anat. Entwickl. Gesch. 1951(116): 67-95
207)
Schnermann J. Juxtaglomerular cell complex in the regulation of renal salt excretion. Am. J. Physiol.
Regulatory Integrative Comp. Physiol. 1998(274):R263-R79
208)
Schnermann J , Tubuloglomerular feedback: New concepts and developments Kidney International,
1998(54, Suppl.67) S40 -45
209)
Schricker K, Hamann M, Renal autacoids are involved in the stimulation of renin gene expression by low
perfusion pressure. Kidney Int. 1994(46): 1330-1336
210)
Schricker K, Hamann M, Kurtz A. Nitric oxide and prostaglandins are involved in the macula densa
control of the renin system. Am J Physiol. 1995(269): F825–F830
211)
Schricker K, Hegyi I, Hamann M, Tonic stimulation of renin gene expression by nitric oxide is
counteracted by tonic inhibition through angiotensin II. Proc. Natl. Acad. Sci. USA 1995(92): 8006-8010
212)
Schricker K, Kurtz A, Liberators of NO exert a dual effect on renin secretion from isolated mouse renal
juxtaglomerular cells. Am. J. Physiol. 265 (Renal Fluid Electrolyte Physiol. 1993(34): F180-F186
213)
Schweda F, Klar J, Narumiya S; Stimulation of renin release by prostaglandin E2 is mediated by EP2
and EP4 receptors in mouse kidneys; Am J Physiol Renal Physiol 2004(287): F427-F433
214)
Seed M, Brown J, Freemantle C , The inhibition of colon-26 adenocarcinoma development and
angiogenesis by topical diclofenac in 2.5% hyaluronan, Cancer Res. 1997(57): 1625–1629
215)
Segi E , Sugimoto Y , Yamasaki A , Aze Y. Biochem. Biophys. Res. Commun. 1998(246): 7-12
216)
Shao J, Sheng H, Inoue H, Regulation of constitutive cyclooxygenase-2 expression in colon carcinoma
cells. J Biol Chem 2000(275):33951–33956
217)
Shaw G, Kamen R, A conserved AU sequence from the 38 untranslated region of GM-CSF mRNA
mediates selective mRNA degradation. Cell 1986(46):659–667.
218)
Sheng H, Shao J, Dubois RN K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves
activation of the protein kinase B1. Cancer Res 2001(61):2670–2675
219)
Sheng H, Shao J, Washington MK, DuBois RN Prostaglandin E2 increases growth and motility of
colorectal carcinoma cells. J Biol Chem 2001(276):18075–18081
220)
Sheng H, Shao J, Morrow JD, Modulation of apoptosis and Bcl-2 expression by prostaglandin E2 in
human colon cancer cells. Cancer Res 1998(58):362–366
221)
Shiff SJ, Rigas B Nonsteroidal anti-inflammatory drugs and colorectal cancer: evolving concepts of their
chemopreventive actions. Gastroenterology 1997(113):1992–1998
222)
Silldorf E, Yang S, Pallone T, Prostaglandin E2 abrogates endothelin-induced vasoconstriction in renal
outer medullary descending vasa recta of the rat. J. Clin. Invest. 1995(95):2734-2740
223)
Silverstein FE, Faich G, Goldstein JL, Gastrointestinal toxicity with celecoxib vs nonsteroidal antiinflammatory drugs for osteoarthritis and rheumatoid arthritis: the CLASS study: A randomized controlled
trial. Celecoxib Long-term Arthritis Safety Study. JAMA 2000(284): 1247 1255
224)
Singh I, Grams M, Wang WH, Coordinate regulation of renal expression of nitric oxide synthase, renin,
and angiotensinogen mRNA by dietary salt. Am J Physiol. 1996(270): F1027–F1037
225)
Skorka Annett; Quantitativ- und qualitativ-morphologische Untersuchungen an Nieren und Nebennieren
von Katzen im Altersgang und unter Berücksichtigung des Plasma-Taurin-Gehaltes;InauguralDissertation Veterinärmedizin an der Freien Universität Berlin, 1999
226)
Skott O, Briggs J; Direct demonstration of macula densa-mediated renin secretion. Science Wash.DC
1987(237):1618-1620
227)
Smalley W, DuBois R, Colorectal cancer and non steroidal anti-inflammatory drugs. Adv. Pharmacol.
1997(39): 1–20
228)
Smith, G. C. S. Pharmacol. Rev. 1998(50): 35-58
80
229)
Smith JB, Willis AL. Aspirin selectively inhibits prostaglandin production in human platelets. Nature
1971; (231): 235 -237
230)
Smith, W., Garavito, R., and DeWitt, D. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1
and -2. J. Biol. Chem. 1996(271): 33157–33160
231)
Sonoshita M, Takaku K, Oshima M, Cyclooxygenase-2 expression in fibroblasts and endothelial cells of
intestinal polyps. Cancer Res 2002(62):6846–6849
232)
Sonoshita M, K. Takaku, N. Sasaki, Y. Sugimoto, Acceleration of intestinal
polyposis through prostaglandin receptor EP2 in Apc(Delta 716) knockout mice,
Nat. Med. 2001(7):1048–1051.
233)
Steinbach G, P.M. Lynch, R.K. Phillips, M.H. Wallace, The effect of celecoxib, a
cyclooxygenase-2 inhibitor, in familial adenomatous polyposis,
N. Engl. J. Med. 2000(342):1946–1952.
234)
Stewart W, Kawas C, Corrada M,. Risk of Alzheimer's disease and duration of NSAID use. Neurology
1997(48): 626–632
235)
Subbaramaiah K, Altorki N, Chung WJ, Mestre JR, Inhibition of cyclooxygenase-2 gene expression by
p53. J Biol Chem 1999(274):10911–10915
236)
Subbaramaiah K, Lin DT, Hart JC, Peroxisome proliferator-activated receptor gamma ligands suppress
the transcriptional activation of cyclooxygenase-2: evidence for involvement of activator protein-1 and
CREB-binding protein/p300. J Biol Chem. 2001(276): 12440–12448
237)
Sugimoto, Y, Failure of parturition in mice lacking the prostaglandin F receptor. Science. 277:681–683.
238)
Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Failure of parturition in mice lacking the prostaglandin F
receptor, Science, 1997(277): 681—683
239)
Taniguchi Y, Yokoyama K, Inui K, Inhibition of brain cyclooxygenase-2 activity and the antipyretic action
of nimesulide. Eur. J. Pharmacol. 1997(330): 221–229
240)
Tharaux P, Dussaule J , Pauti M, Activation of renin synthesis is dependent on intact nitric oxide
production. Kidney Int. 1997(51): 1780-1787
241)
Theilig F, Bostanjoglo M, Pavenstädt H, Grupp C; Cellular distribution and function of soluble guanylyl
cyclase in kidney and liver, rat. J Am Soc Nephrol. 2001(12): 2209–2220
242)
Theilig F,Campean V; Epithelial COX-2 Expression Is Not Regulated By Nitric Oxide in Rodent Renal
Cortex;Hypertension. 2002(39):848
243)
Therland K; Stubbe J, Thiesson H; Cycloxygenase-2 Is Expressed in Vasculature of Normal and
Ischemic Adult Human Kidney and Is Colocalized with Vascular prostaglandin E2 EP4 Receptors ; Jou
Amer.Soc.Nephr. 2004 (15,5): 1189-1198
244)
Thomas DW, Mannon RB, Mannon PJ, Latour A, Oliver JA, et al.. Coagulation defects and altered
hemodynamic responses in mice lacking receptors for thromboxane A2. J. Clin. Invest. 1998(102): 19942001
245)
Thomson S, Blantz R, Ions and signal transduction in the macula densa
J. Clin. Invest. 2000 (106) 633-635
246)
Thun M, Namboodiri M, Calle E, Flanders, Aspirin use and risk of fatal cancer. Cancer Res.
1993(53):1322–1327
247)
Thun M , Namboodiri M , Aspirin use and reduced risk of fatal colon cancer. N. Engl. J. Med. 1991(325):
1593–1596
248)
Thun M, S.J. Henley, C. Patrono, Nonsteroidal antiinflammatory drugs as anticancer agents: mechanistic
pharmacologic, and clinical issues, J. Natl Cancer Inst. 2002(94): 252-266
249)
Thurau K, Sschnermann J: Die Natriumkonzentration an den Macula densa Zellen als regulierender
Faktor fur das Glomerulumfiltrat (Mikropunktionsversuche). Klin Wochenschr 1965(43): 410 413,
250)
Thurau K: Modification of angiotensin-mediated tubulo-glomerular feedback by extracellular volume.
Kidney Int 1975(8 Suppl 5):S202–207,
81
251)
Tilley S, Audoly L; Reproductive failure and reduced blood pressure in mice lacking the EP2
prostaglandin E2 receptor; J. Clin. Invest. 1999(103):1539–1545
252)
Treude A, Nüsing R.M., Weissenberger C; Dominant role of prostaglandin E2 EP4 receptor in furosemid
induced salt losing tubulopathie: a model of Hyperprostaglandin E Syndrome/ Antenatal Bartter
Syndrome; J Am Soc Nephrol. 2005(16): 2354-2362
253)
Tsujii M, DuBois RN Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing
prostaglandin endoperoxide synthase 2. Cell 1995(83):493–501
254)
Tsujii M, Kawano S, DuBois RN Cyclooxygenase-2 expression in human colon cancer cells increases
metastatic potential. Proc Natl Acad Sci U S A 1997(94):3336–3340
255)
Tsujii M, Kawano S, Tsuji S, Sawaoka H, Hori M, DuBois RN Cyclooxygenase regulates angiogenesis
induced by colon cancer cells. Cell 1998(93):705–716
256)
Van der Heijden B; Persistant anuria, neonatal death, and renal microcystic lesions after prenatal
exposure to indomethacin; Am J.Obstet.Gyn. 1994(171):617-623
257)
Van der Ouderaa FJ, Buytenhek M, Nugteren DH, Purification and characterization of prostaglandin
endoperoxide synthetase from sheep vesicular glands. Biochim Biophys Acta 1977(487): 315–31.
258)
Van Dorp DA, Beerthuis RK, Nugteren DII, The biosynthesis of prostaglandins. Biochim Biophy Acta
1964 (90): 204-207
259)
Vane JR. Inhibition of prostaglandin synthesis as a mechanism of action for aspirin-like drugs. Nature
1971(231): 232- 5.
260)
Vimtrup B. On the number, shape, structure and surface area of the glomeruli in the kidney of man and
mammals. Am. J. Anat. 1928(41): 123-151
261)
Vio C, Balestrini C; Postnatal development of cyclooxygenase-2 in the rat kidney; Immunopharmacology
1999(44: 205-210
262)
Von Euler U, Bergström S, Voyer L, Drut R, Fetal renal maldevelopment with oligohydramnios following
maternal use of piroxicam. Pediatr Nephrol 1994(8): 592 594
263)
Von Euler US. Zur Kenntnis der pharmakologischen Wirkungen von Nativsekreten und extrakten
männlicher acessorischer Geschlechtsdrüsen Naunyn-Schmiedebergs Arch Pharmacol 1934 (175):
78-84
264)
Waddell W, Ganser G, Cerise E, Sulindac for polyposis of the colon, Am. J. Surg. 1989(157):175–179.
265)
Waddell W, Loughry R, Sulindac for polyposis of the colon, J. Surg. Oncol. 1983(24):83–87.
266)
Wang J , Cheng H, Harris C, Cyclooxygenase-2 inhibition decreases renin content and lowers blood
pressure in a model of renovascular hypertension. Hypertension 1999(34): 96-101
267)
Wang J, Cheng H, Shappell S; A selective COX-2 inhibitor decreases proteinuria and retards
progressive renal injury in rats; Kidney Int. 2000(57,6):2334
268)
Watanabe K, T. Kawamori, S. Nakatsugi, T. Ohta, Role of the prostaglandin E receptor
subtype EP1 in colon carcinogenesis, Cancer Res. 1999(59): 5093–5096.
269)
Weichert W, Paliege A, Provoost AP, Bachmann S. Upregulation of juxtaglomerular NOS1 and COX-2
precedes glomerulosclerosis in fawn-hooded hypertensive rats. Am J Physiol. 2001( 280): F706–F714
270)
Whelton A: Renal safety and tolerability of celecoxib, a novel cyclooxygenase-2 inhibitor. Am J Ther
1999(7) :159 175
271)
Whorton A ,Misono K, Hollifield J; Prostaglandins and renin release. 1. Stimulation of renin release from
rabbit renal cortical slices by PGI2. Prostaglandins. 1977(14):1095-1104.
272)
Wilcox C, Welch W; Macula densa nitric oxide synthase: Expression, regulation, and function; Kidney
Int. 1998(54,s67):53
273)
Wilkes BM, Solomon J, Maita M, Mento PF. Characterization of glomerular thromboxane receptor
sites in the rat. Am. J. Physiol. Renal Physiol. 1989(256): F11 -F16
82
274)
Williams C, Tsujii M, Reese J, Host cyclooxygenase-2 modulates carcinoma growth, J. Clin.
Invest. 2000(105):1589–1594.
275)
Wright F, Schnermann J; Interference with feedback control of glomerular filtration rate by furosemid,
triflocin and cyanide. Jou.Clin.Invest.1974(53):1695-1708
276)
XieW, Chipman JG, Robertson DL, Expression of a mitogen-responsive gene encoding prostaglandin
synthase is regulated by mRNA splicing. Proc Natl Acad Sci U S A 1991(88):2692–2696.
277)
Yamamoto T, Nozaki-Taguchi N; Analysis of the effects of cyclooxygenase (COX)-1 and COX-2 in
spinal nociceptive transmission using indomethacin, a non-selective COX inhibitor, and NS-398, a COX2 selective inhibitor. Brain Res. 1996(739): 104–110
278)
Yang T, Endo Y, Huang Y, Renin expression in COX-2-knockout mice on normal or low-salt diets. Am J
Physiol Renal Physiol 2000(279): F819-F825
279)
Yang T, Singh I,Pham H; Regulation of cyclooxygenase expression in the kidney by dietary salt intake.
Am J Physiol (Renal Physiol 1998(274) :F481 F489,
280)
Yang V, Shields J, Hamilton S, Spannhake E, Size-dependent increase in prostanoid levels in adenomas
of patients with familial adenomatous polyposis, Cancer Res. 1998(58):1750–1753.
281)
Yang Z, Potential sites of prostaglandin actions in the periimplantation mouse uterus: differential
expression and regulation of prostaglandin receptor genes. Biol. Reprod. 1997(56):368–379
282)
Yu K, Bayona W, Kallen CB; Differential activation of peroxisome proliferator-activated receptors by
eicosanoids. J Biol Chem. 1995(270): 23975–23983
283)
Yuning G, Paliege A, Inhibition of nNOS expression in the macula densa by COX-2-derived
prostaglandin E2 Am J Physiol Renal Physiol 2004 (287): F152-159
284)
Zambraski E; The effects of nonsteroidal anti-inflammatory drugs on renal function: experimental studies
in animals. Semin. Nephrol. 1995(15): 205–213
285)
Zha S, Yegnasubramanian V; Cyclooxygenases in cancer: progress and perspective; Cancer Letters
2004(215): 1–20
286)
Zhang M, Wang J; Cyclooxygenase-2 in rat nephron development; Am J Physiol Renal Physiol
1997(273): F994-F1002
83
8. DANKSAGUNG
Danken möchte ich an dieser Stelle allen, die das Zustandekommen dieser Arbeit ermöglicht haben.
Mein besonderer Dank gilt dabei meinem Doktorvater und Betreuer Prof. Rolf Nüsing, der für Fragen,
Tipps und Diskussionen stets zur Verfügung stand und persönlich an einem Vorankommen
interessiert war. Seine professionelle Art und Motivation hat mich stets ermutigt. Ferner danke ich der
Kinderklinik Marburg für die Bereitstellung der Materialen, Geräte und Räume und die Möglichkeit, Tag
und Nacht davon Gebrauch zu machen. Bedanken möchte ich mich bei allen Mitarbeitern der
Forschungslabore, den MTA’s Steffi, Christina, Anika und ganz besonders Antje für ihre unglaublich
offene und herzliche Art, mit der sie die Kälte aus den Forschungslaboren genommen hat. Natürlich
danke ich auch meinen MitdoktorandInnen für gegenseitige Hilfe und Gespräche am Wochenende
oder späten Abend. Dank und Gruß auch an Dr. Martin Kömhoff, der mich ebenfalls mit viel know how
unterstützt hat.
Nichtzuletzt danke ich meinen Eltern für die persönliche Hilfe, die Überarbeitung meiner Texte und
natürlich auch für die finanzielle Unterstützung.
84
9. VERZEICHNIS MEINER AKADEMISCHEN LEHRER
Prof. Dr. med. Gerhard Aumüller
Prof. Dr. med. Eberhard Weihe
Prof. Dr. rer. nat. Jürgen Seitz
Prof. Dr. med. Yalcin Cetin
Prof. Dr. Dr. Heinz-Dieter Basler
Prof. Dr. Dr. Ulrich Otto Mueller
Prof. Dr. Dr. Jürgen Daut
Prof. Dr. Karlheinz Voigt
Prof. Dr. Thomas Gudermann
Prof. Dr. Röhm
Prof.Dr. Koolman
Prof. Dr. med. Harald Renz
PD Dr. med. Maritta Kühnert
Prof. Dr. Jochen Alfred Werner
Prof. Dr. Rudolf Arnold
Prof. Dr. Peter H. Kann
Prof. Dr. med. Andreas Neubauer
Prof. (apl.) Dr. med. Christian Görg
Prof. Dr. med. Bernhard Maisch
PD Dr. Matthias Herzum
PD Dr. Uwe Kuhlmann
Prof. Dr. Claus Franz Vogelmeier
Prof. Dr. med. Hinnerk Wulf
Prof. Dr. med. Peter Kroll
Prof. Dr. med. Matthias Rothmund
Prof. Dr. Rainer Hofmann
PD Dr. Michael Schnabel
Prof. Dr. Helmut Bertalanffy
Prof. Dr. Rainer Georg Moosdorf
Prof. Dr. Roland Moll
Dr. Nikola Jeck
Dr. Martin Kömhoff
Prof. Dr. Rolf Michael Nüsing
Prof. Dr. Dr. Helmut Remschmidt
Prof. Dr. Norbert Sommer
Prof. Dr. Jürgen-Christian Krieg
Prof. Dr. med. Klaus Jochen Klose
PD Dr. Helmut Höffken
Prof.Dr. Hannsjörg Seyberth
Prof. Dr. Hans Dieter Mennel
Prof. Dr. Wolfgang Oertel
PD Dr. med. Joerg Beyer
Prof. Dr. Leo Gotzen
Prof. Dr. Horst-Franz Kern
85
Herunterladen
Explore flashcards