Genetik

Werbung
18
Anfang des Kapitels
Epigenetik und Genetik
GENETIK
Epi-Genetik
EPIGENETIK
Was ist Epigenetik?
Genetik – Bauplan des Körpers
Anweisung: Wie kann Nahrung verdaut werden?
Anweisung: Wie kann Blutzucker reguliert werden?
Anweisung: Welche Farbe sollten die Augen haben?
Anweisung: Wie können starke Knochen aufgebaut werden?
Gendefekt >> fehlende Funktion des Körpers >> Krankheit
Epigenetik – „Lautstärkeregler“ für Gene
Umwelteinflüsse schalten Gene ein (machen sie LAUTER)
Umwelteinflüsse schalten Gene aus (machen sie LEISER)
„Lautere“ und „Leisere“ Gene beeinflussen Prozesse im Körper
Epigenetische Programmierung kann vererbt werden
EPIGENETIK
Was ist Epigenetik?
1944
Niederlande
Hungersnot
400kcal/Tag
1947
Niederlande
1997
Niederlande
2013
Niederlande
Herzkrankheit
Brustkrebs
Übergewicht
Herzkrankheit
Brustkrebs
Übergewicht
Umwelteinfluss auf Mutter 1944 beeinflusst
Gesundheit 2 Generationen später
GENETIK
Wie funktioniert Epigenetik?
Laktose
verdauen
Laktose verdauen
GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG
Heterochromatin
GENETIK
Wie funktioniert Epigenetik?
Hungersnot
400kcal/Tag
Funktion A
Funktion B
Funktion C
Funktion D
Funktion E
Funktion F
GENETIK
Wie funktioniert Epigenetik?
GENETIK
Wie funktioniert Epigenetik?
Wenn Epigenetik Gene ein- und ausschalten kann, übertrumpft sie dann nicht
Gendefekte in ihrer Wirkung?
Laktose verdauen
GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG
Antwort:
Manche Gendefekte zerstören die Anweisung für den Körper. Diese ist dann
vollkommen verloren und kann nicht von Epigenetik gerettet werden.
>> Genmutationen die schlimme Krankheiten auslösen
18
Ende des Kapitels
Epigenetik und Genetik
Herunterladen
Random flashcards
Laser

2 Karten anel1973

Erstellen Lernkarten